Transcriptional Organization and Regulatory Elements of aPseudomonas sp. Strain ADP Operon Encoding a LysR-Type Regulatorand a Putative Solute Transport System

Ana Isabel Platero, Manuel García-Jaramillo, Eduardo Santero, and Fernando Govantes

Centro Andaluz de Biología del Desarrollo, Universidad Pablo de Olavide, Consejo Superior de Investigaciones Científicas, Junta de Andalucía, and Departamento deBiología Molecular e Ingeniería Bioquímica, Universidad Pablo de Olavide, Seville, Spain

The atzS-atzT-atzU-atzV-atzW gene cluster of the Pseudomonas sp. strain ADP atrazine-degradative plasmid pADP-1, whichcarries genes for an outer membrane protein and the components of a putative ABC-type solute transporter, is located down-stream from atzR, which encodes the LysR-type transcriptional regulator of the cyanuric acid-degradative operon atzDEF. Herewe describe the transcriptional organization of these genes. Our results show that all six genes are cotranscribed from the PatzRpromoter to form the atzRSTUVW operon. A second, stronger promoter, PatzT, is found within atzS and directs transcription ofthe four distal genes. PatzT is �N dependent, activated by NtrC in response to nitrogen limitation with the aid of IHF, and re-pressed by AtzR. A combination of in vivo mutational analysis and primer extension allowed us to locate the PatzT promoterand map the transcriptional start site. Similarly, we used deletion and point mutation analyses, along with in vivo expressionstudies and in vitro binding assays, to locate the NtrC, IHF, and AtzR binding sites and address their functionality. Our resultssuggest a regulatory model in which NtrC activates PatzT transcription via DNA looping, while AtzR acts as an antiactivator thatdiminishes expression by interfering with the activation process.

Pseudomonas sp. strain ADP (31) is the model organism forbacterial degradation of the s-triazine herbicide atrazine (2-

chloro-4-ethylamino-6-isopropylamino-1,3,5-triazine). Pseudomo-nas sp. strain ADP uses atrazine as the sole nitrogen source via asix-step hydrolytic pathway, carried by the 108-kbp catabolic plas-mid pADP-1 (35). The six genes involved in atrazine mineraliza-tion are localized in two distinct regions of the plasmid: atzA, atzB,and atzC, responsible for atrazine conversion to cyanuric acid(2,4,6-trihydroxy-1,3,5-triazine), are harbored at three distantpositions within a large (�40-kbp) unstable region featuring mul-tiple direct repeats and transposable elements. The genes involvedin cyanuric acid cleavage and ammonium release are clustered inthe stable portion of pADP-1 to form the atzDEF operon (re-viewed in reference 51).

Our previous work has shown that atrazine utilization by Pseu-domonas sp. strain ADP is regulated by nitrogen availability in amanner resembling general nitrogen control (15), and the cy-anuric acid utilization operon atzDEF is one of the targets for suchregulation (16). Expression of atzDEF is induced by the substrateof the pathway, cyanuric acid, and repressed in the presence of apreferential nitrogen source. The product of atzR, the gene tran-scribed divergently from atzDEF, is a LysR-type transcriptionalregulator (LTTR) required for both nitrogen- and cyanuric acid-dependent control. Transcription of atzR is initiated from the �N-dependent PatzR promoter, activated by the general nitrogen con-trol protein NtrC, and repressed by AtzR (16). NtrC-dependentactivation of atzR is unusual in that it does not require interactionwith any upstream or downstream sequence elements (41). AtzRbinds a single site overlapping the PatzR promoter �N RNA poly-merase (E-�N) recognition element and competes with E-�N forDNA binding, resulting in decreased promoter occupancy (41).Cyanuric acid interacts with AtzR to alter its conformation on thedivergent PatzR-PatzDEF promoter region and activate atzDEFtranscription (40). Despite this effect, cyanuric acid does not alter

the ability of AtzR to repress its own synthesis (16). AtzR alsostimulates atzDEF transcription in response to nitrogen limitationby an unknown mechanism involving protein-protein interactionwith the PII protein GlnK (17; A. López-Sánchez and F. Govantes,unpublished results). Regulation of the atrazine utilization path-way was recently reviewed (21).

A specific transport system for s-triazines has not been de-scribed thus far. Several loci at the pADP-1 plasmid appear tocarry genes for transport proteins (35). The product of orf46 issimilar to a family of xanthine/uracil permeases, and that of orf69is homologous to a secondary magnesium/citrate transporter.Finally, the orf98-orf97-orf96-orf95-orf94 cluster (renamed hereas atzS-atzT-atzU-atzV-atzW) gene products display significantsimilarity to a family of outer membrane proteins containing anucleoside binding channel (atzS) and to the subunits of the ABCfamily of solute transporters (atzT, atzU, atzV, and atzW). This,and the fact that this group of genes is located immediately down-stream from atzR and in the same orientation (Fig. 1A), drew ourattention to the possibility that their function may be related to theatrazine-degradative pathway.

In the present work, we explored the transcriptional organiza-tion and regulation of the atzR-atzS-atzT-atzU-atzV-atzW genecluster. Our work documents the presence of two promoters, thepreviously characterized PatzR, providing low-level transcriptionof the complete atzRSTUVW operon, and the internal PatzT pro-moter, which fosters high-level transcription of the four distal

Received 27 July 2012 Accepted 25 September 2012

Published ahead of print 5 October 2012

Address correspondence to Fernando Govantes, fgovrom@upo.es.

Copyright © 2012, American Society for Microbiology. All Rights Reserved.

doi:10.1128/JB.01348-12

6560 jb.asm.org Journal of Bacteriology p. 6560–6573 December 2012 Volume 194 Number 23

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

b on

27

Janu

ary

2022

by

182.

155.

225.

219.

genes. Here we describe and characterize in detail the physiologi-cal regulation, as well as the cis- and trans-acting elements, in-volved in transcriptional control of the latter.

MATERIALS AND METHODSBacterial strains and growth conditions. Bacterial strains used in thiswork and their relevant genotypes are summarized in Table 1. Minimalmedium containing 25 mM sodium succinate as the sole carbon sourcewas used for in vivo gene expression analysis (30). Nitrogen sources wereammonium chloride, L-serine (1 g/liter), or cyanuric acid (3.3 mM).When required, 0.1 mM cyanuric acid was added as a nonmetabolizableinducer. Luria-Bertani (LB) medium was used as rich medium (46). Liq-uid cultures were grown in culture tubes or flasks with shaking (180 rpm)at 30 or 37°C (for Pseudomonas or Escherichia coli strains, respectively).For solid medium, Bacto agar (Difco, Detroit, MI) was added to a finalconcentration of 18 g/liter. Antibiotics and other additions were used,when required, at the following concentrations: ampicillin (100 mg/liter),kanamycin (20 mg/liter), carbenicillin (500 mg/liter), rifampin (10 mg/liter), chloramphenicol (15 mg/liter), tetracycline (5 mg/liter), and 5-bro-mo-4-chloro-3-indoyl-�-D-galactopyranoside (X-Gal; 25 mg/liter). Allreagents were purchased from Sigma-Aldrich.

Plasmid construction. Plasmids and oligonucleotides used in thiswork are summarized in Tables 1 and 2, respectively. All DNA manipula-tions were performed according to standard procedures (46). Restrictionenzymes, DNA polymerases, and T4 DNA ligase were purchased fromRoche Applied Science. The Klenow fragment or T4 DNA polymerase wasroutinely used to fill in recessed 3= ends and trim protruding 3= ends ofincompatible restriction sites. Plasmid DNA preparation and DNA puri-fication kits were purchased from Sigma-Aldrich, GE Healthcare, or Ma-cherey-Nagel and used according to the manufacturers’ specifications. Inall cloning procedures involving PCR amplification, the presence of thedesired mutations and the absence of unwanted alterations were deter-mined by commercial sequencing (Secugen, Madrid, Spain). Sequencecomparison was performed using the BLAST package (2), available at the

NCBI Web server (http://www.ncbi.nlm.nih.gov/blast). E. coli DH5� wasused as the host in all cloning procedures. Plasmid DNA was transferred toE. coli and Pseudomonas putida strains by transformation (27) or by tri-parental mating (10).

The 8.3-kb BalI fragment from the atrazine catabolic plasmid pADP-1carrying atzT, atzS, atzR, and the atzDEF operon was cloned into XbaI-cleaved pBluescript II KS(�) to yield pMPO216. To construct the atzS-lacZ transcriptional fusion plasmid pMPO806, a 1,539-bp HindIII-BamHI fragment from pMPO216 carrying PatzR, atzR, and the 5= end ofatzS was inserted into EcoRI- and BamHI-cleaved pMPO234. Similarly, a1,459-bp SphI-BamHI fragment and a 532-bp EcoRI-BamHI fragmentfrom pMPO216 spanning the complete but promoterless atzR and the 5=end of atzS, or the 3= end of atzR and the 5= end of atzS, were clonedinto EcoRI- and BamHI-digested pMPO234 to yield pMPO807 andpMPO805, respectively. PatzT deletion mutants were constructed by PCRamplification of the �1, �2, �3, and �4 PatzT fragments by using orf98-2,orf98-3, orf98-5, or orf98-6 as the forward primers and orf98-0 as thereverse primer. The PCR products obtained were cleaved with EcoRI andBamHI and ligated to EcoRI- and BamHI-digested pMPO234 to yieldpMPO810, pMPO811, pMPO813, and pMPO814, respectively. Short de-rivatives of the wild-type and �2 fusions were generated by PCR amplifi-cation using pMPO805 and pMPO811 as the templates with primers de-lABS and Porf98XS. The resulting PCR products were cloned similarlyinto pMPO234 to construct pMPO829 and pMPO830. The in vitro tran-scription template plasmid pMPO831 was constructed by cloning the532-bp PatzT EcoRI-BamHI insert from pMPO805 into EcoRI- andBamHI-digested pTE103.

Site-directed mutagenesis by overlap extension with PCR was per-formed essentially as described previously (1). pMPO805 was used as atemplate except when noted, and oligonucleotides fwd-lacZ and ext1-revwere used as external primers in all cases. The AtzR-L and AtzR-R mutantderivatives were generated using the mutagenic oligonucleotide pairsmut2-rev/mut1-fwd and mut4-rev/mut3-fwd, respectively. The final PCRproducts were cleaved with EcoRI and BamHI and ligated into EcoRI- andBamHI-digested pMPO234 to generate pMPO815 and pMPO816, re-spectively. Plasmid pMPO816 was used as the template to generate theAtzR-LR mutant derivative, along with the mutagenic oligonucleotidepair 2mutAtzR1/2mutAtzR2. The mutant PCR product was cloned intopMPO234 to yield pMPO821. Similarly, mutagenic primer pairs mut10-rev/mut9-fwd and mut8-rev/mut7-fwd were used to generate theNtrC1-L and NtrC1-R mutant derivatives, which were cloned intopMPO234 to yield pMPO818 and pMPO819, respectively. pMPO818 wasused as the template to generate the NtrC1-LR mutant by using themutagenic primer pair 2mutNtrC/2mutNtrC2. Cloning of the mutantfragment into pMPO234 yielded pMPO822. The NtrC2-L mutant de-rivative was also obtained by the same procedure, using the mutagenicoligonucleotide pair 3mutNtrC/3mutNtrC2 to produce pMPO825.The NtrC1-LR�NtrC2-L mutant was derived from pMPO822 by us-ing the mutagenic oligonucleotide pair 3mutNtrC/3mutNtrC2, andsubsequent cloning into pMPO234 yielded pMPO826. Finally, the �N sitemutant was constructed with oligonucleotides mut6-rev/mut5-fwd andan �500-bp NaeI-BamHI fragment cloned to replace the wild-type se-quences in pMPO805, pMPO806, and pMPO807 to generate pMPO817,pMPO882, and pMPO883, respectively.

�-Galactosidase assays. Steady-state �-galactosidase assays were usedto examine the expression of the different atzS-lacZ fusions in P. putidaKT2440 and its derivatives. Preinocula of bacterial strains harboring therelevant plasmids were grown to saturation in minimal medium undernitrogen-sufficient conditions (ammonium chloride at 1 g/liter), and cellswere then diluted in minimal medium containing the appropriate nitro-gen sources (1 g/liter ammonium chloride for nitrogen excess, or 1 g/literL-serine for nitrogen limitation). Diluted cultures were shaken for 16 to 20h to mid-exponential phase (optical density at 600 nm, 0.25 to 0.5).Growth was then stopped, and �-galactosidase activity was determined

FIG 1 RT-PCR analysis of the atzRSTUVW intergenic regions. (A) Schematicof the atzRSTUVW cluster. The scale indicates the coordinates of the pADP-1plasmid, as described by Martinez et al. (35). (B) Agarose gel images of RT-PCR products obtained from Pseudomonas sp. ADP cultures grown on ammo-nium, serine, or cyanuric acid as the sole nitrogen source, using primers flank-ing each intergenic region. As a control, 16S rRNA primers were used. cDNA(25 ng) for each experimental condition was used as a template. (C) Positiveand negative experimental controls. The - sign denotes RT-PCRs performed inthe absence of template RNA. The DNA lanes show PCRs performed usingcloned atzRSTUVW operon DNA as the template. One representative image ofat least three repeat experiments using independent RNA preparations isshown for each primer set.

Regulation of the Pseudomonas sp. ADP atzRSTUVW Operon

December 2012 Volume 194 Number 23 jb.asm.org 6561

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

b on

27

Janu

ary

2022

by

182.

155.

225.

219.

from SDS- and chloroform-permeabilized cells as previously described(36).

Protein purification. AtzR-His6 was purified from the overproducingstrain NCM631 harboring pMPO135 and pIZ227 by nickel affinity chro-matography as previously described (40). IHF was purified from the over-producing strain E. coli K5746 by ammonium sulfate fractionation andaffinity chromatography on heparin-Sepharose as described previously(37). Pure P. putida NtrCD55E,S161F (25) and �N (28) were kind gifts ofA. B. Hervás and V. Shingler. Core E. coli RNA polymerase was purchasedfrom Epicenter Biotechnologies (Madison, WI).

Gel mobility shift assays. Gel mobility shift assays with AtzR wereperformed essentially as described previously (42). Probes containing thewild-type and the mutant versions of the AtzR binding site (AtzR-L,AtzR-R, and AtzR-LR) were obtained by PCR using the correspondinglacZ fusion plasmids pMPO805, pMPO815, pMOPO816, and pMPO821as templates and oligonucleotides Del-RBS and R-SalI as primers. ThePCR products were subsequently digested with EcoRI and BamHI and gelpurified. DNA fragments were labeled by filling in 5=-overhanging ends

using the Klenow fragment in a reaction mixture containing [�-32P]dCTP. AtzR-DNA complexes were formed at room temperature in20-�l reaction mixtures containing 10 ng of the probe, 100 �g/ml salmonsperm DNA, 250 �g/ml bovine serum albumin (BSA), and increasingamounts (0 to 160 nM) of purified AtzR-His6 (40) in binding buffer (35mM Tris-acetate [pH 7.9], 70 mM potassium acetate, 20 mM ammoniumacetate, 2 mM magnesium acetate, 1 mM calcium chloride, 1 mM dithio-threitol [DTT], 5% glycerol) for 20 min. Reactions were stopped with 4 �lof loading buffer (0.125% [wt/vol] bromophenol blue, 0.125% [wt/vol]xylene cyanol, 10 mM Tris-HCl [pH 8], 1 mM EDTA, 30% glycerol), andsamples were separated on a 5% polyacrylamide native gel in Tris-borate-EDTA buffer at 4°C. Gels were dried and exposed to phosphoscreens,which were scanned in a Typhoon 9410 scanner (GE Healthcare) andanalyzed with the ImageQuant software (GE Healthcare).

A probe containing the IHF binding site was obtained by PCR ampli-fication using pMPO805 as the template and primers ret-1 and ret-3. ThePCR product was subsequently digested with ClaI, gel purified, and radio-labeled, as described above. IHF-DNA complexes were formed at room

TABLE 1 Bacterial strains and plasmids used in this work

Strain or plasmid Genotype or phenotype Reference or source

Bacterial strainsE. coli DH5� 80dlacZ�M15 �(lacZYA-argF)U169 recA1 endA1 hsdR17 (rK

mK�) supE44 thi-1 gyrA relA1 23

E. coli KT5746 N5271 [galK ilv his (� cIts5857 N7N53 �Bam�HI)]/pPLhiphimA-5; Apr 37E. coli NCM631 hsdS gal �DE3::lacI lacUV5::gen1 (T7 RNA polymerase) �lac linked to Tn10 20Pseudomonas. sp.

ADPPrototroph, pADP-1 31

P. putida KT2440 mt-2 hsdR1 (r m�) Cmr 13P. putida

KT2440-IHF3mt-2 hsdR1 (r m�) �ihfA::Tcr 33

P. putida KT2442 mt-2 hsdR1 (r m�), Rifr 13P. putida MPO201 mt-2 hsdR1 (r m�) Cmr Rifr �ntrC::Tcr 16

PlasmidspIZ227 pACYC184-derived plasmid containing lacIq and the T7 lysozyme gene; Cmr 20pMPO109 atzR coding sequence and promoter region cloned in pKT230; Kmr 16pMPO135 pET23b plasmid derivative for overexpression of AtzR-His6; Apr 40pMPO216 Fragment from pADP-1 containing atzT, atzS, atzR, and atzDEF operon cloned in pBluescript II SK(�); Apr This workpMPO234 Broad-host range lacZ transcriptional fusion vector, based on pBBR1MCS-4; Apr 41pMPO805 atzS-lacZ transcriptional fusion in pMPO234 carrying the sequence between positions 218 to and

�319; Apr

This work

pMPO806 PatzR-atzR-atzS-lacZ transcriptional fusion in pMPO234; Apr This workpMPO807 Promoterless atzR-atzS-lacZ transcriptional fusion in pMPO234; Apr This workpMPO810 atzS-lacZ transcriptional fusion in pMPO234 carrying the sequence between positions 150 and �319; Apr This workpMPO811 atzS-lacZ transcriptional fusion in pMPO234 carrying the sequence between positions 123 and �319; Apr This workpMPO813 atzS-lacZ transcriptional fusion in pMPO234 carrying the sequence between positions 103 and �319; Apr This workpMPO814 atzS-lacZ transcriptional fusion in pMPO234 carrying the sequence between positions 76 and �319; Apr This workpMPO815 atzS-lacZ transcriptional fusion in pMPO234 containing the AtzR-L mutant sequence; Apr This workpMPO816 atzS-lacZ transcriptional fusion in pMPO234 containing the AtzR-R mutant sequence; Apr This workpMPO817 atzS-lacZ transcriptional fusion in pMPO234 containing PatzT with a mutant E-�N binding motif; Apr This workpMPO818 atzS-lacZ transcriptional fusion in pMPO234 containing the NtrC1-L mutant sequence; Apr This workpMPO819 atzS-lacZ transcriptional fusion in pMPO234 containing the NtrC1-R mutant sequence; Apr This workpMPO821 atzS-lacZ transcriptional fusion in pMPO234 containing the AtzR-LR mutant sequence; Apr This workpMPO822 atzS-lacZ transcriptional fusion in pMPO234 containing the NtrC1-LR mutant sequence; Apr This workpMPO825 atzS-lacZ transcriptional fusion in pMPO234 containing the NtrC2-L mutant sequence; Apr This workpMPO826 atzS-lacZ transcriptional fusion in pMPO234 containing the NtrC1-LR�NtrC2-L mutant sequence; Apr This workpMPO831 PatzT template plasmid for in vitro transcription, based on pTE103; Apr This workpMPO882 PatzR-atzR-atzS-lacZ transcriptional fusion in pMPO234 containing PatzT with a mutant E-�N binding

motif; Apr

This work

pMPO883 Promoterless atzR-atzS-lacZ transcriptional fusion in pMPO234 containing PatzT with a mutant E-�N

binding motif; Apr

This work

pRK2013 Helper plasmid used in triparental conjugation; Kmr Tra� 12pTE103 Vector for in vitro transcription assays; Apr 9

Platero et al.

6562 jb.asm.org Journal of Bacteriology

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

b on

27

Janu

ary

2022

by

182.

155.

225.

219.

temperature in 15-�l reaction mixtures containing 10 ng of the probe, 20�g/ml of poly(dI-dC), 300 �g/ml BSA, and increasing amounts (0 to 500nM) of purified IHF in binding buffer (10 mM Tris acetate [pH 8], 100mM potassium acetate, 27 mM ammonium acetate, 8 mM magnesiumacetate, 1 mM DTT, 5% glycerol) for 20 min. Reactions were stopped, andsamples were separated on an 8% polyacrylamide native gel and processedas described above.

DNase I footprinting assays. DNase I footprinting assays with AtzRwere performed essentially as described previously (42). Probes for DNaseI footprinting were obtained by PCR amplification using pMPO805 as thetemplate and primers delABS and fpIHF2 for the top strand and fpNtrC1

and fpIHF4 for the bottom strand. The PCR products were subsequentlydigested with SalI and gel purified. Binding reactions were performed inbinding buffer (35 mM Tris-acetate [pH 7.9], 70 mM potassium acetate,20 mM ammonium acetate, 2 mM magnesium acetate, 1 mM calciumchloride, 1 mM DTT, 5% glycerol, 100 �g/ml salmon sperm DNA, 250�g/ml BSA; pH 7.9) containing 10 ng of the radiolabeled probe and 0 to400 nM AtzR in a final volume of 20 �l. After a 20-min incubation at roomtemperature, partial digestion of the DNA was initiated by the addition of1 �l of an empirically determined dilution (typically 102 to 103) of aDNase I stock solution (10 U/ml; Roche Diagnostics, Basel, Switzerland).Incubation was continued for 30 additional seconds, and reactions werestopped by the addition of 5 �l stop buffer (1.5 M sodium acetate [pH5.2], 130 mM EDTA, 1 mg/ml salmon sperm DNA, 2.4 mg/ml glycogen).DNA was subsequently ethanol precipitated, resuspended in 5 �l loadingbuffer (0.125% [wt/vol] bromophenol blue, 0.125% [wt/vol] xylene cy-anol, 20 mM EDTA, 95% [vol/vol] formamide) and separated by gel elec-trophoresis on a 6% polyacrylamide– 6 M urea denaturing sequencing gel.Sequencing reactions were performed with the Sequenase 2.0 kit (USB)using the primers secIHFa for the upper strand and secNtrCb for thebottom strand and run in parallel as size markers. Gels were processed andanalyzed as described above.

DNase I footprinting assays with NtrC and IHF were performed es-sentially as described for AtzR. Probes for DNase I footprinting were ob-tained by PCR amplification using pMPO805 as the template and primerspairs delABS and BendP2 (NtrC, top strand), fpNtrC1 and fpNtrC2(NtrC, bottom strand), or fpIHF3 and fpIHF4 (IHF, bottom strand). ThePCR products were subsequently digested with SalI and gel purified. Bind-ing reactions were performed in binding buffer (10 mM Tris-acetate [pH8], 100 mM potassium acetate, 27 mM ammonium acetate, 8 mM mag-nesium acetate, 0.67 mM CaCl2, 0.33 mg/ml salmon sperm DNA, 250�g/ml BSA, 1 mM DTT, 5% glycerol) containing 10 ng of the radiolabeledprobe and 0 to 2 �M NtrC or 0 to 4 �M IHF in a final volume of 15 �l.Sequencing reactions were performed using primers secNtrCa (NtrC, topstrand), secNtrCb (NtrC, bottom strand), or secIHFb (IHF, bottomstrand), and run in parallel as size markers.

RNA preparation and RT-PCR. Pseudomonas sp. strain ADP wasgrown to mid-exponential phase under nitrogen excess. Cultures werethen washed three times, suspended in the same volume of medium con-taining ammonium, serine, or cyanuric acid as the sole nitrogen source,and incubated for an additional 2 h prior to harvesting. The total RNApreparation procedure was as previously described (16). Reverse tran-scription (RT) of total RNA (3 �g) was carried out using the high-capacitycDNA Archive kit (Applied Biosystems), with random hexamers as prim-ers. To detect transcript segments corresponding to the atzR-atzS, atzS-atzT, atzT-atzU, atzU-atzV, and atzV-atzW intergenic regions, primerpairs fpNtrC3/fpIHF4, orf98-97a/orf98-97b, orf97-96a/orf97-96b, orf96-95a/orf96-95b, and orf95-94a/orf95-94b were used with 10 to 50 ng ofcDNA as template in a 25-cycle PCR program. Amplification of a 455-bpband of the 16S ribosomal gene with primers f27 and r519 (29) was per-formed to ensure integrity of the cDNA. Negative and positive controlswere performed with no template or pMPO216 as a template, respectively.The RT-PCR products obtained were resolved by 1% agarose gel electro-phoresis and visualized by ethidium bromide staining.

Primer extension. Primer extension reactions were performed as pre-viously described (16) with 50 �g of RNA from each condition as thetemplate and 32P-end-radiolabeled primer PEX98-2 in reaction mixturescontaining SuperScript III reverse transcriptase (Invitrogen, Carlsbad,CA). Sequencing reactions were performed with the Thermo Sequenasecycle sequencing kit (USB, Cleveland, OH), according to the manufactur-er’s instructions. Samples were run on 6% polyacrylamide– urea sequenc-ing gels and subsequently processed as described above.

In vitro transcription. Multiround in vitro transcription reactionswere performed as previously described (41) in a final volume of 20 �lcontaining 35 mM Tris-acetate (pH 7.9), 70 mM potassium acetate, 20mM ammonium acetate, 5 mM magnesium acetate, 1 mM DTT, 10%

TABLE 2 Oligonucleotides used in this study

Oligonucleotide Sequence (5=–3=)2mutAtzR1 GCAACGTTTCGTTGCCGGTGTGATT2mutAtzR2 AATCACACCGGCAACGAAACGTTGC2mutNtrC ACGTGACATCATATGTAATATTCGTGTGGC2mutNtrC2 GCCACACGAATATTACATATGATGTCACGT3mutNtrC ATTTCCCTGCATATTTTTGAGATCC3mutNtrC2 GGATCTCAAAAATAAGCAGGGAAATBendP2 AACCTGGTCGACGAACACATAAAAAAGGdel-ABS TATCAGGGTTATTGTCTCATGAGCGGdel-RBS TTGAATGGGCAAATATTATACGCAAext1-rev TGGTCGCATTGCGTGAGAGGf27 AGAGTTTGATCMTGGCTCAGfpIHF2 AAGGCGGTCGACTCGGATGCAATCTTTfpIHF3 ACCCACGTCGACACGTGACATCACCAGfpIHF4 AGACAGGCGGTGCGGACGGTfpNtrC1 TTACAAGTCGACTTATGAGCTTGATATCfpNtrC2 TATCGTTATGAAAGGCACTGCGTTfpNtrC3 GAATTCGTCGACGGCAAGCTCGCTGATACGfwd-lacZ GTTTTCCCAGTCACGACmut1-fwd TTGAATCACACCGGCAACGAAACGGCACCGGmut10-rev ACGTGACATCATATGTAAGGTGCGTGTGGCmut2-rev CCGGTGCCGTTTCGTTGCCGGTGTGATTCAAmut5-fwd CCTTGTTATAAAAGAGCGGGCCAGCCTCAACmut6-rev GTTGAGGCTGGCCCGCTCTTTTATAACAAGGmut7-fwd GCCACACGAATATTACTGGTGATGTCACGTmut8-rev ACGTGACATCACCAGTAATATTCGTGTGGCmut9-fwd GCCACACGCACCTTACATATGATGTCACGTorf95-94a ATCATCGTGGCCTACGTCGGorf95-94b GTCCGAGGAAGGCCGACAGGorf96-95a TGCTGATCCGCCAGGCGATCorf96-95b GTACAGGCTGGTGCACGGCTorf97-96a CGCCGCCAAACTGTTCGAGGorf97-96b GTTCTCGCCCAGCACCGCATorf98-0 ACACGGCATAGGCTTorf98-2 GGGAATTCTGGCATTTCCCTGCACorf98-3 TTGAATTCCCGGTGCCGTTTCGGCorf98-5 CGGAATTCGTGTGATTCAAAAAACorf98-6 TTGAATTCTTCGGTCAACAGGTTCorf98-97a GACCGCAGTCGAGATCAACGorf98-97b GTTCTTCTCCATCGCCAGGCPEX98-2 GACGGTCGTCTTGGACTTCATGCGGGTTCPorf98XS GCGATCGGATCCAACCTTTAAATGCCTTGR-SalI GGGATGTCGACCAAGGCGATTr519 GWATTACCGCGGCKGCTGret1 ATTCGTCGCCGGCAAGret2 ATGCAATCTTTAAATGsecIHFa GGCGATCGGATGCAATCTTTsecIHFb ATGCAACGTGACATCACCAGsecNtrCa TGACCGAACACATAAAAAAGGsecNtrCb TCAAATTATGAGCTTGATATC

Regulation of the Pseudomonas sp. ADP atzRSTUVW Operon

December 2012 Volume 194 Number 23 jb.asm.org 6563

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

b on

27

Janu

ary

2022

by

182.

155.

225.

219.

glycerol, 250 mg/liter BSA, 20 nM E-�N, and 0.5 �g of supercoiled plas-mid pMPO831 containing PatzT. E. coli core RNA polymerase (100 nM;Epicentre), P. putida �N factor (200 nM), and 4 mM ATP were added.When required, IHF was added at a final concentration of 75 nM. Allmixtures were incubated for 10 min at 30°C. Open complex formationwas then stimulated by the addition of different concentrations of NtrCD55E,S161F, and the reaction mixtures were incubated for an additional 10min at 30°C. Subsequently, a mixture of ATP, GTP, CTP (final concen-tration, 0.4 mM each), UTP (0.07 mM), and [�-32P]UTP (0.033 mM;Perkin Elmer) was added to initiate multiround in vitro transcription.After 5 min of incubation at 30°C, reinitiation was prevented by the ad-dition of heparin (0.1 mg ml, final concentration). The samples wereincubated for an additional 5 min at 30°C, and the reactions were termi-nated by the addition of 5 �l of stop buffer (150 mM EDTA, 1.05 M NaCl,14 M urea, 3% glycerol, 0.075% xylene cyanol, and 0.075% bromophenolblue). The samples were run in 6% polyacrylamide– urea gels in Tris-borate-EDTA buffer at room temperature, and gels were processed forradiolabel detection as described above.

RESULTSatzR, atzS, atzT, atzU, atzV, and atzW are cotranscribed in Pseu-domonas sp. strain ADP. The intergenic regions between atzR,atzS, atzT, atzU, atzV, and atzW are short, spanning 50 bp (atzR-atzS), 38 bp (atzS-atzT), or 6 bp (atzT-atzU), or they are absent(the atzU-atzV and atzV-atzW gene pairs overlap by 14 and 11 bp,respectively). To test whether these six genes form an operon,RT-PCR was performed using primers designed to amplify the fivegene junctions and total RNA from Pseudomonas sp. strain ADPgrown under nitrogen excess (ammonium as a nitrogen source),nitrogen limitation (serine as a nitrogen source), or with the in-ducer of AtzR, cyanuric acid, as the sole nitrogen source as thetemplate. A drawback to this approach is the high rate of pADP-1loss in the absence of selection (8, 15). To minimize this effect, asingle culture of Pseudomonas sp. strain ADP was grown in me-dium containing ammonium as the nitrogen source to mid-expo-nential phase. Cells were washed thoroughly and split into threecultures containing the indicated nitrogen sources, and incuba-tion was resumed for two additional hours before harvesting forRNA preparation. Growth during the 2-h incubation was typicallyless than one doubling, implying that minimal plasmid loss oc-curred during this period. Plasmid loss in the initial culture was 30to 70%, as assessed by dilution plating and scoring for clear haloson atrazine-containing minimal medium.

The results of the RT-PCR showed that PCR products span-ning all five gene junctions were efficiently amplified (Fig. 1B),suggesting that readthrough transcription occurs along all fivegene junctions and, therefore, the six genes form an operon. Theintensity of the band corresponding to the PCR product spanningthe atzR-atzS intergenic region was similar under all three condi-tions, suggesting that the RT-PCR assay is not sensitive enough todetect the relatively weak nitrogen regulation of the PatzR pro-moter in the presence of AtzR. In contrast, the products corre-sponding to the other four gene junctions displayed changes inintensity consistent with induction under nitrogen limitation, asexpression was low in ammonium and similarly increased in serineand cyanuric acid, both of which are poor nitrogen sources for Pseu-domonas sp. strain ADP (16, 40). This change in the regulatory pat-tern suggests that a promoter directing nitrogen-regulated transcrip-tion occurs downstream from atzR and upstream from atzT.

A nitrogen-regulated promoter within the atzS coding se-quence. To test directly the presence of a transcript derived from

the atzR-atzS intergenic region, primer extension analysis wasperformed using RNA from Pseudomonas sp. ADP grown on am-monium, serine, or cyanuric acid as the sole nitrogen source (Fig.2) and an oligonucleotide annealed to the atzS sequence as primer.Surprisingly, no extension products compatible with transcrip-tion initiation at the atzR-atzS intergenic region were obtained.Instead, the highest molecular weight products consistently ob-tained in these experiments corresponded to transcripts starting attwo consecutive adenine residues located 117 and 118 bp down-stream from the atzS start codon. The relative intensities of theseproducts under the different growth conditions reproduced thenitrogen response observed in the RT-PCR assays describedabove, and primer extension analysis performed with P. putidaKT2442 bearing this region of pADP1 cloned in plasmidpMPO805 (see below) yielded equivalent results (data notshown). These results strongly suggest that transcription initia-tion within the atzS coding sequence contributes to the expressionof the downstream genes. Interestingly, a region displaying highsimilarity to the consensus for �N-dependent promoters (3)(TGGCCCGCTCTTTGC versus TGGCAC-N5-TTGC [conservedpositions are underlined]) is present immediately upstream (po-sitions 28 to 14) from the transcriptional start mapped above(the most upstream transcript 5= end is used as the �1 coordinatehere). The coincidence of nitrogen regulation and a �N recogni-tion motif supports the notion that this sequence represents abona fide promoter, designated PatzT, that is likely coregulatedwith the upstream promoter PatzR (see below).

FIG 2 Primer extension analysis of the atzS transcripts. Total RNA wasextracted from Pseudomonas sp. strain ADP grown on ammonium (NH),serine (SE), or cyanuric acid (CN) as the sole nitrogen source. A sequencingladder, denoted in the G, A, T, and C lanes, is shown alongside the primerextension reaction results. The sequence around the transcriptional startsite is indicated, and the initiating nucleotides are shown in bold within thissequence.

Platero et al.

6564 jb.asm.org Journal of Bacteriology

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

b on

27

Janu

ary

2022

by

182.

155.

225.

219.

Transcriptional organization of the atzRSTUVW operon.The results above imply an unanticipated complexity in the tran-scriptional organization of the atzRSTUVW operon. To analyzethe relative contributions of the identified promoters, a set of plas-mids bearing transcriptional atzS-lacZ fusions at the BamHI site atposition �319 relative to the PatzT transcriptional start site andcontaining different lengths of upstream sequences were con-structed in the broad-host-range fusion vector pMPO234 (Fig.3A). The insert in plasmid pMPO806 harbors the PatzR promoterregion, the complete atzR, the 50-bp atzR-atzS intergenic region,and 146 codons of the atzS coding region (including the putativePatzT promoter). Plasmid pMPO807 is identical to pMPO806 butlacks the PatzR promoter region. A third plasmid, pMPO805, con-tains only the distal 48 bp of the atzR sequence upstream from theintergenic region and the atzS-lacZ fusion. All three constructswere transferred by mating to Pseudomonas putida KT2442, a ge-netically tractable strain that we have routinely used as a surrogatehost with this system (16, 40), and expression in response to ni-trogen availability was tested by means of �-galactosidase assays(Fig. 3B).

Expression from all three atzS-lacZ fusions was low in mediumcontaining ammonium as the sole nitrogen source. The �-galac-tosidase levels from pMPO806 were increased 17-fold in cellsgrown in nitrogen-limited medium, and induction under nitro-gen limitation was increased further in the constructs lacking thePatzR promoter (pMPO807 and pMPO805), to 106-fold and 134-fold, respectively. These results indicated that the 538-bp insert inpMPO805 displayed a strong promoter activity that was inducedunder nitrogen limitation. The increase in �-galactosidase activityin pMPO807 and pMPO805, which do not produce AtzR, relativeto AtzR-producing pMPO806, may be an indication that AtzRnegatively regulates this promoter. To test this possibility, expres-

sion levels from pMPO807 and pMPO805 were also tested in thepresence of the AtzR-producing plasmid pMPO109. Under nitro-gen limitation, a 4- to 5-fold decrease in expression was observedwith both constructs, to levels equivalent to those with pMPO806,thus confirming that AtzR represses transcription from both con-structs. Expression was also tested in the presence of 0.1 mM cy-anuric acid, the inducer of the atzDEF operon and an effector ofAtzR. However, no significant effect was observed, indicatingthat cyanuric acid does not influence the regulation of theatzRSTUVW operon (data not shown).

To test whether the predicted PatzT promoter is accountablefor the high levels of gene expression observed in our atzS-lacZfusions, we performed site-directed mutagenesis to replace theconserved GC dinucleotide at the 12 box of PatzT with TA.This set of mutations was expected to prevent transcriptioninitiation from PatzT. Plasmids pMPO882, pMPO883, andpMPO817 are pMPO234-based atzS-lacZ fusion plasmidsequivalent to pMPO806, pMPO807, and pMPO805, respectively,but carry the mentioned substitutions at PatzT (Fig. 3A). Whenexpression from these fusion plasmids was tested in P. putidaKT2442 (Fig. 3B), basal levels in ammonium-containing mediumwere similarly low. PatzT promoter inactivation considerably de-creased the induced activity levels (6-fold) in the construct con-taining the PatzR promoter (pMPO882 versus pMPO806) andnearly abolished expression of the shorter constructs (82-fold de-crease in pMPO883 versus pMPO807; 119-fold in pMPO817 ver-sus pMPO805). These results confirmed that PatzT is the func-tional promoter present in pMPO805.

Taken together, our results indicated that PatzT is likely re-sponsible for most of the transcription of the genes downstreamfrom atzS under nitrogen limitation. Much of the residual expres-sion observed in the absence of PatzT can be attributed to PatzR,which is responsible for transcription of atzR and atzS but only aminor contributor to the expression of the downstream genes. Inaddition, our results indicate that cis-acting sequences requiredfor high-level transcription (except for an additional 1.6-foldchange that may require upstream sequences), nitrogen control,and AtzR-dependent repression of PatzT are contained within the538-bp insert in pMPO805.

Transcription from PatzT is subjected to general nitrogencontrol. Transcription from the PatzR promoter is activated bythe general nitrogen control activator NtrC (16, 41). To testwhether PatzT transcription was also dependent on NtrC, ex-pression from the PatzT promoter in pMPO805 was tested in P.putida strain MPO201, a KT2442 derivative harboring a dele-tion of ntrC (16). In addition, since the DNA bending proteinIHF acts as a coactivator in many promoters regulated by NtrCand other �N-dependent activators, PatzT-lacZ expression wasalso assessed in a �ihf mutant of P. putida KT2440 (KT2442 isa rifampin-resistant derivative of KT2440). The results are dis-played in Table 3.

The expression pattern of pMPO805 in the wild-type strainsKT2440 and KT2442 was as described above: expression was lowduring nitrogen-sufficient growth and greatly induced (over 100-fold) under nitrogen limitation. Induction was abolished whenassayed in the �ntrC strain, indicating that PatzT is directly orindirectly subjected to NtrC-dependent nitrogen control. Expres-sion in the �ihf background was also substantially lowered (7-fold) relative to the wild-type strains, indicating that PatzT acti-vation is also dependent on this auxiliary protein.

FIG 3 Expression of atzS-lacZ fusions with deletions in atzR. (A) Schematic ofthe atzRS region fused to lacZ. Black bars below the genes denote the extensionof the fragments present in each of the indicated constructs. Inactivation of thePatzT promoter is denoted by an X. (B) Expression of atzS-lacZ transcriptionalfusions in P. putida KT2442. Bars represent the averages and standard devia-tions from at least three independent measurements.

Regulation of the Pseudomonas sp. ADP atzRSTUVW Operon

December 2012 Volume 194 Number 23 jb.asm.org 6565

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

b on

27

Janu

ary

2022

by

182.

155.

225.

219.

Functional characterization of the NtrC UAS at the PatzTpromoter region. Sequence analysis of the PatzT promoter regionrevealed a possible upstream activation sequence (UAS) for NtrC,consisting of two putative NtrC binding sites centered at positions160 and 130 relative to the PatzT transcriptional start (Fig. 4A).The promoter-distal element, designated NtrC-1, shows high conser-vation on both half-sites relative to the P. putida NtrC binding siteconsensus (24), (TCACCAGTAAGGTGC versus GCACCAW-N4-GTGC [conserved positions are underlined]), while the promot-er-proximal element, designated NtrC-2, displays a highly con-served left half-site and a degenerate right half-site (GCACCATTTTGAGAT versus GCACCAW-N4-GTGC [conserved positionsare underlined]) (Fig. 4A). To address the relevance of these andother possible cis-acting elements for transcriptional regulation ofPatzT, a series of PatzT-lacZ transcriptional fusion plasmids bear-ing deletions at the PatzT promoter region was constructed. Weshowed above that the insert in the control construct, pMPO805,spanning positions 217 to �321 relative to the PatzT tran-scriptional start, harbors all the sequences required for correcttranscriptional regulation. Plasmids pMPO810, pMPO811,pMPO813, and pMPO814 also harbor PatzT-lacZ fusions at po-sition �321, but the upstream endpoints of the inserts are locatedat positions 150, 123, 103, and 76, respectively (Fig. 4A).These fusions are designated �1, �2, �3, and �4, respectively.Expression from all fusion constructs was monitored by means of�-galactosidase assays with P. putida KT2442 (Fig. 4B).

Expression from the wild-type fusion in pMPO805 was essen-tially as described above: activity levels were low in nitrogen-suf-ficient medium and greatly increased (129-fold) under nitrogen-limited conditions. A large decrease in induction (down to 19-folddecrease) was observed with fusion �1, indicating that sequencespresent in the wild type but not in �1 are involved in PatzT acti-vation in response to nitrogen limitation. Deletion of additionalsequences decreased induction further, to a residual �10-fold,which was maintained in fusions �2, �3, and �4. Induction undernitrogen limitation was completely abolished when tested in a�ntrC strain (data not shown). Taken together, these results indi-cate that a major determinant for activation of PatzT expressionby NtrC is located between positions 218 and 150, containingthe proposed NtrC1 site. In addition, the region between 50 and123, containing the proposed NtrC2 site, also appears to be in-volved in activation. To determine whether sequences down-stream from the PatzT promoter are involved in NtrC-dependentactivation, fusions wt-short and �2-short (equivalent to the wild-type and �2 fusions, but with lacZ fused to position �4) weretested. These constructs displayed 100-fold and 7-fold inductionunder nitrogen limitation (data not shown), similar to the 129-

fold and 10-fold induction observed with the wild type and �2fusions. Thus, sequences downstream from PatzT appear to havea marginal contribution to its regulation, and the observedresidual NtrC-dependent activation is likely to occur in a UAS-independent fashion (i.e., with the activator not bound or non-specifically bound to DNA) (53), as documented previously forother Pseudomonas NtrC-dependent promoters (41).

To test directly the possible implication of the NtrC1 andNtrC2 elements in PatzT activation in vivo, sets of point mutationswere generated by site-directed mutagenesis. These sets of muta-tions are intended to impair NtrC binding by diminishing thesimilarity of each half-site to the consensus. Mutants NtrC1-L andNtrC1-R bear three substitutions at the left and right half-sites ofthe NtrC1 element, respectively, while mutant NtrC1-LR bearsmutations at both half-sites of NtrC1. Mutant NtrC2-L bearsthree substitutions at the left half-site of NtrC2, and mutantNtrC1-LR�2-L combines mutations at both half-sites of NtrC1and the left half-site of NtrC2. Mutations at the right half-site ofNtrC-2 were not deemed necessary, as it bears no resemblanceto the consensus. Fragments equivalent to that in pMPO805 bear-ing the indicated mutations were transferred to pMPO234 to gen-erate the PatzT-lacZ fusion plasmids pMPO818, pMPO819,pMPO822, pMPO825, and pMPO826. These plasmids weretransferred to P. putida KT2442 by mating, and expression wasmonitored in �-galactosidase assays as described above. Resultsare shown in Fig. 4C.

Disruption of either one or both half-sites of the NtrC1 ele-ment provoked a 6- to 7-fold decrease in expression relative to thewild-type fusion under nitrogen limitation, similar to that ob-tained with the deletion of the complete NtrC1 element (fusion�1). Interestingly, the NtrC2-L mutation at the left half-site of theNtrC2 element was sufficient to elicit a 13-fold decrease in expres-sion under these conditions, to levels equivalent to those observedwith the �2, �3, and �4 deletions. Furthermore, the combinationof mutations at both NtrC1 half-sites with the NtrC2-L mutation(NtrC1-LR�2-L) failed to diminish induced expression levels sig-nificantly below those obtained with NtrC2-L alone. All muta-tions tested provoked a slight (�2-fold) but reproducible decreasein activity under nitrogen excess and failed to significantly affectexpression in a �ntrC background (data not shown). Taken to-gether, our results indicate that both NtrC1 and NtrC2 are re-quired for full PatzT activation, and therefore they represent abona fide NtrC UAS.

NtrC interaction with the PatzT promoter region. To charac-terize the interaction of NtrC with the PatzT promoter regionfurther, we used pure NtrCD55E,S161F to perform DNA bindingassays. NtrCD55E,S161F is a constitutively active mutant that doesnot require phosphorylation for in vivo or in vitro activity (25).Initially, gel mobility shift assays were attempted, but NtrC-DNAcomplexes were not consistently obtained, likely due to low sta-bility under electrophoresis conditions (data not shown). Next,the NtrC-DNA interaction was tested by means of DNase I foot-printing assays (Fig. 5). NtrCD55E,S161F protected the PatzT pro-moter region bottom strand at positions 174 to 171, 166 to160, and 156 to 150, overlapping with the NtrC1 site. Hy-persensitive positions were observed in this region at 178, 177,176, 158, 149, 148, and 147. Several protected positionswere also observed at the bottom strand around the NtrC2 site, at138 to 134 and 124 to 122. Two strongly hypersensitivepositions were observed in this region, at positions 127 and

TABLE 3 PatzT-lacZ expression in �ntrC and �ihf mutant backgrounds

Fusionplasmid Strain Background

�-Galactosidase activitya withnitrogen source

Ammonium Serine

pMPO805 KT2442 Wild type (Rifr) 346 � 62 40,800 � 6,710pMPO805 MPO201 �ntrC 236 � 36 445 � 106pMPO805 KT2440 Wild type (Rifs) 262 � 8 45,300 � 4,830pMPO805 KT2440�ihf �ihf 128 � 35 6,220 � 930a Expression of the PatzT-lacZ transcriptional fusion in pMPO805 in the wild type andnull ntrC and ihf mutants of P. putida. Data (reported in Miller units) representaverages and standard deviations of at least three independent measurements.

Platero et al.

6566 jb.asm.org Journal of Bacteriology

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

b on

27

Janu

ary

2022

by

182.

155.

225.

219.

FIG 4 Expression of PatzT-lacZ fusions bearing deletions and point mutations at putative cis-acting elements. (A) Schematic of the PatzT promoter region and lacZfusion constructs. Putative NtrC and AtzR binding sites are denoted by open boxes and shaded boxes, respectively (the degenerate right half-site of NtrC-2 is surroundedby a broken line). (Top) Sequence of the relevant region containing the putative NtrC and AtzR binding sites. The identities of the mutations constructed are indicatedabove the sequence. Upstream ends of deletion mutants are shown by bent arrows. The atzS start codon is underlined. (Bottom) Schematic of the fusion constructs ofthe PatzT promoter region (drawn to scale). The putative PatzT �N-dependent promoter is denoted by a closed arrow. Mutationally inactivated elements are crossed. (Bto D) �-Galactosidase activities from PatzT-lacZ fusions bearing deletions at the PatzT promoter (B), point mutations at the NtrC binding sites (C), or point mutationsat the AtzR binding site (D). Bars represent the averages and standard deviations from at least three independent measurements.

December 2012 Volume 194 Number 23 jb.asm.org 6567

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

b on

27

Janu

ary

2022

by

182.

155.

225.

219.

128. Protection was also observed on the top strand at positions168 to 164, 158 to 154, 148 to 145, 139 to 134, and130 to 124. Hypersensitive positions at this strand occurred atpositions 174, 173, 171, 161, 141, 140, 133, and131. Taken together, the in vitro footprinting results confirmedthe location of the two NtrC binding sites at the PatzT promoterregion. In addition, the occurrence of hypersensitive positionssuggested that NtrC binding causes deformation in the DNAstrand at both of its binding sites.

Functional characterization of the AtzR binding site at thePatzT promoter region. The PatzT promoter region contains thesequence GGTGCCGTTTCGGCACC, centered at position 112(Fig. 4A). The perfect heptameric inverted repeat (positions un-derlined) is identical to that found at the AtzR repressor bindingsite (RBS), responsible for the primary interaction of AtzR withthe atzR-atzDEF promoter region (40). To explore the role of thisand other cis-acting sequences involved in AtzR-dependent re-pression, expression from the deleted derivatives of the PatzT pro-moter was also determined in the presence of the AtzR-producingplasmid pMPO109 (Fig. 4B). Under nitrogen excess, expressionwas essentially unchanged in all constructs compared to that ob-tained in the absence of AtzR. Under nitrogen limitation, removalof the sequences between 217 and 150 in the �1 fusion fully

abolished AtzR-dependent repression, and similar results wereobtained with the shorter �2, �3, and �4 fusions, suggesting thatan essential determinant for repression lies between positions217 and 150. The striking coincidence of this region with thelocation of the NtrC1 site (see above) and the fact that the pre-dicted AtzR binding element is located far downstream from thisregion suggest that NtrC binding (rather than AtzR binding) tothis region may be a requisite for AtzR-dependent repression (forfurther clarification, see below).

The fact that repression is abolished when sequences upstreamfrom 150 are removed precludes the analysis of the role of theputative RBS motif centered at 112 in the deletion analysisabove. To test directly whether this element is involved in AtzR-dependent repression, site-directed mutagenesis was performedseparately on each half-site of the motif. Mutant promoter AtzR-Lcontains three substitutions in the left half-site that alter the se-quence to GGCAACG (mutated positions underlined). Mutantpromoter AtzR-R contains three substitutions in the right half-site that alter the sequence to CGTTGCC (mutated positionsunderlined). Mutant promoter AtzR-RL harbors the combinationof both sets of mutations. Plasmids pMPO815, pMPO816, andpMPO821 contain fusions identical to pMPO805 but harborthe promoter variants AtzR-L, AtzR-R, and AtzR-LR, respectively(Fig. 4A). The effects of these mutations were determined bymeans of �-galactosidase assays in P. putida KT2442 and P. putidaKT2442 bearing the AtzR-producing plasmid pMPO109(Fig. 4D).

Expression levels of the PatzT-lacZ fusions bearing mutationsat the putative AtzR RBS in the absence of AtzR were similar tothat of the control wild-type fusion, indicating that the mutationsdid not significantly affect basal transcription or NtrC-dependentactivation. In contrast, AtzR-dependent repression was nearlyabolished in all three mutant promoters, as the repression ratiowas reduced from 4-fold to less than 1.5-fold in all cases. Thisresult indicated that the putative RBS is indeed an essential ele-ment for AtzR-dependent repression.

AtzR interaction with the PatzT promoter region. To charac-terize the interaction of AtzR with the PatzT promoter region, gelmobility shift assays were performed using the wild-type pro-moter region as a probe (Fig. 6A and E). Upon addition of increas-ing concentrations of AtzR, a specific retarded band was observed,strongly suggesting that AtzR binds the PatzT promoter regionstrongly at a single site. The apparent dissociation constant (Kd)for AtzR binding was �9 nM. To assess the importance of the RBSelement identified for the AtzR-DNA interaction, assays were alsoperformed with probes harboring the AtzR-L, AtzR-R, andAtzR-LR mutations (Fig. 6B, C, D, and E). A similar retarded bandwas observed with the wild-type and AtzR-L and AtzR-R mutantprobes, but the affinity of AtzR for the mutant probes was dimin-ished �10-fold relative to the wild-type fragment. Very weakbinding was detected only at the highest protein concentrationswhen the AtzR-LR probe was used. These results indicated that theheptameric palindrome is an essential determinant for AtzR bind-ing to the PatzT promoter region. Integrity of both half-sites of theputative recognition is essential for optimal high-affinity DNAbinding by AtzR and in vivo repression. However, the presence ofa single functional half-site may promote a low level of AtzR-DNAinteraction.

DNase I footprinting assays were also performed in order tocharacterize further the interaction of AtzR with its binding site at

FIG 5 DNase I footprinting analysis of NtrC at the PatzT promoter region.Gel images were obtained from assays performed with radiolabeled the bot-tom-strand (left) or top-strand (right) PatzT promoter region as a probe. Thepredicted NtrC-1 and NtrC-2 sites are shown as open boxes. Protected regionsare denoted by closed bars, and hypersensitive positions are denoted by closedcircles. Coordinates are relative to the PatzT transcriptional start site.NtrCD55E,S161F concentrations used were 0 (lanes 1), 0.25 �M (lanes 2), 0.5 �M(lanes 3), 1 �M (lanes 4), and 2 �M (lanes 5).

Platero et al.

6568 jb.asm.org Journal of Bacteriology

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

b on

27

Janu

ary

2022

by

182.

155.

225.

219.

the PatzT promoter region (Fig. 7). AtzR protected positionsaround the identified RBS (128 to 109 at the bottom strandand 120 to 97 at the top strand). In addition, hypersensitivepositions were noted at 139, 136, 129, 100, 99, 90, and85 (bottom strand) and 130, 96, 95, 87, 86, and 85(top strand). Continuous protection of the RBS and the presenceof strongly hypersensitive positions downstream from the RBSwere reminiscent of the AtzR interaction with the PatzDEF pro-moter region and suggested that AtzR bends DNA upon binding(40, 42). However, unlike the PatzDEF promoter region, addi-tional protected positions extending toward the PatzT promoterwere not observed, suggesting that the interaction of AtzR withDNA outside the strong RBS element is likely very weak or absent.Accordingly, our in vivo and in vitro analyses of the AtzR bindingsite did not support the notion that AtzR interacts with the PatzTpromoter region upstream from position 150, and therefore thelack of repression observed with the �1 mutant (see above and Fig.4B) is likely due to a requirement for the NtrC interaction in thisregion for repression to occur (see Discussion).

IHF assists NtrC-dependent PatzT activation. The region be-tween 100 and 50 contains several A-T-rich stretches showingpartial matches to the IHF recognition sequence consensus, WATCAA-N4-TTR (14), although poor conservation of the consensusin IHF binding sites precludes unequivocal identification (19). Toassess the hypothesis that IHF interacts with the PatzT promoter,gel mobility shift assays were performed using purified IHF fromEscherichia coli (Fig. 8A). A clear retarded complex was observed atIHF concentrations ranging between 200 and 500 nM. However,the complex only represented a small fraction of the labeled probe,and the assay was not improved by changing buffers or the IHFpreparation. DNase I footprinting of IHF was also performed on abottom-strand-radiolabeled PatzT promoter fragment (Fig. 8B).A window of partial protection was observed at positions 82 to55. The protected region is A-T rich (66%) and contains the bestmatch (6 out of 9 positions) to the IHF consensus (GGTCAACAGGTTC [conserved positions underlined]) within the PatzT pro-moter region, suggesting that this region indeed represents a trueIHF binding site. Footprinting assays with top-strand-radiola-

FIG 6 Gel mobility shift analysis results for AtzR at the PatzT promoter re-gion. (A to D) Gel images obtained from assays performed using the wild-type(A), AtzR-L (B), AtzR-R (C), or AtzR-LR (D) PatzT promoter fragments as aprobe are shown. The arrowheads indicate the retarded complexes. AtzR-His6

concentrations were 0 (lanes 1), 5 nM (lanes 2), 10 nM (lanes 3), 20 nM (lanes4), 40 nM (lanes 5), 80 nM (lanes 6), and 160 nM (lanes 7). (E) The percentageof retarded probe plotted against the AtzR-His6 concentration. Curves repre-sent the best-fitting rectangular hyperbola curves for each data set. Values anderror bars represent the averages and standard deviations of at least threeindependent experiments.

FIG 7 DNase I footprinting analysis of AtzR at the PatzT promoter region. Gelimages obtained from assays performed with radiolabeled bottom-strand(left) or top-strand (right) PatzT promoter region as a probe are shown. Thepredicted AtzR RBS is shown as a pair of open boxes. Protected regions aredenoted by closed bars, and hypersensitive positions are denoted by closedcircles. Coordinates are relative to the transcriptional start site. AtzR-His6

concentrations used were 0 (lanes 1), 50 nM (lanes 2), 100 nM (lanes 3), 200nM (lanes 4), and 400 nM (lanes 5).

Regulation of the Pseudomonas sp. ADP atzRSTUVW Operon

December 2012 Volume 194 Number 23 jb.asm.org 6569

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

b on

27

Janu

ary

2022

by

182.

155.

225.

219.

beled PatzT failed to reveal a reproducible protection pattern(data not shown). Taken together, our binding assays suggest thatIHF interacts with the PatzT promoter region. However, IHF af-finity for its binding site is low, and the complex appears to beunstable under the set of conditions tested.

To reinforce the notion that IHF interacts with, and contrib-utes to positive control of, the PatzT promoter, we directly testedthe ability of IHF to stimulate PatzT transcription in vitro. To thisend, we set up a multiround in vitro transcription assay usingsupercoiled plasmid pMPO831, which bears the wild-type PatzTpromoter region, as a template, pure E. coli core RNA polymeraseand IHF and P. putida �N and NtrCD55E,S161F. The results areshown in Fig. 9. The PatzT transcript was not detected in theabsence of NtrC, regardless of the addition of IHF. In contrast,increasing transcript levels were detected when the NtrC concen-

tration was increased gradually between 100 and 500 nM, consis-tent with the notion that NtrC is the direct activator of the PatzTpromoter. Addition of 75 nM IHF to NtrC-containing reactionmixtures greatly enhanced transcription at all NtrC concentra-tions. These results strongly suggest that IHF is a coactivator thatstimulates NtrC-dependent activation of PatzT, although it is notstrictly required for activation.

DISCUSSION

LTTRs and �N-dependent promoters are widespread elements in-volved in the control of bacterial transcription initiation. While�N-dependent promoters are obligately activated by a groupof transcription factors designated enhancer binding proteins(EBPs), belonging to the family of AAA� ATPases (49), very fewof them are also subjected to negative regulation exerted by mem-bers of other regulatory families. AtzR is one of these rare proteinsthat has been shown to repress a �N-dependent promoter (41).Here, we characterized the regulatory cis- and trans-acting ele-ments involved in activation and repression of PatzT, a �N-depen-dent internal promoter responsible for transcription of the fourdistal genes of the atzRSTUVW operon.

Two promoters are accountable for most of the transcriptionof the atzRSTUVW operon. The upstream PatzR promoter waspreviously characterized as �N dependent, NtrC activated, andAtzR repressed (16, 41). Transcript levels seen in RT-PCR andprimer extension assays, as well as �-galactosidase actvity ob-tained from PatzR-lacZ fusions, suggested that PatzR is a weakpromoter, as frequently observed for genes that encode transcrip-tion factors. Consistently, AtzR, the product of the first gene in theoperon, is known to be present in limiting concentrations withinthe cell (16, 40). Translation of the second gene of the operon,atzS, is initiated from a suboptimal GUG start codon, suggestingthat high levels of AtzS are also avoided. We found that a second

FIG 8 DNA binding assays of IHF at the PatzT promoter region. (A) Gelmobility shift analysis. Shown is the gel image obtained from an assay per-formed using the wild-type PatzT promoter fragment as a probe and 0 (lane 1),100 nM (lane 2), 200 nM (lane 3), 300 nM (lane 4), 400 nM (lane 5), and 500nM (lane 6) pure IHF. The arrowhead indicates the retarded complex. (B)DNase I footprinting analysis. Gel images obtained from assays performed onthe bottom-strand radiolabeled PatzT promoter region. The protected regionis denoted by a closed bar. Coordinates are relative to the transcriptional startsite. AtzR-His6 concentrations used were 0 (lane 1), 0.5 �M (lane 2), 1 �M(lane 3), 2 �M (lane 4), and 4 �M (lane 5).

FIG 9 In vitro activation of the PatzT promoter. (A) Gel image obtained froma representative multiround in vitro transcription assay using the wild-typePatzT promoter region as a template and 0 nM (lanes 1), 100 nM (lanes 2), 200nM (lanes 3), 300 nM (lanes 4), 400 nM (lanes 5), and 500 nM (lanes 6)NtrCD55E,S161F. Reaction mixtures contained 75 nM IHF (�; left) or no IHF(; right). (B) Levels of PatzT transcript obtained in the in vitro transcriptionassays plotted against the NtrCD55E,S161F concentration. The signal obtainedwith the highest concentration of NtrCD55E,S161F (500 nM) in the presence ofIHF was set as 100%. Transcript levels are expressed relative to this value. Barsrepresent the averages and standard deviations of three independent measure-ments.

Platero et al.

6570 jb.asm.org Journal of Bacteriology

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

b on

27

Janu

ary

2022

by

182.

155.

225.

219.

promoter, PatzT, is present within the atzS coding region. Ourresults are consistent with this promoter being responsible for thebulk of transcription of the four distal genes, atzT, atzU, atzV, andatzW. The regulatory patterns of the PatzR and PatzT promotersare similar: they are both �N dependent, activated by NtrC undernitrogen limitation, and repressed by AtzR in a cyanuric acid-independent fashion. Thus, the regulatory responses are consis-tent throughout the complete operon, although the overall levelsof transcription are higher for the four distal genes. This mayreflect the requirement of higher concentrations of the atzT, atzU,atzV, and atzW gene products. These four proteins are the sub-units of a ABC-type solute transporter, and the presence of veryshort or absent intergenic regions between them may reflect tighttranslational coupling in order to maintain the correct stoichiom-etry in the transporter complex (20).

Analysis of the PatzT promoter region revealed the character-istic architecture of a �N-dependent promoter (45), including a�N binding motif with high similarity to the 12/24 consensus,a pair of binding sites for the enhancer binding protein NtrC, anda binding site for the auxiliary protein IHF (Fig. 10). Activation ofPatzT in vivo under nitrogen limitation is strictly dependent onNtrC and partly dependent on IHF. In vitro transcription assaysconfirmed that dependence on both factors is direct and likely dueto the interaction of both proteins with the promoter region. Weidentified two NtrC binding sites, centered at positions 160 and130. Deletion and point mutation analyses showed that bothsites are required for activation, as NtrC1 did not suffice to pro-mote activation in the absence of a functional NtrC2 and inacti-vation of NtrC1 yielded only 2-fold activation above the levelsobserved in the absence of both sites. Interestingly, the NtrC1 siteis a better match to the NtrC binding consensus in P. putida (24),while NtrC2 has a conserved left half-site but a highly degenerateright half-site (Fig. 10). We propose that the NtrC1 element facil-itates the NtrC interaction with NtrC2 via protein-protein con-tacts, based on the following observations: (i) both sites are on thesame side of the helix, offset by approximately three helix turns,(ii) both sites bind NtrC at the same concentrations, despite theapparent differences from the consensus sequence, and (iii) mul-tiple hypersensitive sites occurred in the DNase I footprinting as-says in the region between the NtrC1 and NtrC2 sites, indicative ofDNA deformation that may be required for interaction betweenNtrC dimers bound to each site. The presence of UAS elements

composed of pairs of activator binding sites located on the sameface of the helix is a conserved feature of �N-dependent promoters(7), including the NtrC-activated glnK, ureD, and codB promoterregions of P. putida (25), and has been linked to cooperative bind-ing and oligomerization of the activator (43). Interestingly, signif-icant (up to 10-fold) NtrC-dependent activation is observed whenboth NtrC binding sites are removed. As downstream sequencesappear to make a marginal contribution to the regulation of thesystem, we conclude that the observed residual induction is likelydue to UAS-independent activation. This phenomenon has beendocumented for several �N-dependent promoters (5, 39, 44, 55),including PatzR, which completely lacks NtrC binding sites and isactivated exclusively in a UAS-independent fashion (41).

We also showed that IHF interacts with the PatzT promoterregion at a single site centered at position 70 (Fig. 10) and stim-ulates NtrC-dependent activation, both in vivo and in vitro. As anauxiliary protein in the activation of �N-dependent promoters,IHF usually binds at A-T-rich stretches within the interveningregion between the activator binding sites and the promoter. Inthis position, IHF-induced bending acts as a hinge to bring theactivator into close contact with RNA polymerase. This activationmodel has been documented for multiple examples of �N-depen-dent promoters (4, 6, 26).

Our results showed that AtzR is a repressor of the PatzT pro-moter. Repression was mild (�4-fold) and did not require thecognate inducer of AtzR, cyanuric acid. Similarly, AtzR repressesits own synthesis in an inducer-independent fashion (41), a traitthat is conserved in other LTTRs (47, 50). AtzR binds the PatzTpromoter region at a single site containing a strong binding deter-minant, the RBS, which is essential for repression (Fig. 10). Thesequence of the 14-bp interrupted palindrome in this element isidentical to that found at the atzR-atzDEF divergent promoterregion (40). AtzR, like most LTTRs, is a tetramer that interactswith an extended (�50-bp) site at the atzR-atzDEF promoter re-gion. This form of binding requires a second, weaker recognitionelement, designated the activator binding site (ABS), which is es-sential for PatzDEF activation. In contrast, DNase I protection ofthe PatzT promoter region by AtzR does not extend far beyond thelimits of the RBS. Sequence comparison revealed that the se-quences of the three individual binding sites within the ABS, des-ignated ABS-1, ABS-2, and ABS-3 (42), are poorly conserved inthe PatzT promoter region. Due to this fact, interaction in this

FIG 10 Schematic of all cis-acting elements at the PatzT promoter region. The sequence of the PatzT promoter region is shown along with the location of theNtrC-1, NtrC-2, AtzR, and IHF binding sites and the PatzT �N-dependent promoter. Conserved binding motifs for NtrC, AtzR, IHF, and �N-RNA polymeraseare denoted by open boxes. A broken line surrounds the box corresponding to the nonconserved right half-site of the NtrC-2 site. The consensus for thecorresponding binding sites are shown below the sequence. Protected regions from the DNase I footprinting assays for NtrC (closed bars), AtzR (open bars), orIHF (shaded bar) are displayed above (top strand) or below (bottom strand) the sequence. Hypersensitive positions in DNase I footprints are also displayed forNtrC (closed circles) and AtzR (open circles). The mapped transcription start sites are denoted by bent arrows. Coordinates are relative to the first (upstream)transcription start site.

Regulation of the Pseudomonas sp. ADP atzRSTUVW Operon

December 2012 Volume 194 Number 23 jb.asm.org 6571

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

b on

27

Janu

ary

2022

by

182.

155.

225.

219.

region may be too weak to be detected by means of DNase I foot-printing. AtzR has been shown to generate a bend on its bindingsite at the atzR-atzDEF promoter (40). Two lines of evidence sup-port the notion that AtzR also bends DNA at the PatzT promoterregion. First, two sets of DNase I-hypersensitive positions occurbetween positions 100 and 80 of PatzT in one-helix turn in-tervals on both DNA strands. This hypersensitivity pattern is veryreminiscent of that observed at the atzR-atzDEF promoter region.Second, an A-tract is present at an identical location in both bind-ing sites (positions 94 to 89 relative to the PatzT transcrip-tional start). We recently demonstrated that this element is intrin-sically bent and contributes to AtzR binding, DNA bending, andPatzDEF activation (O. Porrúa and F. Govantes, unpublished re-sults). Experiments aimed to address the presence and relevanceof an AtzR-induced DNA bend at the PatzT promoter region areunder way.

Only a few examples of negatively regulated �N-dependentpromoters have been reported thus far (11, 32, 34, 52), includingthe AtzR-repressed PatzR promoter (41). Although PatzR andPatzT are both �N-dependent promoters repressed by AtzR, ourresults suggest that the underlying mechanisms of repression arestrikingly different. In PatzR, AtzR prevents transcription by com-peting with E-�N for DNA binding. However, the location of theAtzR binding site at the PatzT promoter region, �80 bp upstreamfrom the E-�N binding motif, makes this possibility unlikely. Asdiscussed above, NtrC displays significant UAS-independent ac-tivation at the PatzT promoter. Strikingly, deletions that elimi-nated one or both of the NtrC binding sites while leaving the AtzRrecognition sequences intact completely prevented AtzR-depen-dent repression of the UAS-independent transcription. DNase Ifootprinting failed to identify any interactions of AtzR, at least inthe region overlapping the NtrC-1 site, and in vivo and in vitroevidence strongly suggests that AtzR binds primarily to the RBSmotif centered at position 112, far downstream from this re-gion. The simplest explanation for this phenomenon is that AtzRis an antiactivator that interferes with the action of NtrC whenactivating transcription from its specific binding sites and, con-versely, UAS-independent activation observed in the promoterdeletion derivatives is not sensitive to AtzR-dependent repression.Antiactivation as a mechanism for repression of �N-dependentpromoters has been previously documented (11, 32, 34).

The functions of the outer membrane protein and ABC trans-port system encoded by atzS, atzT, atzU, atzV, and atzW operonare as of yet unknown. Transport systems for alternative nitrogensources are in fact one of the most abundant functional classesamong genes subjected to general nitrogen control, both in E. coli(55) and P. putida (24). Although s-triazine transport by degrad-ing strains has not been studied in detail, indirect evidence of ans-triazine transporter has been documented for several organisms(18, 48, 54), including Pseudomonas sp. strain ADP (15, 22, 38).Proximity to the cyanuric acid utilization atzDEF operation andcoregulation by the general nitrogen control system and AtzR sug-gest that they may be involved in the transport of cyanuric acid.On the other hand, our finding that atrazine uptake by Pseudomo-nas sp. ADP is strongly regulated by nitrogen availability, eventhough synthesis of the enzymes required for atrazine conversionto cyanuric acid is constitutive, strongly suggests the existence ofan atrazine transport system that is subject to nitrogen regulation(15). The possibility that the atzRSTUVW operon encodes a ded-icated atrazine or cyanuric acid transport system is certainly at-

tractive, and experimental work aimed to address these questionsis under way.

ACKNOWLEDGMENTS

We thank Aroa López-Sánchez for assistance in preparation of the man-uscript, Ana B. Hervás, Inés Canosa (CABD, Universidad Pablo de Olav-ide), Linda U. M. Johansson, Lisandro M. D. Bernardo, Eleonore Skärf-stad, and Victoria Shingler (Umeå University) for purified proteins,Guadalupe Martín and Nuria Pérez for technical help, and all members ofthe Govantes and Santero laboratories for their insights and helpful sug-gestions.

Work in our lab is supported by grants BIO2004-01354, BIO2007-63754, BIO2010-17853, CSD2007-0005, and BIO2011-24003, cofundedby the Spanish Ministerio de Educación y Ciencia and the European Re-gional Development Fund.

REFERENCES1. Aiyar A, Xiang Y, Leis J. 1996. Site-directed mutagenesis using overlap

extension PCR. Methods Mol. Biol. 57:177–191.2. Altschul SF, et al. 1997. Gapped BLAST and PSI-BLAST: a new genera-

tion of protein database search programs. Nucleic Acids Res. 25:3389 –3402.

3. Barrios H, Valderrama B, Morett E. 1999. Compilation and analysis of�54-dependent promoter sequences. Nucleic Acids Res. 27:4305– 4313.

4. Buck M, Gallegos MT, Studholme DJ, Guo Y, Gralla JD. 2000. Thebacterial enhancer-dependent �54 (�N) transcription factor. J. Bacteriol.182:4129 – 4136.

5. Burtnick MN, et al. 2007. Insights into the complex regulation of rpoS inBorrelia burgdorferi. Mol. Microbiol. 65:277–293.

6. Carmona M, Claverie-Martin F, Magasanik B. 1997. DNA bending andthe initiation of transcription at �54-dependent bacterial promoters. Proc.Natl. Acad. Sci. U. S. A. 94:9568 –9572.

7. Cases I, Ussery DW, de Lorenzo V. 2003. The �54 regulon (sigmulon) ofPseudomonas putida. Environ. Microbiol. 5:1281–1293.

8. de Souza ML, Wackett LP, Sadowsky MJ. 1998. The atzABC genesencoding atrazine catabolism are located on a self-transmissible plasmidin Pseudomonas sp. strain ADP. Appl. Environ. Microbiol. 64:2323–2326.

9. Elliott T, Geiduschek EP. 1984. Defining a bacteriophage T4 late pro-moter: absence of a “-35” region. Cell 36:211–219.

10. Espinosa-Urgel M, Salido A, Ramos JL. 2000. Genetic analysis of func-tions involved in adhesion of Pseudomonas putida to seeds. J. Bacteriol.182:2363–2369.

11. Feng J, Goss TJ, Bender RA, Ninfa AJ. 1995. Repression of the Klebsiellaaerogenes nac promoter. J. Bacteriol. 177:5535–5538.

12. Figurski DH, Helinski DR. 1979. Replication of an origin-containingderivative of plasmid RK2 dependent on a plasmid function provided intrans. Proc. Natl. Acad. Sci. U. S. A. 76:1648 –1652.

13. Franklin FC, Bagdasarian M, Bagdasarian MM, Timmis KN. 1981.Molecular and functional analysis of the TOL plasmid pWWO from Pseu-domonas putida and cloning of genes for the entire regulated aromatic ringmeta cleavage pathway. Proc. Natl. Acad. Sci. U. S. A. 78:7458 –7462.

14. Friedman DI. 1988. Integration host factor: a protein for all reasons. Cell55:545–554.

15. García-González V, Govantes F, Shaw LJ, Burns RG, Santero E. 2003.Nitrogen control of atrazine utilization in Pseudomonas sp. strain ADP.Appl. Environ. Microbiol. 69:6987– 6993.

16. García-Gonzalez V, Govantes F, Porrua O, Santero E. 2005. Regulationof the Pseudomonas sp. strain ADP cyanuric acid degradation operon. J.Bacteriol. 187:155–167.

17. García-González V, et al. 2009. Distinct roles for NtrC and GlnK innitrogen regulation of the Pseudomonas sp. strain ADP cyanuric acid uti-lization operon. FEMS Microbiol. Lett. 300:222–229.

18. Gebendinger N, Radosevich M. 1999. Inhibition of atrazine degradationby cyanazine and exogenous nitrogen in bacterial isolate M91-3. Appl.Microbiol. Biotechnol. 51:375–381.

19. Giladi H, et al. 1998. Participation of IHF and a distant UP element in thestimulation of the phage lambda pL promoter. Mol. Microbiol. 30:443–451.

20. Govantes F, Molina-Lopez JA, Santero E. 1996. Mechanism of coordi-nated synthesis of the antagonistic regulatory proteins NifL and NifA ofKlebsiella pneumoniae. J. Bacteriol. 178:6817– 6823.

Platero et al.

6572 jb.asm.org Journal of Bacteriology

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

b on

27

Janu

ary

2022

by

182.

155.

225.

219.

21. Govantes F, et al. 2010. Regulation of the atrazine-degradative genes inPseudomonas sp. strain ADP. FEMS Microbiol. Lett. 310:1– 8.

22. Govantes F, Porrúa O, García-González V, Santero E. 2009. Atrazinebiodegradation in the lab and in the field: enzymatic activities and generegulation. Microb. Biotechnol. 2:178 –185.

23. Hanahan D. 1983. Studies on transformation of Escherichia coli withplasmids. J. Mol. Biol. 166:557–580.

24. Hervás AB, Canosa I, Santero E. 2008. Transcriptome analysis of Pseu-domonas putida in response to nitrogen availability. J. Bacteriol. 190:416 –420.

25. Hervás AB, Canosa I, Little R, Dixon R, Santero E. 2009. NtrC-dependent regulatory network for nitrogen assimilation in Pseudomonasputida. J. Bacteriol. 191:6123– 6135.

26. Hoover TR, Santero E, Porter S, Kustu S. 1990. The integration hostfactor stimulates interaction of RNA polymerase with NIFA, the transcrip-tional activator for nitrogen fixation operons. Cell 63:11–22.

27. Inoue H, Nojima H, Okayama H. 1990. High efficiency transformationof Escherichia coli with plasmids. Gene 96:23–28.

28. Johansson LU, Solera D, Bernardo LM, Moscoso JA, Shingler V. 2008.�54-RNA polymerase controls �70-dependent transcription from a non-overlapping divergent promoter. Mol. Microbiol. 70:709 –723.

29. Lane DJ. 1991. 16S/23S rRNA sequencing, p 115–175. In Stackebrandt E,Goodfellow M (ed), Nucleic acid techniques in bacterial systematics. Wi-ley, Chichester, United Kingdom.

30. Mandelbaum RT, Wackett LP, Allan DL. 1993. Mineralization of thes-triazine ring of atrazine by stable bacterial mixed cultures. Appl. Envi-ron. Microbiol. 59:1695–1701.

31. Mandelbaum RT, Wackett LP, Allan DL. 1995. Isolation and character-ization of a Pseudomonas sp. that mineralizes the s-triazine herbicide atra-zine. Appl. Environ. Microbiol. 61:1451–1457.

32. Mao XJ, Huo YX, Buck M, Kolb A, Wang YP. 2007. Interplay betweenCRP-cAMP and PII-Ntr systems forms novel regulatory network betweencarbon metabolism and nitrogen assimilation in Escherichia coli. NucleicAcids Res. 35:1432–1440.

33. Marqués S, et al. 1998. Activation and repression of transcription at thedouble tandem divergent promoters for the xylR and xylS genes of theTOL plasmid of Pseudomonas putida. J. Bacteriol. 180:2889 –2894.

34. Martin-Verstraete I, Stulke J, Klier A, Rapoport G. 1995. Two differentmechanisms mediate catabolite repression of the Bacillus subtilis levanaseoperon. J. Bacteriol. 177:6919 – 6927.

35. Martinez B, Tomkins J, Wackett LP, Wing R, Sadowsky MJ. 2001.Complete nucleotide sequence and organization of the atrazine catabolicplasmid pADP-1 from Pseudomonas sp. strain ADP. J. Bacteriol. 183:5684 –5697.

36. Miller JH. 1992. A short course in bacterial genetics: a laboratory manual,p 72–74. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

37. Nash HA, Robertson CA, Flamm E, Weisberg RA, Miller HI. 1987.Overproduction of Escherichia coli integration host factor, a protein withnonidentical subunits. J. Bacteriol. 169:4124 – 4127.

38. Neumann G, et al. 2004. Simultaneous degradation of atrazine and phe-

nol by Pseudomonas sp. ADP: effects of toxicity and adaptation. Appl.Environ. Microbiol. 70:1907–1912.

39. Ninfa AJ, Reitzer LJ, Magasanik B. 1987. Initiation of transcription at thebacterial glnAp2 promoter by purified E. coli components is facilitated byenhancers. Cell 50:1039 –1046.

40. Porrúa O, García-Jaramillo M, Santero E, Govantes F. 2007. The LysR-type regulator AtzR binding site: DNA sequences involved in activation,repression and cyanuric acid-dependent repositioning. Mol. Microbiol.66:410 – 427.

41. Porrúa O, García-González V, Santero E, Shingler V, Govantes F. 2009.Activation and repression of a �N-dependent promoter naturally lackingupstream activation sequences. Mol. Microbiol. 73:419 – 433.

42. Porrúa O, Platero AI, Santero E, Del Solar G, Govantes F. 2010.Complex interplay between the LysR-type regulator AtzR and its bindingsite mediates atzDEF activation in response to two distinct signals. Mol.Microbiol. 76:331–347.

43. Porter SC, North AK, Wedel AB, Kustu S. 1993. Oligomerization ofNTRC at the glnA enhancer is required for transcriptional activation.Genes Dev. 7:2258 –2273.

44. Reitzer LJ, Magasanik B. 1986. Transcription of glnA in E. coli is stimu-lated by activator bound to sites far from the promoter. Cell 45:785–792.

45. Reitzer L, Schneider BL. 2001. Metabolic context and possible physio-logical themes of �54-dependent genes in Escherichia coli. Microbiol. Mol.Biol. Rev. 65:422– 444.

46. Sambrook J, Russell DW, Russell D. 2000. Molecular cloning, a laboratorymanual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

47. Schell MA. 1993. Molecular biology of the LysR family of transcriptionalregulators. Annu. Rev. Microbiol. 47:597– 626.

48. Shiomi N, et al. 2006. Degradation of cyanuric acid in soil by Pseudomo-nas sp. NRRL B-12227 using bioremediation with self-immobilizationsystem. J. Biosci. Bioeng. 102:206 –209.

49. Studholme DJ, Dixon R. 2003. Domain architectures of �54-dependenttranscriptional activators. J. Bacteriol. 185:1757–1767.

50. Tropel D, van der Meer JR. 2004. Bacterial transcriptional regulators fordegradation pathways of aromatic compounds. Microbiol. Mol. Biol. Rev.68:474 –500.

51. Wackett LP, Sadowsky MJ, Martinez B, Shapir N. 2002. Biodegradationof atrazine and related s-triazine compounds: from enzymes to field stud-ies. Appl. Microbiol. Biotechnol. 58:39 – 45.

52. Wang YP, et al. 1998. CRP interacts with promoter-bound �54 RNApolymerase and blocks transcriptional activation of the dctA promoter.EMBO J. 17:786 –796.

53. Wu SQ, Chai W, Lin JT, Stewart V. 1999. General nitrogen regulation ofnitrate assimilation regulatory gene nasR expression in Klebsiella oxytocaM5al. J. Bacteriol. 181:7274 –7284.

54. Yanze-Kontchou C, Gschwind N. 1994. Mineralization of the herbicideatrazine as a carbon source by a Pseudomonas strain. Appl. Environ. Mi-crobiol. 60:4297– 4302.

55. Zimmer DP, et al. 2000. Nitrogen regulatory protein C-controlled genesof Escherichia coli: scavenging as a defense against nitrogen limitation.Proc. Natl. Acad. Sci. U. S. A. 97:14674 –14679.

Regulation of the Pseudomonas sp. ADP atzRSTUVW Operon

December 2012 Volume 194 Number 23 jb.asm.org 6573

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

b on

27

Janu

ary

2022

by

182.

155.

225.

219.