toxin operon of shigella dysenteriae 1

Vol. 174, No. 20JOURNAL OF BACTERIOLOGY, Oct. 1992, p. 6498-65070021-9193/92/206498-10$02.00/0Copyright X 1992, American Society for Microbiology

Identification of a B Subunit Gene Promoter in the ShigaToxin Operon of Shigella dysenteriae 1

NADIA F. HABIBt AND MAITHEW P. JACKSON*Department ofImmunology and Microbiology, Wayne State University School ofMedicine,

540 East Canfield Avenue, Detroit, Michigan 48201

Received 28 April 1992/Accepted 30 July 1992

The Shiga toxin operon (six) is composed of A and B subunit genes which are transcribed as a bicistronicmRNA from a promoter which lies 5' to the stxA gene. Northern (RNA) blot and primer extension analysesrevealed the existence of a second stxB gene transcript. Recombinant plasmids which carried the stxB genewithout the six operon promoter and with the influence of a vector promoter abrogated produced STX Bpolypeptides, suggesting that the stxB gene mRNA was transcribed from an independent promoter and was notproduced by endoribonucleolytic processing of the bicistronic mRNA. Examination of the DNA sequences 5' tothe siB gene transcription initiation site which were carried by the recombinant plasmids revealed a region withhigh homology to the consensus for Escherichia coil promoters. Deletion and mutation ofthis region affected StxBand holotoxin production, establishing its role in the regulation of the stxB gene. Comparison of the promotersby using a transcription analysis vector revealed that the stxB gene promoter differed from the sit operonpromoter in that was approximately sixfold less efficient and was not repressed by iron. Identification ofa secondpromoter in the six operon indicates that independent transcription of the stxB gene may regulate overproductionof the STX B polypeptides and may contribute to the 1A5B subunit stoichiometry of the holotoxin.

Shiga toxin (STX), which is produced by Shigella dysen-teriae type 1, is the prototype for a family of relatedcytotoxins produced by strains of Escherichia coli that areassociated with human and animal disease (29). Members ofthe STX family are multimeric molecules composed of twononcovalently associated polypeptide chains, a single enzy-matic A subunit and a pentamer of receptor-binding Bsubunits (10, 31). The most conclusive evidence regardingthe 1A:5B subunit stoichiometry of the Shiga holotoxincomes from the recent X-ray crystallographic analysis byBoodhoo et al. (4) and Stein et al. (39) which demonstratedthat the B subunits of Shiga-like toxin (SLT) I form apentameric ring. Because nucleotide sequence analysis re-vealed that the six and slt-I genes are essentially identical(40), these findings can be extrapolated to the STX Bsubunits.As shown in Fig. 1, the A and B subunit genes of STX

(designated sixA and stxB) are arranged as a single transcrip-tional unit with stxA preceding stxB and separated from it by12 noncoding nucleotides (40). The stxA and stxB genes arepreceded by putative ribosome-binding sites, and an iron-regulated promoter is 5' to the stxA gene (6, 7, 9, 40). Inaddition, the following reports have suggested the existenceof a promoter in the downstream sequences of the stxA andslt-IA genes which could direct independent transcription ofthe B-subunit genes: (i) Huang et al. (17) and Newland et al.(28) detected Slt-IB production by recombinant plasmidswhich carry the slt-IB gene but are devoid of the slt operonpromoter; (ii) DeGrandis et al. (9) identified a separate slt-IBtranscript using S1 nuclease protection analysis; (iii) Wein-stein et al. (43) detected promoter activity in the 3' se-quences of the slt-IA gene using lac operon fusions; and (iv)Kozlov et al. (21) performed Northern (RNA) blot hybrid-

* Corresponding author.t Present address: U.S. NAMRU-3, Box 5000, FPO AE 09835-

0007.

ization analysis of RNA extracted from S. dysenteriae type1 and detected a 1.7-kb band with an stx operon probe and a0.7-kb band with an stxB-specific probe. Because the smallerRNA species was more abundant, it was suggested that thestxB gene is transcribed more efficiently, which would con-tribute to overproduction of the STX B subunits and the1A:5B holotoxin stoichiometry. However, although Kozlovand coworkers (21) identified the 5' end of an stxB transcriptusing primer extension analysis, a sequence homologous tothe consensus for E. coli promoters could not be identified 5'to this transcription initiation site. In contrast to the findingswith the six and slt-I operons, Northern blot and primerextension analyses demonstrated that the SLT-II and SLT-IIvariant operons are transcribed as a single mRNA with noevidence for an independent B-subunit gene promoter (42).

It has been proposed that independent transcription of thestxB gene may be one genetic mechanism which contributesto the overproduction of StxB and the 1A:5B subunit stoi-chiometry of the holotoxin. However, previous reports havenot unequivocally addressed this model because the exist-ence of an independent promoter for the stxB gene has notbeen demonstrated. Therefore, we mapped and character-ized a promoter 5' to the sixB gene using primer extension,deletion and mutation analysis, and a promoter selectionvector.

MATERIALS AND METHODS

Bacteria, bacteriophages, and plasmids. E. coli HB101 [F-supE44 hsdS20 (rB- mB ) recA13 ara-14proA2 lacYl galK2rpsL20 (Smr)xyl-S mtl-1] (5) and E. coli SURE {e14- (mcrA)A(mcrCB-hsdSMR)171 endA1 supE44 thi-1 gyrA96 reLA1 lacrecB recJ sbcC201 umuC::TnS (Kanr) uvrC [F' proABlacIqZAM15 TnlO (Tetr)} (Stratagene, La Jolla, Calif.) (13)were used as hosts in transformation experiments. The E.coli SURE strain overproduces the lac operon repressorfrom the lacIq gene which is carried on an F' episome. E. coliJM109 [recAl supE44 endAl hsdR17 gyrA96 relA1 thi-1

6498

on March 25, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

TRANSCRIPTION OF SHIGA TOXIN OPERON 6499

stxA stxB

B T Hc PH XN EV Hc PI I 11

Pr

rbs

p E

rbs

- lOObpFIG. 1. Restriction map of the stx operon. The open reading

frames of the stxA and stxB genes are shown above the map.Abbreviations: B, BglII; E, EcoRI; EV, EcoRV (introduced bysite-directed mutagenesis); H, HindIII; Hc, HincII; N, NcoI (intro-duced by site-directed mutagenesis); P, PvuII; T, TaqI; X, XmnI;Pr, promoter; rbs, ribosome-binding site.

A(lac-proAB) F'(traD36proAB+ laclIq lacZAM15)] was usedas a host for the M13 bacteriophages (45). The S. dysentenaeserotype 1 strain 3818T (Centers for Disease Control, entericreference number 3818-69), which produces high levels ofSTX, and a nontoxigenic mutant of 3818T designated 725-78(11, 27) were also used in this study.The recombinant phages used in this study are listed in

Table 1. Bacteriophages M13mp18 and M13mpl9 were ob-tained from Boehringer Mannheim Biochemicals, Indianap-olis, Ind. The replicative forms of these phages were used incloning experiments, and the single-stranded forms of therecombinant phages were used as templates for site-directedmutagenesis and sequencing.The recombinant plasmids used in this study are listed in

Table 2. The following plasmid vectors were used: (i)pBR329 encodes resistances to ampicillin, chloramphenicol,and tetracycline; (ii) pBS (Stratagene) encodes resistance toampicillin; and (iii) pKK232-8 (Pharmacia, Piscataway, N.J.)encodes resistance to ampicillin and carries the promoterlesschloramphenicol acetyltransferase (CAT) gene (cat).DNA and restriction fragment preparation. Plasmid DNA

was prepared as described by Sambrook et al. (36), using aminilysate procedure adapted from Birnboim and Doly (3).Individual restriction endonuclease fragments were isolatedfrom agarose gels by using an analytical unidirectionalelectroelutor (model UEA; International BiotechnologiesInc., New Haven, Conn.) according to the instructions of themanufacturer.

Single-stranded phage DNA was prepared as described byMessing (25). The single-stranded DNA was extracted fromthe phage in a single step by using 1 M Tris-HCl (pH7.0)-saturated phenol and then precipitation with 0.5 volumeof 7.5 M ammonium acetate and 2 volumes of ice-coldethanol.

TABLE 1. Recombinant M13 bacteriophages

Designation' Restriction fragment Source or(gene) reference

mpl8BH 750-bp BglII-HindIII (stxA') 19mpl8H 1-kb HindlIl (stxA') 19mpl9HE 1.8-kb HindIII-EcoRI (stxA'B) 19mpl8HE 1.8-kb HindIII-EcoRI (sixA'B) 20mpl8HE(PRM-35) mpl8HE with -35 PRM This studympl8HE(PRM-10) mpl8HE with -10 PRM 18mpl8HE(PRM-35-10) mpl8HE with -35, -10 PRM This study

a PRM, promoter mutation.

TABLE 2. Recombinant plasmidsDesignationa Restriction fragment (gene)

pEW3.Ob.......... 2.5-kb BglII-EcoRI (stx operon)pNH28 .......... 900-bp PvuII (s1xA'B)pNH28.12 .......... pNH28 with trpA terminatorpNH14 .......... Inverted 900-bp PvuII (stxA'B)pNH56 .......... 1.8-kb HindIII-EcoRI (stxA'B)pMJ153b ...... ....pEW3.0 with EcoRV introducedpKZ.......... 382-bp PvuII (lac operon promoter)pKB1.0.......... 392-bp PvuII-EcoRV (sixB promoter)pKB1.1.......... 240-bp PvuII-NruI/sfxB promoterpKA1.......... 525-bp TaqI (stx operon promoter)pKA2.......... 145-bp BgIII-HindIII (stx operon promoter)pMJ230b ........... pEW3.0 with A829-865pKB1.A .......... pKBl.l with A829-865pNH56.A .......... pNH56 with A829-865pPRM-35AB .......... pEW3.0 with PRM-35pPRM-35B .......... pNH56 with PRM-35pPRM-1OAB .......... pEW3.0 with PRM-10pPRM-1OB .......... pNH56 with PRM-10pPRM-35-1OAB ..........pEW3.0 with PRM-35-10pPRM-35-1OB .......... pNH56 with PRM-35-10pKB-35.......... pKB1.1 with PRM-35pKB-lO.......... pKBl.l with PRM-10pKB-35-lO .......... pKBl.l with PRM-35-10

a PRM, stxB gene promoter mutation.b Plasmids from previous studies: pEW3.0 (20); pMJ153 (44); pMJ230 (18).

Bacterial transformation. All E. coli and S. dysenteriaestrains were made competent for transformation by theCaCl2-heat shock method described by Hanahan (15). Ex-cess DNA (5 ,ug) was required to transform S. dysenteriae.

Preparation of crude bacterial lysates. Bacterial cultureswere grown overnight at 37°C with shaking and lysed bysonication (30) either directly or after a 10-fold concentrationof the culture. Sonic lysates were clarified by sedimentingcell debris by centrifugation at 13,000 x g for 5 min. Theprotein concentration of the clarified lysate was measuredspectrophotometrically with a protein assay kit (Bio-RadLaboratories, Richmond, Calif.) with bovine serum albumin(BSA) as the standard. Sonicate lysates were used forcytotoxicity assays, the receptor-analog enzyme-linked im-munosorbent assay (ELISA), and the CAT enzymatic as-says.

Cytotoxicity assay. Cytotoxicity was assessed with Africangreen monkey kidney (Vero) cells according to publishedprocedures (12, 24). The last dilution of the sample whichkilled 50% or more of the cells was taken as the 50%cytotoxic dose (CD50) and was expressed in relation to thetotal protein concentration of the sonic lysate (CD50 permilligram).ELISAs. The colony blot ELISA was performed as de-

scribed by Strockbine et al. (41) to quantify STX B polypep-tides. The receptor-analog ELISA was done as described byWeinstein et al. (44), using the receptor-analog galactose a-1-4galactose-BSA (Carbohydrate International, Chicago, Ill.).The monoclonal antibody 13C4, which specifically recognizesthe STX B subunits (41), was used in the ELISAs. Soniclysates of E. coli HB1O1(pEW3.0), which encodes STX (20),or E. coli HB1O1(pNH56), which encodes StxB (Table 2),were used as standards in the receptor-analog ELISA, withwild-type levels considered to be 1.000 (100%).

Oligonucleotide synthesis and nucleotide sequence analysis.Synthetic oligonucleotides used in this study are shown inTable 3. Oligonucleotides were prepared by the Wayne StateUniversity Biochemistry Department Core Facility with an

VOL. 174, 1992


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

6500 HABIB AND JACKSON

TABLE 3. Synthetic oligonucleotides

Oligonucleotidea Positionb Use(s)'

PRM-35: GGAAGGATfLTAGTGTCCTG 816-836 SDMPCRBglII: GTCGCATGAGATCTGACCAG T-14 = nucleotide 1 PCRPCRHindIII: TATTACACAATAAA.QCTTGAGCACCATACG 161-132 PCR, SDMPEl: TCCAGTTACACAATCAGGCGTCGCC 1198-1174 PEPE2: CAGAATTGCCCCCAGAGTGGAT 1083-1062 PE

a Underlined nucleotides were mutated from the wild-type six sequence. PE1, PE2, and PCRHindIII were non-message sense.b Nucleotide positions taken from Strockbine et al. (40).c Abbreviations: PCR, polymerase chain reaction; PE, primer extension analysis; SDM, site-directed mutagenesis.

Applied Biosystems model 380A DNA synthesizer withphosphoramidite chemistry. Nucleotide sequence analysiswas done by the dideoxynucleotide (ddNTP) chain-termina-tion method of Sanger et al. (37) with the Sequenase DNAsequencing kit (U.S. Biochemicals, Cleveland, Ohio)adapted for the use of 35Sequetide (Dupont, NEN ResearchProducts, Wilmington, Del.). Predictions of dyad symme-tries, RNA secondary structures, and DNA sequence ho-mologies were made by using the Intelligenetics DNA se-quence analysis program.

Oligonucleotide-directed site-specific mutagenesis. The dou-ble-primer method of Zoller and Smith (47) was used tointroduce the nucleotide sequence changes shown in Fig. 2.The template for mutation of the stxB gene promoter wasM13mp18HE (Table 1), which carries the noncoding strandof the 3' sixA sequences and the entire sixB gene on a 1.8-kbHindIII-EcoRI fragment (Fig. 1). The M13mpl8HE(PRM-10) template (Table 1) was used to construct the PRM-35-10double mutation. DNA sequence analysis of the mutatedtemplates and recombinant plasmids was used to confirm thenucleotide substitutions and exclude second-site mutations.

Construction of mutated stx operon. Double-stranded DNAfrom M13mp18HE carrying the PRM-35, PRM-10, andPRM-35-10 mutations (Table 1) was prepared from the phagereplicative form and restricted with HindIII and EcoRI. The1.8-kb HindIII-EcoRI fragment carrying the mutated stxAsequences and the entire sixB gene (Fig. 1) was isolated byagarose gel electrophoresis and electroelution and simulta-neously ligated with a 0.75-kb BglII-HindIII fragment (car-rying the remainder of the sixA gene, Fig. 1) into BamHI-

stxB promoterT T G A G T T A T C A T

-35 -10Leu Scr Tyr His

A T T T C Tlie Ser

pI

T T G A G TLeu Ser

PRM-35T A T C A T

Tyr His

RM-1oT A C C A T

Tyr His

PRM-35-10AL T T C T T A ( C A T

lle Scr Tyr His

FIG. 2. Mutation of the stxB promoter. Nucleotide sequencesubstitutions designated PRM-35 and PRM-10 that were introducedin the stxB promoter are underlined. Translated amino acids areshown below the sequence. The sequence was taken from Strock-bine et al. (40).

and EcoRI-restricted pBR329 to construct the six operon asdescribed for pEW3.0 (20) (Table 2). In addition, the 1.8-kbHindIII-EcoRI fragment carrying the 3' sixA sequences andthe entire sixB gene was ligated to pBS to construct pNH56an its mutated derivatives (Table 2).

Construction of recombinant plasmids for stxB promoterdetection. Three plasmids carrying the downstream sixAsequences and the entire sixB gene were constructed asdepicted in Fig. 3 to investigate the existence of an indepen-dent sixB promoter (Table 2): (i) pNH28 carries a 0.9-kbPvuII fragment of the six operon (Fig. 1) inserted in themultiple cloning site of pBS 3' to the lac operon promoter;(ii) pNH14 also carries the 0.9-kb PvuII fragment in pBS butin the inverse orientation with respect to the lac operonpromoter; and (iii) pNH28.12 is pNH28 with a 0.5-kbBamHI-PstI fragment containing the trpA transcription ter-

pNH28

l0a.d^ sx,4,sA' st&

>-

S/P P/sPs

HI B H N Hc E

pNH14

J. st,i? sft,xA

S/P P/SPsH| B Hc N H E

_1^ ~~I ML

pNH28. 12

cz? st,4A stlAf-> - ->

S/P P/S

HT H N Hc EI

I

FIG. 3. Construction of stxB gene recombinant plasmids. Threerecombinant plasmids carrying a 900-bp PvuII fragment with the 3'sequences of the sixA gene and the entire sixB gene introduced inthe plasmid vector pBS 3' to the lac operon promoter. Abbrevia-tions are defined in the legend to Fig. 1.

J. BACTERIOL.


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


minator inserted between the lac operon promoter and thesix sequences.

Restriction fragments carrying the 3' sequences of stx4were inserted in the SmaI site of the promoter analysisvector pKK232-8 5' to the promoterless cat gene to test forpromoter activity. The following plasmids were generated(Table 2 and Fig. 1): (i) pKB1.0 carries a 392-bp PvuII-EcoRV fragment of the sixA gene; (ii) pKBl.1 carries a240-bp PvuII-NruI fragment of the sixA gene; (iii) pKB1.A ispKBl.1 with a deletion of nucleotides 829 to 865 (18); and(iv) pKB-35, pKB-10, and pKB-35-10 are pKB1.1 with thePRM-35, PRM-10, and PRM-35-10 mutations, respectively.The six operon promoter was introduced in the vector

pKK232-8 in the constructs designated pKA1 and pKA2(Table 2) to permit comparison with the putative stxBpromoter. Plasmid pKA1 carries the six operon promoter ona 525-bp TaqI fragment (Fig. 1) which was made compatiblefor ligation to SmaI-restricted pKK232-8 by filling the pro-truding ends with T7 DNA polymerase. Ligation was per-formed in the presence of SmaI to reduce vector self-ligation(22). Plasmid pKA2 carries the stx operon promoter on a145-bp BglII-HindIII fragment which was isolated by thepolymerase chain reaction (35). The polymerase chain reac-tion template was the replicative form of the recombinantphage M13mpl8H (Table 1), and the primers were PCRBglIIand PCRHindIII (Table 3). The 3' primer PCRHindIII intro-duced a HindIII restriction site at nucleotide 150 of the stxAgene. Thirty nanograms of pure template was mixed with 5,ug each of the 5' and 3' primers in a 20-,ul mixture of 50 mMTris-HCl (pH 9.0), 20 mM (NH4)2SO4, 1.5 mM MgCl2, and125 ,uM each of the four dNTPs. One unit of Replinase(Dupont, NEN Research Products) was added, and thesamples were incubated for 30 cycles under the followingconditions: 94°C for 1 min, 53°C for 2 min, and 72°C for 2 minwith a 1-s extension at each cycle. The amplified DNAproduct was restricted with BglII and HindIII and ligated tothe BamHI- and HindIII-restricted vector pKK232-8 to formthe recombinant pKA2.The lac operon promoter was isolated on a 382-bp PvuII

fragment from the vector pBS and ligated to SmaI-restrictedpKK232-8 to form the recombinant plasmid pKZ which wasused as a positive control in the promoter analysis experi-ments.CAT production assays. Promoter activity was assessed as

growth of E. coli carrying the promoter-cat gene recombi-nant plasmids in chloramphenicol-containing medium and byquantifying the amount of CAT activity by using an enzy-matic assay with thin-layer chromatographic (TLC) analysisas described by Lopata et al. (23). The acetylated species of[14CJchloramphenicol from the enzymatic assay were sepa-rated by TLC, autoradiographed, and quantified with aradioanalytic imaging system (AMBIS, San Diego, Calif.).CAT activity was expressed as total counts per minute ofacetylated [14C]chloramphenicol per nanogram of total pro-tein of the bacterial sonicate. For iron regulation studies, 200p,M 2,2'-dipyridyl was added to a 2-h culture; this wasfollowed by overnight incubation (9) and sonic extraction oftotal cellular protein.

Isolation of total bacterial RNA. RNA extraction followedthe protocol described by Chirgwin et al. (8) with somemodifications. Bacterial RNA was harvested at several timepoints during the log phase of bacterial culture. Since stxmRNA was detected by Northern blot analysis only after 5 hof growth, this time point was monitored for all RNAisolation experiments. The quality of the RNA preparationswas assessed by agarose gel electrophoresis after 50% form-

amide denaturation at 60°C for 15 min (34). RNA extractswere quantified spectrophotometrically (36) and used forNorthern blot hybridization and primer extension analysis.

Analysis of mRNA by Northern blot hybridization. Totalbacterial RNA (15 to 100 jig) was denatured with glyoxal anddimethyl sulfoxide and subjected to agarose gel electropho-resis. Separated RNA species were transferred to nylonmembranes, and specific mRNA bands were detected byusing isotopically labeled DNA probes (36g. Hybridizationwas performed with approximately 3 x 10 cpm of labeledprobe per ml for 48 h, and the temperature of hybridizationwas varied to eliminate the nonspecific binding to rRNA.Specific six transcripts were detected at hybridization tem-peratures ranging from 68 to 76.5°C. Blots were washed atthe same hybridization temperature in 6x SSC (lx SSC is0.15 M NaCl plus 0.015 M sodium citrate) and autoradio-graphed for 2 weeks. In some instances, the RNA blots werestripped of the DNA probe to permit hybridization with asecond probe. The treatment to remove the DNA probeconsisted of agitation of the blots in 100 ml of boiling 0.lxSSC-0.1% sodium dodecyl sulfate two times for 15 min eachand then overnight autoradiography to confirm removal ofthe probe (1).Two probes were used in Northern blot hybridization (Fig.

1): a 750-bp BglII-HindIII probe carrying the upstream sixAsequences and a 755-bp HinclI probe carrying sequencesfrom both the stxA and sixB genes. DNA probes werelabeled by the random primer method with an oligonucleo-tide labeling kit according to the manufacturer's (Pharmacia)instructions.

Analysis of stx mRNA by primer extension. Primer exten-sion was used to map the 5' end of an sixB mRNA followingthe protocol of Ausubel et al. (1) with some modifications.The isotopically 5'-end-labeled oligonucleotide PE1 (Table3), which is complementary to a 25-bp sequence of the sixBtranscript 55 bp 3' to the initiation codon, was used to primethe synthesis of a cDNA from the total RNA extracted fromSTX-producing bacteria by using reverse transcriptase(Promega, Madison, Wis.). The size of the cDNA wasestimated by electrophoresis and compared with a DNAsequence ladder, using the M13mp19HE template (Table 3)and PE1 as a primer. A second oligonucleotide, designatedPE2 (Table 3), was used for primer extension analysis toconfirm the location of the transcription initiation sitemapped by using PEL.

RESULTS

We explored the hypothesis that, in addition to the sixbicistronic mRNA which is transcribed from the operonpromoter, there exists an independent promoter for tran-scription of the stxB gene.

B-subunit production by sitB gene plasmids. As shown inFig. 3, three recombinant plasmids were constructed toinvestigate transcription of the stxB gene in the absence ofthe six operon promoter. Plasmid pNH28 carried a 900-bpPvuII fragment with the 3' sequences of sixA and the entiresixB gene (Fig. 1) in the vector pBS. Plasmid pNH14contained the same 900-bp PvuII fragment but in the reverseorientation with respect to the lac operon promoter in pBS.Plasmid pNH28.12 contained the trpA transcription termina-tor inserted between the lac operon promoter and the stisequence in plasmid pNH28. These plasmids were used toidentify the promoter which controls expression of the sixBgene and to determine whether transcription is mediated by

VOL. 174, 1992


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


TABLE 4. B subunit production by sixB gene plasmidsa

Strain Colony blot ELISA Receptor-analog ELISA

HB1O1(pNH28) + + 1.000HB1O1(pNH14) + 0.064HB1O1(pNH28.12) + 0.226SURE(pNH28) + + 1.440SURE(pNH14) -+ 0.046SURE(pNH28.12) + 0.048

a The STX B-specific 13C4 was used as the primary monoclonal antibody.Sonic extracts of HB101 and SURE were not immunoreactive in the ELISAs.

an upstream vector promoter, an independent sixB pro-moter, or both.StxB production by E. coli HB101 and E. coli SURE, which

overproduces the lac operon repressor, carrying pNH14 andpNH28.12 was assessed by using the colony blot and recep-tor-analog ELISAs and compared with B-subunit productionby the same strains carrying pNH28 (Table 4). As shown inTable 4, HB1Ol(pNH14) and HB1Ol(pNH28.12) producedsignificantly lower levels of StxB than HB1O1(pNH28).Measurement of StxB production by the receptor-analogELISA showed that values for HB1O1(pNH14) and HB101(pNH28.12) were 0.064 and 0.226, respectively, comparedwith the control level of 1.000 produced by HBlOl(pNH28).While SURE(pNH28) produced approximately 40% moreStxB than did HBlOl(pNH28), repression of the lac operonpromoter in the SURE strain reduced StxB production bypNH14 and pNH28.12 to approximately 5% of the controllevels produced by pNH28 (Table 4). Because the influenceof the lac operon promoter was mitigated by reversing theorientation of the restriction fragment carrying the sixB genein pNH14, or by the combined effects of the lac repressorand the trp transcriptional terminator in SURE(pNH28.12),these results suggested that StxB production by theserecombinant plasmids was governed by transcription froman independent sixB promoter.

Northern blot hybridization analysis. Northern blot hybrid-ization analysis of whole-cell RNA extracted from the STX-producing strain HB1O1(pEW3.0) was performed to investi-gate the existence of an independent stxB transcript. Using a32P-labeled BglII-HindIII probe which carried the upstreamsequences of the stxA gene, one band of approximately 1.3kb was observed (Fig. 4B, lane 2). This band was notobserved in the RNA blots of HBlOl(pNH28), which carriedthe stxB gene (Table 2). When the blots were stripped of theBglII-HindIII probe and hybridized to a 32P-labeled HincIIfragment which carried the downstream sixA sequences andthe entire sixB gene (Fig. 1), two six-specific transcripts ofapproximately 1.3 and 0.95 kb were detected in the whole-cell RNA of HB1O1(pEW3.0) (Fig. 4A, lane 2). As shown inFig. 4A, lane 5, the smaller transcript was also detected inthe whole-cell RNA of HBlOl(pNH28) which expressed thesixB mRNA predominantly from the lac operon promoter(Table 4).

It is noteworthy that RNA extraction was performed atdifferent time points (4, 5, 7, and 9 h) in the logarithmic phaseof the culture and that the six-specific transcripts weredetected only in RNA extracted after a 5-h incubation of theculture. It was necessary to use appromately 100 ,ug oftotal cellular RNA per sample and 3 x 106 cpm of the DNAprobes per ml and to perform hybridization in 50% form-amide at 68°C to prevent hybridization with the 16S rRNAwhich masked the six bicistronic transcript. However, underthese stringent hybridization conditions, detection of the

A 1 2 3 4 5 B

44002900.2320-1540--

1 2 3 4 5

4400 -2900- :.2320-1540-

FIG. 4. Northern blot analysis. (A) Northern blot hybridizedwith a 755-bp HincIl fragment which contained sixA and stxB genesequences. (B) Northern blot hybridized with a 750-bp BglII-HindIIIfragment which contained sixA gene sequences. Whole-cell RNAwas extracted from the following strains: lanes 1, E. coli HB101;lanes 2, HB101(pEW3.0); lanes 3, S. dysenteriae 3818T; lanes 4, S.dysenteriae 725-78; lanes 5, HB101(pNH28). Arrows to the right ofeach blot indicate the stx-specific transcripts. RNA molecularweight markers are shown on the left in base pairs.

sicB mRNA band was inconsistent, and no hybridizationsignal was observed with RNA from S. dysenteriae 3818T,which carries a single copy of the stx operon (Fig. 4, lanes 3)(38, 40). These results demonstrated the relatively lowabundance and/or unstable nature of the six mRNAs.Primer extension analysis. Primer extension analysis was

performed on whole-cell RNA extracted from HB101(pEW3.0) and HB1Ol(pNH28), which carried the entire stxoperon and the sixB gene, respectively (Table 2), to map thetranscription initiation site of the sixB mRNA identified byNorthern blot analysis. Oligonucleotide PE1, which is com-plementary to the sixB message-sense strand (Table 3), wasused as a primer. Reverse transcription with RNA fromHB101(pEW3.0) and HB101(pNH28) with the PE1 primerterminated at two thymine residues (Fig. 5), which corre-sponded to transcription initiation for the sixB gene atadenine residues 907 and 920 within the sixA sequence (Fig.6). This finding was confirmed by using a second oligonucle-otide primer (designated PE2 in Table 3). The nucleotidesequence of the stxA gene 5' to the identified transcriptioninitiation sites was examined for a region characteristic of E.coli RNA polymerase recognition and binding sites (16, 33).As shown in Fig. 6, sequences highly homologous to the E.coli -35 and -10 consensus promoter sites were identified atnucleotide positions 842 to 847 (TTGAGT) and 863 to 868(TATCAT), respectively.

Analysis of stxB promoter-cat gene fusions. The down-stream sequences of the sixA gene which contain the stxBgene transcription initiation site mapped by primer extensionwere examined for promoter activity with the transcriptionanalysis vector pKK232-8. Recombinant plasmid pKB1.0(Table 2) was constructed by introducing the 390-bp PvuII-EcoRV fragment of the stx operon (Fig. 1) 5' into thepromoter-deficient cat gene in pKK232-8. CAT activityexpressed by pBR329 or pKZ, which carried the lac operonpromoter 5' to the cat gene in pKK232-8 (Table 2), was usedas a positive control in these studies.HB101(pKBl.0), HB101(pBR329), and HB101(pKZ) were

initially assayed for CAT activity by the ability to grow inchloramphenicol-containing medium. As shown in Table 5,HB101(pBR329) and HB101(pKZ) expressed high levels ofresistance, while HB101(pKB1.0) was resistant to 75 p,g of

J. BAcTERIOL.

-0


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


AAAAC \C AG CT 1 2 3

907 TT

GTAATTACGT

920 TAA

FIG. 5. Primer extension analysis. Whole-cell RNA extractedfrom the following strains was used in primer extension analysiswith the oligonucleotide PEl: lanes 1, HB101(pEW3.0); lane 2,HB101; lane 3, HIB101(pNH28). The DNA sequence represents thenoncoding strand generated with the M13mp19HE template and thePEl primer. The two bands indicated by arrows comigrated withthymine residues that correspond to adenines 907 and 920 of thestxA gene sequence.

chloramphenicol per ml. In addition, the capacity of sonicextracts of HB101 carrying the promoter-cat gene fusions toacetylate chloramphenicol was assessed by using an in vitroenzymatic assay and TLC. The products of the in vitroenzymatic assay were visualized by autoradiography andquantified by using the AMBIS radioanalytic imaging sys-tem. As shown in Fig. 7A and Table 5, expression of CATactivity by the positive control strains HB101(pBR329) andHB101(pK.Z) corresponded with the high levels of chloram-phenicol resistance, while HB101(pKB1.0) expressed lower,albeit significant, levels of CAT activity. These findingsdemonstrated the existence of a promoter in the sequences5' to the stxB gene transcription initiation sites which weremapped by primer extension.

Plasmid pKB1.1 was constructed by introducing' the240-bp PvulI-NruI fragment of the stx operon (Fig. 1) intothe vector pKK232-8 to further localize the stxB gene

TABLE 5. CAT activity of stx promoter-cat gene fusions

Plasmid' Chloramphenicol resistance CAT activity(Pg/ml) (cpm/ng)b

pBR329 600 153pKZ 750 231pKA1 700 159pKA2 750 251pKBl.0 75 10pKB1.1 300 43pKB1.A 0 0pKB-10 300 20pKB-35 >750 437pKB-35-10 700 346

a The host strain was E. coli HB101.b Total counts per minute of acetylated [14CJchloramphenicol per nanogram

of total protein.

promoter. Therefore, the stxB gene promoter is 245 bp 5' tothe cat gene in pKBl.0, while the intervening sequence wasshortened to 100 bp in pKB1.1. Placing the stxB promoter145 bp closer to the cat gene in pKBl.1 significantly en-hanced transcriptional activity, increasing chloramphenicolresistance and CAT activity approximately fourfold (Fig. 7Aand Table 5). Sequences containing the stxB promoter weredeleted in pKB1.A, which was constructed by inserting a240-bp PvuII-NruI fragment from pMJ230 (Table 2) contain-ing a deletion of nucleotides 829 to 865 in the vectorpKK232-8, 5' to the promoterless cat gene. The observation

A3;-Ac Cm

l-Ac Crn

Cm

2 3 4 5 6 8 9

.9,.... .

0.5 5 0.9 750 75 0.9 0.9 75 75

5 10 11 12 13

stxA ORF....... ............>

830CTT ACA ITG AAC TGG GGA AGO TTG AGT AGT GTC CTG CCT GACLzu rTr Leu An Trp Gly Arg Leu Ser Ser Val Len Pro AP

900TAT CAT GGA CAA GAC TCT GTT CGT GTA GGA AGA ATT TCT TTTTyr His Gly Gln Asp Ser Val Arg Val Gly Arg lie Scr Phe

t tGGA AGC ATT AAT GCA ATT (180 nt) AGT TGA GGG GGT AAA ATGGly Ser Ce Ass Ala Ie Ser Met

stxB ORF..>

FIG. 6. Nucleotide sequence surrounding the sixB gene pro-moter. Arrows above and below the sequence give the orientationsof the sbx4 and sixB gene open reading frames (ORF). The -35(TTGAGT) and -10 (TATCAT) sequences of the stxB promoter areshown in boldface, and the two mapped transcription initiation sitesare identified by a t above the sequence at nucleotides 907 and 920.The sequence was taken from Strockbine et al. (40) with the deletionof 180 bp at the 3' end of sixA.

3-Ac Cm-

1-AcCm-

Cm-

75 750 100 1 0.75

FIG. 7. CAT activity of gene fusions. TLC of acetylated forms of[14C]chloramphenicol. Sonic lysates of the following strains wereassessed for CAT activity. (A) Samples: 1, HB101(pKZ); 2, HB101(pKAl); 3, HB101(pKA2); 4, BB101(pKBl.0); 5, HB101(pKBl.l);6, HBlOl(pKA2) grown in the presence of 200 ,M 2,2'-dipyridyl; 7,HB1O1(pKA2) grown in the presence of 50 FM ferrous sulfate; 8,HBlO1(pKB1.l) grown in the presence of 200 ,uM 2,2'-dipyridyl; 9,HB1O1(pKB1.1) grown in the presence of 50 pM ferrous sulfate. (B)Samples: 5, HBlOl(pKBl.l); 10, HB1Ol(pKB1.A); 11, HB1Ol(pKB-10); 12, HBlOl(pKB-35); 13, HBlOl(pKB-35-10). Numbers below thelanes are the total protein content (in nanograms) of bacterial sonicateused in each reaction. Ac, acetylated; Cm, chloramphenicol.

B

VOL. 174, 1992


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


that E. coli HB1O1(pKB1.A) neither grew on chlorampheni-col-containing medium nor produced acetylated forms ofchloramphenicol in the TLC analysis (Fig. 7B and Table 5)established the existence of a promoter within the 36-bpregion deleted from pKBl.1.The relative transcriptional activity of the stxB promoter

was assessed by comparing CAT production by pKBl.O andpKBl.l with that produced by pKAl and pKA2, which carrythe six operon promoter 5' to the promoterless cat gene inpKK232-8 (Table 2). As with the sixB promoter-cat generecombinant plasmids pKBl.O and pKBl.l, the interveningsequence between the stx promoter and the cat gene wasshortened from approximately 200 bp in pKAl to 100 bp inpKA2 to enhance transcriptional activity. Comparison ofCAT production by strains HB1Ol(pKA1) and HB101(pKA2) indicated that, as with pKBl.O and pKBl.l, short-ening the intervening sequence between the promoter andcat gene increased chloramphenicol resistance and enzy-matic activity (Table 5 and Fig. 7A). Comparison of the CATproduction expressed by the equivalent promoter-cat generecombinant plasmids demonstrated that the six operonpromoter is more active than the stxB gene promoter in thisassay. Levels of chloramphenicol resistance for HB101(pKA2) and HBlOl(pKBl.l) were 750 and 300 jig/ml, re-spectively, while the levels of CAT enzymatic activity were251 cpm of acetylated chloramphenicol per ng of totalprotein for HBll(pKA2) and 43 cpm/ng for HBll(pKBl.l)(Table 5 and Fig. 7A). These values represent an approxi-mate 2.5- to 6-fold difference between the transcriptionalactivities of the six operon promoter and the stxB genepromoter.

Mutational analysis of stxB promoter. Plasmids pMJ230and pNH56.A carry the six operon and the 3' sequences ofsixA and the entire stxB gene, respectively (Table 2), with a36-bp deletion encompassing the sitB promoter. Because theSTX A subunit encoded by pMJ230 lacks an enzymatic site(18), the effect of the sixB promoter deletion on StxBproduction could not be assessed by using the cytotoxicityassay. Although the 36-bp deletion eliminated the sequencesidentified as the stxB promoter, B-subunit production maybe mediated by the six operon promoter in pMJ230 or the lacoperon promoter in pNH56.A. However, the observationthat the 36-bp deletion caused a 4.6- to 6-fold reduction inB-subunit production as assessed by the receptor-analogELISA (Table 6) indicated that the sequence identified as thestxB promoter has a role in StxB production.

Three mutations designated PRM-35, PRM-10, and PRM-10-35 were introduced in the sixB promoter to deviate it thefrom the consensus sequence (Fig. 2) and establish its role inStxB synthesis. These substitutions were in highly con-served residues of consensus E. coli promoters and havebeen reported to cause a significant reduction in promoteractivity (46). Nucleotide substitutions were designed tointroduce either no amino acid sequence changes or a singleconservative change (Leu to Ile) in the STX A polypeptideand to have no effect on codon usage (14). Northern blothybridization analysis of RNA extracted from HB101(pPRM-35-1OAB) demonstrated that the PRM-35 andPRM-10 mutations had no effect on the steady-state level ofthe bicistronic mRNA (data not shown). Recombinant plas-mids were constructed containing the stxB promoter -35and -10 mutations in the six operon (designated AB) or ona 1.8-kb HindIII-EcoRI fragment carrying the 3' sequencesof stxA and the entire sixB gene (designated B) (Table 2). Asshown in Table 6, immunoreactivity assessed by the recep-tor-analog ELISA demonstrated that mutation of the sixB

TABLE 6. Mutation of stxB promoter

Strain Colony blot Receptor-analog CytotoxicityELISA ELISAW assayb

HB1O1(pEW3.0) ++ 1.000 2.5 x 106HB1O1(pMJ230) ++ 0.170 0HB1O1(pPRM-35AB) ++ 0.219 2.5 x 106HB1O1(pPRM-1OAB) ++ 0.181 5.5 x 105HB1O1(pPRM-35-1OAB) ++ 0.286 2.5 x 106HB1O1(pNH56) ++ 1.000 NACHB101(pNH56.A) - 0.217 NAHB1O1(pPRM-35B) - 0.172 NAHB1O1(pPRM-1OB) + 0.311 NAHB1O1(pPRM-35-1OB) + 0.346 NA

a STX B-specific 13C4 was used as the primary monoclonal antibody.Extracts of E. coli HB101 were not immunoreactive in the assays.

b Titers were expressed as CD50 per milligram of total protein in bacterialsonicate.

c NA, not applicable.

promoter caused a three- to sixfold reduction in StxBproduction with a corresponding decrease in the colony blotELISA. Cytotoxin levels produced by HB1O1(pPRM-1OAB)were decreased fivefold compared with wild-type levels,although the corresponding effect was not observed forHB1O1(pPRM-35) or HB1O1(pPRM-35-10), perhaps due tothe limited sensitivity of the cytotoxicity assay or transcrip-tional enhancement induced by the PRM-35 substitution (seebelow).

Mutation of the -35 and -10 regions of the stxB promoterestablished its role in STX B production as assessed bydecreased cytotoxicity and immunoreactivity in the ELISAs.Introduction of these mutations in the sixB promoter-cat genefusion plasmid pKBl.l either increased or decreased tran-scription as measured by using chloramphenicol resistanceand the CAT enzymatic assay. As shown in Fig. 7B and Table5, the PRM-10 mutation had no effect on chloramphenicolresistance but caused a twofold reduction in the CAT enzy-matic activity assessed by TLC. In contrast, the PRM-35 andPRM-35-10 mutations induced a dramatic increase in chlor-amphenicol resistance and CAT activity (Table 5), perhapsdue to the influence of surrounding DNA secondary structureon transcriptional efficiency. These results demonstrated thatmutation of the nucleotide sequences identified as the sIxBpromoter affected STX B polypeptide production or CATproduction when fused to the cat gene.

Regulation of six promoter-cat gene fusions by iron. Theproduction of STX is negatively regulated by the presence ofiron in the growth medium, an effect shown to be governedby thefir gene product (6, 7, 9). Therefore, regulation of theslxB promoter by iron was investigated by examining thesurrounding sequences for the presence of the Fur-bindingoperator sequence and by using the CAT assay withHBlOl(pKB1.1) grown under iron-depleted conditions. Al-though computer analysis revealed three separate regionswith 70% homology to the Fur-binding sequence, thesesequences were distantly separated from the stxB promoter(data not shown). This was in contrast to other Fur-regulatedgenes in which the operator site is contiguous with thepromoter. The level of CAT production by HBlOl(pKA2),which carries the iron-regulated six operon promoter in thetranscription analysis vector pKK232-8 (Table 2), was in-creased 11-fold by the depletion of iron with the chelatingagent 2,2'-dipyridyl (LB broth, 251 cpm of total acetylated[14C]chloramphenicol per ng of total protein; 200 ,uM 2,2'-dipyridyl, 2,794 cpm of total acetylated [14Cjchlorampheni-

J. BACrERIOL.


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


col per ng of total protein) (Fig. 7A). In contrast, the level ofCAT production by HB101(pKB1.1), which carries the stxBpromoter in pKK232-8, was slightly reduced (from 43 to 22cpm) by the depletion of iron from the culture medium. Theeffect of including ferrous sulfate in the culture medium wasless conclusive than the iron depletion studies (Fig. 7A).This observation confirmed the sequence analysis and estab-lished that, unlike the six operon promoter, the sixB genepromoter is not negatively regulated by iron.

DISCUSSION

Although the structural genes which encode the STXsubunits are on a single transcriptional unit on the chromo-some of S. dysenteriae serotype 1 (38, 40), the B subunitsassociate to form pentameric rings. The 1A:5B subunitstoichiometry suggests that there is a genetic mechanismwhich governs the overproduction of B subunits, perhaps attranscription, translation, or a combination of both.

Previous studies which suggested the existence of a weakpromoter in the 3' sequences of sixA which could mediatethe independent transcription of the stxB gene have beenequivocal (9, 17, 21, 28, 43). B-polypeptide production byrecombinant plasmids which contain the 3' sequences of thestxA gene and the entire stxB gene may be under thetranscriptional regulation of a vector promoter. Therefore,we assessed StxB production using recombinant plasmidscarrying the equivalent sequences but with the effect of avector promoter abrogated. In addition, because the sixBtranscripts identified by using Northern blot or primer ex-tension analysis may have been products of endoribonucle-olytic processing, we used mutational analysis to identify anindependent sixB promoter. Finally, a promoter analysisvector was used to demonstrate that the transcriptionalactivity of the identified sixB promoter was less than that ofthe six operon promoter.Our preliminary findings using the recombinant plasmids

which contained the 3' sequences of stxA and the entire stxBgene suggested the existence of an independent stxB pro-moter. While E. coli HB101(pNH28) produced high levelsof STX B polypeptides, HB101(pNH14) and HB101(pNH28.12) produced 25- and 4-fold less, respectively, asdetected by the receptor-analog ELISA. StxB production byHB101(pNH14) was possibly mediated by an stxB promoter,since the stxB gene in this construct was introduced in thereverse orientation, thereby eliminating the contribution ofthe lac operon promoter to the transcription of the stxBgene. This was supported by the finding that the sonicextracts of HB101(pNH28.12) were less immunoreactivethan the sonic extracts of HB101(pNH28), since the formercontains the trpA transcription terminator between the lacoperon promoter and the stx sequence. However, the obser-vation that HB101(pNH28.12) produced more StxB thanHB101(pNH14) indicated that the effect of the lac operonpromoter was not completely abrogated by the terminator,possibly due to readthrough from the strong lac operonpromoter. Interestingly, SURE(pNH28) produced higherlevels of StxB polypeptides than did HB101(pNH28). Thismay be due to increased stability of the recombinant plas-mids or B polypeptides in the SURE host. The finding thatStxB production by SURE(pNH14) and HB101(pNH14) wasessentially equivalent indicated that transcription was solelymediated by an sixB promoter in this reverse-orientationrecombinant plasmid. In support of this contention, intro-duction of pNH28.12 into the SURE strain significantlyreduced the influence of the vector promoter, indicating that

the additive effect of the trpA transcription terminator inpNH28.12 and the lac operon repressor in the SURE hostrestricted the regulation of StxB production exclusively tothe sixB gene promoter. Finally, although the level of StxBproduced by the sixB gene recombinant plasmids was low asassessed by the receptor-analog ELISA, it was not negligi-ble. Owing to the differential sensitivity of the assays, asignificant reduction in the receptor-analog ELISA is notreflected by a decrease in cytotoxicity (20). Therefore, theELISA values expressed by strains carrying the sixB generecombinant plasmids pNH14 and pNH28.12 may be equiv-alent to the expression of 104 to 105 CD5smg by a plasmidcarrying the entire six operon.Northern blot analysis of RNA isolated from E. coli

HB101 carrying the six operon or the 3' sequences of sixAand the entire stxB gene corroborated earlier findings (9, 21).We observed a 1.3-kb band, which presumably corre-sponded to the 1.7-kb bicistronic mRNA reported by Kozlovet al. (21), and a smaller transcript of approximately 950 bp,which was presumably the sixB mRNA. This variation in thesize of the bicistronic transcript calculated by us and Kozlovand coworkers (21) may have resulted from technical differ-ences in our estimation of mRNA size or nucleolytic degra-dation of whole-cell RNA preparations. Primer extensionanalysis was used to map the 5' end of the sixB transcript 197or 210 bp 5' to the AUG initiation codon of the stiB gene.Accordingly, the predicted sizes of the sixB transcript were715 and 730 bp, which were shorter than the size of themRNA identified by Northern blot hybridization. This dis-crepancy, as well as the identification of two transcriptioninitiation sites for the sixB gene mRNA, may have been dueto (i) mRNA secondary structure; (ii) stalling of the reversetranscriptase during primer extension; or (iii) specific endor-ibonucleolytic processing of the stxB mRNA. However, theobservation that these two transcription initiation sites werereproducibly identified by primer extension indicated thatthe 5' end of the sixB mRNA was produced by specificprocessing or an independent promoter and that it was notgenerated by nonspecific degradation of the bicistronic tran-script. Our finding that the sixB gene transcription initiationsite is 197 or 210 bp 5' to the open reading frame contradictsthe earlier finding which placed this site 96 bp upstream (21),a value which corresponds more closely to the spacingbetween the six operon promoter and the sixA gene openreading frame. This discrepancy may have been caused bytechnical differences in the primer extension assays and mayexplain why a sequence homologous to the consensus for E.coli promoters was not identified by Kozlov and coworkers(21). Despite our findings that the size of the sixB mRNAidentified by primer extension analysis did not correspondwith previous reports or the Northern blot analysis, weexamined the sequences 5' to the mapped transcriptioninitiation sites for a promoter.Examination of the sequences 5' to the stxB gene tran-

scription initiation site revealed the presence of sequenceshighly homologous to the E. coli -35 and -10 consensus forpromoters (16). This promoter was approximately sixfoldless active than the sti operon promoter using the transcrip-tion analysis vector pKK232-8. This may be explained by thepresence of the spacer region between the -35 and -10sequences of promoters. This spacer region varies in lengthfrom 16 to 19 bp, with the optimal distance being 17 bp (26).A change from 16 to 15 bp in this space reduced expressionof the tyrT promoter in vivo to 2% of its wild-type level (2).While this spacing is the optimal 17 bp for the six operonpromoter, the corresponding distance between the -35 and

VOL. 174, 1992


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


-10 sites of the sixB promoter is 15 bp. Another factorwhich may have affected expression of the stxB gene was thespacing between the open reading frame and the promoter.While the sixB promoter was separated from the stxB geneinitiation codon by 250 bp, the stx operon promoter and stxAinitiation codon are separated by 114 bp. The influence ofthis spacing was demonstrated by the enhancement of CATactivity when the length of intervening sequences betweenthe stx promoters and cat gene was decreased in pKA2 andpKB1.1 (Table 5). While these findings identified and char-acterized a promoter which lies 5' to the transcriptioninitiation site for the stxB gene, it was necessary to usedeletion and mutation analysis of this promoter to establishits role in StxB production.

Deletion and mutation of the stxB promoter established itsrole in STX B-subunit production. Recombinant plasmidspMJ230 and pNH56.A, which contained a deletion of thestxB promoter, encoded significantly less StxB than didplasmids carrying these sequences, probably due to tran-scription of the sixB gene, the six operon promoter inpMJ230, or the lac operon promoter pNH56.A. Mutation ofthe -35 and -10 sequences of the stxB promoter caused asignificant reduction in STX B-polypeptide production asmeasured by the receptor-analog ELISA and the cytotoxic-ity assay. However, the full effect of these mutations maynot have been detected because of the limitations of thereceptor-analog ELISA and cytotoxicity assay, which de-pend on receptor binding by the holotoxin. Complementa-tion analysis has shown that the effect of mutations designedto down-regulate the stxB promoter may be mitigated be-cause of a reduction in the number of STX B polypeptideswhich compete with holotoxin for receptor-binding sites,thereby simulating an increase in holotoxin levels (unpub-lished data).Down-regulated of the stxB promoter by the nucleotide

substitutions at the -10 site was also observed with thepromoter-cat gene fusion pKB-10, although conflicting re-sults were observed with the PRM-35 mutation. Althoughthe PRM-35 mutation deviated the -35 sequence fromconsensus by the introduction of a 4-bp substitution(TTGAGT to AT'TCT), it caused an approximate 10-foldincrease in stxB promoter activity in the cat gene transcrip-tion fusion vector. As a possible explanation for this result,nucleotide sequence analysis of the sixB promoter regionidentified another potential -35 sequence (TTGAAC) 9 bp 5'to the primary -35 sequence. This upstream sequence mayhave functioned as an RNA polymerase recognition site inpKB-35, and since the PRM-35 mutation increased thenumber of adenine and thymine residues in this region,transcriptional activity was enhanced. The -35 region of apromoter serves as an entry site for RNA polymerase (33),and AT richness in the -45 to -35 region may be a generalfeature of strong promoters that would facilitate such entry(32). This conformation-dependent enhancement of tran-scription was influenced by the surrounding sequences inpKK232-8, since this effect was only observed with pKB-35and pKB-35-10 and not the PRM-35 constructs. While thepromoter-cat gene fusion system was a means to measurerelative promoter strengths, the role of an independent sixBgene promoter in B-subunit and holotoxin synthesis wasmore accurately assessed by using plasmids which carriedthe entire stx operon.The six operon is negatively regulated by a Fur protein-

iron complex which binds to an operator site that overlapsthe -10 sequence of the promoter (6, 7, 9). Computeranalysis of the sequences surrounding the sixB promoter

revealed three noncontiguous regions with 70% homology tothe operator sites of the Fur-regulated genes fur, iucA, andsixA. The observation that the stxB promoter in the cat genefusion pKB1.1 was not induced by iron depletion while theactivity of the sti operon promoter was increased 11-foldunder iron-depleted conditions indicated that the regions ofhomology which surround the sixB promoter were notfunctional Fur-binding operators.Our findings have demonstrated that the STX A and B

subunits are encoded by a bicistronic mRNA transcribedfrom a promoter 5' to the sixA gene and that the STX Bsubunits are also encoded by a monocistronic stxB mRNAwhich is transcribed from an independent promoter 5' to thesixB gene. Transcriptional fusion studies indicated that thesixB promoter is approximately sixfold less active than thestx operon promoter, although the influence of surroundingsequences in this system must be considered. The existenceof an independent sitB gene promoter is in contrast to theslt-II operon, which is transcribed as single mRNA with noevidence for an independent slt-IIB gene promoter (42). The1A:SB subunit stoichiometry of STX suggests that the Bpolypeptide is overproduced relative to the A polypeptide.Our findings have implicated an independent promoter in theregulation of StxB production. However, the role of thispromoter in regulating the stoichiometry of subunit produc-tion, as well as the additional contribution of an independentribosome-binding site for the stxB gene, is currently underinvestigation.

ACKNOWLEDGMENTS

This work was supported by Public Health Service grant AI29929from the National Institute of Allergy and Infectious Diseases and aPEO Peace Program fellowship to N.F.H.

REFERENCES1. Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G.

Seidmans, J. A. Smith, and K. Struhl (ed.). 1989. Currentprotocols in molecular biology, vol. 1, unit 4.4. John Wiley &Sons, Inc., New York.

2. Berman, M. L., and A. Landy. 1979. Promoter mutations in thetransfer RNA gene tyrT of Escherichia coli. Proc. Natl. Acad.Sci. USA 76:4303-4307.

3. Birnboim, H. C., and J. Doly. 1979. A rapid alkaline extractionprocedure for screening recombinant plasmid DNA. NucleicAcids Res. 7:1513-1523.

4. Boodhoo, A., R J. Read, and J. Brunton. 1991. Crystallizationand preliminary X-ray crystallographic analysis of verotoxin-1B-subunit. J. Mol. Biol. 221:729-731.

5. Boyer, H. W., and D. Roulland-Dussoix. 1969. A complementa-tion analysis of the restriction and modification of DNA inEscherichia coli. J. Mol. Biol. 41:459-472.

6. Calderwood, S. B., and J. J. Mekalanos. 1987. Iron regulation ofShiga-like toxin expression in Eschenichia coli is mediated bythe fir locus. J. Bacteriol. 169:4759-4764.

7. Calderwood, S. B., and J. J. Mekalanos. 1988. Confirmation ofthe Fur operator site by insertion of a synthetic oligonucleotideinto an operon fusion plasmid. J. Bacteriol. 170:1015-1017.

8. Chirgwin, J. M., A. E. Przybyla, R. J. MacDonald, and W. J.Rutter. 1979. Isolation of biologically active ribonucleic acid fromsources enriched in ribonuclease. Biochemistry 18:5294-5299.

9. DeGrandis, S., J. Ginsberg, M. Toone, S. Climie, J. Friesen, andJ. Brunton. 1987. Nucleotide sequence and promoter mappingof the Escherichia coli Shiga-like toxin operon of bacteriophageH-19B. J. Bacteriol. 169:4313-4319.

10. Donohue-Rolfe, A., G. T. Keusch, C. Edson, D. Thorley-Lawson,and M. Jacewicz. 1984. Pathogenesis of Shigella diarrhea. IX.Simplified high yield purification of Shigella toxin and charac-terization of subunit composition and function by the use ofsubunit-specific monoclonal and polyclonal antibodies. J. Exp.

J. BAcrERIOL.


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

VTRANSCRIPTION OF SHIGA TOXIN OPERON 6507

Med. 160:1767-1781.11. Gemski, P., A. Takeuchi, 0. Washington, and S. B. Formal.

1972. Shigellosis due to Shigella dysenteriae 1: relative impor-tance of mucosal invasion versus toxin production in pathogen-esis. J. Infect. Dis. 126:523-530.

12. Gentry, M. K., and J. M. Dalrymple. 1980. Quantitative micro-titer cytotoxicity assay for Shigella toxin. J. Clin. Microbiol.12:361-366.

13. Greener, A. 1990. E. coli SURE strain: clone unclonable DNA.Strategies 3:5-6.

14. Grosjean, H., and W. Fiers. 1982. Preferential codon usage inprokaryotic genes: the optimal codon-anticodon interactionenergy and the selective codon usage in efficiently expressedgenes. Gene 18:199-209.

15. Hanahan, D. 1983. Studies on transformation of Escherichia coliwith plasmids. J. Mol. Biol. 166:557-580.

16. Hawley, D. K., and W. R. McClure. 1983. Compilation andanalysis of Escherichia coli promoter DNA sequences. NucleicAcids Res. 11:2237-2255.

17. Huang, A., S. DeGrandis, J. Friesen, M. Karmali, M. Petric, R.Congi, and J. L. Brnton. 1986. Cloning and expression of thegenes specifying Shiga-like toxin production in Escherichia coliH19. J. Bacteriol. 166:375-379.

18. Jackson, M. P., R. L. Deresiewicz, and S. B. Calderwood. 1990.Mutational analysis of the Shiga toxin and Shiga-like toxin IIenzymatic subunits. J. Bacteriol. 172:3346-3350.

19. Jackson, M. P., J. W. Newland, R. K. Holmes, and A. D.O'Bnen. 1987. Nucleotide sequence analysis of the structuralgenes for Shiga-like toxin I encoded by bacteriophage 933J fromEschenichia coli. Microb. Pathog. 2:147-153.

20. Jackson, M. P., E. A. Wadolkowski, D. L. Weinstein, R. K.Holmes, and A. D. O'Brien. 1990. Functional analysis of theShiga toxin and Shiga-like toxin type II variant binding subunitsby using site-directed mutagenesis. J. Bacteriol. 172:653-658.

21. Kozlov, Y. U., A. A. Kabishev, E. V. Lukyanov, and A. A.Bayev. 1988. The primary structure of the operons coding forShigella dysenteriae toxin and temperate phage H30 Shiga-liketoxin. Gene 67:213-221.

22. Un, Z., and L. M. Schwartz. 1992. An efficient method forblunt-end ligation of PCR products. BioTechniques 12:28-30.

23. Lopata, M. A., D. W. Cleveland, and B. Sollner-Webb. 1984.High level transient expression of a chloramphenicol acetyltransferase gene by DEAE-dextran mediated DNA transfectioncoupled with a dimethyl sulfoxide or glycerol shock treatment.Nucleic Acids Res. 12:5707-5717.

24. Marques, L., M. Moore, J. Wells, I. Wachsmuth, and A.O'Brien. 1986. Production of Shiga-like toxin by Escherichiacoli. J. Infect. Dis. 154:338-341.

25. Messing, J. 1983. New M13 vectors for cloning. MethodsEnzymol. 101:20-78.

26. Mulligan, M. E., J. Brosius, and W. R. McClure. 1985. Charac-terization in vitro of the effect of spacer length on the activity ofEscherichia coli RNA polymerase at the TAC promoter. J. Biol.Chem. 260:3529-3538.

27. Neill, R. J., P. Gemski, S. B. Formal, and J. W. Newland. 1988.Deletion of the Shiga toxin gene in a chlorate-resistant deriva-tive of Shigella dysenteriae type 1 that retains virulence. J.Infect. Dis. 158:737-741.

28. Newland, J. W., N. A. Strockbine, S. F. Miller, A. D. O'Brien,and R. K. Holmes. 1985. Cloning of Shiga-like toxin structuralgenes from a toxin converting phage of Eschenichia coli. Sci-ence 230:179-181.

29. O'Brien, A. D., and R. K. Holmes. 1987. Shiga and Shiga-liketoxins. Microbiol. Rev. 51:206-220.

30. O'Brien, A. D., and G. D. LaVeck. 1982. Immunochemical andcytotoxic activities of Shigella dysentenae 1 (Shiga) and Shiga-like toxins. Infect. Immun. 35:1151-1154.

31. Olsnes, S., R. Reisbig, and K. Elklid. 1981. Subunit structure ofShigella cytotoxin. J. Biol. Chem. 256:8732-8738.

32. Post, L. E., A. E. Arfsten, G. R. Davis, and M. Nomura. 1980.DNA sequence of the promoter region for the a ribosomalprotein operon in Escherichia coli. J. Biol. Chem. 255:4653-4659.

33. Rosenberg, M., and D. Court. 1979. Regulatory sequencesinvolved in the promotion and termination of RNA transcrip-tion. Annu. Rev. Genet. 13:319-353.

34. Ross, J. 1976. A precursor of globin mRNA. J. Mol. Biol.106:403-420.

35. Saiki, R. K., D. H. Gelfand, S. Stoffel, S. J. Scharf, R. Higuchi,G. T. Horn, K. B. Mullis, and H. A. Erlich. 1988. Primer-directed enzymatic amplification of DNA with thermostableDNA polymerase. Science 239:487-491.

36. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecularcloning: a laboratory manual, 2nd ed. Cold Spring HarborLaboratory, Cold Spring Harbor, N.Y.

37. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequenc-ing with chain-terminating inhibitors. Proc. Natl. Acad. Sci.USA 74:5463-5467.

38. Sekizaki, T., S. Harayama, G. M. Brazil, and K. N. Timmis.1987. Localization of six, a determinant for high-level produc-tion of Shiga toxin by Shigella dysenteriae serotype 1, nearpyrFand generation of stx transposon mutants. Infect. Immun.55:2208-2214.

39. Stein, P. E., A. Boodhoo, G. J. Tyrrell, J. L. Brunton, and R. J.Read. 1992. Crystal structure of the cell-binding B oligomer ofverotoxin-1 from E. coli. Nature (London) 355:748-750.

40. Strockbine, N. A., M. P. Jackson, L. M. Sung, R. K. Holmes,and A. D. O'Brien. 1988. Cloning and sequencing of the genesfor Shiga toxin from Shigella dysentenae type 1. J. Bacteriol.170:1116-1122.

41. Strockbine, N. A., L. R. M. Marques, R. K. Holmes, and A. D.O'Brien. 1985. Characterization of monoclonal antibodiesagainst Shiga-like toxin from Escherichia coli. Infect. Immun.50:695-700.

42. Sung, L. M., M. P. Jackson, A. D. O'Brien, and R. K. Holmes.1990. Transcription of the Shiga-like toxin type II and Shiga-liketoxin type II variant operons of Eschenichia coli. J. Bacteriol.172:6386-6395.

43. Weinstein, D. L., R. K. Holmes, and A. D. O'Brien. 1988. Effectsof iron and temperature on Shiga-like toxin I production byEscherichia coli. Infect. Immun. 56:106-111.

44. Weinstein, D. L., M. P. Jackson, J. E. Samuel, R. K. Holmes,and A. D. O'Brien. 1988. Cloning and sequencing of a Shiga-liketoxin type II variant from an Escherichia coli strain responsiblefor edema disease of swine. J. Bacteriol. 170:4223-4230.

45. Yanish-Perron, C., J. Vieira, and J. Messing. 1985. ImprovedM13 phage cloning vectors and host strains: nucleotide se-quences of the M13mpl8 and pUC19 vectors. Gene 33:103-119.

46. Youderian, P., S. Bouvier, and M. M. Susskind. 1982. Sequencedeterminants of promoter activity. Cell 30:843-853.

47. Zoller, M. J., and M. Smith. 1984. Laboratory methods. Oligo-nucleotide-directed mutagenesis: a simple method using twooligonucleotide primers and a single-stranded DNA template.DNA 3:479-488.

VOL. 174, 1992


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

toxin operon of shigella dysenteriae 1

Documents