transcriptional regulation of g-protein cyi subunit genes in llc

THE JOURNAL OF BIOLOGICAL CHEMISTRY (0 1993 by The American Society for Biochemistry and Molecular Biology, Inc

VOl. 268, NO. 6, Issue of February 25, pp. 3964-3975,1993 Printed in U. S. A.

Transcriptional Regulation of G-protein cyi Subunit Genes in LLC-PK1 Renal Cells and Characterization of the Porcine GQi-3 Gene Promoter*

(Received for publication, March 20, 1992)

Eliezer J. Holtzman, T. Bernard Kinane, Kenneth West, Brian W. Soper, Helen Karga, Dennis A. Ausiello, and Louis Ercolaniz From the Renal Unit and Department of Medicine, Massachusetts General Hospital and Harvard Medical School, Boston. Massachusetts 021 14

Heterotrimeric guanine nucleotide-binding proteins (G-proteins) function as signal transducers for a variety of hormone-coupled enzyme and ion transport sys- tems in eukaryotic cells. The expression of pertussis toxin-sensitive G-proteins (Gi) which couple their cog- nate receptors and effectors are regulated by cell cycle- dependent events in porcine LLC-PK1 renal epithelial cells. Gai-2 and Gai-3 isoforms are detected in these cells, and like G ~ I - ~ (Holtzman, E. J., Soper, B. W., Stow, L. L., Ausiello, D. A., and Ercolani, L. (1991) J. Biol. Chem. 266, 1763-1771), we now demonstrate that Gai.3 mRNA and protein is coordinately expressed in these cells during differentiation. To gain further in- sights into these events, the porcine Gai.3 gene minimal promoter was characterized and found 67 base pairs upstream from the major transcription start site. The 56-base pair minimal promoter lacked TATAAA and GC boxes but did contain a sequence GGAAGTG conserved in both the human and porcine gene that could potentially bind an adenovirus E4TF1 transcription factor. In cells stably transfected with Gai.z or Gai-3 gene 5’-flanking sequences fused to firefly luciferase cDNA reporter, temporal 10-15-fold transcriptional activation of both genes occurred before cellular polarization. Utilizing mobility shift assays which compared nuclear extracts from cells before and after cell polarization, a motif in the 5‘ region of the gene promoter GTACTTCCGCT was identified that bound an induced nuclear protein complex during transcriptional activation. In polarized cells complemented with the human glucocorticoid receptor, dexamethasone de- creased Gai.2 but increased Gai.3 basal transcription and mRNA content 3-fold. These studies demonstrate that both Gai genes are dynamically regulated in LLC- P K I cells by both growth, differentiation, and hormone signals.

Heterotrimeric guanine nucleotide-binding proteins (G-

* This work was supported by National Institutes of Health Grant DK 42543 and by Grant 13-553-890 from the American Heart Asso- ciation. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “aduertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) L W i J l / .

$ To whom all correspondence should be addressed Renal Unit, 8th Floor, Massachusetts General Hospital East, 149 13th St., Charl- estown, MA 02129. Tel.: 617-726-5666; Fax: 617-726-5669.

proteins)’ play an essential role in transmembrane signaling by coupling receptors with enzyme and ion transport processes in mammalian cells (1). These regulatory proteins are com- posed of individual a, @, and y subunits that are encoded by super gene families that have been conserved by eukaryotes throughout evolution (2). Most of the transducing activities of G-proteins in mammalian cells are associated with the state of activation of the a subunit, which is involved in GDP/GTP exchange and GTP hydrolysis. This cycle is induced by ligand- receptor interactions with the heterotrimeric G protein resulting in disassociation of the activated a subunit from its Py subunit (3). A variety of studies have suggested that both the isoform and concentration of G-proteins in a cell can dictate its pattern of physiological responses, including second messenger generation, ion channel activity, enzyme activation, and membrane protein trafficking (4). We have previously utilized the polarized renal epithelial cells LLC-PK1 and A6 as models to study G-protein-regulated function. These studies indicated that renal epithelia express pertussis toxin-sensitive G-proteins (Gi), which are involved in the regulation of hormone-stimulated adenylyl cyclase ( 5 ) , amiloride-sensitive sodium transport (6), and constitutive proteoglycan secretion through the Golgi complex ( 7 ) . In LLC-PKI and A-6 renal cells, the Gi.3 isoform is found in Golgi and apical membranes whereas the Gi.2 isoform is found at the basolateral membrane consistent with the location of their physiological effects (8, 9). In rat kidney there is also cell- specific expression and topological segregation of these isoforms in various nephron segments (10).

Recent studies in other mammalian tissues indicate the expression of several G-protein a subunit isoforms are modulated by hormones (11-13), cytokines (14), second messengers (15), growth factors (16), and developmental influences (17-20). In both Dictyostelium (21-23) and Drosophila (24), differentiation events are dependent on G-protein a subunit expression. Hence, it seems probable that the modulation of the transcription of G-proteins, particularly Gai subunits, may be important in the overall modulation of growth, development of polarity, and physiological responses seen in epithelia. Indeed, Gi modulation of signal transduction in LLC- PK1 cells are influenced by cell cycle events (25). Such findings suggest that during renal epithelial cell differentiation alterations in hormone responsiveness may reflect the variable expression of G-protein isoforms similar to that described in other cell types. We confirmed this possibility by docu- menting the differentiation-dependent expression of the

The abbreviations used are: G-proteins, guanine nucleotide-binding proteins; bp, base pair(s); kh, kilobase pair(s); NPT, neomycin phosphotransferase; MOPS, 4-morpholineethanesulfonic acid; CHES, 2-(cyclohexy1amino)ethanesulfonic acid GRE, growth response element.

3964

Regulation of the G-protein Subunit Gene 3965

G c Y ~ . ~ subunit in LLC-PK, cells. T o further examine these processes, we isolated the species-specific genomic DNA segments encoding the G L Y ~ . ~ gene, characterized its promoter, and documented the ability of dexamethasone to directly inhibit G N ~ . ~ gene transcription (26). In the present study, we find a differentiation-dependent expression of Gai.3 messenger RNA and protein during the development of epithelial cell polarity similar to that for the Gai.2 subunit, suggesting that the G C Y ~ . ~ gene is also transcriptionally regulated. T o understand the developmental expression of the Gai.3 subunit LLC-PKI cells and its potential transcriptional regulation, we isolated the species-specific genomic DNA segments encoding this gene and characterized its promoter in renal epithelial cells. Utilizing mobility shift assays which compared nuclear extracts from cells before and after polarization, a motif in the 5’ region of the gene promoter GTACTTCCGCT was identified that bound an induced nuclear protein complex during transcriptional activation. We now directly demonstrate in these cells that both Gai.* and G L Y ~ . ~ genes are transcriptionally activated in a coordinated manner during differentiation but differ in response to glucocorticoids, a physiologically relevant hormone in the Gai.3 modulation of amiloride-sensitive sodium transport.

EXPERIMENTAL PROCEDURES

Cell Culture

LLC-PK, cells, a polarized epithelial cell line derived from pig kidney, were grown as confluent monolayers and maintained in Dulhecco’s modified Eagle’s medium containing 10% fetal calf serum in 5% CO, atmosphere as previously described (5). Cells were plated at a density of 1 X 106/10 cm2 and were used for the following experiments at days 1 through 10 after plating. For hormonal studies 0.1% fetal calf serum was used.

RNA Gel Blots

Poly(A)’ RNA from LLC-PK, cells was separated by electrophoresis in 1.0% formaldehyde/agarose gels and then transferred to Genescreen Plus membranes (Du Pont-New England Nuclear. Mem- branes were prehyhridized for 2 h a t 42 “C in the presence of 1% SDS, 1 M NaC1, 10% dextran sulfate, and 50% deionized formamide. Hybridization was performed under similar conditions for 24 h in the presence of a full-length rat olfactory Gcui.2 cDNA or a full-length rat olfactory Ga.3 cDNA (27) (kindly provided by R. Reed, Johns Hop- kins University) probe labeled with [a-”P]ATP by priming with random hexamers followed by extension of these primers with the Klenow fragment of DNA polymerase. After hybridization, membranes were washed twice for 30 min each in: 0.3 M NaCl, 0.03 M sodium citrate a t 23 “C; then the same buffer with 1% SDS at 65 “C; followed by 15 mM NaCI, 1.5 mM sodium citrate at 65 “C.

Isolation of Porcine Genomic Clones Encoding the G-protein Subunit Gene

Full-length EcoRI (3072 bp) and 5’ EcoRI-ScaI (227 bp) rat olfactory Gni.:, cDNA fragments were labeled with [o~-~’P]ATP by priming with random hexamers followed by extension of these primers with the Klenow fragment of DNA polymerase. These fragments were used to screen 1.5 X lo6 recombinant plaques of an EMBL-3 adult porcine genomic library (Clontech). Plaques hybridizing to both fragments were isolated by limiting dilution and were rescreened until purity. Two positive clones (T31 and T32) were obtained and were subjected to restriction endonuclease mapping and Southern blot analysis. The purified SalI-liberated inserts from these clones were subcloned into Bluescript IIKS+ (Stratagene) and used for nucleotide sequencing analysis, further restriction enzyme analysis, subcloning, and expression studies as described below.

Nucleic Acid Sequencing Oligonucleotide primers 17-18 nucleotides in length were synthe-

sized on an automated Pharmacia Gene Assembler Plus synthesizer. Sequencing of double-stranded templates were performed on both strands as previously described (28) except for the substitution of T7

polymerase as the DNA polymerase and of 7-deaza-dGTP for dGTP. Overlapping sequences were assembled and analyzed using University of Wisconsin Genetics Group Software (29).

Cellular Transfections Plasmid Construction-For identification of promoter activity,

poLUC (a promoterless plasmid containing a firefly luciferase reporter gene (30)) (a gift of A. Brasier and J. Hahener, Massachusetts General Hospital) was utilized as an expression vector (31). The SacII-Sac11 (4 kb) 5”flanking sequences from clones T31 and NcoI- SacII (0.5 kh) from the same clone were suhcloned into poLUC as SacII (LUC) and NcoI (LUC), respectively, in both orientations. Nested deletions of the putative 5”flanking regions of the plasmid SacII (LUC) were made by excision of discrete DNA segments with site-specific restriction enzymes or by amplifying the putative 5’- flanking DNA segment of the plasmid with sequence-specific primers by polymerase chain reaction (Perkin-Elmer Cetus) and ligation to poLUC. Upstream primers: (A), 5’-(CGCGGATCCGTACTTCCGC TTTCGGT)-3’; B, 5”(CGCGGATCCAGCCAGAAAGGTCCGCG)- 3’; C, 5’-(CGCGGATCCTCGCCGGAAGTGCGTG)-3’; D, 5”(CGC GGATCCTATCCGGTTCCTTCGGG)-3’; E, 5”(CGCGGATCCCC GGGGGCTGACGGAGA)-3’. Downstream primer: F, 5’-(CCCGA

Plasmids containing these DNA segments were confirmed by nucleic acid sequencing.

Transient Transfections-Plasmids were transfected in equimolar amounts into LLC-PK, cells by the calcium phosphate precipitation (32) Optimum transfection efficiency was obtained by the addition of 20 pg of total plasmid DNA/55-cm2 p10 plate (Falcon) followed by incubation for 20 h without glycerol shock. When required this amount of DNA was achieved by the addition of “carrier plasmid Bluescript I1 KS+. A minimum of nine transfections/poLUC construct was performed. Transfection efficiency was normalized by cotransfection with 2.5 pg of pSV2Apap, a plasmid carrying a human placental alkaline phosphatase reporter gene driven by a Rous sarcoma virus promoter (generously provided by T. Kadesch, University of Pennsylvania) (33). In additional studies, cells were also transfected with the following plasmids: pRShGRcu, an eukaryotic expression plasmid containing 3.0 kh of the human glucocorticoid receptor cDNA driven by a Rous sarcoma virus long terminal repeat promoter (generously provided by R. Evans, Salk Institute) (34).

Stable Transfections-LLC-PK1 cells were cotransfected by the calcium phosphate precipitation method with 1 pg of pRMH140, a plasmid carrying a neomycin phosphotransferase I1 (NPTII) gene (35) and 10 pg of SacII (LUC) or 10 fig of 13-2 LUC, a plasmid containing 11 kh of the porcine G-protein Gai., subunit gene 5’ flank (26). Cells containing stably integrated plasmids were selected by resistance to 1.5 mg/ml geneticin (G418) (GIBCO).

AGCTTCCGCGGAGACTGCGGCT)-3’.

Transfection Assays Forty eight h after transfection, LLC-PK, cells were washed twice

in phosphate-buffered saline (without calcium or magnesium) and then lysed by addition of 1.0 ml of buffer A (1% Triton, 25 mM glycylglycine, pH 7.8, 15 mM MgSO,, 4 mM EGTA, and 1 mM fresh dithiothreitol). Scraped lysates were transferred to Eppendorf micro- fuge tubes and centrifuged at 10,000 X g for 5 min at 4 “C. The supernatants were transferred to fresh Eppendorf tubes and briefly vortexed prior to each assay.

Firefly Luciferase and Human Placental Alkaline Phosphatase As- says-The assays were performed as previously described (26). Re- sults are expressed as percent increase * S.E. in luciferase activity of constructs versus poLUC, normalized for heat-insensitive alkaline phosphatase activity. Data was analyzed by paired Students t test.

Neomycin Phosphotramferase I I (NPTII) Assay-This assay was performed by the enzyme-linked immunosorbant assay of Platt and Yang (36) as described by the manufacturer (5’ + 3 ’ , West Chester, PA).

Protein Assay-This was performed by the dye binding assay of Bradford (37) as described by the manufacturer (Bio-Rad).

SI Nuclease Protection and Primer Extension Assays 32P-Labeled cRNA probes were made by the SP6 and T7 RNA

polymerase (Riboprobe” System, Promega) as described by the manufacturer.

DNA Templates-SalI-XbaI (LUC) minus, contained the SalI- XbaI fragment of insert T31 (which encompassed approximately 4.5 kb of putative 5”flanking segment, exon I, and an early portion of

3966 Regulation of the G-protein Subunit Gene

intron A in the porcine Grr,.:, gene) ligated to poLUC in the antisense orientation. SalI-XbaI (LUC) minus was linearized before the inser- tion site of the firefly luciferase cDNA by Hindi11 digestion.

Pn,., ex 1 which encompassed 126 bp of the exon 1 coding region of the porcine Gwtj gene was created by amplifying porcine genomic DNA with sequence-specific primers by polymerase chain reaction and directional ligation of the EcoRI-RamHI-digested fragment to pGem7ZF (Promega). Upstream primer, 5"GATGAATTC- CCGCCGCCATGGGCTGCACTG-3'. Downstream primer, 5'- CGTGGATCCAAGTAGCAGCAGCTTCACTTC-3'. The plasmid was linearized with EcoRI and extended with SP6 polymerase to produce a 171-nucleotide cRNA probe.

hGR-308 which encompassed 308 bp of the coding region of the human n-glucocorticoid receptor starting with the initiator codon was creat.ed by amplifying pRShGRn with sequence-specific primers by polymerase chain reaction and directional ligation of the EcoRI- HamHI-digested fragment to pGem7ZF. Upstream primer, 5'- GATGAATTCATGGACTCCAAAGAATCATTA-3'. Downstream primer, 5'-CGTGGATCCCCCAGGTCATTTCCCATCACT-3'. The plasmid was linearized with EcoRI and extended with SP6 polymerase to produce a 353-nucleotide cRNA probe.

Sl Nuclease Assays-Assays were performed as previously described (26). Approximately 150 ng of riboprobe (-2 X IO6 cpm) purified by Sephadex G-50 chromatography was mixed with either: 1) 25 pg of RNA from non-transfected LLC-PK, cells, 2) 20 pg of calf liver tRNA, or 3) 25 pg of RNA from LLC-PK, cells transfected with the Sac11 (LUC) or hGR. The mixture was lyophilized, resuspended in 80% formamide 0.4 M NaC1, 1 mM EDTA, and 40 mM MOPS, pH 7.0, boiled for 5 min, and allowed to hybridize a t 65 "C for 3 h. After hybridization, 250 mM NaC1, 50 mM sodium acetate, pH 4.5, 3 mM ZnS04, and 200 units of SI nucleus (Boehringer Mannheim) were added followed by incubation at 45 "C for 30 min. The nucleic acids in this solution were ethanol precipitated and resuspended in 25% formamide 5 mM EDTA, 0.1% bromphenol blue, and 0.1% xylene cyanol. These samples and a "P end-labeled Hue111 ladder of 6x174 RF (New England Biolabs) were electrophoresed on G or 8% acrylamide, 8 M urea gels.

Primer Extension Assays-mRNAs from non-transfected LLC- PKl cells and from cells transiently transfected with Sac11 (LUC) were isolated. Identification of the start sites of mRNA transcripts was determined by annealing 10 Fg of mRNA from these cells with a '"P end-labeled 26-mer oligonucleotide primer complementary to the coding legion of porcine G c Y ~ . ~ mRNA (5"GCGGTCGAT- CATCTTGCTCCGTTCCA-3') or a 20-mer oligonucleotide primer complementary to firefly luciferase mRNA (5"TCGTTGACGT- ATTCCGATAC-3'), respectively. The RNA-DNA duplexes were extended in the presence of reverse transcriptase and digested with Sl nuclease as previously described (28). The extension products were extracted w.ith phenol-chloroform, ethanol precipitated, and resuspended in 25% formamide 5 mM EDTA, 0.1% bromphenol blue, and 0.1% xylene cyanol. These samples and a 32P end-labeled Hue111 ladder of 6x174 RF (New England Biolabs) were electrophoresed on 6 or 8% acrylamide, 8 M urea gels.

Mobility Shift Assays

Nuclear Extracts Preparation-Nuclei were isolated from LLC- PK, cells 24 and 144 h after plating. Nuclear proteins were extracted as described by Saatcioglu et al. (69).

Binding Assays-6 mg of nuclear extract was preincubated for 30 min in the presence of 4-6 mg of poly(d1-dC), 140 mM KC1, 9% glycerol, 18 mM Tris, pH 7.3, and 1 mM EDTA at 4 "C. Binding reactions were begun by the addition of '"P end-labeled double- stranded DNA. Complexes were separated on 5.6% polyacrylamide gel with (89 mM Tris-borate, 89 mM boric acid, 2 mM EDTA) buffer (TBE) at 0.2 X concentration with 3% glycerol. The electrophoresis was carried out at 10 V/cm for 3-5 h in 0.2 X TBE buffer a t 4 "C.

ADP-ribosylation and Immunoblotting of Membrane Gi Membrane Preparation-LLC-PK1 cells were washed with phos-

phate-buffered saline, pH 7.4, at 4 "C and scraped into buffer A (1 mM EGTA and 5 mM Tris-HCI, pH 7.4) at 4 "C. The suspension was disrupted by Dounce homogenizer. Cell hreakage was monitored by inverted phase microscopy of the suspension. The homogenate was spun at 50 X g for 10 min to remove nuclei and then respun a t 10,000 x 6. The pellet was resuspended in buffer A and maintained at 4 "C p r ~ o r to experiments.

PII'X-catalyzed ~'2PIADP-ribosylation-This was performed on

isolated LLC-PK1 membranes (20 pg of protein) as described by Ribeiro-Neto et al. (38). Ribosylation products were resuspended in 30 pl of solubilization buffer B (0.05 M CHES, 2% SDS, 10% glycerol, 2% bromphenol blue at pH 9.5) and boiled for 10 min. The solubilized products were resolved by stepwise two-dimensional polyacrylamide gel electrophoresis as described by Goldsmith et al. (39): first dimension with ampholytes 1:l ampholine, pH 3.5-10, and 2D-Pharmalyte, pH 3-10, second dimension 10-20% gradient SDS-polyacrylamide electrophoresis. The predicted PI of non-phosphorylated Gai.n and GLY,.~ are 5.19 and 5.46, respectively.

Irnmunoblotting-Proteins in the membrane and cytosol fractions were solubilized by boiling in sample buffer (1% SDS, 30 mM Tris, pH 6.8, 12% glycerol) and loaded onto a 10% Laemmli acrylamide gel with 150 pg of protein loaded/lane. Following SDS-polyacrylamide gel electrophoresis, proteins were transferred onto Immobilon membrane (Millipore), and the membrane was then stained with Coo- massie Blue to ensure that all lanes contained equivalent amounts of transferred protein. The destained membrane was then blocked in blotting buffer (5% non-fat dry milk in 20 mM Tris, pH 7.4, with 0.15 M NaCl and 1% Triton X-loo), incubated with EC antiserum which detects the Gn1.3 carboxyl terminus (Du Pont-New England Nuclear) diluted 1/1000 in blotting buffer and washed. EC-bound proteins were reacted with an enhanced chemiluminescent detection system as described by the manufacturer (Amersham Corp.) followed by autoradiography.

Autoradiography

For Northern blotting, S I nuclease, primer extension, ADP-ribosylation, and mobility shift studies, the dried gels were autoradi- ographed with Kodak XAR film a t -80 "C for 0.5-96 h with Cronex Lightning Plus intensifying screens (Du Pont). Quantification of hybridization signals was performed by densitometry of the autoradiograms with an LKB ultroscan XL enhanced laser densitometer (Pharmacia LKB Biotechnology Inc.) or by scintillation counting of excised radiographic bands.

RESULTS

Induction of GO^;.^ mRNA and Protein during LLC-PKl Cell Differentiation-Our previous studies demonstrated that isoforms for Gai.z and Gac3 (but not G ai.l) subunits are found in polarized LLC-PKI cells (8). During culture, LLC-PK1 cells differentiate from a rounded cell type to a fully polarized epithelium. This phenotypic change coincides with the induction of Gq.* mRNA and the appearance of the G a i ~ subunit at the basolateral membrane of cells achieving polarization. The disappearance of this transcript and membrane-associated protein also coincides in cells following prolonged culture. The kinetics of this process was entirely dependent on the number of trypsinized cells seeded in these cultures. An increased initial cell density hastened the onset of polarization (culture days 2-3) and the induction of Gai.z mRNA and protein whereas a lowered initial cell density delayed both polarization (culture days 4-6) and GO(^.^ induction (data not shown). To determine if a similar pattern occurred for Gai.3, the content of this transcript was determined in LLC-PK1 cells. As seen in Fig. 1, following hybridization with a rodent Gaj.? full-length cDNA probe, a 2.6-kb mRNA species was detected following a 72-h radiographic exposure (Fig. 1, lane a) . Similar hybridization with a rodent Gc~i.~ full-length cDNA probe detected an extremely low abundance 3.8-kb mRNA species of equivalent intensity after a 10-day radiographic exposure (Fig. 1, lane b) . Comparison of Gai-s (Fig. 1, lane c ) and Gai., (Fig. 1, lane d ) mRNA indicated the latter transcript was 50-fold less abundant by quantitative slot blotting. There- fore, to examine Gai.a mRNA expression in LLC-PKl cells during culture, a species-specific cRNA probe (Pai., ex 1) was utilized to quantify this low abundance mRNA transcript by solution hybridization and resistance to S I nuclease digestion. As seen in Fig. 2 , Gai.3 mRNA transcripts were detected 24 h following trypsinization of cells which increased maximally by 36 h and then fell progressively to undetectable levels by

Regulation of the G-protein a i -3 Subunit Gene 3967

ai-2 ai-3

4 a r 1

28s

18s “b

a b C d FIG. 1. Gel blot analysis of LLC-PKI cells poly A+ mRNA.

A GeneScreen Plus membrane containing 5 pg of size fractionated (left hand panel) or unfractionated (right hand panel) poly(A)+ RNA lrom LLC-PK, cells was hybridized with a full-length rat olfactory (& cDNA (lanes a and c) or a full-length rat G W . ~ probe (lanes b and d) . A 2.6-kilobase Gni.2 mRNA species was detected following a 72 radiographic exposure as seen in lane a. A 3.8-kilobase Gai.3 species of equivalent intensity was detected after a 10-day radiographic exposure in lane b. Following equivalent 72-h exposures, the relative intensity of Gn i.2 mRNA (lane c) was 50-fold greater than Gni.3 mRNA (lane d) .

DAYS OF CULTURE

0 1 1 . 5 2 3 4 6 8 FIG. 2. SI nuclease analysis of mRNA from LLC-PKI cells

harvested following trypsinization and culture days 1-8. Quiescent LLC-PK, cells from day 10 of culture were trypsinized and cultured for successive days. Gw.3 RNA from each of these cultures was quantitated as described under “Experimental Procedures” using a uniformly labeled [:’2P]cRNA probe derived from Pw.3 ex 1. RNA duplexes were subjected to SI nuclease digestion. The resultant 126- nucleotide protected fragments were fractionated. Composite autoradiograms from an acrylamide gel of these protected fragments following cell trypsinization (day 0) and cell culture days 1-8 are seen in the panel.

day 10 of culture. These findings are consistent with the transcriptional activation of t h e G C Y ~ . ~ gene during the differentiation of renal LLC-PK, cells from non-polarized to a polarized phenotype.

We previously demonstrated that G w - ~ and Gi.3 proteins were predominantly found in plasma and Golgi membranes, respectively, by immunofluoresent microscopy (8). Immuno- blotting of LLC-PK, membranes and cytosol confirmed their membrane association even after selective overexpression of each subunit (8). We simultaneously quantified these proteins in cells a t days 1-10 after plating by pertussis toxin [“PI ADP-ribosylation followed by two-dimensional analysis of the labeled products (Fig. 3). Gi proteins were not detectable immediately after plating (Fig. 3a). However, by days 3-4 when the cells became initially polarized, Gai-2 and the less acidic Gw., isoform were easily detected (Fig. 36). On later days 6-10 (Fig. 3, c-e) the membrane content for both isoforms began to disappear even though the cell monolayers remained fully polarized. As these studies only identify a i subunits in the G-protein holoenzyme, the obligatory substrate for pertussis toxin, we examined whether the expression of the isolated Gni.3 subunit was similar in immunoblots of these membranes utilizing EC antisera specific for this protein. As seen in Fig. 4, a similar pattern for G w . ~ subunit expression was observed. Thus the presence of membrane-associated G W . ~ protein and the expression of its mRNA transcript coincide at various points during cell differentiation in these LLC-PKI cultures in a manner similar to proteins, as

4 C I Ir - ” . I

e ’ I I 1

PH 5.0 6.0

FIG. 3. ADP-ribosylation of LLC-PKl cell membranes from cells harvested following trypsinization and culture days 3- 10. Quiescent LLC-PK, cells from day 10 of culture were trypsinized (day 0) and cultured for successive days. ADP-ribosylation of membranes from each of these cultures was performed to compare the relative amounts of Gi proteins present. Each lane represents 20 pg of membrane protein quantitated for Gi by resolving ribosylated reaction products by sequential isoelectric focusing followed by size fractionation as described under “Experimental Procedures.” The PI of Gni.2 and Goi.$ are 5.19 and 5.46, respectively. Autoradiograms of these gels after 72 h of exposure barely detect products (-40-41 kDa) for day 0 cell membranes (panel a). By day 3 there is an induction of these products (panel b) , which then fall progressively on day 6 (panel c ) , day 8 (panel d ) , and day 10 (panel e) .

we have previously shown (26). Isolation of Porcine Genomic Clones Encoding the Gai.3 Gene

and Sequence Comparison to the Human Homologue-To further understand the molecular basis for the regulation of Gw.3 gene in renal LLC-PK, cells, a porcine EMBL-3 genomic library was screened with EcoRI (3072 bp) and 5’ EcoRI-ScaI (227 bp) rat olfactory Gai.s cDNA 32P-labeled fragments to obtain species-specific DNA segments encoding the putative gene promoter. The inserts of two phage (T31 and T32) that

3968 Regulation of the G-protein ais3 Subunit Gene

hybridized with these fragments encoded a putative exon 1, a variable length of 5”flanking sequence, and a first intron (Fig. 5). Limited sequencing of the 5’-flanking area from clone T31 revealed a GC content of 60% with 49 CpG uersus 69 GpC dinucleotides. As seen in Fig. 6, two repeats AGAAATTCCC were found in positions 339-348 and 352- 361. No TATAA box was found. However two potential CAAT box sequences and two GC boxes (CCGCCC or GGGCGG) that could potentially bind an SP1 transcription factor were identified. A sequence 92% similar to the known consensus sequence glucocorticoid responsive element (GRE) was found in positions 225-236. E2A- and E4-binding consensus sequences were also identified. Sequences compatible with binding sites for other known DNA transcription factors were not found (40,41).

The porcine exon 1-coding sequence differed by eight conservative nucleotide substitutions from the human genomic and r a t Gw.~ cDNA sequences which did not alter its amino acid composition. Sequence comparison of the nucleotide sequence of clone “31 upstream to the translation start site revealed 75.9% identity to the human Gw-3 subunit gene (850- bp overlap) (42) and 78% identity to the rat olfactory Gai.3 mRNA (90-bp overlap). No significant sequence identity was found between the 5”flanking area of the porcine G c Y ~ . ~ gene and other genes.

Identification of the Porcine GLY;.~ Transcription Start Site- The transcription start site of porcine Gai.3 gene was identified by SI nuclease protection and primer extension assays. RNA duplexes between LLC-PKI RNA and a uniformly 32P- labeled cRNA probe derived from SdI-XbaI (LUC) minus encompassing the 5‘ flank, coding area of exon 1, and part of intron A of the Gw.3 gene were subjected to SI nuclease digestion as seen in Fig. 7. The resulting protected fragments seen in Fig. 7, lane a, included a major band of 225 nucleotides and at least two minor protected fragments of 200 and 250

DAYS OF CULTURE

0 1.5 3 5 8

FIG. 4. Immunoblot of LLC-PKI cell membranes harvested from cells following trypsinization and culture days 1-8. Quiescent LLC-PK1 cells from day 10 of culture were trypsinized (day 0 ) and cultured for successive days. Immunoblotting of membranes from each of these cultures was performed to compare the relative amounts of Gw.:) protein present. Each lane represents 100 pg of membrane protein quantitated as described under “Experimental Procedures” using a peptide antibody (EC) specifically recognizes the Gw.:% subunit in this cell type. Composite autoradiograms of this protein from the same acylamide gel (-41 kDa) show its induction following culture (days 1.5-3) followed by its decay in culture (days 5-8) as seen in the panel.

FIG. 5. Structure and restriction map of porcine genomic clones par-

nucleotides, respectively, which were compatible with transcription start sites in the first exon of the G3.R gene. These findings suggested the major Gai.3 mRNA 5“untranslated region to be approximately 105 nucleotides with minor species of 80 or 130 nucleotides in LLC PKI cells. Primer extension studies indicated a similar predicted major transcription start. A major band of 175 nucleotides was detected from which only 112 nucleotides of the 5”untranslated region was derived (Fig. 7, lane c ) .

Identification of the Gene Promoter-To determine the regulatory sequences of the Gai.3 gene necessary for transcription the SQCII-Sad1 (4 kb) and NcoI-Sad1 (0.5 kb) inserts of clone T31 (which lack the 3‘ portion of exon 1 and intron A) were ligated in both orientations to a promoterless plasmid, poLUC. These plasmids were transiently transfected into LLC-PKI cells that were 25-3096 confluent and thus would be likely to have maximal transcription of the Gai.3 gene based on our previous RNA studies. Only transfectants with the 0.5 and 4 kb of putative 5”flanking sequence in the sense orientation displayed a significant increase in luciferase activity as compared with cells transfected with poLUC or antisense plasmids (Table I ) . These data suggested that clones T31 and T32 contained an orientation specific promoter for the gene.

RNA was extracted from S d I (LUC)-transfected cells to confirm tha t t he Gw.~ gene promoter was responsible for the correct initiation of firefly luciferase mRNA. RNA duplexes between luciferase mRNA and the cRNA probe described above were subjected to SI nuclease digestion. Four protected fragments were found. Major and minor bands compatible with three protected fragments of native Gai.3 mRNA were identified (Fig. 7, lanes d and e ) . However, a new band of 57 nucleotides was also seen consistent with the Gai.3 promoter- driven transcription of the firefly luciferase gene from the Sad1 (LUC) plasmid also seen (Fig. 7, lane e ) . These data confirmed that the T31 and T32 clones encoded the porcine Gai.3 promoter.

Characterization of the Gai.3 Gene Promoter-To determine the precise location of the gene promoter, 5‘ deletion constructs of Sad1 (LUC) were created as seen in Fig. 8, panel A. Unique BamHI, NcoI, A p d , XhoI, and AccI restriction sites in this plasmid were utilized to generate successively greater deletions. The XhoI (LUC) construct which deleted four kilobases of 5‘ flank containing two CAAT box sequences still had comparable luciferase activity when compared to Sac11 (LUC). However, the AccI (LUC) construct which deleted the remaining 250 bp of 5“flanking sequence reduced luciferase activity to base line, thereby demarcating the promoter to this segment. Successive fine deletions were made 3‘ to the XhoI site to define the minimal promoter (unnum- bered arrows, Fig. 8, panel A ) . As seen in Fig. 8, panel B, based on four successive 25-base pair deletions in this area which lowered luciferase activity from 26-fold above poLUC

tially encoding ;he Gai.s gene. T w o - - - EMRL-3 clones contained overlapping genomic segments. Open boxes indicate the putative position of exon 1 as determined by nucleotide sequencing and T-32 : Southern blot analysis. Relevant restriction sites for subcloning are shown.

5 ; g

g I I I I I 0 5.0 10.0 15.0 20.0

KILOBASES

Regulation of the G-protein CY^.^ Subunit Gene 3969

1 GGAATTTTCTGGAGCAACTACACTCTTTATCTTTCAGGTAATTTAAGATC

5 1 TGTTAGCGATTTCACGGTGCCCTTTGCCAACATAGTAGCTGGGCAACTCT 1 [TG A AG

101 CAAGCCCACAGGGTACAGCTAAGAGAAGGAGGCGGTGGGCCAGAG*.GGC 8 AAGG CA GGACAT TT * T A AC

1 4 9 AGAAAGGGATCCATGAAGTCCCAACCATGGCCGATCTTACTTATTTCAGA 57

1 9 9 1 0 6

247 1 5 6

2 95 206

345 2 5 6

3 95 3 0 6

445 343

3 8 6 4 95

545 430

595 479

5 2 9 645

695 5 7 8

7 4 5 628

1

678 795

43

844 725

92

894 175 1 4 1

825 944

1 9 1

994 1044 1 0 9 4

A TT TGC G T G C A T G G 'G c

TGTGGAGCGTGGCCAGGGTCCAGAC..ATAATTCTCACCCTAGCGATGTG AGA AA GC CC AG C GG GC TGTT ATT C TGA

GCTGAGACAACCCTGGCAGAGAAAGTGTTC"TACACACTTGGGCAGGGGCC T T CAA G GC C CA CT G TA T

CCAGATCGTCACAGCCAGAGTTCAGATGGGCTTTCTGGCCAGTGAGAAAT GAG TC A A G A T AG C

TCCCAGCAGAAATTCCCGTGCGGGCTGTGGGGAAITATTTGGGAAGTCCC A TC C A A TT A A A TCT

A C C C C C C C A C G C W C T G A A G C T G G C T A T G T G A C C T C G G G A G G A T G C C T G ............. A A ATCT A G GCATTA

TGAGCTGGAGCAACCAGTCCCTGGCTTTTCTGCATTTATCCAAACAAGGC T -.**... GC G C T C TC T

AGCCGAAAAAAAAGGTGAAAGGGGACTAAGGTCGAGCGGAGCCCGGGGGA ..... A T A C T C A T G C G G * A C

G C T C G A G A G A G C C T C C C C A C T T C A C C A G A A T C G C C G W T C C C A A C A T C A GAA - TG TC C A A AG GC

CCTCTCTCTGTACTTCCGCTTTCGGTTGTGCCTCCCCTACCCCAGCCAGA AGCTC C GTG CTCAA T C TG GAGAG

TG T TAAACGGTG G CT AAGGTCCGCGCAGCAACGGCGCGGGGCGTCGCCGGAAGTGTCGTGWCT

* G Major start site

U CCGGATATCCGGTTCCTTCGGGCGCTCCGGGGGCTGACGGAGAGGGCCG~

T CT A A A A

-AGCAGTAGACGCTGTCTCAGCCGGCCGAGCCGCAGTCTCCGCGGT G A T T T

[ A TGTGT GCGGT C

GTGTTAAGTGAGCCCCGGCCCG.GTCCCCACTCCCGCCGCCGCCATGGGC ... T G T T ' G AG T G T

MetGly

TGCACGTTGAGCGCCGAAGACAAGGCGGCGGTGGAACGGAGCAAGATGAT A G A

G G T CysThrLeuSerAlaGluAspLysAIaAlaValGluArgSerLysMetI~

CGACCGCAACTTGCGGGAGGATGGGGAGAAAGCGGCGAAAGAAGTGAAGC A C A C

C A C eAspArgAsnLeuArgGluAspGlyGluLysA1aAlaLysGluValLysL

TGCTGCTACTTGGTGAGGAGCTGGGGGCGGGGCTTGGCGGAGGTTTCGGG C

G C l 1

euLeuLeuLeuG( Intron A

AGGGCCCAGGCACTCGGGAGCCCTGAGCCGGGAGCCCTGAGCCGGGAGCC CTGAGCCGGGGTCAGACCGGGCCCTCGGAAAGGACCCCGAAGTCTGGAGG CAGTGACGGGCTCAAGGCGGGGTGTGGGGCTGG

:A

:A :B

:A :B

:A :B

:A :B

:A :B

:A :B

:A :B

:A :B

:A :B

:A :B

:A :B

:A :B

:A :B

:A :B

:A :B :C

:A :B :C

:B :C

:D

:A

:D

:A :B :C :D

:A :B :C

:D

:A :A :A

FIG. 6. Sequence of the porcine Gai.3 subunit gene and its immediate 5'-flanking sequences as compared to other sequences. The porcine G N ~ . ~ subunit gene ( A ) and its deduced amino acid sequence of exon 1 (D) were compared to the published sequence of the human Goi.:$ subunit gene (B) of Itoh e t al. (42) and the rat olfactory Gai.:r subunit cDNA (C) of Jones et al. (27). Only nucleotides that are different from sequence A are depicted. A bullet in the sequence (0) indicates a missing base. A broad inuerted arrow above a sequence (3) indicates the major transcription start site in the porcine G(Y;.~ subunit gene cDNA. The underlined sequences indicate potential regulatory sequences including CAAT boxes, GC boxes (CCGCCC), and an adenovirus E4 sequence (GGAAGTG). Rectan- gular brackets ( [ ) indicate the beginning or (1) ending of a known sequence.

to base line and a 91% sequence identity with the human gene, the 56-bp minimal promoter was found 67 bp upstream of the major transcription start site. This segment did not contain a GC box but did contain a sequence GGAAGTG conserved in both the human and porcine gene that could potentially bind an adenovirus E4TF1 transcription factor (40).

Induction of Gn,.3 and Gni.n Subunit Gene Transcription in L,X-PK1 Cells Prior to Differentiation-Our previous mRNA studies suggested that G c Y ~ . ~ and G o I ~ . ~ genes are transcriptionally activated during the differentiation of renal LLC-PKI cells from a non-polarized to a polarized phenotype. TO examine these events directly, LLC-PK1 cells were cotransfected with pRMH140, a plasmid carrying a NPTII gene (35) and 10 pg of SacII (LUC) or 10 pg of 13-2 LUC, a plasmid containing 11 kb of the porcine Gai.? subunit gene 5' flank. Clonal cells containing stably integrated plasmids were selected by continued passage in G418-supplemented media. Following trypsinization and plating, individual clones were then monitored during cell culture as they progressed from sparse rounded cells to a polarized monolayer for cell number, luciferase, and NPTII activity. As seen in Fig. 9, panels b and c, in cells stably transfected with either SacII (LUC) or 13-2 LUC luciferase activity markedly increased during early in different.iation when cells were approximately 20-30% confluent (Fig. 9, panel d) and fell thereafter. Cells that were fully confluent and polarized after prolonged culture days 7- 10 had the lowest levels of gene activity. By contrast, the same cells that were also stably transfected with pRMH140 showed no change in NPTII gene expression during all culture days (Fig. 9, panel a). These data indicate that in renal epithelial cells both G C Y ~ ~ ? and G N ~ . ~ genes are transcriptionally regulated during differentiation.

Identification of a Cis-acting Element in the Gai.3 Promoter That Binds a Nuclear Transcription Complex during Tran- scriptional Activation-To begin to identify the putative sequences required for the differentiation-dependent transcriptional activation of the Gni.3 gene, the progressively deleted DNA segments utilized to delineate the gene promoter were each Iq2P end-labeled. These DNA segments were incubated with nuclear extracts derived from LLC-PK1 cells 24 h after trypsinization (that were non-polarized, undergoing cell divi- sion, and showed maximal transcriptional activation) or from LLC-PK1 cells after 7 days in culture (that were fully confluent, polarized, and had basal transcriptional activity). As seen in Fig. 10, only the first three DNA segments A-F, B-F, and C-F that previously demonstrated transcriptional activity in reporter gene assays of 32, 39, and 26, respectively (Fig. 8, panel B ) demonstrated binding activities with these extracts. Comparison of these extracts revealed a specific induced binding activity from cells 24 h after trypsinization only for the largest DNA segment A-F (Fig. 11). Because the longer A-F segment was only 34 nucleotides longer than the B-F DNA segment that did not show this new binding activity, complementary oligonucleotides corresponding to this area were synthesized to assess whether the sequences contained in them could also bind the putatively induced nuclear protein complex. As seen in Fig. 11 identical specific binding activities could achieved by utilizing only 22 nucleotides of the 5' region of the A-F segment with these nuclear extracts. To determine the exact sequences required for this binding activity, a series of four progressively mutated complementary oligonucleotides were synthesized that differed from the wild type by only two nucleotides. As seen in Fig. 12, only the most 3'-mutated oligonucleotide was able to successfully compete the wild type oligonucleotide for binding. These competition experiments

:1970

FIG. 7. SI nuclease and primer extension analysis of porcine LLC- P K , cell mRNA. RNA was isolated from LLC-PK, cells transfected with or without the plasmid Sac11 (LUC). RNA was quantitated as described under “Ex- perimental Procedures.” Predicted fragments from reactions with a uniformly labeled [:”P]cRNA probe for SI nuclease assays (double headed arrows -) and reactions with a ‘”P-labeled oligonucle- o t ide for primer extension studies (single haded arrow c) are shown in the lower panel. Detected fragments are shown in the upperpanels. SI nuclease assay: lanes n and d, LLC-PK, mRNA; lane b, calf liver tRNA; lane d, mRNA from LLC- I’K, cells transfected with the SacII (LUC) plasmid. Primer extension assay: lane c, LLC-PK, mRNA. Note: molecular mass markers run with lanes a-c are shown on the left, whereas the same markers run with lanes d and e are shown on the right.

Regulation of the G-protein ai.3 Subunit Gene

171 -

255 + 234 -

225 “-c

194 - 200 ”-c

170 +

a b c d e - 234

- 194

- 111)

- ? I

c 55

INTRON A ] DNA SEGMENT

4 ] cRNAPROBE

65 at

255 nt 4-›

225 nt - 200 nt - 170nt } a 1-3 rnm

TABLE I Luciferase activity in LLC-PK, cells transfected with chimeric firefly luciferase genes

Plasmid Length of G R . ~ 5‘ flank No. of trans- 5’ flank

Mean light units ? (S.E.) direction fections normalized to psV2pap

p0LUC 0 15 4,014 f (369)

Nco I (LUC) 0.5 kb + -

12 9

297,945 f (26,682) 4,865 f (465)

Sac I1 (LUC) 4 kb + 14 262,330 f (24,755) - 9 1,089 f (58)

indicated that the motif GTACTTCCGCT contained the requisite “cis sequences” for binding activity that was both constitutive and induced in these nuclear extracts.

Dexamethasone Increases Gene Transcription and G L Y ~ . ~ m R N A Content in Renal Epithelial Cells-We have previously demonstrated that Ge.p gene transcription is inhibited by dexamethasone in glucocorticoid receptor-complemented LLC-PK, renal cells (26). Therefore, to determine whether the Gai.B gene is also regulated by steroids at the level of transcription in renal epithelia, pRShGR and either the plasmid 13-2 (LUC) encoding 11 kb of 5”flanking sequence of the Gai., gene or SacII (LUC) encoding 4 kb of 5’-flanking sequence of the Gai.8 gene or poLUC were transiently cotransfected into LLC-PKI cells to assess their transcription. Trans- fectants were treated with or without IO-* M dexamethasone. As seen in Fig. 13, panel a, lo-’ M dexamethasone had no

effect on poLUC luciferase activity. Go(i.* and Gai.3 luciferase activity in the absence of hormone was equal. However, after addition of steroid to cell cultures, Gai.* luciferase activity fell by 45% ( p c 0.01) while GCYI.~ luciferase activity increased approximately 3-fold ( p < 0.005). These data indicate that in renal epithelia, G c ~ . ~ and Gai.s subunit genes are regulated differently by hormone-activated steroid receptor complexes.

Positive regulation by steroid-receptor complexes may also occur at the level of mRNA stabilization (43). To examine this possibility, a species-specific cRNA probe derived from (Pai.s ex 1) was utilized to quantify the low abundance G L Y ~ . ~ mRNA transcript in these cells by solution hybridization and resistance to SI nuclease digestion. Transfection efficiency for these experiments was determined by the simultaneous quantification of human a-glucocorticoid receptor RNA utilizing a species-specific cRNA probe derived from (hGR-308).

Regulation of the G-protein Subunit Gene

65.4 66.9 74.2 57.4 67.1 0.8 A

3971

5' I EXON 1 3' GRE CAAT

FLANK Gc E4 tm INTRON A

MINOR START SITE MATOR START SITE

m 0.9 0.8 0.7 0.6 0.5 0.4 0.3 0.2 0.1 0

Kilobases

X h O I 81 1 1

1 5 1

32 1 '? B

G G G A G C T C G A G A G A G C C T c c c c A c T T ~ A ~ c A ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ G C T T T C G G T T G T G C ~ T C C ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ :A

1 1 i ~ a j ~ r Start Site

c A T c A GM TG TC c AA AGC GC AGCTC C GTG 26

CTCAA T C TG :B 2 BASELINE

C I I G R h A G G T C C G C G C A ~ A A c ~ ~ . ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ C ~ G G ~ ~ C C T T C G ~ C G C T C C ~ G G ~ T G ~ C ~ ~ G ~ ~ ~ :A ,"___."_"__""_"""."""".."""""""""- u

G GT TAAAAG TG A T GT T C T AA A :B

BASELINE 1

GCCGCCGCCCAGCAGT :A A A :B

1 AccI

FIG. 8. Determination of the gene promoter by deletion analysis of the porcine Ge.3 subunit gene 5' flank. Panel A , serial deletions of plasmid Sac11 (LUC) utilizing depicted restriction sites were transfected into LLC-PK1 cells and examined for luciferase activity. Luciferase activity results shown as numbers above these restriction sites (located by large upward arrows T), are expressed for increases in light units of constructs above poLUC normalized for human placental alkaline phospholipase activity in each of nine individual deletion experiments. Sites for successive fine deletions 3' from the XhoI site are depicted by small upward arrows (f). Abbreviations: GC, Spl-binding site; CAAT, CAAT box; and GRE (glucocorticoid-responsive element) indicate potential regulatory sequences. Panel B , determination of the gene promoter by deletion analysis and by comparison to conserved sequences between the porcine ( A ) and human ( B ) Gai.3 gene of Itoh et al. (42). A broad inverted arrow (1) indicates the major transcription start site in the porcine Gai.s gene. Only nucleotides that are different from the porcine sequence are depicted. Potential regulatory sequences are underlined. Dashed lines bordered by vertical lines ( 1 - - - 1 ) indicate the extent of the minimal promoter. A narrow inverted arrow (1) indicates luciferase activity and the 5' nucleotide position of each deletion construct.

As seen in Fig. 13, panel b, Gai.3 mRNA expression was not altered by lo-' M dexamethasone treatment of LLC-PK1 cells that were not complemented with pRShGRa. However, Gai.3 mRNA content increased approximately 3-fold in cells that were both complemented with this plasmid and treated with dexamethasone. These studies indicate that in renal cells, steroid-receptor complexes increase Gai.3 mRNA content as a direct result of increased gene transcription rather than mRNA stabilization.

DISCUSSION

Previous reports have demonstrated that mRNA and/or protein content for Gai.3 or Gai.z are altered in mammalian tissues during differentiation, by steroid hormones, growth factors, lymphokines, or by second messengers such as cyclic AMP. These reports did not determine whether the expression of these genes might be regulated either at the level of transcription, translation, or both. We now directly demonstrate in renal cells that both Gai.z and Gai.3 genes are transcriptionally activated in a coordinated manner during growth and differentiation and are subsequently repressed to a basal state following the achievement of cell polarity. The activity of these genes was directly reflected in the expression of their gene products during this period. Despite repression of gene expression following cell polarization, basal transcription of these genes could still be modulated but differed in response t o glucocorticoids.

The importance of temporal G-protein a subunit expression during differentiation has been convincingly demonstrated in

lower eukaryotes. In Dictyostelium differentiation is triggered by a cyclic AMP-dependent increase in the transcription of a subunit genes (22). Ga4 null mutants created by gene disrup- tion have aberrant morphologic differentiation, reduced levels of prespore gene expression, and are unable to produce spores (21). In Drosophila gastrulation is impaired for homozygotes with mutations of the concertina gene which encodes a Ga- protein (24). As the gene family encoding Ga-subunits is highly conserved in all eukaryotes, it is likely that mechanisms for their regulation have also been conserved. Indeed, functional studies have suggested there is a selective alteration of Gi subunit levels during differentiation of LLC-PKl cells. Following synchronization of these cells with 5-flurouridine deoxyriboside, Chakraborty et al. (25) have demonstrated calcitonin receptors couple to Gi during the S-phase whereas this coupling could not be demonstrated in quiescent cells during G2-phase implying a selective loss or modification of Gi subunits in these cells. Following the prolonged incubation of quiescent LLC-PKI cells, Weiss et al. (44) have shown that intracellular CAMP levels rise in these cells, which also sug- gests an adaptive loss of inhibitory Gi input on adenylyl cyclase. These functional studies are consistent with our direct findings that Gi isoforms are induced during cell divi- sion prior to polarization and fall to barely detectable levels after the cells remain quiescent for several days in culture.

Our current studies now directly demonstrate that genes encoding Gai isoforms are under dynamic genetic control in renal epithelia during growth and differentiation. The neces- sity of genetic control mechanisms that prevent the strong

G .r(

Regulation of the G-protein ~ i . 3 Subunit Gene

Y Q)

a , o n

b

LC 0

” 0 0 . 5 1 2 3 4 5 6 7 8 9 1 0

0 0 . 5 1 2 3 4 5 6 7 8 9 1 0

0 0 . 5 1 2 3 4 5 6 7 8 9 10

d $ Q)

0 0 . 5 1 2 3 4 5 6 7 8 9 10

DAYS OF CULTURE FIG. 9. Transcription of NPTII, Gai.2, and Gw.3 genes in

LLC-PK, cells during culture. Quiescent LLC-PK, cells stably transfected with pHMH140 and either Sac11 (LUC) or 13-2 LUC

2 3 I

4 5 6 7 8 9 1 0 1 1 12 1

FIG. 10. Mobility shift assays with progressively deleted Gm.3 promoter DNA segments. Nuclear extracts were prepared from LLC-I’K1 cells 24 or 144 h after trysinization and culture. Progressively deleted A-F, B-F, C-F, and D-F DNA segments generated by polymerase chain react,ion as described under “Experimental Procedures” were utilized as probes in the mobility shift assay. Lane I , A-F probe alone; lane 2, A-F with 24-h nuclear extracts (a horizontal arrow + indicates the position of a new binding activity); lane 3, A- F with 144-h nuclear extracts; lan? 4 , B-F probe alone; lane 5, B-F probe with 24-h nuclear extracts; lane 6, B-F with 144-h nuclear extracts; lane 7, C-F probe alone; lane 8, C-F with 24-h nuclear extracts; lane 9, C-F with 144-h nuclear extracts; lane IO, D-F probe alone; lane 11, D-F probe with 24-h nuclear extracts; and lane 12, D- F probe with 144-h nuclear extracts.

constitutive activation of these genes in fully differentiated renal epithelia is suggested by studies of monomeric GTP- binding proteins such as Ha-ras. Mutations in Ha-ras GP21 which decrease its GTPase activity confer oncogenic potential to this protein presumably via persistent modulation of existing cell signaling pathways (45). Comparable mutations from Arg-179 to Cys or His which decrease GTPase activity in Gq., have been found in tumors of the adrenal cortex and ovary which convert this gene into the oncogene gip2 (46). Transfection of gip2 into Rat-1 cells induces their oncogenic transformation (47). Importantly, stoichiometric control of Ha-ras proteins is critical for normal intracellular signaling, as overexpression of wild type Ha-ras can also induce oncogenic transformation (48-50). Comparable overexpression of wild type Gai.* subunits can also induce oncogenic transformation in Rat-la cells (51). Conversely, the serum-stimulated mitogenic response of mouse Babl/c3T3 fibroblasts can be inhibited by either pertussis toxin or their direct injection with antibodies against G%., subunits (52). Overexpression of two other pertussis toxin substrates, Go, (53) or G%., (54) can also alter both morphology and growth in fibroblasts. Hence, it is possible that both Gai.2 and Gai.3 genes are highly activated during during the growth phase of renal epithelia but are subsequently repressed to a basal state in the polarized

from day 10 of culture were trypsinized (day 0) and cultured for successive days. Panel d depicts confluence of these cells on culture days following trypsinization. Luciferase activity of these clonal cells stably transfected with Gw.3 Sac11 (LUC) or Gw.2 13-2 LUC is depicted in panels hand c, respectively. Panel a depicts average NPTII activity of clonal cells from panels h and c.

Regulation of the G-protein ai-3 Subunit Gene 3973

r 1 2 3 4 5 6

1 - 7 . .

c J

7 8 9 10 11

FIG. 11. The A-P G c Y ~ . ~ promoter DNA segment and its 22- bp 5’ region have comparable binding act ivi t ies in the mobil- i ty sh i f t assay. Nuclear extracts were prepared from LLC-PK1 cells 24 or 144 h after trypsinization and culture. The A-F DNA segment generated by polymerase chain reaction as described under “Experi- mental Procedures” and a 22-bp DNA segment (GTACTTCCGCTT- TCGGTTGTGC) corresponding to the 5’ region of A-F were utilized as probes in the mobility shift assay. Lane I, A-F probe alone; lane 2, A-F with 24-h nuclear extracts; lane 3, A-F with 24-h nuclear extracts competed with 10 ng of unlabeled A - F lane 4, same as lane 2 with 20 ng of unlabeled A-F; lane 5, same as lane 2 competed with 25 ng of Bluescript I1 KS plasmid; lane 6, same as lane 2 competed with 50 ng of Bluescript I1 KS plasmid; lane 7,22-bp DNA segment probe alone; lane 8, 22-bp DNA segment with 24-h nuclear extracts; lane 9, same as lane 8 competed with 20 ng of unlabeled 22-bp DNA segment; lane IO, 22-bp DNA segment with 144-h nuclear extracts do not demonstrate an induced binding activity seen in lane 8 or lanes 2, 5, and 6 at the level of the horizontal arrow +; and lane 11, same as lane 10 competed with 20 ng of unlabeled 22-bp DNA segment.

phenotype to maintain normal cellular signaling. Despite transcriptional repression in quiescent polarized

cells, these genes were still responsive to hormonal stimuli. In cells complemented with glucocorticoid receptors, lo-’ M dexamethasone inhibited Gw., but stimulated Gai.s gene transcription and mRNA content 3-fold. Such alterations in gene expression although modest have significant physiologic effects in these cells. We have previously shown that transcriptional activation of a chimeric mouse metallothionein I-Gcvi.3 gene in these cells produces a 3-fold increase in the membrane accumulation of Gw.8 subunits with a consequent 60% inhi- bition in heparan sulfate proteoglycan secretion by these cells (7). In other studies comparable transcription induced increases in the Ge., subunit attenuated vasopressin-mediated stimulation of adenylyl cyclase in these c e k 2 Hence, modulation in the transcription-dependent expression of Gw subunits may act as a control point for the response of renal epithelia to hormones and intracellular signals. I t is therefore notable that aldosterone stimulation of amiloride-sensitive sodium transport in A6 renal epithelia is dependent on the transcription-dependent production of a regulatory protein or proteins that activate a pre-existing pool of quiescent sodium channels (55). Studies from our laboratory (56, 57) have demonstrated that G W . ~ is one regulatory protein involved in the activation of sodium channels in renal epithelia. Hence, i t is likely that the Ge.3 gene may participate in the renal adaptive response to mineralocorticoids which increases vec- torial salt and water transport in the kidney.

To begin to understand the transcriptional regulation of

L. Ercolani, C. Tao, and D. A. Ausiello, unpublished observations.

1 2 3 4 5 6 7 8 9 10 1 1 1 2 1 3 14 1

I’ “I

FIG. 12. Progressive mutat ions in the 22-bp DNA segment identify the nucleotides for binding activities in the mobility shift assay. Nuclear extracts were prepared from LLC-PK1 cells 24 h after trypsinization and culture. The A-F DNA segment generated by polymerase chain reaction as described under “Experimental Pro- cedures” was utilized as a probe in the mobility shift assay. Lane 1, A-F probe alone; lane 2, A-F with 24-h nuclear extracts; lane 3, A-F with 24-h nuclear extracts competed with 10 ng of unlabeled A-F; lane 4, same as lane 2 with 20 ng of unlabeled A-F; lane 5, same as lane 2 competed with 10 ng of 22-bp DNA segment (GTACTTCCGCTTTCGGTTGTGC); lane 6, same as lane 5 with 20 ng of 22-bp DNA segment; lane 7, same as lane 2 competed with 10 ng of 22-bp mutant 1 DNA segment (GTETTCCGCTTTCGGTTGTGC); lane 8, same as lane 7 with 20 ng of mutant 1 DNA segment; lane 9, same as lane 2 competed with 10 ng of 22-bp mutant 2 DNA segment (GTACT-

mutant 2 DNA segment; lane 11, same as lane 2 competed with 10 ng of 22-bp mutant 3 DNA segment (GTACTGAC- TATTTCGGTTGTGC); lane 12, same as lane I 1 with 20 ng of mutant 3 DNA segment; lane 13, same as lane 2 competed with 10 ng of 22-bp mutant 4 DNA segment (GTACT- GACGCTBCGGTTGTGC); lane 14, same as lane 13 with 20 ng of mutant 4 DNA segment. A horizontal arrow + indicates the position of a new binding activity in these extracts.

the Gai.3 gene in LLC-PKI cells, we isolated porcine genomic clones encoding it. Utilizing a sensitive firefly luciferase reporter gene, we have identified and mapped several cis-acting elements in the 5’-flanking region of the gene that contributed to its basal transcriptional expression. Analysis of successive 5’-flanking region gene deletions suggested multiple regulatory sequences that are the likely enhancer and promoter elements. The primordial mammalian divergence that produced porcine and primate species occurred approximately 50 million years ago. Such divergence allows compar- ative inspection of putatively conserved “cis-acting” sequences that could potentially mediate transcriptional activity in both genes. Although the general sequence identity between these genes 5‘ flanks was 78%, the minimal promoter region shared 91% sequence identity with the human gene. Of the five non- conserved nucleotides in this region, four were conservative pyrimidine substitutions. This segment was unique insofar as it did not contain TATAA or GC boxes but did contain a sequence GGAAGTG conserved in both human and porcine genes that could potentially bind an adenovirus E4TF1 transcription factor. As a family, all other Ga subunit genes (yi.,, ao, as, a=, and at.J (42, 58-61) studied thus far have multiple transcription start sites. Although only the promoter for the Gw., gene has been previously characterized (26, 70), multiple start sites are consistent with these genes having promoters that also lack an orienting TATAA box for RNA polymerase I1 (62,63). The GCYI.~ minimal promoter was found in an area that is 60% G-C rich, with 49 CpG uersus 69 GpC dinucleotides. CpG dinucleotide sequences are potential sites for methylation at the 5-position of cytidine and occur infre-

- GACGCTTTCGGTTGTGC); lane IO, same as lane 9 with 20 ng of

3974 Regulation of the G-protein Subunit Gene

poLuc alpha i-2 Luc alpha i-3 Luc lsGR (4 rsGR (+)

FIG. 13. Dexamethasone alters transcription of Gai luciferase plasmids and Gai.3 mRNA content in renal epithelial cells. Panel a, poLUC, 13-2 LUC ( G c ~ . ~ ) , or Sac11 (Luc) (Gni.3) were cotransfected with pRShGRa into LLC-PK, cells and examined for luciferase activity 16 h after treatment without (striped bars) or with (solid bars) dexamethasone lo-* M. Luciferase activity results are expressed as mean light units & S.E., normalized for human placental alkaline phosphatase activity in each of six individual experiments. Panel 6, LLC- PK, cells were transfected with or without pRShGRn and examined 16 h after treatment without (striped bars) or with (solid bars) dexamethasone lo-’ M for Gni., mRNA content. Gni.s mRNA was determined by SI nuclease analysis as described under “Experimental Procedures” where probes derived from (Pni.s ex 1) and (hGR-308) were respectively used to assay Gai.3 mRNA and to correct for transfection efficiency in cells with pRShGRtu. Mean corrected 32P counts/minute from excised hands corresponding to these protected fragments are displayed in the right hand axis of panel b from three experiments.

quently in genomic DNA except in the regulatory regions of genes (64). In general there is an inverse correlation between the state of methylation of a gene’s promoter and its transcriptional activity. This may occur by steric interference with the binding of transcription factors or alteration of chromatin structure (65). Methylation and demethylation events can occur selectively in the same cell resulting in the activation of some genes and the deactivation of others (66). Hence, differences in methylation may contribute to the variable expression of this gene in other tissues.

The existence of two potential areas containing enhancer sequences were also found. The first enhancer located between positions 570-604 and 112-172 contained a sequence CGCCC that could potentially bind an Spl transcription factor. The second enhancer located at positions 637-672 contained the conserved sequence GCGGGGCG. Although two CAAT boxes were found as potential regulatory elements, they did not contribute to basal transcriptional activity of the gene as determined by deletion analysis. By utilizing the same progressively deleted DNA segments in mobility shift assays with nuclear extracts from cells before and after cell polarization, a completely conserved motif in the 5’ region of the gene promoter GTACTTCCGCT was identified that bound an induced nuclear protein complex during maximal transcriptional activation of the GCI.~ gene. The central 9 residues had a pyrimidine/purine/pyrimidine (5)/purine/pyrimidine order- ing reminiscent of the sequence CGCCCCCGC and its var- iants that bind a family of zinc finger transcription factors such as WT1 and Egrl. WT1 is postulated to normally function as a repressor to prevent occupancy of the same cis sequence by the strong activating transcription factor Egrl that is induced by mitogenic signals in a variety of cell types (67, 68). A partial GRE site (GGTACAN3TGTTCT) was found in the immediate 300 bp region of the Gai.3 promoter. However, cis-acting sequences such as GRE sequences can function as enhancers at great distances from the promoter following the binding of ligand-occupied steroid receptors. As

our studies required cotransfection of pRShGRa to genetically complement our glucocorticoid receptor negative cells, further studies to precisely map sites interacting with the steroid receptor complex will require cell lines that have stably integrated this plasmid.

Having isolated genomic clones that encode the promoter- enhancer regions of both the porcine Ga!.? and Gai, subunit genes, the identification of other comparable sequences and trans-activating proteins which modulate their activity during growth and differentiation is now possible. Furthermore, the action of hormones, second messengers, growth factors, and lymphokines known to influence renal physiology and also alter GCY;.~ and Gai, expression in other tissues can now be examined at the transcriptional level in kidney epithelia.

REFERENCES 1. Gilman, A. G . (1987) Annu. Reo. Biochem. 56,615-649 2. Lochrie, M. A,, and Simon, M. I. (1988) Biochemistry 27,4957-4965 3. Birnbaumer, L., Abramowitz, J., Yatani, A., Okahe, K., Mattera, R., Graf,

Mol . Bid. 25, 225-244 R., Sanford, J., Codina, J., and Brown, A. M. (1990) Crit. Reu. Biochem.

4. Simon, M. I., Strathmann, M. P., and Gautam, N. (1991) Science 2 5 2 , 802-808

5. Skorecki, K. L., Verkman, A. S., and Ausiello, D. A. (1987) Biochemistry 26,639-645

6. Mohrmann, M., Cantiello, H. F., and Ausiello, D. A. (1987) Am. J. Physiol. 2 5 3 , F372-F376

7. Stow. .J. L.. de Narula. A. J. B.. Holtzman. E. J.. Ercolani. L.. and Ausiello. D.A. (1991)J. Cellbiol. 11b,1113-1124

. .

8. Ercolani, L., Stow, J. L., Boyle, J. F., Holtzman, E. J., Lin, H., Grove, J. R., and Ausiello, D. A. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 4635- 4639

D. J. (1992) J. Biol. Chern. 267,4759-4765

F840

9. Ausiello, D. A,, Stow, J. L., Cantiello, H. F., de Almeida, J. B., and Benos,

10. Stow, J. L., Sabolic, I., and Brown, D. (1991) Am. J. Physiol. 261 , F831-

11. C h a i i F. H., and Bourne, H. R. (1987) Endocrinology 121 , 1711-1715 12. Rapiejko, P. J., Watkins, D. C., Ros, M., and Malhon, C. C. (1990) Biochim.

13. Green, A,, Johnson, J. L., and Milligan, G. (1990) J. Biol. Chem. 2 6 5 , Biophys. Acta 1052,348-350

5206-5210

Neer E. J. (1989) FEES Lett. 2 4 9 , 139-142 14. Lee, R. T., Brock, T. A,, Tolman, C., Bloch, K. D., Seidman, J. G., and

15. Hadcoik. J. R.. Ros. M.. Watkins, D. C.. and Malbon, C. C. (1990) J. Biol.

16. Missale, C., Boroni, F., Castelletti, L., Dal, T. R., Gabellini, N., Sigala, S.,

17. Liang, B. T., Hellmich, M. R.. Neer. E. J.. and GalDer. J. B. (1986) J. Eiol.

Chem.’265,’14784-14790

and Spano, P. (1991) J. Eiol. Chem. 266,23392-23398

Chem. 261,9011-9021

Regulation of the G-protein a i -3 Subunit Gene 3975 18. Watkins, D. c . , Northup, J. K., and Malbon, C. C. (1987) J. Biol. Chem. 45. McGrath, J. P., Capon, D. J., GoeddeL D. V., and Levinson, A. D. (1984)

262,10651-10657 19. Luetje, c. w. , ~ i ~ t j ~ , K. M., Christian, J. L., and Nathanson, N. M. (1988) 46. Lyons, J., Landis, c. A., Harsh, G., Vallar, L.7 Grunewald, K.7 FeichtiWer,

J. Biol. Chem. 2 6 3 , 13357-13365 H.? Duh, Q. Y., Clark, 0. H., Kawasaki, E., and Bourne, H. R. (1990) 20. Watkins, D. C., Rapiejko, P. J., Ros, M., Wang, H. Y., and Malhon, C. C.

(1989) Biochem. Biophys. Res. Comnun. 165,929-934 47. Pace, A. M., Wong, Y. H., and Bourne, H. R. (1991) Proc. Natl. Acad. Sci. 21. Hadwiger, J. A,, and Firtel, R. A. (1992) Genes & Deu. 6 , 38-49

Nature 310,644-649

Sccence 249,655-659

U. S. A. 8 8 , 7031-7035 22, Firtei, R, A,, van, H, p. J,, Kimmel, A, R,, and ~ ~ ~ ~ ~ ~ t ~ ~ , p, N. (1989) cell 48. DeFeo. D., Gonda, M. A.3 Young, H. A.9 Chang, E. H.3 LPWY, D. R., Scolnick,

5 8 , 235-239 E. M., and Ellis, R. W. (1981) Proc. Natl. Acad. Scc. U. S. A. 7 8 , 3328-

23. Hadwiger, J. A., Wilkie, T. M., Strathmann, M., and Firtel, R. A. (1991) 49. Chang, E. H., Furth, M. E., Scolnick, E. M., and Lowy, D. R. (1982) Nature 3332

Proc. Natl. Acad. Sci. U. S. A. 88,8213-8217 24. Parks, S., and Wieschaus, E. (1991) Cell 64,447-458

297,479-483

25. Chakrahorty, M., Chatterjee, D., Kellokumpu, S., Rasmussen, H., and 50. Pulciani, S. Santos, S., Long, L. K., Sorrentino, V., and Barbacid, M.

Baron, R. (1991) Science 251,1078-1082 (1985) M6l. Cell Biol. 5 , 2836-2841

51. Gu ta, S. K., Gallego, C., Lowndes, J. M., Pleiman, C. M., Sable, C., 26. Holtzman, E. J., Soper, B. W., Stow, J. L., Ausiello, D. A,, and Ercolani, L. &sfelder, B. J., and Johnson, G. L. (1992) Mol. Cell Biol. 12, 190-197

(1991) J . Biol. Chem. 2 6 6 , 1763-1771 52. LaMorte, V. J., Goldsmith, P. K., Spiegel, A. M., Meinkoth, J. L., and 27. Jones, D. T., and Reed, R. R. (1987) J . Biol. Chem. 262 , 14241-14249 28. Ercolani, L., Florence, B., Denaro, M., and Alexander, M. (1988) J . Biol. 53. Bloch, D. B., Bonventre, J. V., Neer, E. J., and Seldman, J. G. (1989) Mol.

29. Devereux, J., Haeherli, P., and Smithies, 0. (1984) Nucleic Acids Res. 12 , 54. Cui, Z., Zubiaur, M., Bloch, D. B., Michel, T. , Seidman, J. G., and Neer, E. Chem. 2 6 3 , 15335-15341 Cell Biol. 9 , 5434-5439

387-395 J. (1991) J . Biol. Chem. 266,20276-20282 :jo. &Wet, J. R., Wood, K. v., ~ e ~ u c a , M., Helinski, D. R., and Subramani, 55. Kleyman, T. R., Cragoe, E. J. J., and KraehenbuhL J. P. (1989) J . B i d . S. (1987) Mol. Cell Biol. 7, 725-737 Chem. 2 6 4 , 11995-12000

31, ~ ~ ~ ~ i ~ ~ , A. R., T ~ ~ ~ , J , E,, and Habener, J , F, (1g89) ~ i ~ ~ ~ ~ h ~ i ~ ~ ~ ~ 7 , 56. Cantiello, H. F., Patenaude, C. R., and AusielIo, D. A. (1989) J. Chem. 1116-1122 264,20867-20870

3 2 , c, M,, Moffat, L, F,, and Howard, B. H, (1982) Mol. cell Bioi, 2, 57. Cantiello, H. F., Patenaude, C. R., Codina, J., Birnbaumer, L., and Ausiello, 1044-1051 D. (1990) J. Biol. Chem. 265,21624-21628

93. Henthorn, P., Zervos, P., Raducha, M., Harris, H., and Kadesch, T. (1988) 58. Tsukamoto, T., Toyama, R., Itoh, H., Kozasa, T., Matsuoka, M., and Proc. Natl. Acad. Sci. U. S. A. 85, 6342-6346

Kaziro, Y. (1991) Proc. Natl. Acad. Sci. U. S. A. 8 8 , 2974-2978

34. Giguere, V., Hollenherg, S. M., Rosenfeld, M. G., and Evans, R. M. (1986) 59. Kozasa, T., Itoh, H., Tsukamoto, T., and Kaziro, Y. (1988) Proc. Natl.

Cell 46,645-652 60. Raport, C. J., Dere, B., and Hurley, J. B. (1989) J . Biol. Chem. 264,7122- Acad. Sci. (1. S. A. 85, 2081-2085

35. Hudziak, R. M., Laski, F. A,, RajBhandary, U. L., Sharp, P. A,, and Capecchi, M. R. (1982) Cell 31, 137-146

7128

36. Platt, S. G., and Yang, N. S. (1987) Anal. Biochem. 162,529-535 61. Matsuoka, M., Itoh, H., and Kaziro, Y. (1990) J . Biol. Chem. 2 6 5 , 13215-

37. Bradford, M. M. (1976) Anal. Biochem. 72, 248-254 13220

62. Saltzman, A. G., and Weinmann, R. (1989) FASEB J . 3 , 1723-1733 38. Ribeiro-Neto, F., Mattera, R., Grenet, D., Sekura, R. D., Birnbaumer, L., 63. Pugh, B. F., and Tjian, R. (1991) Genes & Deu. 5 , 1935-1945

39. Goldsmith, P., Backlund, P. S. J., Rossiter, K., Carter, A,, Milligan, G., 65. Iguchi-Ariga s. M., and Schaffner, W. (1989) Genes & Deu. 3 , 612-619 and Field, J. B. (1987) Mol. Endocrinot. 1, 472-481 64. Bird, A. P. (1986) Nature 321,209-213

Unson, C. G., and Spiegel, A. (1988) Biochemistry 2 7 , 7085-7090 66. Shinar, D., "offe, O., Shani, M. and Yaffe, D. (1989) Differentiation 4 1 , 40. Jones, N. C., Rigby, P. W., and Ziff, E. B. (1988) Genes & Deu. 2,267-281 41. Mitchell, P. J., and Tjian, R. (1989) Science 245 , 371-378 67. Gu ta, M. P., Gupta, M., Zak, R., and Sukhatme, V. P. (1991) J . Biol.

42' Itoh, H'' R', T., Tsukamoto* T., M., and 68. Madden, S. L., Cook, D. M., Morris, J. F., Gashler, A,, Sukhatme, V. P., Kaziro, Y. (1988) J . Biol. Chem. 263,6656-6664 43. Petersen, D. D.9 Koch, s. R.7 and Granner, D. K. (1989) prof. 69. Saatcioglu, F., Perry, D. J., Pasco, D. S., and Fagan, J. B. (1990) J . Bid.

44. Weiss, E. R., Amsler, K., Dawson, W. D., and Cook, J. S. (1985) Ann. N. 743. Weinstein, L. S., Kats, I., Spiege], A. M., and Carter, A. D. (1990) Mol. Sci. U. S. A. 8 6 , 7800-7804 Chem. 265,9251-9258

Y. Acad. Sci. 4 5 6 , 420-435 Endocrrnol. 4,958-964

Feramisco, J. R. (1992) J . Biol. Chem. 267 ,691~694

116-126

them. 266,12813-12816

and Rauscher, F. J. (1989) Sccence 253 , 1550-1553

transcriptional regulation of g-protein cyi subunit genes in llc

Documents