transcriptional regulation of meiosis in budding yeast · regulation of meiosis in budding yeast...

Transcriptional Regulation of Meiosis in Budding Yeast

Yona Kassir,* Noam Adir, t Elisabeth Boger-Nadjar, t Noga Guttrnann Raviv,* Ifat Rubin-Bejerano, ~ Shira Sagee,* and Galit Shenhar** *Department of Biology, tDepartment of Chemistry, and ~Food Engineering and Biotechnology, Technion, Haifa 32000, Israel; §Whitehead Institute for Biomedical Research, Cambridge, Massachusetts 02141; and **Department of Molecular Cell Biology, Weizmann Institute, Rehovot 76100, Israel

Initiation of meiosis in Saccharomyces cerevisiae is regulated by mating type and nutritional conditions that restrict meiosis to diploid cells grown under starvation conditions. Specifically, meiosis occurs in MATa/MATo~ cells shifted to nitrogen depletion media in the absence of glucose and the presence of a nonfermentable carbon source. These conditions lead to the expression and activation of line 1, the master regulator of meiosis. IME1 encodes a transcriptional activator recruited to promoters of early meiosis-specific genes by association with the DNA-binding protein, Ume6. Under vegetative growth conditions these genes are silent due to recruitment of the Sin3/Rpd3 histone deacetylase and Isw2 chromatin remodeling complexes by Ume6. Transcription of these meiotic genes occurs following histone acetylation by Gcn5. Expression of the early genes promote entry into the meiotic cycle, as they include genes required for premeiotic DNA synthesis, synapsis of homologous chromosomes, and meiotic recombination. Two of the early meiosis specific genes, a transcriptional activator, Ndt80, and a CDK2 homologue, Ime2, are required for the transcription of middle meiosis-specific genes that are involved with nuclear division and spore formation. Spore maturation depends on late genes whose expression is indirectly dependent on line1, Ime2, and Ndt80. Finally, phosphorylation of Imel by line2 leads to its degradation, and consequently to shutting down of the meiotic transcriptional cascade.

This review is focusing on the regulation of gene expression governing initiation and progression through meiosis.

International Review of Cytology, Vol. 224 ] 1 1 Copyright 2003, Elsevier Science (USA). 0074-7696/03 $35.00 All rights reserved.

112 KASSIR ETAL.

KEY WORDS: Meiosis, Saccharomyces cerevisiae, Transcriptional repression and silencing, Transcriptional activation, Glucose, Nitrogen, Signal transduction pathways, o2003, EIsevierScience (USA).

I. Introduct ion

The budding yeast Saccharomyces cerevisiae is a simple unicellular eukaryote exhibiting several optional developmental pathways. Figure 1 schematically illustrates the developmental options of MATa/MATot diploid cells. In the presence of both carbon and nitrogen sources both haploid and diploid cells adopt the yeast form morphology; upon nitrogen limitation, and in the presence of high levels of glucose, a dimorphic transition to a filamentous growth takes places (for recent reviews see Gancedo, 2001; Lengeler et al., 2000; Pan et aL, 2000). Haploid as well as diploid cells manifesting these forms propagate by the mitotic cell cycle. Upon nitrogen depletion the developmental decision made by the cells depends on the presence or absence of a fermentable carbon source such as glucose, as well as on the information at the MAT locus. In the presence of functional MATal and MATot2 alleles, regardless of ploidy, i.e., MATa/MATot diploids, MATa/MATot disomic cells, and haploid cells expressing both MAT alleles, cells enter the meiotic cycle (Kassir and Simchen, 1976, 1985; Rine and Herskowitz, t987; Roman and Sands, 1953; Roth and Fogel, 1971). In the presence of only a single functional

Pseudohyphae

Mitosis - ~ @

Meiosis

FIG. 1 Developmental choices of MATa/MATo~ diploid cells of Saccharomyces cerevisiae. In the presence of carbon and nitrogen sources cells adopt the yeast form morphology; upon nitrogen limitation and in the presence of high levels of glucose, a dimorphic transition to a filamentous growth reminiscent of hyphae takes place. In the absence of nitrogen and glucose and the presence of acetate as the sole carbon source cells enter the meiotic cycle, forming four haploid spores engulfed in a sac, the ascus.

REGULATION OF MEIOSIS IN BUDDING YEAST 113

allele, i.e., MATa and MAToI haploids or MATa/MATa and MATot/MATvt diploids, depletion of nitrogen leads to a cell cycle arrest at G1 (Kassir and Simchen, 1976; Roman and Sands, 1953; Strathern et al., 1981). The last developmental option S. cerevisiae cells possess is that of mating, cells carrying only one of the two MAT alleles can respond to the pheromone secreted by cells expressing the other MAT allele by temporal arrest in G1, mate, and then resume cell growth (reviews on the mating process as well as on how the MA T alleles control cell type are Fields, 1990; Herskowitz, 1995; Sprague, 1991).

In this review we focus on how the meiotic signals, namely, the presence of the MATa and MATo~ alleles, the presence of a nonfermentable carbon source, the absence of glucose and nitrogen, control initiation, and progression through the meiotic cycle. We focus on transcriptional regulation rather than the function of the proteins involved with the specific meiotic events (for reviews on these aspects of meiosis see Kupiec et al., 1997; Roeder, 1997). Table I lists the transcriptional regulators of meiosis-specific genes discussed in this review.

II. Transcriptional Cascade Governs Initiation of Meiosis

Entry and progression through the meiotic cycle depend on the expression and activity of many genes that can be roughly divided into three groups: meiosis-specific, cell-division cycle (CDC), and radiation-sensitive (RAD) genes. The meiosis- specific genes are expressed only under meiotic conditions, and their function is required only in meiosis. The cell-division cycle genes that are involved with the nuclear cell cycle are required for meiosis (Simchen, 1974), and are expressed in both the mitotic and meiotic cycles. The RAD genes are involved with DNA repair as well as in checkpoint surveillance, and in meiosis are required for meiotic recombination and surveillance mechanisms.

Initiation and progression through the meiotic cycle are regulated by a transcriptional cascade consisting of a temporal and programmed expression of six classes of meiosis-specific genes (early I, early II, early middle, middle, mid-late, and late) (Chu et al., 1998; Primig et al., 2000). Figure 2 shows a schematic drawing of this transcriptional cascade, the timing of meiotic events, and the input of the meiotic signals. IME1 is the master regulator gene absolutely required for entry into the meiotic cycle and the transcription of all meiosis-specific genes (Kassir et aL, 1988; Smith and Mitchell, 1989). Briefly, in the mitotic cell cycle IME1 is silent, as its transcription is regulated by the three meiotic signals (Kassir et aL, 1988). The translation and activity of Ime 1 are also regulated by nutrients (Rubin- Bejerano et al., 1996; Sherman et al., 1993). IME1 encodes a transcriptional activator that is directly required for the transcription of early meiosis-specific genes

114

Nitrogen depletion (absence of glucose)

1511 arrest

Premeiotie DNA replication & Recombination

M A T ±

Imel

EMG Ndt80 Ime2

' ' ',,., / ......

Nuclear divisions ~ MMG & spore formation

l ! Spore maturation ~ L M G r

KASSIR ET AL.

Nutrients

FIG. 2 A transcriptional cascade governs initiation of meiosis. The meiotic signals, i.e., the presence of Matal and Match2, the absence of glucose and nitrogen, and the presence of acetate leads to Gi arrest as well as to the expression and activity of Imel. IME1 encodes a transcriptional activator required for the transcription of early meiosis-specific genes (EMG). EMG are involved with premeiotic DNA replication and meiotic recombination. Ndt80 and Ime2, a transcriptional activator and a protein kinase, whose transcription depends on Ime 1, are required for the transcription of middle meiosis-specific genes (MMG). MMG are involved with nuclear division and spore formation. The transcription of tile late meiosis-specific genes (LMG) depends on Imel and Ime2, and these genes are required for spore maturation. The nutrient signal has a direct effect also on the activity of Ime2 and the transcription of LMG. An arrow represents a positive role, a line represents a negative role. A scissor symbolizes the negative feedback role of Ime2 in regulating degradation of Ime 1.

(EMG) 1 (Mandel et al., 1994; Smith et al., 1993). The transcription of the middle meiosis-specific genes (MMG) depends on the transcription factor, Ndt80, and on the serine/threonine protein kinase, Ime2, two early meiosis-specific genes whose transcription depends on Imel (Chu and Herskowitz, 1998; Hepworth et al., 1998; Mitchell et al., 1990; Yoshida et al., 1990). In addition, the function of Ime2 is directly regulated by nutrients (Donzeau and Bandlow, 1999; Mitchell et al., 1990; Yoshida et al., 1990). Transcriptional regulation of mid-late and late meiosis- specific genes (LMG) is less clear, however, their regulated expression depends on

1Abbreviations: ad, activation domain; bd, DNA-binding domain; CDK, cyclin-dependent kinase; EMG, early meiosis-specific genes; id, interaction domain; LMG, late meiosis-specific genes; MMG, middle meiosis-specific genes; MSE, middle spornlatiou element; MAPK, mitogen-activated protein kinase; NIS, nuclear import sequence; NLS, Nuclear localization sequence; PKA, cAMP-dependent protein kinase A; SA, synthetic growth media with acetate as the sole carbon source; SCB0 Swi4/6 cell cycle box; SD, synthetic growth media with glucose as the sole carbon source; SPM, sporulation media; STRE, stress response element; UAS, upstream activation sequence; UCS, upstream controlling sequence; URS, upstream repression sequence.


the upstream regulators, Imel, Ime2, and Ndt80, as well as on nitrogen depletion (Friesen et al., 1997; Kihara et al., 1991).

There is a good correlation between time of transcription and meiotic function (Chu et al., 1998; Primig et al., 2000). The transcription of EMG is induced prior to premeiotic DNA replication, and it includes genes required for pairing of homologous chromosomes (i.e., HOP1), and meiotic recombination (i.e., DMC1). Furthermore, the transcription of CDC genes required for premeiotic DNA replication is induced at this time (i.e., POLl ) (Johnston et al., 1986). Middle genes are induced following completion of DNA replication and prior to the first nuclear division. These genes are involved with nuclear division (i.e., CLB1,3,4, CDC26). The late genes are expressed following completion of nuclear divisions, and are involved with spore formation and its maturation (i.e., DIT1, SPSIO0) (Chu et al., 1998). However, some genes do not follow this rule. For example, CLB5,6 are middle genes (Chu et aL, 1998) that are required for premeiotic DNA replication (Dirick et al., 1998; Stuart and Wittenberg, 1998). In the mitotic cell cycle Clb5 is also required for spindle orientation, a process occurring concomitantly with DNA replication (Segal et al., 2000). On the other hand, in the meiotic cycle, separation of the duplicated spindle-pole bodies and spindle formation occur following completion of DNA replication (Goetsch and Byers, 1982). It seems, therefore, that the transcription of CLB5,6 correlates with their second putative meiotic function.

lU. Transcriptional Regulation of I M E I

The different signal pathways that lead to meiosis converge at IME1, promoting its transcription (Kassir et aL, 1988). In vegetative growth media with glucose as the sole carbon source (SD, synthetic dextrose) IME1 is not transcribed. A low basal level o f lME1 mRNA is present in growth media when acetate is the sole carbon source (SA, synthetic acetate) (Kassir et aL, 1988). Upon nitrogen depletion and the presence of acetate (SPM, sporulation media), the level of IME1 m R N A is transiently increased in MATa/MATot diploids, but not in cells carrying only a single active M A T allele (Kassir et al., 1988). In addition, IME1 is subject to both positive and negative feedback regulation (Shefer-Vaida et al., 1995). An extremely large region, about 2.1 kb long, consisting of distinct positive and negative elements mediates the regulated transcription o f lME1 (Granot et al., 1989; Sagee et al., 1998; Sherman et al., 1993; Smith et al., 1990). By deletion analysis and insertion of specific elements of IME1 in heterologous reporter genes, the meiotic signals affecting discrete elements were identified (Fig. 3) (Covitz and Mitchell, 1993; Sagee et al., 1998; Sherman et al., 1993; Smith et al., 1990). Below is a detailed review on how the MAT, glucose, and nitrogen signals are transmitted to IME1.

KASSIR ET AL.

Glucose Acetate Nitrogen

116

MATa/MAT~

Tr* -4401 -2112 -1641 -1369 -1202 -1153 -1122 -915 -788 -756 -621 -330 -229

t ucs FIG. 3 Schematicstructure•fthe•ME•5/untrans•atedregi•n.Theregu•atedtranscripti•n•f•ME•is mediated by the combinatorial effect of distinct elements. The MAT signal mediates repression activity of two elements, UCS3 and UCS4. The carbon source signal is transmitted to four elements. UCS1, UASru, and IREu function as repression elements in the presence of glucose. In addition, UASru IREu, as well as UASrm function as activation elements in the absence of glucose and the presence of acetate as the sole carbon source. UCS 1 functions as a negative element in the presence of nitrogen. Filled boxs, elements required for transcriptional activation. Open boxs, elements whose function is only to repress transcription. A positive role is marked with an arrow, a negative role by a line. Larger effects are denoted by heavier lines and lesser effects are denoted by slender lines.

A. The MATSignal

The MAT signal is transmitted through two distinct elements, UCS3 and UCS4, which do not share any sequence homology (Covitz and Mitchell, 1993; Sagee et al., 1998). Deletion of any of these elements leads to partial derepression, whereas deletion of both elements results in full expression of lME1 in MATa/MATa cells (Sagee et al., 1998). In addition, UCS3 is apparently required for complete relief of repression of UCS4. Nested deletion of UCS3 leads to a 2-fold reduction in the expression of imel-lacZ in MATa/MAT~ cells incubated under meiotic conditions, whereas in concomitant deletion of UCS4 and the entire upstream region, the expression of imel-lacZ is complete (Fig. 4, compare line B to lines A and C). The proteins through which MA T regulation is transmitted to UCS3 are not known. As discussed below, Rmel transmits the MAT signal to UCS4 (Covitz and Mitchell, 1993) (see Section III.A. 1.a).

Full expression of Imel in $288C strains deleted for RME1 or UCS3 and UCS4 does not lead to complete sporulation (Kassir et al., 1988; Sagee et al., 1998), suggesting that the Matal Mat~2 proteins might be required for a downstream meiotic event. On the other hand, in SKI background, this is not the case, and the


13-galactosidase units

SO SA SPM3 SPM6

B. ~ i ! ~ 1 [ ~ 1 lii~i~ Eii~i;ll o~ 0.5 NT 28.4

c. l i ~ i i l [ ~ 1 ,,liii~ifl ti;~!iill 0.2 0.3 ST 58.0

D. Ii ! i l l ill 0.1 0.1 NT 36.7

E II !1 ~ 2.5 15.4 ~ , 39.0

F. i ~ ! ~ I [~ i [ I;ii ] ~ 36.6 0.1 0.1 NT

G. ~ 0 , ~ , I--q I ~ , ~ 1 [~!~1 5.2 6.1 10.1 11.~

H. [ ~ $ N i i ~ . i i | l ~ i [ I [ l i i~ii![ 0.4 0.3 10.3 8.4

FIG. 4 The function of positive and negative elements regulating the transcription of IME1. IME1

with various portions of its 5 ~ untranslated region were fused at the sixth amino acid to the E. coli IacZ gene. The chimeric genes were integrated at the LEU2 loci of a MATa/MATc~ diploid (strain Y4122, $288C background). Samples were taken from 1 × 1O 7 cells grown in either SD (synthetic glucose) or PSP2 (SA, synthetic acetate) (Kassir and Simchen, 1991). In addition, cells grown in PSP2 to 1 × 107 were washed once in water and resuspended in spondation media (SPM) (Kassir and Simchen, 1991). Samples were taken to extract proteins and measure lacZ levels after 3 and 6 hr in SPM. The level of/~-galactosidase is given in Miller units. The results are the averages of three to five independent transformants. Standard deviations were less than 10%. The studied elements are marked as filled boxes. A nested deletion is marked by a line. NT, not tested.

MATal and MAT~2 alleles are requi red only for the transcript ion of lME1 (Covi tz

and Mitchel l , 1993). There are many repor ted cases of phenotypic differences

be tween SK1 and other strains, i.e., $288C or W303. Genomic D N A hybridizat ion

reveals the presence o f many delet ions and po lymorph i sms be tween these strains

(Pr imig et al., 2000). Thus, the discrepancy be tween results is attributed to the

absence o f some funct ions in the different strains.

1. Genes Whose Products Transmit the MAT Signal to IME1 and Meiosis

Three genes are known to t ransmit the MAT signal to IME1 and meiosis : RME1,

IME4, and RES1.

a. RME1 RMEl encodesazinc-fingerDNA-bindingprotein(Covitzetal. , 1991;

Sh imizu et al., 1997a) that is a negat ive regulator for the transcript ion o f IME1

and meios is in cells carrying only one o f the MAT alleles (Kassir et al., 1988;

118 KASSlR ETAL.

Kassir and Simchen, 1976; Mitchell and Herskowitz, 1986; Rine et al., 1981). Recessive mutations in RME1 and deletion of RME1 lead to complete expression of IME1 and sporulation in matal/MATo~, MATa/MATa, and MATodMATo~ strains (Kassir et al., 1988; Kassir and Simchen, 1976; Mitchell and Herskowitz, 1986). Haploid cells carrying the rmel -1 mutation complete premeiotic DNA replication, but arrest as mononucleate cells without loss of viability (Kassir and Simchen, 1976). This is most probably due to the pachytene checkpoint mechanism that monitors lack of synapsis and/or recombination (for review on this checkpoint see Roeder and Bailis, 2000). In MATa/MAT~ strains relief of repression is due to the substantial reduction (10- to 20-fold) in the level of RME1 mRNA and protein (Mitchell and Herskowitz, 1986; L. Johnston, personal communication). The Matal/Mato~2 complex binds to a specific element in the promoter of RME1 repressing its transcription (Goutte and Johnson, 1988; Johnson and Herskowitz, 1985; Li et al., 1995; Stark and Johnson, 1994).

Rmel binds the IME1 5' region to two sites localized within UCS4, at -2040 to -2030 and -1959 to -1949 (Shimizu et al., 1998). The consensus sequence for binding is GWACCTCAARA (Shimizu et al., 1998). The presence of these two binding sites, defined as the RRE and the modulation element (Covitz and Mitchell, 1993), is required to repress the transcription of IME1. Deletion or mutations in a single site cause only partial derepression (Shimizu et al., 1998). Moreover, deletion of both sites does not lead to complete relief of repression (Shimizu et al., 1998), probably due to the repression activity of the UCS3 site (Sagee et al., 1998). Insertion of the UCS4 element upstream of the CYC1 UAS results in 17-fold repression, depending on overexpression of Rmel, as well as on the presence of both the RRE and the modulation sites (Covitz and Mitchell, 1993). Unlike the intact IME1 gene, repression dependent on overexpression of Rme 1 and dependence on M A T was not reported. It is not surprising, therefore, that in this heterologous system repression is accomplished by sequestering the binding of a transcriptional activator (Shimizu et al., 1997b). The mode by which Rmel represses transcription of IME1 is not known, however, it repression activity depends on Sin4 and Rgrl (Covitz et al., 1994), two components of the RNA polymerase SRB mediator complex (Myer and Young, 1998). These proteins are not required for the stability of Rmel (Covitz et al., 1994), or its binding to DNA (Shimizu et al., 1998).

Rme 1 also functions as a transcriptional activator; it activates the transcription of CLN2 whose promoter includes Rmel 's binding site (Toone et al., 1995). Accord- ingly, Rmel also activates the transcription of CYC1 and HIS3 when artificially tethered to their promoters (Covitz and Mitchell, 1993; Covitz et al., 1994). The transcription of RME1 is mainly induced in G1 (Frenz et al., 2001), suggesting that although this gene is nonessential, it might contribute to the high level expression of Cln2 at this stage in the cell cycle. Transcriptional activation is independent of Rgrl or Sin4 (Blumental-Perry et al., 2002), although the function of Rmel as an activator or repressor is mediated through the same domain (Bhimental-Perry et al., 2002). These results suggest that the function of Rmel is determined by interacting proteins binding to nearby DNA sites.


The effect of MAT on the transcription of IME1 is evident only upon nitrogen depletion; in SA media the level of IME1 mRNA is low and identical in haploid and MATa/MAT~ diploid cells (Kassir et al., 1988), and only SPM and in MATa/MATot that IME1 is fully induced. Moreover, because nitrogen depletion induces the transcription ofRME1 (Frenz et al., 2001), it is possible that Rmel represses transcription only in the absence of nitrogen. This hypothesis predicts that in the absence of Rme 1, initiation of meiosis will not depend on nitrogen depletion. However, cells where either RME1 or UCS3 along with UCS4 (the sites mediating the MAT signal) have been deleted, induce meiosis only upon nitrogen depletion (Kassir and Simchen, 1976; Sagee et al., 1998). The effect of Rmel is mediated through one of two mechanisms: by direct binding and repression of IME1 and by activation of CLN2 transcription (Frenz et al., 2001; Toone et aL, 1995). The increase in activity of the Cln/Cdc28 complex could result in an increase in phosphorylation of Ime 1 and its sequestering from the nucleus (Colomina et al., 1999). Consequently, the reduction in positive autoregulation would lead to a decrease in the level of IME1 m R N A .

b. I M E 4 IME4 encodes a positive regulator absolutely required for the transcription of lME1 (Shah and Clancy, 1992). The transcription o f lME4 is regulated by the meiotic signals; it requires the presence of the MATal and MATot2 gene products and nitrogen depletion. Rmel does not transmit the MAT signal to IME4 (Shah and Clancy, 1992), suggesting that Rmel and Ime4 function in two distinct signal pathways. The region within IME1 responding to Ime4 and the mode by which Ime4 activates the transcription of IME1 are not known. Overexpression of Imel partially suppresses ime4A, suggesting that Ime4 has an additional role in meiosis (Shah and Clancy, 1992). Ime4 associates with Mum2/SpoT-8 (Uetz et al., 2000), which is required for premeiotic DNA replication (Engebrecht et al., 1998; Tsuboi, 1983). It is possible that the second meiotic function of Ime4 is to regulate the function of this protein.

c. RES1 The dominant mutation Resl-1 bypasses the requirement for the presence of both Matal and Matot2 for the expression of IME1 and meiosis (Kao et al., 1990). Resl-1 is not allelic to RME1, IME1, or IME4 (Kao et al., 1990; Shah and Clancy, 1992), neither is Resl in the Ime4 or Rmel signal pathway (Kao et aL, 1990; Shah and Clancy, 1992). This gene has not been cloned, and its normal function is not known.

B. The Ni t rogen Signal

The nitrogen signal is transmitted to IME1 through the UCS1 element (Fig. 3). Nested deletion of this region leads to a 5- and 15-fold increase in the expression of ime l - lacZ in vegetative growth media with either glucose (SD) or acetate (SA) as the sole carbon source, respectively (Fig. 4, compare lines D and E;

120 KASSIR ETAL.

1 0 0 -

40 -:

0 30-

N ~- 20-

o

1 0

0

Control

HIS4vAs-his4-1acZ

SD SA SPM

HIS4vAs-IME1 vcsl-his4-lacZ o

Strains: [ ] wt 30°C [ ] cdc25-5 25°C

I cdc25-5 6 h. at 35°C

FIG. 5 Cdc25 transmits the nitrogen signal that modulates the repression activity of UCS1, a URS element in the IME1 5 ~ region, UCS1 was inserted between HIS4 UAS and the TATA box in a his4- lacZ chimera. The level of fl-galactosidase was determined in three to five independent transformants. Standard deviations were less than 10%. The results are given as relative levels in comparison (in each case) to the level of expression of UASHls4-his4-1acZ (control). Insertion of UCS 1 in the heterologous UASms4-his4-1acZ chimera leads to a substantial reduction in its expression in vegetative growth conditions. Partial relief of repression is observed upon nitrogen depletion, suggesting that the activity of UCS1 as a URS element is mediated by nitrogen. Depletion of Cdc25 by shifting cdc25-5 cells to the nonpermissive temperature leads to relief of repression in vegetative growth media, and has no effect upon nitrogen depletion (SPM), suggesting that Cdc25 transmits the nitrogen signal to UCS 1.

Sagee et al., 1998). These results suggest that UCS1 functions as a negative ele-

ment in the presence of glucose and nitrogen. By itself UCS 1 has no UAS activity; it cannot promote expression of a his4-1acZ reporter gene lacking its own UAS (Nadjar-Boger, 2000). Insertion of UCS1 between the HIS4 UAS and TATA box in the HIS4uAs-HIS4TATA-lacZ reporter gene leads to a substantial reduction of expression in SD and SA (Fig. 5; Sagee et al., 1998). Level of repression is 2- to 3-fold higher in SD in comparison to SA, confirming that the activity of UCS 1 is partially regulated by glucose. Upon nitrogen depletion (SPM) a substantial increase in expression is observed (Fig. 5; Sagee et al., 1998), suggesting that nitrogen is the major signal regulating the function of UCS 1.

The cAMP/PKA pathway transmits a nitrogen signal to IME1 and meiosis (Matsumoto et aL, 1983; Matsuura et al., 1990). Mutations that cause low or no activity of PKA, such as cyrl, ras2, and cdc25, lead to the expression of IME1


and spore formation in the presence of nitrogen (Matsumoto et al., 1983; Matsuura etal., 1990; Shilo etaL, 1978; Smith and Mitchell, 1989) (CYR1 encodes adenylate cyclase, RAS2 encodes a small G protein that functions as a positive regulator of Cyrl, CDC25 encodes the Ras GDP/GTP exchange factor, which serves as a positive regulator of adenylate cyclase; Broach, 1991; Broek et aL, 1987; Toda et aL, 1985). On the other hand, mutations that cause constitutive PKA activity, such as RAS2-vall9 (activated Ras) and bcyl (the regulatory subunit of PKA; Broach, 1991) are spornlation deficient, and are suppressed by overexpression of IME1 (Matsuura et aL, 1990). The repression activity of UCS 1 is reduced in vegetatively grown cdc25-5 cells incubated at the nonpermissive temperature (Fig. 5). Upon nitrogen depletion (SPM), this phenomenon is not observed; the same levels of expression are observed in cells incubated at the permissive or restrictive temperature (Fig. 5). These results suggest that Cdc25 transmits the nitrogen signal to UCS 1. Cdc25 is a positive regulator of both the cAMP/protein kinase A (PKA) (Broek et al., 1987) and mitogen-activated protein kinase (MAPK) (Shenhar, 2001) signal transduction pathways. Therefore, further experiments are required to determine if this effect of Cdc25 is mediated through PKA, MAPK, or a different signal pathway.

MDS3 and its homologue, PMD1, are negative regulators oflME1 transcription in vegetative growth media with acetate as the sole carbon source. Deletion of these genes results in an increase in the transcription of IME1 and the EMG IME2 and HOP1 (Benni and Neigeborn, 1997). In addition, when stationary phase mds3A p m d l A diploid cells are shifted from SD to SA media, growth is ceased and about 10% of the cells enter and complete the meiotic cycle. These results suggest that Mds3/Pmdl function upstream of Imel in preventing cell cycle arrest in the presence of nitrogen (Benni and Neigeborn, 1997). Growth arrest and spomlation are suppressed in cells carrying the RAS2-vaI19 mutation, suggesting that these genes might be upstream activators of the Ras pathway (Benni and Neigeborn, 1997). The region in IME1 that is regulated by these genes is not known. It will be interesting to determine if their effect is mediated through the UCS 1 element.

As discussed above, the Matal and Matt~2 gene products are required to induce expression in the absence of nitrogen, suggesting that UCS 1 might also mediate the MAT signal. However, the repression activity of UCS 1 and its relief (in a UASms4-UCSl-his4-lacZ reporter) is identical in isogenic haploid and diploid cells (Boger-Nadjar, 2000), indicating that the activity of UCS 1 is not regulated by MAT. However, it is still possible that within the context oflME1 promoter, UCS 1 might interact with the UCS3 and/or UCS4 elements that mediate MATregulation.

C. The Glucose Signal

The UAS activity of IME1 is confined to UCS2, a region that contains alternate positive and negative elements (Fig. 3; Sagee et al., 1998). Nested deletions of

122 KASSIR ETAL.

either one of its three positive elements, UASru, IREu, and UASrm, lead to a reduction in expression of i m e l - l a c Z in SPM (Fig. 4, lines F, G, and H), confirming their function as UAS elements (Sagee et al., 1998; Shenhar and Kassir, 2001). In addition, in the presence of glucose UASru and IREu function as repression elements (Fig. 4, lines F and G; Shenhar and Kassir, 2001). Deletion of UASru increases expression in SD, but in SA or SPM expression is absent (Fig. 4, line F), suggesting that UASru functions as a URS element in the presence of glucose and as a UAS element in the absence of glucose and/or the presence of acetate. Nested deletion of 1REu leads to the same levels of expression of i m e l - l a c Z in both SD and SA media (Fig. 4, line G; Sagee et al., 1998), suggesting that its URS activity is regulated by either the carbon or nitrogen source. These UASru, IREu and UASrm elements function as a carbon source regulated UAS when inserted upstream of a his4-1acZ reporter gene (Fig. 6). Decreased levels of expression are observed in SD, and increased expression is observed in SA, whereas in SPM there is a slight increase in activity, but only in the presence of UASru (Fig. 6; Sagee et al., 1998). These results imply that IREu and UASrm are regulated only by the glucose signal, and that UASru is mainly regulated by glucose but nitrogen also has a partial effect on its activity.

70-

= 60,,

50

o 40-

"~ 30-

20

hZv4-1acZ: - UASru UASrm

F-] SD

/ SPM

IREu IREd

FIG. 6 The UAS activity of the IME1 elements UASru, IREu, and UASrm is modulated by the carbon source. His4-lacZ fusions carrying various elements from IME1 5 r untranslated region were integrated at the LEU2 loci of a MATa/MATc~ diploid (strain Y4122, $288C background). Cells were grown in either synthetic glucose (SD) or PSP2 (SA, synthetic acetate) (Kassir and Simchen, 199 i). In addition, cells grown in PSP2 to 1 x 107 were washed once in water and resuspended in sporulation media (SPM) (Kassir and Simchen, 1991) and incubated for 6 hr. Samples were taken from 1 x 107 cells/ml to extract proteins and measure lacZ levels. The level of/3-galactosidase is given in Miller units. The results are the averages of three to five independent transformants. Standard deviations were less than 10%. UASru, IREu, and UASrm support the expression ofhis4-lacZ, suggesting that all three elements possess a UAS activity. The UAS activity is low in SD, and increased activity is observed in SA and SPM media, suggesting that their activity is repressed by glucose and/or depends on acetate. The IREd element that is homologus to IREu (see Fig. 8) shows very low UAS activity.


1. The cAMP/PKA Signal-Transduction Pathway

Genetic analysis suggests that the cAMP/PKA signal pathway transmits a nitrogen signal (see Section III,B; Gancedo, 2001; Pan et al., 2000). However, bio- chemical and genetic analyses demonstrate that this pathway is one of the major signal transduction pathways transmitting a glucose signal to yeast cells. This is an essential pathway that transiently increases the level of cAMP in response to glucose addition (Broach, 1991; Thevelein and de Winde, 1999). Addition of 10 mM cAMP to diploid cells incubated in sporulation conditions leads to a small but significant reduction in the expression of IME1 and the level of sporulation (Fig. 7). The expression of either UASrm-his4-1acZ or UASru-his4-lacZ is slightly increased by addition of cAMP. However, about 1.6-fold reduction in the expression of IREu-his4-1acZ is observed, similar to the effect cAMP has on

120

I00

80

~. 60 .=

"~ 40.

20-

0 . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

/acZ fi~sions: [ime/ 1REu UASrm UASru % asei [ - 13ngalaetosidase units

Control [ ] + 10raM cAMP

FIG. 7 cAMP reduces sporulation and the expression oflME1 through the IREu element. MATa/MATc~ diploid cells (strain Y4122, $288C background) carrying imel-lacZ or his4-1acZfusions with various elements from IME1 5' untranslated region integrated at the LEU2 loci. Cells were grown in PSP2 (synthetic acetate) (Kassir and Simchen, 1991) with or without 10 mM cAMP to 1 x 107 cells/ml, washed once in water and resuspended in sporulation media (SPM) (Kassir and Simchen, 1991) with or without 10 mM cAMP, respectively. Samples were taken at 6 hr in SPM. The level of,6-galactosidase is given in Miller units. The results are the averages of three to five independent transformants. Standard deviations were less than 10%. At 24 hr in SPM samples were taken to count the percentage of asci. Results are given as relative levels. Addition of cAMP leads to a reduction in sporulation (72.6% and 49.8% in the absence and presence of cAMP, respectively) as well as a reduction in the expression of imel-lacZ. We assume that the minor effect is due to the function of the cAMP-specific phosphodi- esterases. Addition of cAMP reduces the UAS activity of IREu whereas it has no effect on the activity of either UASru or UASrm.

124 KASSIR ETAL.

IREd -788 TTT~CGT~TTCGAGG~GGATCAAAGGCGC

III llllilllllll llllllllllllill IREu -1153 TTTTCGT~TTCGAGGGGAAGGATCAAAGGC GC

lililll lilll TTTTCGTG AGGGG

SCB STRE FIG. 8 IREu and IREd are almost identical repeats in the IME1 5' region carrying the known UAS sequences STRE and SCB. Sequence alignments of 1REu (upstream) and IREd (downstream) to the stress response element (STRE) and the Swi4/6 cycle box (SCB). We suggest that Msn2 binds the STRE element in IREu as Msn2 binds IREu as well as STRE elements in stress response genes. We further suggest that Sok2 binds the SCB element because it is highly homologous to the DNA-binding domain of Swi4 that binds such elements, and because genetic analysis reveals that it binds IREu (see text). The physical association between Sok2 and Msn2 suggests that they bind the DNA as a heterodimer,

sporulation and IME1 expression, suggesting that the activity of IREu is negatively regulated by cAMP. The signal transduction pathways that transmit the glucose signal to UASru and UASrm are not known.

a. The I R E u Element The sequence of IREu ( - 1 1 5 3 to - 1 1 2 1 ) reveals that it includes two known positive elements, a stress response element, STRE, and the Swi4/Swi6 cell cycle box, SCB (Fig. 8). An almost identical element, IREd, is present at - 7 8 8 to - 7 5 6 of IME1 (Fig. 3). IREd differs from IREu in two residues localized to the STRE and SCB elements (Fig. 8). ime l - lacZ chimeras whose 5' end are terminated downstream or upstream of either IREu or IREd show that IREu functions as a positive element, whereas IREd functions as a negative element (Sagee et al., 1998). Furthermore, unlike IREu, IREd promotes only low UAS activity when inserted upstream of his4-1acZ (Fig. 6), suggesting that the STRE and/or the SCB elements are the transcriptional activation sequences within IREu. The cAMP/PKA pathway negatively regulates IREu, promoting its URS activity and preventing its UAS activity in the presence of glucose (Sagee et al., 1998; Shenhar and Kassir, 2001). Deletion of BCY1, the regulatory subunit of P K A (Toda et al., 1987a), leads to no expression of IREu-his4-1acZ, whereas a temperature-sensitive mutation in CDC25 leads to a substantial increase in the activity of IREu in the presence of either glucose or acetate as the sole carbon source (Sagee et al., 1998). Transcription factors that regulate the activity of IREu are the two homologous DNA-binding proteins, Msn2 and Msn4, Ime l and Sok2. Msn2 and Msn4 are absolutely required for the activity of 1REu, Ime l is required


for the complete UAS activity of IREu, and Sok2 is a negative regulator for IREu activity (Sagee et al., 1998; Shenhar and Kassir, 2001).

i. Msn2 andMsn4 These C2H2 zinc-finger proteins bind the STRE site present in many stress-induced genes (Martinez-15astor et al., 1996; Schmitt and McEntee, 1996), including the IREu and IREd elements in IME1 (Sagee et aL, 1998). Com- petition experiments reveal that IREu is a better competitor than IREd (Sagee et al., 1998), suggesting that Msn2 and Msn4 bind to the STRE element in IREu. In vitro transcribed and translated Msn2 can bind the STRE sequence and the IREu element (Martinez-Pastor et aL, 1996; Sherthar, 2001), suggesting that binding is independent of posttranslational modifications and/or the presence of additional proteins. However, two lines of evidence suggest that Msn2 forms a heterodimer with Sok2 (see Section III.C. 1 .a.ii): (1) Msn2 physically associates with Sok2 and (2) deletion of the postulated Sok2 binding site within IREu (the SCB element) abolishes the activity of IREu (Shenhar and Kassir, 2001). These results suggest that in vivo, Msn2 forms a heterodimer with Sok2, and that Sok2 facilitates its binding to the DNA. In the absence of Sok2, an imposter protein can promote the binding of Msn2/4 to STRE (Fig. 8; Shenhar and Kassir, 2001). Msn2/4 are apparent targets of the cAMP/PKA pathway. This is concluded from the following observations: (1) Deletion of both MSN2 and MSN4 suppresses the lethality of a strain deleted for the three TPK genes (TPK1-3 are the three homologous genes encoding the catalytic activity of PKA; Smith et aL, 1998; Toda et al., 1987b). (2) Msn2 includes sites required for its nuclear import (NLS) as well as for its export (NIS), whose functions are regulated by glucose through the cAMP/PKA pathway (Gorner et al., 2002). Glucose starvation and inactivation of the cAMP/PKA pathway through mutations lead to nuclear localization, whereas addition of glucose or cAMP leads to cytoplasmic localization (Gorner et al., 1998, 2002). Interest- ingly, the NIS element is also regulated by the TOR signaling pathway. When this signal pathway is activated, the binding of Msn2/4 to Bmh2, the 14-3-3 adaptor, sequesters it from the nuclei (Beck and Hall, 1999). 3. The NLS site of Msn2 contains four PKA consensus sites. These residues are phosphorylated in vivo in response to glucose addition, depending on the presence of the three TPK genes. Serine to alanine mutations of all these sites lead to constitutive nuclear localization of Msn2, whereas serine to aspartic acid, mimicking a phosphorylated serine residue, leads to its cytoplasmic localization (Gorner et al., 2002).

ii. Sok2 SOK2 encodes a DNA-binding protein that is highly homologous to the DNA-binding domain of Swi4 and Phdl proteins that are known to bind the SCB consensus sequence. This homology suggests that Sok2 might also bind the same sequence. Direct binding of Sok2 to IREu was not reported, however, the following genetic evidence suggests that Sok2 binds IREu under all growth conditions. The IREu-his4-1acZ reporter shows a 10-fold increase in expression in the triple mutant sok2A msn2A msn4A in comparison to the double mutant msn2A msn4A. On the other hand, IREu-h i s4 - lacZ is not expressed in the sok2T598A msn2A msn4A triple mutant. The sok2T598A allele, similar to the SOK2 deletion

126 KASSIR ETAL.

allele, is defective in repression, but unlike the latter, the defective Sok2 protein is present in the cells (Shenhar and Kassir, 2001). These results imply that Sok2 binds IREu under all growth conditions, and that in its physical absence an imposter protein can bind and activate transcription. Sok2 functions as a transcriptional repressor for several PKA target genes such as GAC1, SSA3, SWI5, and IME1 (Pan and Heitman, 2000; Shenhar and Kassir, 2001; Ward et al., 1995). Furthermore, it functions as a negative regulator of pseudohyphal growth (Ward et al., 1995) and meiosis (Shenhar and Kassir, 2001), and as a positive regulator in the mitotic cell cycle (Ward et al., 1995). Glucose regulates both the transcription of SOK2 and the repression activity of Sok2 protein. The latter is concluded from the observation that a Sok2-Gal4(bd), expressed from the ADH1 promoter represses the transcription of UAS~aL]-UASms4-his4-lacZ, but only in the presence of glucose (SD media) (Shenhar and Kassir, 2001). The signal pathway regulating the transcription of SOK2 is not known (Shenhar and Kassir, 2001). However, the signal pathway transmitting the glucose signal regulating Sok2 repression activity is the cAMP/PKA pathway. This is evident from the following observations: (1) Overexpression of SOK2 suppresses the temperature-sensitive growth defect of a tpklA tpk2-ts tpk3A mutant (Ward et al., 1995). (2) Repression of IREu- his4-1acZ and UASgall-UAShis4-his4-lacZ by either Sok2 or Gal4(bd)-Sok2, respectively, is relieved in cdc25-5 cells incubated at the nonpermissive temperature, as well as by a threonine to alanine mutation in a PKA consensus site in Sok2 (Shenhar and Kassir, 2001). Furthermore, Sok2 is a phosphoprotein whose phosphorylation depends on this same threonine (T598) residue (Shenhar and Kassir, 2001).

In the absence of glucose Sok2 does not repress transcription. Relief of repression in the absence of glucose depends on its N-terminal domain, amino acids 1-247, as well as on Imel (see Section III.E; Shenhar and Kassir, 2001). The mode by which Sok2 represses transcription and Imel relieves repression is not known.

b. R iml5 Riml5 encodes a serine/threonine protein kinase whose activity in glucose growth media is inhibited due to its phosphorylation by PKA (Reinders et al., 1998). In addition, the transcription of RIM15, and consequently the steady- state level of Riml5, is increased in acetate growth media (Vidan and Mitchell, 1997). Diploid cells deleted for RIM15 or carrying a kinase-dead point mutation are sporulation deficient (Vidan and Mitchell, 1997). Deletion of RIM15 causes a drastic reduction in the transcription of IME1. The mode of action of Riml5 and the IME1 element regulated by it are not known.

2. The Snfl Signal-Transduction Pathway

SNF1 encodes a protein kinase whose activity as a kinase is inhibited in the presence of high levels of glucose (Jiang and Carlson, 1996). Snfl function is required for the


expression of glucose-repressed genes (Lesage et al., 1996). Snfl phosphorylates the DNA-binding protein Migl (Treitel et aL, 1998) that recruits the Tupl/Ssn6 repression complex to the glucose-repressed genes to which it binds (Nehlin et al., 1991). Snfl is required for the high level induction in the transcription of lME1 in sporulation conditions, and diploid cells deleted for SNF1 arrest prior to premeiotic DNA replication, meiotic recombination, and spore formation (Honigberg and Lee, 1998). Overexpression of either Msn2 or Msn4 suppresses a temperature-sensitive allele of SNF1 (Estruch and Carlson, 1993), suggesting that the effect of Snfl on IME1 might be mediated through Msn2/4. It is not known, though, whether Msn2/4 are direct targets of Snfl. Genetic evidence suggests that Snfl is in a pathway separate from the cAMP/PKA pathway (Thompson-Jaeger et aL, 1991) and both regulate Msn2/4. The sequence of lME1 shows no homology to the Migl binding site, and the region in IME1 regulated by Snfl is not known.

In the meiotic cycle Snfl is also required following the transcription of IME1. When IME1 is placed on a multicopy plasmid it is highly expressed in both wild- type and sn f lA diploid cells, nevertheless, in the SNF1 deleted strain overexpressing Imel, the EMG IME2 is only partially expressed; 10-15% of the cells complete premeiotic DNA replication and meiotic recombination, but spores are not formed (Honigberg and Lee, 1998). It was suggested that Snfl is required in the meiotic cycle at three points: for the transcription of Imel, for the transcription of Ime2, and for spore formation (Honigberg and Lee, 1998).

3. Respiration and the Transcription of IME1

The presence of glucose prevents the activity of the mitochondria, whose function is required for sporulation (Berger and Yaffe, 2000). The transcription of IME1 is absent in diploid cells without mitochondria--petites, or in cells treated with oligomycin--an inhibitor of the mitochondrial ATPase (Treinin and Simchen, 1993). It is not known whether mitochondrial function is also required at a stage preceding the transcription of IME1. The site within IME] that responds to mitochondria function is not known, nor is it known how the respiration signal is transmitted. The connection between mitochondria function and IME] transcription is also evident from the identification of the Riml (Riml01) Rim8, Rim9, Riml3, and Rim20 proteins as positive regulators of lME1 (Li and Mitchell, 1997; Su and Mitchell, 1993a). RIMI encodes a C2H2 zinc finger protein that is required for high-level expression of IME1 as well as for efficient sporulation (Su and Mitchell, 1993b). Activation of Riml requires its cleavage by the products of Rim8, Rim9, and Riml3 (Li and Mitchell, 1997), as well as the activity of Rim20 that might be required for presenting Riml to Riml3 (Xu and Mitchell, 2001). Riml is localized to mitochondria and is required for mitochondria DNA replication, and consequently for the maintenance of the mitochondria (Berger and Yaffe, 2000; Van Dyck et al., 1992). Thus, the effect of these RIM],8,9,13,20 genes on

128 KASSlR ETAL.

the transcription of IME1 may be indirect, through their effect on the maintenance of the mitochondria.

D. Additional Proteins Regulating the Transcription of IME1

1. Mckl

MCK1 encodes a protein kinase required for efficient transcription of IME1, for expression of early and middle genes such as IME2 and SPS1,2, respectively, and for spore maturation (Neigebom and Mitchell, 1991). Expression of IME1 from the hetrologous GALl promoter suppresses the requirement of Mckl for the transcription of EMG and MMG, but spore maturation remains defective, suggesting that Mckl directly regulates IME1 transcription and spore maturation (Neigebom and Mitchell, 1991). MCK1 is one of four yeast genes showing homology to mammalian glycogen synthase kinase 3 (GSK3-fi), R I M l l , YOL128c, and MRK1. These homologues are not required for the transcription of IME1 (Hajji et al., 1999; Mandel et al., 1994; Rabitsch et al., 2001), suggesting that the transcription of IME1 is only partially dependent on Mckl.

Mckl inhibits the kinase activity of PKA both in vitro and in vivo, through a mechanism that does not depend on Mckl kinase activity (Rayner et al., 2002). This result implies that deletion of MCK] might increase rather than decrease the transcription of IME1. Therefore, the effect of Mckl on the transcription of IME1 is most probably not mediated by PKA. Mckl is subject to autophosphorylation, including on a conserved tyrosine (Y199) (Rayner et al., 2002). Phosphorylation of this tyrosine residue in Mckl, similar to other GSK3fl homologues, is required for its kinase activity on exogenous substrates, but not for autophosphorylation (Rayner et al., 2002). The Ptp2 and Ptp3 tyrosine phosphatases are required for Mckl dephosphorylation (Zhan et al., 2000). Deletion of either PTP2 or PTP3 has no effect on meiosis, however, the double mutant ptp2A p tp3A is sporulation deficient; it arrests in meiosis prior to premeiotic DNA replication, with a significant reduction in the expression of lME1 and IME2, and no expression of middle or late meiosis-specific genes (Zhan et al., 2000). A third tyrosine phosphatase, Yvhl, might contribute to this regulation (Guan et al., 1992). Deletion of YVH1 leads to minor effects on the transcription of IME1, a reduced transcription of IME2, and a reduction in the efficiency of asci formation (Park et al., 1996), but in the double mutant y v h l A p tp2A sporulation is almost diminished (Park et al., 1996). Thus, the effect of these tyrosine phosphatases on meiosis may be partially mediated through Mckl. The transcription of YVH1 is induced upon nitrogen depletion, suggesting that it might be involved with transmitting the nitrogen signal (Park et al., 1996).

Overexpression of Mckl suppresses the sporulation defect of cells deleted for TPS1 (De Silva-Udawatta and Cannon, 2001). TPS1 encodes one of the subunits


of the trehalose phosphate synthase complex (Reinders et aL, 1997). Thus, Tpsl may either regulate Mckl, or suppression of m c k l A by Tpsl is due to unrelated increase in the level of Imel. The region in IME1 regulated by Mckl and its mode of function are not known. However, the additive effects of mutations in MCK1, MDS3, PMD1, RIM1, and IME4 suggest that these genes affect different regulatory elements in the IME1 promoter (Su and Mitchell, 1993b).

2. Tupl/Ssn6

The Tupl/Ssn6 complex functions as a general transcriptional repressor upon recruitment by specific DNA-binding proteins (Keleher et al., 1992). These proteins are also negative regulators for the transcription of IME1 (Mizuno et al., 1998), but the specific DNA-binding protein that tethers them to IME1 is not known. Two regions in IME1 promoter respond to Tupl, the first one is from -9 1 4 to -621 and the second from -1215 to -915 (Mizuno et al., 1998), functioning as URS in the presence of Tupl and UAS in the absence of Tupl, respectively (Mizuno et al., 1998). Because these regions carry the IREd and IREu repeated elements (Fig. 3) that function as repression and activation sequences, respectively, it should be interesting to determine if the Tupl/Ssn6 complex mediates its effect through these elements, and whether Sok2 is the DNA-binding protein that recruits them to these elements.

3. Yhpl

YHP] encodes a homeodomain protein that binds to the UASv element in IME1 promoter, between -702 to -675 (Fig. 3; Kunoh et al., 2000). This 28-bp element by itself does not function as a UAS, but when tethered to heterologous reporter genes, it causes a 2-fold reduction in expression, suggesting that Yhp 1 functions as a repressor (Kunoh et al., 2000). The mode by which Yhpl represses transcription is not known, but its effect is independent of the Tupl/Ssn6 repression complex (Kunoh et al., 2000). The transcription of YHP1 is reduced in vegetative cells grown in the presence of acetate as the sole carbon source in comparison to glucose (Kunoh et al., 2000), implying that it might transmit a glucose signal. However, deletion of YHP1 has no effect on either the transcription of IME1 or on the ability of cells to enter and complete meiosis and sporulation (Kunoh et al., 2000).

4. The Swi/Snf Chromatin Remodeling Complex

Two components of the Swi/Snf complex, Snf2 and Swil, are required for high- level expression of IMEI (Yoshimoto et al., 1993). This complex is involved with transcriptional activation of genes to which it is tethered through interaction with specific activation domains (Carlson and Laurent, 1994).

130

E, Positive and Negative Feedback Regulation

KASSIR ET AL.

The transcription of IME1 is subject to positive regulation. Overexpression of Ime 1 leads to increase in the level of ime l - lacZ through its effect on the function of IREu (Shenhar and Kassir, 2001). The effect of Imel on additional elements has not yet been determined. This autoregulation is required to relieve repression by Sok2. This is deduced from the following results: (1) Expression of IREu-his4- lacZ is substantially reduced in diploid cells deleted for IME1 (Shenhar and Kassir, 2001). (2) Gal4(bd)-Sok2 represses the transcription of GAL1uAs-HIS4uAs-his4-lacZ in SD but has no repression activity in SA (Shenhar and Kassir, 2001). However, in diploid cells deleted for IME1 the transcription of the reporter gene is repressed in both SD and SA media (Shenhar and Kassir, 2001). Because Imel is not expressed in the presence of glucose, it is not surprising that the effect ofIme 1 is observed only in SA. As will be detailed in Section 1V.B.2, Imel does not bind directly to DNA, and is recruited to the DNA by interacting with a DNA-binding protein. Because the N-terminal domain of Sok2 is also required to relieve repression in SA, it is tempt- ing to suggest that Imel associates with the N-terminal domain of Sok2. No information on possible associations between these two proteins has yet been reported.

The transcription of IME1 as well as the steady-state level of Imel protein in meiotic conditions is transient; when induced upon a shift to SPM, the level of IME1 peaks at about 6-8 hr in SPM, followed by a decline (Guttmann-Raviv and Kassir, 2002; Kassir et al., 1988; Shefer-Vaida et al., 1995). This transient transcription depends on both Ime 1 and Ime2 (Guttmann-Raviv and Kassir, 2002; Mitchell et al., 1990; Shefer-Vaida et al., 1995; Smith and Mitchell, 1989; Yoshida et al., 1990). This negative feedback effect is on transcription of IME1 rather than the stability of the mRNA, as insertions of two separate regions, -621 to -924 and -9 2 4 to -1368 (Fig. 3) upstream of cyc l - lacZ exhibit the same feedback regulation (Shefer-Vaida et al., 1995). Imel is a nonstable protein that is degraded by the proteasome and whose half-life depends on Ime2 (Guttmann-Raviv and Kassir, 2002). IME2 encodes a meiosis-specific protein kinase that interacts with Imel and phosphorylates it in vitro (Guttmann-Raviv and Kassir, 2002). We suggest that the effect of Ime2 on shutting down the transcription of IME1 is due to its effect on the stability of Imel protein. In the presence of Ime2, degradation of Imel would lead to the establishment of Sok2 repression and silencing. On the other hand, in cells deleted for IME2, accumulation of Imel leads to positive autoregulation and increase in its transcription, and consequently the availability of Imel protein (Guttmann-Raviv and Kassir, 2002).

F. Summary

IME1 encodes the master regulator required to open a developmental pathway, that of meiosis, in S. cerevisiae. It is not surprising, therefore, that its transcription is regulated by an unusually large 5' region that is subject to multiple regulations.

REGULATION OF MEIOSIS IN BUDDING YEAST

MA TalMA To~ Glucose

1 ' R g r l / ~ n 4

~ R m e l

131

Nitrogen

i"::" \ c125 ,~ So sn2/4

- 2 1 1 2 -1641-1369 -1202 -1153-1122 -915 -788 -756 -621 -330 -229

FIG. 9 A schematic structure of the IME1 5 ~ untranslated region showing the positive and negative transcription factors that regulate its expression. The regulated transcription oflME1 is mediated by the combinatorial effect of distinct elements. The MATsignal is transmitted to UCS4 by Rmel. The activity of Rmel as a repressor requires Rgrl and Sin4. The cAMP/PKA signal transduction pathway transmits the glucose signal to IREu through the transcription factors, Sok2 and Msn2,4. In glucose growth media phosphorylation of Sok2 by PKA promotes its repression activity, whereas phosphorylation of Msn2 sequesters the protein in the cytoplasm. In acetate growth media Sok2 repression is relieved by a decrease in the activity of PKA, as well as by the function of Imel. The increased binding of Msn2 to IREu leads to transcriptional activation. Yhpl binds to UASv, however, its activity is not required for the transcription oflME1. Nitrogen, via Cdc25, regulates the URS activity of UCS1. It is not known whether the effect of Cdc25 is mediated through the cAMP/PKA and/or MAPK pathways. Filled box, elements required for transcriptional activation. Open box, elements whose function is only to repress transcription. A positive role is marked with an arrow, a negative role by a line. Dashed lines and a question mark, preliminary data.

Figure 9 is a summary of the results described above on the current knowledge on how the meiotic signals are transmitted to IME1. A combinatorial effect of at least 10 distinct elements ensures that IME1 will be transcribed only under the appropriate conditions, namely in MATa/MATot diploids, the absence of glucose, the presence of acetate, and nitrogen depletion. Two negative elements, UCS3 and UCS4, restrict elevated transcription of IME1 to cells expressing Matal and Mata2 peptides. In vegetative growth media with glucose as the sole carbon source IME1 is silent. This regulation is accomplished by using four distinct elements, UCS1, IREu, UASru, and UASv, whose function as repression elements is mediated through distinct signal transduction pathways. In acetate growth media a low level of transcription is accomplished by the positive activity of UASru, IREu, UASrm, and UASv that is opposed by negative regulation from UCS 1 as well as from three constitutive URS elements, URSu, URSd, and IREd. Upon nitrogen depletion, relief of UCS 1 repression promotes an increase in transcription.

132 KASSIR ETAL.

IV. Transcriptional Regulation of Early Meiosis-Specific Genes (EMG)

A. Silencing of Early Meiosis-Specific Genes in Vegetative Growth Conditions

In vegetative growth conditions with either glucose or acetate as the sole carbon source meiosis-specific genes are silent. Silencing of EMG is not only due to the absence of their main transcriptional activator, Imel, but is rather due to active repression. The genes required to promote this silencing are WTM3, UME2, UME3, SIN3, RPD3, UME5, UME6, and ISW2 (Goldmark et al., 2000; Strich et al., 1989, 1994; Vidal and Gaber, 1991). Except for Ume6 and Isw2, these genes are not essential for the expression of EMG under meiotic conditions (Goldmark et aL, 2000; Strich et aL, 1989).

1. The WTM Genes

UME1 (WTM3) and its two homologues WTM1 and WTM2 repress the transcription of the EMG IME2 synergistically (Pemberton and Blobel, 1997). These proteins also function as transcriptional repressors of the silent HMR cassette, and when tethered artificially to heterologous genes. These genes are nonessential; the wtrnl wtm2 wmt3 triple mutant is viable (Pemberton and Blobel, 1997). The Wtm proteins are expressed constitutively in both mitotic and meiotic conditions, and are localized to the nucleus (Pemberton and Blobel, 1997). The mode by which they cause repression is not known.

2. The UME2 Gene

UME2 (SRB9, SSN2) is a component of the SRB subcomplex of RNA polymerase II holoenzyme (Kornberg, 1999). Although it is a negative regulator of EMG under vegetative growth conditions (Strich et al., 1989), when fused to lexA it activates transcription (Song and Carlson, 1998).

3. The UME3 and UME5 Genes

The UME3 ( SRB 11, SSN8) and UME5 ( SRB 1 O, SSN3) encode integral components of the SRB subcomplex of RNA polymerase II holoenzyme (Cooper and Strich, 1998; Kornberg, 1999). UME3 encodes a cyclin C homologue that associates with the cyclin-dependent ldnase, Ume5 (Cooper et al., 1997; Cooper and Strich, 1998). Ume5 phosphorylates the C-terminal CTD repeats of RNA polymerase II, but this event is independent of its repression activity (Cooper and Strich, 1998), thus, it is not know how Ume5 represses the transcription of EMG. Ume3 is degraded

REGULATION OF MEIOSIS IN 8UODING YEAST 133

in meiotic conditions, and this degradation, which is independent of Ume5, is required for complete relief of repression of EMG (Cooper et al., 1997).

4. The SIN3 , U M E 6 , and RPD3 Genes

UME6 encodes a C6Zn2 protein that binds the URS 1 sequence present in many genes including EMG (Anderson et al., 1995; Strich et al., 1994). The C6Zn2 domain is sufficient for binding, and is required for its repression activity (Anderson et al., 1995; Strich et al., 1994). Deletion of UME6 causes high expression of EMG, as well as additional nonmeiotic genes carrying the URS 1 element, in vegetative growth conditions (Bowdish and Mitchell, 1993; Lopes et al., 1993; Park et al., 1992; Strich et aL, 1994). In addition, Ume6 functions as a transcriptional repressor when tethered to heterologous genes following its fusion to lexA (Kadosh and Struhl, 1997). This repression activity of Ume6 depends on the availability of Sin3 (Ume4, Rpdl) and Rpd3 (Kadosh and StruM, 1997). Coimmunoprecipitation and two-hybrid assays demonstrate physical association between Ume6(515-530) and Sin3(426-472) (the PAH2 domain), as well as between Sin3 and Rpd3 (Kadosh and Struhl, 1997; Kasten et al., 1997; Washburn and Esposito, 2001).

Sin3 functions as a transcriptional repressor when tethered to heterologous genes following its fusion to lexA (Wang and Stillman, 1993). The repression activity of Sin3 depends on Rpd3 (Kadosh and Struhl, 1997; Kasten et al., 1997). In accord, the double mutant sin3 rpd3 has the same phenotype as either single mutant (Vidal and Gaber, 1991).

R P D 3 encodes histone deacetylase whose deletion, similar to the SIN3 deletion, causes an increase in acetylation of lysines 5 and 12 in histone H4 in various genes carrying the URS1 element (Burgess et al., 1999; Rundlett et al., 1998). Recruitment of the Sin3/Rpd3 complex by Ume6 to DNA results in decreased acetylation of histone H3 and H4 in a restricted region, up to two nucleosomes from the binding site of Ume6 (Kadosh and Struhl, 1998).

5. The ISW2 Gene

Isw2 in a complex with Itcl functions as an ATP-dependent chromatin-remodeling factor that is required for the repression of EMG under vegetative growth conditions (Goldmark et al., 2000). Isw2 functions in parallel to the Sin3/Rpd3 histone deacetylase complex, as deduced from the observation that the level of expression of EMG is dramatically increased in the sin3 isw2 double mutant in comparison to the single mutants (Goldmark et al., 2000). Isw2 physically associates with Ume6, and because its binding to the URS l element depends on Ume6, it was concluded that Ume6 recruits the Isw2 complex to URS 1 (Goldmark et al., 2000). DNase I and micrococcal nuclease digestion of the chromatin near the EMG R E C I 0 4 show dependence on Isw2, suggesting that the Isw2 complex forms an inaccessible chromatin structure near the URS 1 element (Goldmark et al., 2000). These results

134 KASSIR ETAL.

suggest that Isw2 would be localized to the nucleus in vegetative growth media. However, this is not the case; Isw2 is mainly localized to the cytoplasm in vegetative growth cultures, to the nuclear and cytoplasmic microtubuli, and to the nucleus in meiotic cultures (Trachtulcova et al., 2000). There is no good explanation to clarify these contradicting results. Isw2 is required for meiosis, cells deleted for ISW2 arrest under meiotic conditions prior to premeiotic DNA replication, and asci are not formed (Trachtulcova et al., 2000). It is not known whether Isw2 is required for the transcription of EMG under meiotic conditions, or why cells deleted for ISW2 are sporulation deficient.

B. Expression of Early MSG under Meiotic Conditions

1. Ume6 Is Also a Positive Regulator

Ume6 is required for the transcription of EMG under meiotic conditions (Bowdish and Mitchell, 1993; Bowdish et al., 1995; Steber and Esposito, 1995; Strich et al., 1994; Szent-Gyorgyi, 1995). In addition, Sin3 and Rpd3 are required for their high level of expression (Lamb and Mitchell, 2001). Ume6, Sin3 and Rpd3 are present and physically associate in both vegetative growth and meiotic conditions (Lamb and Mitchell, 2001).

When tethered to heterologous genes, Ume6 can serve as either a transcriptional repressor or activator, depending on Sin3/Rpd3 and Imel, respectively (Bowdish et al., 1995; Kadosh and Struhl, 1997). Different domains in Ume6 are required for transcriptional repression and activation (Bowdish et al., 1995; Washburn and Esposito, 2001). The Ume6T99N mutant protein is competent in repression of EMG in growth conditions, but is defective in their expression under meiotic conditions (Bowdish et al., 1995). On the other hand, the M530T mutation in UME6 has a defect only in repression (Washburn and Esposito, 2001). In agreement, the transcriptional activator, Imel, associates with Ume6(1-232) (Rubin-Bejerano et al., 1996), whereas the transcriptional repressor, Sin3, associates with Ume6(515-530) (Kadosh and Stmhl, 1997; Kasten et al., 1997; Washburn and Esposito, 2001 ). The positive and negative roles of Ume6 are mediated through its binding to the URS 1 element whose presence is required for complete expression of EMG in starved cells (Bowdish et al., 1995).

2. The Function of Imel

IME1 encodes as a positive regulator of meiosis. Overexpression of Ime 1 bypasses the requirement for MATa 1 and MATot2 gene products for spomlation (Kassir et al., 1988). Diploid cells deleted for IME1 arrest under meiotic conditions in G1, as unbudded cells (Foiani et al., 1996; Kassir et al., 1988), prior to execution of any meiotic event, namely, expression of meiosis-specific genes, premeiotic DNA


replication, commitment to meiotic recombination, meiotic divisions, and spore formation (Foiani etal., 1996; Kassir et al., 1988; Mitchell et al., 1990; Smith and Mitchell, 1989). The requirement of IME] for transcription suggests that it might encode a transcription factor. However, its predicted amino acid sequence does not show any homology to known DNA-binding motifs (Sherman et al., 1993; Smith et al., 1993). Nevertheless, when Ime 1 is tethered to heterologous genes it functions as a potent transcriptional activator (Mandel et al., 1994; Smith et al., 1993).

As described above, the transcription of IME1 is subject to extensive regulation by the MAT alleles and nutrients. In addition, translation of IME1 mRNA is regulated by nutrients (Sherman et al., 1993). In vegetative growth media with acetate as the sole carbon source low but substantial levels of IME1 or ime l - lacZ mRNAs are observed, but Imel-lacZ protein is not detected. On the other hand, upon nitrogen depletion, the level of IME1 mRNA is not induced in MATa/MATa cells, but Imel-lacZ protein is readily observed (Sherman et al., 1993). Further- more, o~-factor and heat-shock treatment increases the transcription of IMEI, but translation occurs only in cells arrested in G1 by either a-factor, or the CDC mutations cdc28-4 and cdc4-3 (Sherman et al., 1993). These results suggest that nitrogen and/or cell cycle progression inhibits translation of lME1 mRNA. Because nitrogen depletion leads to a G1 arrest, it is possible that the effect of nitrogen is indirect, and that a G1 arrest is a prerequisite for efficient translation. IME1 has an atypical 5' UTR (untranslated region), 229 bp long (Sherman et al., 1993), which might mediate this regulation. Sequence analysis reveals that this RNA region can form a stem-and-loop secondary structure that might inhibit translation. However, deletion of this region has no effect on the translation of IMEI mRNA (Ben-Dov, 1994). Thus, it is not known how nitrogen and/or G~ phase control the efficiency of translation of IMEI m R N A .

Overexpression of lmel in acetate growth media does not induce meiosis and sporulation in logarithmic cultures of wild-type diploids (Colonfina et al., 1999; Sherman et al., 1993). On the other hand, in diploid cells arrested in G1 by recessive temperature-sensitive mutations in CDC28, CDC4, CDC25o CDC35 (CYR1), or concomitant deletion of the three CLN genes, high percentages of asci are formed (Colomina et al., 1999; Sherman et al., 1993; Shilo et aL, 1978), suggesting that posttranslafional modification of Imel or another factor required for meiosis depends on lack of function of these proteins. Indeed, in vegetative cultures, depending on the Cdc28/Cln function, Imel is phosphorylated and sequestered from the nucleus (Colomina et al., 1999). The localization of lmel in the cytoplasm prevents its transcriptional activation function and entry into meiosis. Cdc4 is an F-box protein (for review see Patton et al., 1998) required for degradation of specific targets in G1. Interestingly, one of its substrates is Farl, an inhibitor of ClrgCdc28 function (Henchoz et aL, 1997). Thus, the effect of Cdc4 on sporulafion may be mediated through Cdc28/Cln function. The role of Cdc25 and Cdc35, the two positive regulators of PKA on the function of Ime 1, is most probably through their effect on the association of Imel with Ume6 (see below).

136 KASSIR ETAL.

It is not clear if the activity of Imel as a transcriptional activator is subject to regulation. Using the SK1 strain and a LexA-Imel fusion, it was shown that transcriptional activation of the reporter gene l e xAop- lacZ depends on nitrogen depletion and the presence of a protein kinase, Riml 1 (Smith et al., 1993). Genetic analysis showed that in this system Riml 1 was required to relieve a repression activity of Imel that was modulated by the C-terminal domain of Ime 1. This conclu- sion was based on the following results: (1) A lexA-Imel fusion truncated for the C-terminal 66 amino acids activated transcription of lexAop-lacZ in r im l 1 A cells (Smith et al., 1993). (2) The LexA-ImelL321F mutant protein is impaired in both association with Riml 1 and transcriptional activation (Malathi et al., 1997). On the other hand, using the $288C strain and a Gal4(bd)-Imel fusion, it was shown that transcriptional activation of the reporter gene g a l l - l a c Z is independent of growth conditions or Riml 1 (Mandel et al., 1994; Rubin-Bejerano et al., 1996). In both strains Riml 1 is required for the transcription of EMG and sporulation (Mandel et al., 1994; Mitchell and Bowdish, 1992). The reasons for the disparity between these reports are not known, but several possibilities can be suggested: (1) the use of different strain backgrounds, $288C and SK1; and (2) the binding of the Gal4(bd) and lexA to the DNA requires its dimerization. The ga l4 (bd ) - IME1 gene includes the Gal4 dimerization signal, whereas the l e x A - I M E 1 gene might lack the lexA dimerization sequence (Golemis and Brent, 1992). Under meiotic conditions Imel can oligomerize, and this activity depends on Riml 1 (Rubin-Bejerano et al., 1996). Therefore, it is possible that the ability of the lexA-Imel protein to activate transcription only under meiotic conditions and only in the RIM11 strain is due to the ability of the protein to dimerize and bind the DNA only under these conditions.

Deletion and mutation analysis reveals that Imel is composed of at least two domains essential for meiosis: a transcriptional activation domain (ad) (amino acids 165-228), and an interaction domain (id) (amino acids 270-360) (Mandel et al., 1994; Smith et al., 1993). The N-terminal 160 amino acids are not essential for meiosis (Mandel et al., 1994). However, an Imel protein truncated for this domain gives rise to lower levels of asci in comparison to cells expressing this truncated protein fused to the Gal4(bd), suggesting that the later might either provide a nuclear localization signal or increase the stability of the protein (Mandel et al., 1994).

Two hybrid assays reveal that Imel interacts with Ume6, and that this interaction is through amino acids 270-360 of Imel [Imel(id)] and amino acids 1-232 of Ume6 [Ume6(id)] (Colomina et al., 1999; Rubin-Bejerano et al., 1996; Xiao and Mitchell, 2000). The validity of this interaction is evident from the use of different strain backgrounds and different two-hybrid systems, namely, the Gal4(bd)-Imel(id) with Ume6(id)-Gal4(ad) (Rubin-Bejerano et aL, 1996; Xiao and Mitchell, 2000) and the tetR-Imel (id) with Ume6(id)-VP16 (Colomina et al., 1999). However, direct demonstration of physical association between Imel and Ume6 is still missing. The use of the two-hybrid assay enables it to be demon- strated that this interaction is negatively regulated by both glucose and nitrogen. The interaction is absent in vegetative growth conditions with glucose as the sole


carbon source, and excessive interaction takes place under meiotic conditions (SPM media) (Colomina et aL, 1999; Rubin-Bejerano et aL, 1996). Shifting glucose grown stationary cells to acetate growth media leads to partial interaction (Rubin-Bejerano et aL, 1996), suggesting that the interaction of Imel with Ume6 depends on the absence of both glucose and nitrogen. Furthermore, this interaction is absolutely dependent on Rimll (Colomina et aL, 1999; Rubin-Bejerano et al., 1996) and partially dependent on Riml5 (Vidan and Mitchell, 1997).

Two models were suggested for the role of Imel Ume6 and Riml 1 in the transcription of EMG. (1) Bowdish et aL proposed that Ume6 is converted from a repressor to an activator following phosphorylation by Riml 1, and that Imel, which associates with Riml 1 (Bowdish et aL, 1994; Rubin-Bejerano et al., 1996), is required to recruit Riml 1 to Ume6 (Bowdish et aL, 1995). (2) Rubin-Bejerano et al. proposed that Ume6 recruits Imel to the URS1 element present in EMG, and that this recruitment promotes the Imel transcriptional activation domain to induce the transcription of EMG. According to the later, Riml 1 is required for the association between Imel and Ume6 (Rubin-Bejerano et aL, 1996). The following results support the second model. (1) Imel functions as a transcriptional activator (Mandel et aL, 1994; Smith et al., 1993). (2) Fusion of an heterologous transcriptional activation domain, that of Gal4, to Imel(id), leads to the expression of the EMG, IME2, and sporulation (Mandel et al., 1994). Moreover, this Imel(id)-Gal4(ad) fusion protein promotes meiosis of i m e l A diploid cells only when galactose is added to the sporulation media (Mandel et al., 1994). Because galactose is required to relieve repression of Gal80 on the transcriptional activation of Gal4(ad) (Johnston and Carlson, 1992), it was suggested that the normal function of Imel is to activate transcription (Mandel et aL, 1994). (3) A Gal4(ad)- Ume6(159-836) fusion protein that is expressed from the IME1 promoter bypasses the requirement for IME1 for the transcription of EMG and sporulation: it leads to expression of the EMG, HOP1, and to 40% sporulation (Rubin-Bejerano et aL, 1996). (4) A Gal4(ad)-Ume6 fusion protein can activate the transcription of the EMG SPO13 in SD media if it carries mutations that prevent its association with Sin3 (Washburn and Esposito, 2001). In the absence of the Gal4(ad), these ume6 mutants do not promote expression of EMG (Washburn and Esposito, 2001). These results suggest that by itself Ume6 does not function as a transcriptional activator, and its conversion into a positive regulator depends on the recruitment of the transcriptional activation domain ofImel (Rubin-Bejerano et aL, 1996; Washburn and Esposito, 2001). Currently, this is the established model, however, the ultimate proof would be the demonstration that Imel is present on the complex formed on URS1, and/or that it associates with the transcription machinery. Both models assume that because Imel functions through Ume6, deletions of either one of these genes would have a similar phenotype in meiotic cultures. However, i m e l A diploids arrest in G1, whereas ume6A cells mainly arrest at G2. We assume that the expression of EMG in vegetative cultures promotes the entry and progression through some meiotic events.

138 KASSIR ETAL.

Imel has at least two functions: it supplies a transcriptional activation domain, but it is also required to relieve repression of Sin3/Rpd3 (Washburn and Esposito, 2001). Diploid cells deleted for IME1 and expressing Gal4(ad)-Ume6 from the ADH1 promoter are sporulation deficient (Washburn and Esposito, 2001), but the Ga14(ad)-Ume6(M530T) mutant protein promotes low levels of spomlation (10%). Because the latter protein is defective in association with Sin3, it was concluded that Imel is required to relieve repression mediated by the Sin3/Rpd3 complex (Washburn and Esposito, 2001).

The interaction between Imel and Ume6 is regulated by nutrients, Riml 1 and Riml5. Because two-hybrid assays were used to determine this interaction, the regulated expression of the reporter genes might result from regulation at any of the following levels: (1) regulated physical association between Imel and Ume6 or (2) regulated transcriptional activation by the Ume6/Imel complex. The latter model assumes that Imel and Ume6 physically associate under all growth conditions, but in glucose growth media the resulting complex does not function as a transcriptional activator. This hypothesis is supported by the following results. (1) In vegetative growth media association of Ume6 with the Sin3/Rpd3 complex represses transcription (Kadosh and Strnhl, 1997). (2) A point mutation in Ume6 that prevents its association with Sin3 promotes transcriptional activation when the mutant protein is fused to Ga14(ad) (Washburn and Esposito, 2001). Direct demonstration of regulated (or not) physical association between Imel and Ume6 is required to distinguish between these models.

In accord with the role of Imel as a transcriptional activator, the protein is localized to the nucleus (Colomina etal., 1999; Rubin-Bejerano etal., 1996; Smith et al., 1993). Localization of Imel is independent of Rim11 (Rubin-Bejerano et al., 1996), but as described above, it is inhibited by the Cln/Cdc28 function (Colomina et aL, 1999). Figure 10 schematically illustrates how nutrients control the availability and activity of Imel

3. Proteins Required for the Association of I m e l with Ume6

a. The Function o f R i m l l and Its Homologs M c k l and M r k l Rim11 is absolutely required for the interaction between Imel and Ume6 (Colomina et al., 1999; Rubin-Bejerano et al., 1996), the expression of EMG, and spore formation (Bowdish et al., 1994; Rubin-Bejerano et al., 1996). Rim11 associates with Ime l(id) under all growth conditions (Bowdish et al., 1994; Rubin-Bejerano et aL, 1996), and in vitro it phosphorylates both Imel (Bowdish et al., 1994) and Ume6 (Malathi et aL, 1997). The Rim11 homologues Mckl and Mrkl have only minor effects on these processes (Neigeborn and Mitchell, 1991; Rabitsch et al., 2001).

The transcription of R I M l l is constitutive in vegetative and meiotic conditions; however, in imel A cells its expression in meiotic cultures is reduced, probably reflecting the use of the URS l-like site present in its promoter (Bowdish et aL, 1994).


Glucose Nitrogen

139

IMEI IME1 ~ mRNA ~ lmel ~ EMG ~ ~ Meiosis

Nucleus

FIG. 10 The expression and activity of Imel are regulated by nutrients. Schematic representation on how glucose and nitrogen regulates the availability and activity of Imel. The nucleus is depicted between the two circular fines, and cell membrane by a heavy line. A positive role is marked with an arrow, a negative role by a straight line. The transcription of IME1 is inhibited in the presence of glucose and nitrogen. Translation of IME1 mRNA is inhibited in the presence of a nitrogen source. In the presence of nitrogen, Imelis sequestered from the nuclei due to phosphorylation by Cdc28/Cln. Interaction of Imel with Ume6, and consequently transcriptional activation of early meiosis-specific genes (EMG), is inhibited by glucose and nitrogen.

The level of R i m l 1 protein is slightly reduced in glucose growth media in comparison to acetate (Bowdish et aL, 1994). R i m l 1 functions as a kinase that shows autophosphorylation (Bowdish et al., 1994). R i m l 1 is phosphorylated on tyrosine 199 (Zhan et aL, 2000). Tyrosine to phenylalanine mutation in this residue results in impaired expression of ime2- lacZ in vivo, and in a defect in phosphorylation Ume6 in vitro (Zhan et al., 2000). This mutation does not impair autophosphorylation (Zhan et al., 2000), suggesting different requirement for phosphorylation of exogenous substrates (see Section III.D. 1).

R i m l 1 associates with the C-terminal domain of h n e l , amino acids 270-360 (Malathi et aL, 1999; Rubin-Bejerano etaL, 1996). In vitro, R i m l 1 phosphorylates residues in the C-terminal 20 amino acids in this region of Ime l (Malathi et al., 1999). Simultaneous mutations of eight serine, threonine, and tyrosine of these residues have the following effects: (1) in vitro phosphorylation of Ime l by R iml 1 is absent, (2) I m e l does not interact with Ume6, (3) 1ME2 is not expressed, and

140 KASSIR ETAL.

(4) Asci are not formed (Malathi et aL, 1999). Imel is detected by antibodies directed against phosphotyrosines, and tyrosine to phenylalanine mutation in this domain results in impaired expression of ime2-lacZin vivo, suggesting that Rim l 1 phosphorylates these tyrosine resides in Imel.

Riml 1 controls meiosis by regulating not only Imel, but also Ume6. Using the two-hybrid method, colP, and in vitro kinase assay, Malathi et al. show that Riml 1 physically associates with Ume6, it phosphorylates Ume6(1-232), and the association between Riml 1 and Ume6 is independent of Imel (Malathi et al., 1997). In addition, the two-hybrid assay reveals interaction between Ume6 and Mckl (Xiao and Mitchell, 2000). In vivo, Ume6 is a phosphoprotein whose level of phosphorylation is increased in vegetative growth media with acetate as the sole carbon source in comparison to glucose (Xiao and Mitchell, 2000). Moreover, hyper- phosphorylation is observed upon nitrogen starvation (Xiao and Mitchell, 2000). Single deletion of RIM11, MCK1, or MRK1 has no effect on the in vivo pattern of phosphorylation of Ume6 (Xiao and Mitchell, 2000), but a substantial reduction in the pattern of phosphorylation is observed for the rim11 A m c k l A turk1 A triple mutant (Xiao and Mitchell, 2000). The redundant function of these GSK3-/3 homologues is also evident in cells carrying the partially active rim11K68R allele. Efficient sporulation is observed for cells carrying the MCK1 MRK1 wild-type alleles, and no sporulation in either m c k l A MRK1 or MCK1 mrkl A strains (Xiao and Mitchell, 2000). The Ume6 sequence reveals several consensus sites for phosphorylation by the mammalian GSK3-/3 homologue. Simultaneous substitution of serine and threonine residues to alanine in one such site (T99A T103A T107) leads to a reduction in phosphorylation, and concomitantly a dramatic reduction in the ability of Ume6(1-232) to interact with Imel, suggesting that phosphorylation is a prerequisite for interaction (Xiao and Mitchell, 2000).

The two-hybrid method demonstrates that the interaction between Riml 1 and Ume6 is regulated by the carbon source; the interaction is low in glucose growth media and it is increased in acetate growth media (Malathi et al., 1997). However, colP shows physical association between Ume6 and Riml 1 that is independent on nutrients (Malathi et al., 1997). The authors suggest that this is due to lower levels of Galbd-Ume6 in glucose versus acetate growth media (Malathi et aL, 1997). However, it is also possible that this is due to the inability of the Gal4(bd)- Riml 1/Gal4(ad)-Ume6 complex to activate transcription, due to the activity of Sin3/Rpd3. Nevertheless, the ability of Riml 1 to in vitro phosphorylate Ume6 is increased when both proteins are isolated from acetate grown cells, suggesting that the carbon source regulates either the activity of Riml l , or the ability of its substrate, Ume6, to be phosphorylated (Malathi et al., 1997).

The association of Imel with Ume6 and the association of Riml 1 with both Imel and Ume6 suggest that one association may serve as a scaffold for the second association. There is no direct evidence for association of Rim 11 with Ime 1 and Ume6 in cells deleted for UME6 or IME1, respectively. However, a Ga14ad- Ume6T99N mutant protein shows no interaction with Rim 11 in a two-hybrid assay,


and reduced interaction with Imel (Malathi et al., 1997). These results suggest that either the association between Ume6 and Riml 1 is required for the interaction between Imel and Ume6 (Malathi et al., 1997), or that the Ume6 T99 residue is required for the association of Ume6 with both Riml 1 and Imel.

b. The Function o f R i m l 5 Riml5 is absolutely required for the transcription of EMG such as IME2, HOP1, and SPO13 (Vidan and Mitchell, 1997). As described above (Section III.C.l.b), Riml5 is required for the transcription of lME1, however, expression of IME1 from a heterologous promoter does not suppress this phenotype, suggesting that Riml5 is required for an additional event. Indeed, Rim 15 is required for efficient interaction between Ime I and Ume6; in cells deleted for RIM15 a 5-fold reduction in their interaction is observed (Vidan and Mitchell, 1997). This effect is probably due to the effect of Rim15 on Ume6. It is required for complete in vivo phosphorylation of Ume6 in SA and SPM media (Xiao and Mitchell, 2000). Rim15 is not required for the in vitro kinase activity of Rim11 on Imel (Vidan and Mitchell, 1997).

4. The Function of Gcn5

The conversion of URS 1 from a repression to activation element requires the function of the histone acetylase, Gcn5 (Burgess et al., 1999). Diploid cells carrying a recessive mutation in GCN5 arrest under meiotic conditions prior to premeiotic DNA replication and meiotic recombination (Burgess et al., 1999). These cells express IME1, but are defective in the transcription of IME2 (Burgess et aL, 1999). Using antibodies directed against acetylated histones H3 and H4, Burgess et al. (1999) show that under meiotic conditions, depending on Gcn5, specific hyper- acetylation on bistone H3 is observed in the IME2 promoter. Deletion of RPD3, which is required for deacetylation of histone H4 in the IME2 promoter, does not suppress gcn5, suggesting that acetylation of histones is a prerequisite for the transcription of EMG (Burgess et al., 1999). It is not known how Gcn5 is recruited to the promoter of IME2 or additional EMG.

5. The Transcription of EMG Is Also Regulated by Positive Elements

In addition to the negative element, URS1, the promoters of EMG carry positive elements required for their transcription under meiotic conditions: the UASH element in HOP1 and the T4C sequence in IME2 (Bowdish and Mitchell, 1993; Vershon etal., 1992). Homologous sequences are found in additional EMG (Chu et al., 1998). Deletion or mutations of these elements prevent high-level expression of EMG (Bowdish and Mitchell, 1993; Vershon et al., 1992). Abfl binds to the UASH element (Gailus-Durner et aL, 1996). ABF1 encodes an essential DNA- binding transcriptional activator required for the transcription of various genes as

142 KASS~R ETAL.

well as for DNA replication; it binds to origins of DNA replication (Svetlov and Cooper, 1995). The protein that binds the T4C element in IME2 is not known.

6. Additional Positive Regulators

Ime2, Rim4, and Ndt80 are early and early-late genes required for high-level transcription of EMG. A detailed description of their functions is given in Section V.A.

7. The Role of Premeiotic DNA Replication and/or Recombination in Controlling EMG Expression

Hydroxyurea (HU) is routinely used to inhibit DNA synthesis as it inhibits ribonucleotide reductase (Elford, 1968; Slater, 1973). Shifting cells to meiotic conditions in the presence of 40 mM and 200 mM hydroxyurea leads to a reduction or no expression, respectively, of EMG (Davis et al., 2001; Lamb and Mitchell, 2001). It was suggested that perturbation of premeiotic DNA replication inhibits the transcription of EMG. However, cells deleted for CLB5 along with CLB6 or MUM2/SPOT8 arrest prior to premeiotic DNA replication, with complete expression of EMG (Davis etal., 2001; Dirick etal., 1998; Stuart and Wittenberg, 1998). These results imply that HU blocks DNA replication at different points than clb5 clb6 and mum2, and that only the HU block transmits a checkpoint signal to repress transcription. However, it is also possible that the effect of HU is not mediated through DNA replication. The latter hypothesis is strengthened by the observation that treatment of yeast cells with HU leads to a substantial decrease in RNA and protein synthesis (Slater, 1973).

The effect of HU is mediated through Rpd3 and Sin3, whose presence is required for the reduction in transcription (Lamb and Mitchell, 2001). In addition, in the presence of HU there is a reduction in phosphorylation of Ume6, a phenomenon that is associated with reduction in the activity of Ume6 (Lamb and Mitchell, 2001).

8. The Choice between Silencing and Expression of EMG

Silencing and expression of EMG are dependent on the URS 1 element present in their promoter. URS 1 serves as a silencing element in vegetative growth media with glucose as the sole carbon source, and is converted into an activation element under meiotic conditions, i.e., nitrogen depletion in the presence of acetate. Figure 11 summarizes the current knowledge and model for how this regulation is accomplished. Under all growth conditions Ume6 binds to URS1. However, nutrients control the protein complexes that are recruited by Ume6 to the URS 1 element. In glucose growth media Ume6 recruits two repression complexes, the HDAC Sin3/Rpd3 that leads to deacetylation of lysines in histone H4, and the


A

eh~MP

Glucose ~ ~ ~

,®

13 Acerbate, -Nitrogen

0 0 m

FIG. 11 Conditions leading to the choice between silencing and expression of early meiosis-specific genes. (A) Vegetative growth conditions. (B) Meiotic conditions. Ume6 binds to the URS1 element in early meiosis-specific genes (EMG) under all growth conditions. In vegetative growth conditions Ume6 recruits two repression complexes, Sin3/Rpd3 and Isw2, leading to histone H4 deacetylase and chromatin remodeling, respectively, and silencing. Under these conditions Riml5 and most probably Riml 1 are nonactive. The activity of Riml5 is repressed by PKA (Tpkl,2,3) phosphorylation. Under meiotic conditions (acetate media and nitrogen depletion) phosphorylation of lme 1 and Ume6 by Rim i 1 and Riml5 promotes the interaction of Imel with Ume6. Imel function is required to relieve repression by Sin3 and to activate transcription. In addition, transcriptional activation depends on histone acetylation by Gcn5. (See also color insert.)

Isw2 complex that leads to chromatin remodeling. These two activities are required for complete silencing of EMG. The Sin3/Rpd3 complex is conserved, and functions as a transcriptional silencer in all eukaryotes (Ng and Bird, 2000; Pazin and Kadonaga, 1997). However, Ume6 is not conserved, and in mammals, it is the Mad/Max and nuclear receptors that recruit Sin3/Rpd3 to the DNA (Ng and Bird, 2000; Pazin and Kadonaga, 1997). Similarly, the Isw2 complex is also conserved and functional in all eukaryotes (for review see Calms, 1998).

Under meiotic conditions (acetate media and nitrogen depletion) the Sin3/Rpd3 and Isw2 repression complexes are not functional. Relief of repression of Sin3 depends on Imel , which is expressed only in the absence of glucose. The mode by which Imel relieves repression of Sin3/Rpd3 and how Isw2 does not repress transcription under these conditions are not known. Relief of repression does not suffice for transcriptional activation, and requires Gcn5, the histone acetylase, as well as a transcriptional activation protein, Imel . Ume6 recruits Imel to URS1, and the interaction between these two proteins depends on the absence of glucose and nitrogen. These nutrient signals are transmitted to both Imel and Ume6 by

144 KASSIR ETAL.

two protein kinases, Riml5 and Riml 1. Because Rim15 is required for complete phosphorylation of Ume6 in SA and SPM, and because its kinase activity is inhibited in the presence of glucose by PKA, it is assumed that the glucose signal that inhibits the association of Imel with Ume6 is transmitted, at least partially, through Riml5. Because Riml5 is only partially required for the interaction of Imel with Ume6, the glucose signal must be transmitted through an additional protein. Riml 1 phosphorylates both Imel and Ume6, and this phosphorylation is essential for their interaction. It is not known how nutrients regulate the function of Riml 1.

V. Transcriptional Regulation of Middle Meiosi~Specific Genes (MMG)

The regulated transcription of middle meiosis-specific genes (MMG) depends on the presence of two positive elements, the middle sporulation element (MSE) (gNCRCAAAA/T) and an Abfl binding site (Chu et al., 1998; Chu and Herskowitz, 1998; Hepworth et al., 1995, 1998; Ozsarac et al., 1995, 1997; Pierce et al., 1998). The MSE elements present in different MMG are not identical; some, for example that in CLB1, function only as positive elements, whereas others, for example that of SMK1 or N D T 8 0 (designated inhere as MSE*), function also as repression elements in vegetative growth conditions and early meiotic times (Pierce et al., 1998; Xie et al., 1999). A schematic illustration on the regulation of MMG is illustrated in Fig. 12, and is discussed in the text below.

A. Positive Regulators of MMG

Ndt80 and Ime2 are two meiosis-specific positive regulators absolutely required for the transcription ofMMG (Chu et al., 1998; Chu and Herskowitz, 1998; Hepworth et al., 1998; Ozsarac et al., 1997). The sequential transcription of MMG following transcription of the early genes is due to the regulated transcription of both N D T 8 0 and IME2 (Chu and Herskowitz, 1998; Hepworth et al., 1998).

1. Ndt80

N D T 8 0 encodes a transcriptional activator that binds to the MSE and MSE* elements and activates transcription (Chu and Herskowitz, 1998). Cells deleted for N D T 8 0 arrest following the completion of premeiotic DNA replication and meiotic recombination, at pachytene, as mononucleate cells (Chu and Herskowitz, 1998; Hepworth et al., 1998; Xu et al., 1995). Ectopic expression of Ndt80 in vegetative growth conditions is sufficient to induce the transcription of most MMG (probably


Vegetative growth Meiotic conditions Meiotic conditions, no recombination

. . . . . .

MSE (CLB1) ] FIG. 12 Transcriptional regulation of middle meiosis-specific genes. Ndt80 is the transcriptional activator binding to the MSE element present in the 5' region of all middle meiosis-specific genes (MMG). A subset of MMG carries an MSE* site (SMK1 in comparison to CLB1) that can be bound by Suml. Suml associates with Hstl that functions as histone deacetylase, thus leading to silencing under vegetative growth conditions and at early meiotic times. Under meiotic conditions relief of repression is due to degradation of Suml by Ime2. Suml also represses the transcription of NDT80, as it carries both an MSE and MSE* elements. In addition, NDT80 carries two URS1 elements that are bound by Ume6. In vegetative growth media Ume6 recruits the Sin3/Rpd3 historic deacetylase complex that represses transcription. Under meiotic conditions Ume6 recruits Imel that can activate transcription, but only in the absence of Suml. Ime2 phosphorylates Ndt80, and this phosphorylation may contribute to the complete transcriptional activity of Ndt80. In the absence of meiotic recombination the pachytene checkpoint inhibits degradation of Suml and phosphorylation of Ndt80. Consequently, the level of Ndt80 is reduced, and the unphosphorylated Ndt80 is impaired in activating the transcription of MMG.

the ones ca r ry ing the M S E ra the r t han the MSE* e l emen t ) (Chu et al., 1998;

Chu and Herskowi tz , 1998), sugges t i ng tha t u n d e r g r o w t h cond i t ions the s e c o n d

posi t ive regula tor , Ime2 , is nonessen t i a l . I m e 2 is a lso n o n e s s e n t i a l u n d e r me io t i c

condi t ions . W h e n N d t 8 0 is expres sed f r o m a he te ro logous , IME2-independent pro-

moter, the M M G , SPS4, is exp re s sed in b o t h IME2 and ime2 A cel ls (Pak and Segall ,

146 KASSIR ETAL.

2002a). Nevertheless, in the latter, expression of SPS4 is both delayed and lower than in the IME2 diploid cells, suggesting that Ime2 may be required for high and efficient activity of Ndt80 (Pak and Segall, 2002a). This hypothesis is supported by the observation that Ime2 phosphorylates Ndt80 (Benjamin et al., 2002; Sopko et al., 2002). Ndt80 is a phosphoprotein (Benjamin et al., 2002; Tung et al., 2000; Sopko et al., 2002) whose in vivo extent of phosphorylation depends on IME2 (Benjamin et al., 2002). Furthermore, an in vitro kinase assay demonstrates that Ime2 directly phosphorylates Ndt80 (Benjamin et aI., 2002; Sopko et al., 2002).

Ndt80 is also required for high levels of transcription of IME1 as well as for its transient expression (Hepworth et al., 1998). This effect might be mediated through Ime2, as Ndt80 regulates the transcription of IME2 through an MSE element present in its promoter (Chu and Herskowitz, 1998).

N D T 8 0 is a meiosis-specific gene whose transcription is dependent on Imel and Ime2 (Fig. 12) (Chu and Herskowitz, 1998; Hepworth et al., 1998; Pak and Segall, 2002a). This regulated transcription is mediated by two URS 1 and two MSE elements (Chu and Herskowitz, 1998; Hepworth et al., 1998; Pak and Segall, 2002a). One MSE element functions either as a repression or activation element under growth and meiotic conditions, respectively, whereas the second one functions only as an activation element (Pak and Segall, 2002a; Xie et al., 1999). Further- more, both URS 1 elements contribute to repression o f N D T 8 0 in vegetative cultures and for its high level expression under meiotic conditions (Pak and Segall, 2002a; Fig. 12). The presence of the MSE elements delays N D T 8 0 transcription by the Ume6/Imel complex in comparison to other EMG that carry only the URS1 element (Chu and Herskowitz, 1998; Hepworth et al., 1998; Mitchell et al., 1990; Pak and Segall, 2002a; Yoshida et al., 1990).

2. Ime2

IME2 encodes a meiosis-specific protein kinase that shows 58.9% similarity and 37% identity to the human cyclin-dependent kinase, CDK2 (Kominami et al., 1993). The crystal structure of hCDK2 reveals that cyclin A binds to two regions: PSTAIRE and the T-loop (Jeffrey et al., 1995). This binding is required to induce a conformational change that promotes activation of the kinase. Ime2 does not carry the PSTAIRE sequence, but it shows 67% similarity and 52.3% identity to the T-loop region of hCDK2 (Fig. 13). This homology raises the possibility that Ime2 might be activated by binding to a cyclin-like molecule, and that in the meiotic cycle it might replace Cdc28, the yeast CDK that regulates initiation and progression in the cell cycle (Lew et al., 1997). The following results support the hypothesis that in the meiotic cycle Ime2 might replace Cdc28: (1) Similarly to Cdc28, phosphorylation by Ime2 affects stability of Imel, Cdhl, and Sicl; the latter two proteins are known substrates of Cdc28 in the mitotic cell cycle (Bolte et al., 2002; Dirick et al., 1998; Guttmann-Raviv and Kassir, 2002). (2) Ime2 is absolutely required for premeiotic DNA replication and meiotic recombination in

A,

CDF,~


36 DRYQL IEKLC~AGNPG<YgTLANAQ~PLSN ~ L~KQHD I RGTL~DQpKNGHQNY ~ TKTQ~VVAII~T~ ...... LQ . DYI~qVREI~ ILA~

: - : t : t l : l . I . : l . l 1 : . . : I . : } 1 1 : 1 . : . • . I . . I : I l l . : : , : 2 EI~FQI~q~EK~ < } E G T ~ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T ~ E ~ V A L I ~ P , XDTt~T . . . . . . EGVPSTAXRE~SLLKEL

ATp binci%ng site PSTAIRE

IME2 121 PA~rDHL~ Q I FEVFI~ SF/~YQIiq~VMECME~NLyQ~qdRRP~VF S I PSLKS ~ LSQILA~LKH X~ ~ E N ~ LI T P S T Q ~

CDK2 58 . N H N . I N , K L Y L ~ D N T G ! P L P L I K S Y L F Q N S H R V L ~ , . ~LICgQNLLINTEG . . . . . . . . .

C2~talytlc do~i n

~ME2 213 QI GY~DNMVI KLADFGLARRVE . }~PYTAYVSTRWYRS~R 1125RS GYYSKPLD ~WAFGCVAVE~GANEIDQI~K I LEVLG~ p , .

.llllllIlll • :.- II I I lll. IiIll : III.::III,:II:. I:., IIIIII,,IIII:::I: -IIII CDK2 13~ ........ AI ~FGLARAF~VPVRT ~ T HEVVT LR"/RAPE Z ~ y S TAVD 2WSLGC I FAEMVTRRALFp~D SE IDQLFRZ FRTLGT pDE

T - l c < ~

IME2 303 I~SDF4~fN~TAP~FWDDASNL~.~LKLPYV~GSSLDHLLSSSQL S D L S ~ ~ T ~ E L ~ E ~ Q ~ G

: : , : . . . . . . : , I :1 1 . : I . , t : : l , I I I t : : I : : 1 1 1 . 1 , l . , - I l l : : . . . . . 1

CDK2 224 ~%~PG~TSMPDy ~S pP2~NA~D~ S/~/~p~LD ..... ~DG~SL ........ LS~ ....... LRYD PN~/II SAKAALAH PF~QD%"~PV~HLRL

T-lo~p

B. hCDK2 C. Ime2

FIG. 13 Ime2 is highly homologous to hCDK2. (A) Sequence alignment of Ime2 to hCDK2. (B) Ribbon depiction of the crystal structure of hCDK2 (Protein Data Bank structure code 1HCL). (C) Ribbon depiction of the homology-based model of Ime2 based on the CDK structure. The following stretches of residues are colored for clarity: the ATP binding site (yellow), The PSTAIRE site (orange), the catalytic site (red), and the T-loop (blue). The Ime2 model was prepared using the 3D-PSSM modeling algorithm (Kelley et al., 2000). The figures were prepared using InsightII (Accelrys). (See also color insert.)

cdc28-4 cells incubated at the nonpermiss ive temperature (Gut tmann-Raviv et al.,

2001). However, there are no reports on any yeast proteins that b ind to the T-loop-like sequence in Ime2 and are required for its k inase activity. Moreover, a recombinant Ime2 protein isolated from Escherichia coli is active in phosphoryl- ating his tone H1 (Donzeau and Bandlow, 1999), suggest ing that unl ike Cdc28,

148 KASSIR ETAL.

Ime2 is active in the absence of additional yeast proteins. However, phosphorylation of its native substrate, Gpa2 (see below), requires the isolation of Ime2 from yeast cells (Donzeau and Bandlow, 1999), suggesting that specificity, for at least some substrates, might require posttranslation modification or the presence of an activator.

Ime2 is a positive regulator of meiosis required for multiple functions: the correct timing and high level transcription of early meiosis-specific genes, the transcription of middle and late genes (Mitchell et al., 1990; Yoshida et al., 1990), the correct timing of entry into premeiotic DNA replication meiotic recombination and nuclear division (Benjamin et al., 2002; Foiani et al., 1996), as well as for ascus formation (Benjamin et al., 2002; Foiani et al., 1996; Mitchell et aL, 1990; Yoshida et al., 1990). When Ime2 is overexpressed, but only in the SK1 background, it bypasses the requirement for Imel for the transcription of EMG and sporulation (Mitchell et al., 1990), suggesting an Imel-independent pathway for activating the transcription of these genes (Mitchell et al., 1990). It is not known how Ime2, which encodes a kinase, replaces a transcriptional activator, nor if under normal conditions this pathway has any contribution to the transcription of these genes.

Ime2 functions also as a negative regulator for the following functions: (1) Phosphorylation of Ime i by Ime2 leads to its degradation by the 26 S proteasome (Guttmann-Raviv and Kassir, 2002). It is possible that the absence of Ime i reestab- lishes repression by Sok2 and Sin3 (see Sections III.C. 1.a.ii and IV.B.2; (Shenhar and Kassir, 2001; Washburn and Esposito, 2001), resulting in the transient transcription of IME1 and EMG. According to this model, in cells deleted for IME2, the continuous presence of Imel leads to the nontransient expression of IME1 and EMG (Mitchell et al., 1990; Yoshida et al., 1990). (2) In the meiotic cycle, upon completion of premeiotic DNA replication and the presence of Ime2, two subunits of the DNA polymerase ot-primase complex, Poll and Po112, are degraded (Foiani et al., 1996). (3) The level of the Clb/Cdc28 inhibitor, Sic 1, is reduced under meiotic conditions, a process regulated by Ime2 (Dirick et al., 1998). (4) When Ime2 is ectopically expressed in the cell cycle it phosphorylates Cdhl, an event caus- ing dissociation of Cdhl from APC (anaphase promoting complex--the ubiquitin ligase required for proteolysis of specific substrates), and consequently stabilization of its substrates, such as Clb2 and Cdc5 (Bolte et al., 2002). It is not known if Ime2 phosphorylates Cdhl in the meiotic cycle, and what the consequences of this event are for entry into the meiotic divisions. (5) In the meiotic cycle Ime2 is required to limit premeiotic DNA replication and nuclear division to one and two rounds, respectively (Foiani et al., 1996). It is assumed that this phenomenon results from stabilization of specific proteins or regulators of DNA replication and nuclear divisions.

The availability and function of Ime2 are regulated at several levels.

a. Transcript ional Regula t ion The transcription of IME2 is silent in vegetative growth conditions by the binding and activity of the Ume6/Sin3/Rpd3 and


Ume6/Isw2 complexes to the URS 1 element present in its promoter. Under meiotic condition, recruitment of Imel by Ume6 promotes the transcription of Ime2. An additional histone deacetylase activity, that of the Set3/Hos2 complex, regulates the transcription of IME2 as well as NDT80 early in meiosis (Pijnappel et aL, 2001). Deletion of SET3 orHOS2 has no effect during vegetative growth (although this might be due to repression by Sin3/Rpd3), but it leads to increased and ad- vanced transcription of IME2 and NDT80, as well as a moderate increase in the transcription of IME1 (Pijnappel et aL, 2001). Consequently, these cells progress faster through MI, MII, and asci formation (Pijnappel et aL, 2001). Ime2 is subject to positive autoregulation, which is most probably mediated by the MSE element present in its promoter and Ndt80 (see Section V.A. 1).

b. Protein Stability Ime2 is an extremely nonstable protein (Bolte et aL, 2002; Guttmann-Raviv and Kassir, 2002) with a half-life of about 5 rain (Guttmann- Raviv and Kassir, 2002). It is not known if the stability of Ime2 is subject to any regulation.

c. Activity Regulation Ime2 is subject to phosphorylation (Benjamin et al., 2002; Guttmann-Raviv and Kassir, 2002). In vitro kinase assays reveals autophosphorylation (Benjamin et aL, 2002; Guttmann-Raviv and Kassir, 2002; Kominami et aL, 1993), but its effect on the activity and/or stability of Ime2 is not known. The kinase activity of Ime2 is negatively regulated by its C-terminal nonessential domain (Kominami et al., 1993). This is deduced from the following observations: (1) Overexpression of an [me2 protein truncated for tiffs domain promotes meiosis in the presence of either nitrogen or glucose (Kominami et al., 1993), and (2) the in vitro kinase activity of Ime2 is higher for a truncated Ime2 protein in comparison to the wild-type (wt) protein (Kominami et al., 1993). Thus, in the presence of nutrients Ime2 is less, or nonactive. The nutrient signal is transmitted to the C-terminal domain through the Got protein, Gpa2 (Donzeau and Bandlow, 1999). Ime2 specifically associates with the GTP bound Gpa2 (Donzeau and Bandlow, 1999), a form whose level is increased in the presence of glucose (Versele et aL, 2001). In addition, the association between Gpa2 and Ime2 requires the presence of nitrogen (Donzean and Bandlow, 1999). Cells deleted for GPA2 show similar phenotypes to cells overexpressing the truncated Ime2 protein, namely, sporulation in the presence of glucose and nitrogen (Donzeau and Bandlow, 1999). Gpa2 associates with the glucose receptor, Gprl, and transmits the glucose signal to adenylate cyclase (Pan et aL, 2000), however, the effect of Gpa2 on Ime2 is independent ofPKA (Donzean and Bandlow, 1999). This is deduced from the observation that the bcy l - tpk l wl mutation that leads to low activity of PICA does not suppress the reduction in sporulation exhibited by cells expressing the constitutive active Gpa2G132V protein (Donzeau and Bandlow, 1999). The in vitro kinase activity of Ime2 on histone H1 is decreased by the addition of recombinant Gpa2yS (Donzeau and Bandlow, 1999), suggesting that Gpa2 inhibits the kinase activity

150 KASSIR ETAL.

of Ime2 (Donzeau and Bandlow, 1999). In vitro kinase assays also demonstrate that Ime2 phosphorylates Gpa2 (Donzeau and Bandlow, 1999), but the role of this phosphorylation is not known.

Ime2 kinase activity fluctuates in the meiotic cycle; it first peaks concomitantly with premeiotic DNA replication and then concomitantly with nuclear division (Benjamin et al., 2002). The second increase in activity is regulated by Cdc28 (Benjamin et al., 2002).

The activity of Ime2 is also regulated by Ids2 (Sia and Mitchell, 1995). Overex- pression of Ime2 in vegetative growth media is toxic (Bolte et al., 2002; Guttmann- Raviv and Kassir, 2002; Sia and Mitchell, 1995), and this toxicity is relived in cells deleted for IDS2 (Sia and Mitchell, 1995), suggesting that Ids2 is a positive regulator of Ime2. Ids2 is not required for meiosis (Sia and Mitchell, 1995), however, in its absence overexpression of Ime2 (in the SK1 strain) leads to the transcription of only the early meiosis-specific genes, whereas middle and late genes remain silent and spores are not formed (Sia and Mitchell, 1995). This result suggests that the activity of Ime2 is distinctly regulated at early and middle meiotic times (Sia and Mitchell, 1995), in agreement with the finding of Benjamin et al. (2002) reported above. The effect of Ids2 is mediated through the C-terminal domain of Ime2: Overexpression of Ime2 truncated for this domain suppresses ime l A in both wt and i d s2A cells (Sia and Mitchell, 1995). The steady-state level of Ids2 is decreased and then disappears in cells shifted to meiotic conditions (Sia and Mitchell, 1995).

R I M 4 is an EMG required for high-level expression of EMG, premeiotic DNA replication, timely and efficient commitment to meiotic recombination, nuclear division, and spore formation (Deng and Saunders, 2001; Soushko and Mitchell, 2000). Rim4 function is mediated through both the Imel and Ime2 transcriptional activation pathways (Soushko and Mitchell, 2000). r i m 4 A diploids overexpressing Ime2 are sporulation proficient, suggesting that Rim4 functions upstream of Ime2 (Soushko and Mitchell, 2000). Rim4 carries two RNA recognition motifs that are important for its role in meiosis (Soushko and Mitchell, 2000). The mode by which Rim4 affects transcription is not known, although it was proposed that it might stabilize IME2 mRNA (Deng and Saunders, 2001; Soushko and Mitchell, 2000).

3. Sin3 and Rpd3

Random screening for mutations preventing expression of MMG identified NDTSO

and SIN3 (Hepworth et al., 1998). Sin3 as well as Rpd3 are required for the transcription of MMG, suggesting that they function also as positive regulators, or that their function as positive regulators might be due to repression of a negative regulator (Hepworth et aI., 1998). Diploid cells deleted for SIN3 or RPD3 arrest at the same point as ndt80 cells, namely, following the completion of premeiotic DNA replication, as mononucleate cells (Hepworth et aI., 1998). The point of arrest is not due to defects in recombination, as concomitant deletion of S P 0 1 3


and S P O l l does not allow a bypass of the arrest, and the triple mutant cells remain sporulation deficient (Hepworth et al., 1998; Xu et aL, 1995).

B. Negative Regulators of MMG

SMK1 is a middle gene subject to silencing by binding of Suml to the MSE* element in its promoter (Xie et aL, 1999). Suml also represses the transcription of NDTSO; in cells deleted for SUM1 premature expression of NDTSO is observed (Pak and Segall, 2002a). Suml associates with Hstl, and the resulting complex, containing additional proteins, exhibits NAD+-dependent histone deacetylase activity (Pierce et al., 1998; Pijnappel et al., 2001; Rusche and Rine, 2001). Deletion of either SUM1 or HST1 leads to expression of SMK1 in vegetative growth conditions (Xie et al., 1999). This expression is probably independent of Ndt80, as NDT80 remains silent in suml A or hst l A cells (Xie et al., 1999). Relief of repression is regulated by Suml availability: The transcription of SUM1 is constitutive, but the level of Suml protein is reduced prior to expression of MMG, and then it is induced again. As described above, the transcription o f NDT80 is dependent on Ime2, but in cells deleted for both 1ME2 and SUM1, NDT80 is expressed (Pak and Segall, 2002a). These results suggest that Ime2 abrogates Suml repression (Pak and Segall, 2002a). It is possible, as in the case of Imel (Guttmann-Raviv and Kassir, 2002), that phosphorylation of Suml by Ime2 is required for the regulated degradation of Suml. The Suml/Hstl repression activity can be bypassed in vegetative growth media by overexpression of Ndt80 (Xie et al., 1999). Suml and Hstl are not required for meiosis; cells deleted for either gene complete meiosis and form viable spores (Lindgren et al., 2000).

The Sin3/Rpd3/Ume6 and Ssn6/Tup 1 repression complexes that regulate transcription of EMG are not involved with repression activity of MMG (Pierce et al.,

1998).

C. The Recombination Checkpoint

In meiosis, a checkpoint mechanism consisting of Radl7, Rad24, Mekl, Pch2, Mec3, and Ddcl prevents the transcription of MMG and entry into the first meiotic division in cells that have not properly completed synapsis of homologues and meiotic recombination (Roeder and Bailis, 2000). Diploid cells deleted for DMC1 are impaired in both meiotic recombination (Bishop et al., 1992) and expression ofMMG (Chu and Herskowitz, 1998; Hepworth et al., 1998), whereas dmcl cells carrying mutations in RAD17 or MEK1 express MMG (Chu and Herskowitz, 1998; Hepworth et al., 1998). Three targets of the pachytene checkpoint were identified; these are the protein kinase Swel that phosphorylates and inactivates Cdc28 (Leu and Roeder, 1999), the transcriptional activator Ndt80 (Pak and Segall, 2002b;

152 KASSIR ETAL.

Tung et al., 2000), and the transcriptional repressor Suml (Lindgren et aL, 2000; Pak and Segall, 2002b). This is concluded from the observations that in the double mutants dmcl swe l and dmcl suml MMG are expressed and cells enter the meiotic nuclear division (Leu and Roeder, 1999; Lindgren et al., 2000; Pak and Segall, 2002b; Tung et al., 2000). Overexpression of Ndt80 leads to expression of MMG and partial entry into nuclear division (Pak and Segall, 2002b). In this review we focus only on how this surveillance mechanism affects transcription (for a detailed review on the checkpoint pathway see Roeder and Bailis, 2000).

The pachytene checkpoint leads to a reduction in the transcription of NDT80 (Lindgren et al., 2000; Pak and Segall, 2002b). However, contradicting results, namely, no effect, were reported for other different strains (Chu and Herskowitz, 1998; Hepworth etal., 1998; Tung etal., 2000). Sum1 mediates the reduction in the transcription of NDT80. The availability of Suml is regulated by the pachytene checkpoint as evident from the observations that in dmcl cells the steady-state level of Suml is constitutive throughout the meiotic pathway, whereas in the double mutant dmcl radl 7 the level of Suml is reduced in meiotic prophase, as in the wild- type strain (Lindgren et al., 2000). Because Ime2 mediates the availability of Suml under normal meiotic conditions, it is possible that the effect of the checkpoint system on Sum1 is mediated through Ime2. Pak and Segall (2002b) suggest that the effect of Sum1 is mediated only through regulating the transcription of NDT80, as the triple mutant dmcl suml ndt80 does not enter nuclear division (Pak and Segall, 2002b). Moreover, they propose that in the dmcl suml cells, expression of the B-type cyclins is responsible for entry into meiotic nuclear division (Pak and Segall, 2002b). This hypothesis is supported by the observation that entry into nuclear division in swel hop2 cells is delayed in comparison to wild-type cells or to swe l hop2 cells overexpressing Clbl (Leu and Roeder, 1999). However, this model cannot explain why ectopic expression of Ndt80 in dmcl cells leads to inefficient entry into nuclear division in comparison to the dmcl suml cells (20% versus 60%) (Pak and Segall, 2002b). These results suggest that an additional target of Suml might be required for proper meiotic arrest (Lindgren et al., 2000). Because the CLB genes are not direct targets of Sum1, they are not the genes directly regulated by Suml (Lindgren et al., 2000).

The pachytene checkpoint inhibits phosphorylation of Ntd80 (Tung et al., 2000). In cells deleted for ZIP1 (a component of the synaptonemal complex required for synapsis of homologues; Sym etal., 1993) Ndt80 is partially phosphorylated (Tung et al., 2000), whereas in the double mutants zipl pch2 and zipl mek l it is highly phosphorylated (Tung et al., 2000). It was suggested that activation of transcription by Ndt80 requires its phosphorylation (Benjamin et al., 2002; Chu and Herskowitz, 1998; Hepworth et aL, 1998; Tung et al., 2000). Therefore, lack of expression of MMG is also due to the reduction in the phosphorylation of Ndt80. Because Ime2 is required for phosphorylation of Ndt80, it should be interesting to determine if Ime2 is the target for the pachytene checkpoint system.

In addition, the pachytene checkpoint mediates the transcription of MMG through the Cdc28 inhibitor, Swel. In swe l hop2 diploid cells CLB1 transcription


is increased to its normal level, although with a substantial delay, in comparison to wild-type or hop2 cells (Leu and Roeder, 1999). It should be interesting to determine whether this effect of Swe 1 on Cdc28 is mediated through Ime2, as Cdc28 is required for the activity of Ime2 that coincides with nuclear divisions (Benjamin et al., 2002), and Ime2 is absolutely required for the transcription of the CLB genes.

Vl. Transcriptional Regulation of Late Meiosis-Specific Genes

A. Early Late Genes

SGA1 is an early-late gene encoding a glucoamylase whose transcription in growth media is silenced by a negative element, NRE s°A, which exhibits no UAS activity (Kihara et aL, 1991; Mai and Breeden, 2000). Expression under meiotic conditions depends on a UAS element present in its promoter region (Kihara et al., 1991). In addition, it cat-ties four STRE elements (Mai and Breeden, 2000), but their role in the transcription of SGA1 is not known. Relief of repression by the NRE s°A element depends on Imel and Ime2. However, the activity of the UAS element is independent of these regulators, because it does not require the presence of both MATa and MATot alleles that are required for the expression of Ime 1 (Kihara et al., 1991). The activity of the positive element requires nitrogen depletion (Kihara et aL, 1991), demonstrating that the effect of nitrogen on meiosis is mediated not only through Ime 1.

Silencing of SGA1 in vegetative growth media depends on the chromatin- remodeling factor Isw2 (Goldmark et aL, 2000). As described above (Section IV.A.5), Isw2 is also a negative regulator of EMG, and it is recruited by Ume6 to their promoters. Because the URS 1 element to which Ume6 binds is not present in SGA1, it is not known how Isw2 is recruited to SGA1. The identities of the positive regulators promoting transcriptional activation of SGA1 are not known. However, one positive regulator, SME2, when present on a multicopy plasmid, increases the transcription of SGA1 in the presence of nitrogen, thus bypassing the nitrogen signal inhibiting spore formation (Kawaguchi et al., 1992). Deletion of SME2 has no effect on the regulated expression of SGA1 or on the efficiency of sporulation. The sequence and mode of function of SME2 are not known.

B. Mid-Late Genes

The transcription of the mid-late sporulation-specific genes DIT1 and DIT2 is induced upon completion of meiotic divisions (Friesen et al., 1997). Time of expression is compatible with function, as these divergently transcribed genes (Friesen

154 KASSIR ETAL

et al., 1997) encode enzymes required for biosynthesis of the dityrosine precursor that is incorporated into the outermost layer of the spore wall (Briza et al., 1990). A negative element, designated NRE DIT, is required for repression during vegetative growth (Friesen et al., 1997). (Note that NRE DIx is not identical to NRE SGA1 .) This region carries the middle sporulation-like element MSE and the DRE element (Bogengruber et al., 1998; Friesen et al., 1997) that are required for repression in growth conditions and activation under meiotic conditions. Two additional positive elements are required for high expression under meiotic conditions (Friesen et aI., 1997).

Transcriptional activation of the mid-late genes depends on three positive regulators, NdtS0 and Ime2, whose effects are most probably mediated through the MSE-like sequence (Friesen et al., 1997), and Riml (Riml01) through an uniden- tiffed region (Bogengruber et al., 1998). The effect of Riml may be indirect (see Section III.C.3). The repression activity of N R E pIT depends on Ssn6, Tupl, Rox3, Sin4, and Spe3 (Friesen et al., 1997, 1998). Rox3 and Sin4 are subunits of the mediator complex of RNA polymerase II (Gustafsson et al., 1997; Myer and Young, 1998) that repress transcription of many genes (Hanna-Rose and Hansen, 1996). SPE3 encodes spermidine synthase (Hamasaki-Katagiri et al., 1997), and accordingly, addition of spermidine to the media leads to increased repression (Friesen et al., 1998). The way in which these complexes are specifically recruited to NRE DIT is not known.

XBP1 is a mid-late gene whose transcription is initiated at the same time as that of DIT1,2, but unlike these genes its transcription is nontransient (Mai and Breeden, 2000). Accordingly, its regulated transcription is not mediated via an NRE Drr element (Mai and Breeden, 2000). XBP1 encodes a DNA-binding protein that functions as a repressor when fused to lexA. Deletion of XBP1 leads to a delay and reduction in the percentage of asci, whereas meiotic divisions are properly controlled (Mai and Breeden, 2000). It is not known how this effect, of Xbpl is mediated.

C. Late Genes

The transcription of the five late meiotic genes peaks following completion of meiotic divisions at 8-12 hr in sporulation media (Law and Segall, 1988). A rep- resentative of these genes is SPSIO0, which is involved in spore wall formation (Law and Segall, 1988). The transcription of SPSIO0 depends on Imel, Ndt80, and Amal (Cooper et al., 2000; Hepworth et al., 1998). AMA1 encodes a meiosis- specific subunit of APC/C that is required for degradation of CLB! in the meiotic cycle (Cooper et aL, 2000). The transcription of AMA1 is induced at the same time as MMG, but because it does not carry the Ndt80 biding site (Chu et al., 1998) its mode of regulation is not known. In addition, meiosis-specific splicing by the EMG Merl (Engebrecht and Roeder, 1990) determines the accumulation


of Amal protein (Cooper et al., 2000). Diploid cells deleted for A M A I arrest with a short spindle prior to the first meiotic division (Cooper et al., 2000). Ge- netic analysis suggests that Amal is dispensable for the second meiotic division, but is required for spore formation (Cooper et al., 2000). Further work is required to determine if Amal is directly involved with transcriptional regulation of late genes, for example, by degradation of a transcriptional repressor, or if the effect on transcription is mediated by a checkpoint mechanism. The transcriptional activator that binds to and activates transcription of the late genes is not known.

The late meiosis-specific genes SPSIO0 and DTT1 show basal levels of expression in vegetative growth conditions (Jung and Levin, 1999). This expression depends on a functional MAPK cascade that transmits the cell wall integrity signal (Jung and Levin, 1999). Activation of the MAPK Slt2/Mpk 1, or deletion of Rim 1, the transcription factor whose activity is regulated by it, reduces the expression the late meiosis-specific genes (Jung and Levin, 1999). It is not known whether Rim i binds the promoter region of late genes or if it is required for their expression under meiotic conditions.

VII. A Feedback Loop Controlling Meiosis

The transcription of all meiosis-specific genes is transient, reflecting the need for the function of these genes for a limited period. Nevertheless, it is important to point out that transient transcription does not necessarily reflect transient availability of proteins. For instance, in the mitotic cell cycle, the transcription of genes involved in DNA replication, such as CLB5, POLl , or POLl2 , is periodic and identically regulated (Lowndes et al., 1991; Schwob and Nasmyth, 1993). But the steady- state level of Poll and Poll2 is constant (Foiani et al., 1995), whereas the level of Clb5 is periodic (Irniger and Nasmyth, 1997). Periodicity of Clb5 is accomplished by its regulated degradation (Irniger and Nasmyth, 1997). The pattern of protein expression of many meiosis-specific genes is not known, however, the two main positive regulators of meiosis, Ime 1 and Ime2, are nonstable proteins whose protein levels mimic the level of their RNA. This suggests that at least in the case of Imel and Ime2, the transient availability might be a sign of requirement for only a short period. In agreement with this view, overexpression of Imel in meiotic cultures leads (in some strains) to inefficient sporulation, a substantial increase in nondisjunction, the formation of two-spored rather than four-spored asci, and a reduction in sporulation (Shefer-Vaida et al., 1995; Sherman, 1992).

Positive feedback loops control the transcription of both IME1 and IME2 (Fig. 14). Positive autoregulation by Imel is required to relieve repression mediated by Sok2, and thus leads to an increase in Imel level (Shenhar and Kassir, 2001). Positive autoregulation accelerates the availability of Imel and Ime2, and this

156 ~SS~R ETAL.

Pachytene Checkpoint

[ ,

\

FIG. ] 4 Positive and negative feedback loops control meiosis. Imel shows positive autoregulation that is required to relieve repression mediated by Sok2 and thus for its high-level transcription. Expression of early meiosis-specific genes (EMG) requires relief of repression of Sin3 and transcripfionN activation, two functions that are promoted by Imel. The transcription of middle genes (MMG) depends on Ime2 and NdtS0. Transcriptional activation by Ime2 is due to phosphorylation of the transcriptional activator, Ndt80, and degradation of the transcriptional repressor, Suml. Ime2 exhibits a negative feedback role; it is required to shut down the transcription ofIME1. Because Ime2 directly phosphorylates Imel, and this phosphorylation is required for degradation of Imel by the 26 S proteasome, it was suggested that the reduction in the transcription of 1ME1 as well as EMG is due to the absence of Imel and re- establishment of repression by Sok2 and Sin3, respectively. The transcription of MMG is repressed by the pachytene checkpoint that inhibits phosphorylation of NdtS0 and degradation of Suml.

enhanced expression might be essential for proper entry and progression through the meiotic cycle.

The transient transcription of all meiosis-specific genes is explained by the transient availability of I m e l , Ime2, and Ndt80. Phosphorylation of Ime l by Ime2 leads to its degradation by the 26 S proteasome (Guttmann-Raviv and Kassir, 2002). In the absence of I m e l , Sok2 represses the transcription of IME1, leading to a decrease in IME1 mRNA. It is not known whether the negative feedback regulation of Ime2 on the transcription of IME1 is mediated only through its effect on Ime l . Because the transcription o f l M E 2 depends on I m e l (Mitchell et al., 1990; Yoshida et al., 1990) and the half-life of Ime2 is very short (Bolte et aL, 2002; Guttmann-Raviv and Kassir, 2002), there are sufficient levels of Ime l to relieve repression by Sin3 (Washburn and Esposito, 2001) and to activate transcription of EMG. In the absence of Ime l lack of these two functions leads to shutting down the transcription of EMG. The transcription of M M G and L M G depends on Ime2 (Chu et al., 1998; Chu and Herskowitz, 1998; Friesen et aL, 1997; Hepworth et al.,


1998; Kihara etal., 1991; Ozsarac etal., 1997; Smith and Mitchell, 1989). In cells depleted of Imel, Ime2 is absent, and the transcription of the early-late and late genes is closed.

VIII. Concluding Remarks: The Choice between Developmental Pathways

S. cerevisiae is a simple eukaryote with limited developmental options. Diploid cells may choose between growth in yeast or pseudohyphal forms and meiosis. Two crucial mechanisms regarding developmental decisions are required for faithful growth, entry into a specific developmental pathway should take place only in response to specific signals and should be a signal to block entry into an alternative pathway. Concomitant entry into two developmental pathways could lead to chaos. In S. cerevisiae, the MATa and MATo~ gene products as well as the pachytene surveillance mechanisms ensure that only diploid cells can initiate meiosis. This is a crucial decision, because meiosis in haploid cells would lead to the formation of uneuploid gametes.

In S. cerevisiae, the meiotic cycle ends with the formation of dormant spores re- sistant to hazardous conditions. The decision to exit the mitotic cell cycle depends on the availability of nutrients. Entry into the meiotic cycle in the presence of nutrients can be a "waste." Several redundant mechanisms ensure that in the presence of glucose the meiotic pathway will be repressed: (1) The transcription of IME1 is repressed in the presence of glucose due to the presence of distinct negative elements (i.e., UASru, IREu, UCS1), each responding to a different signal pathway. Thus, if one signal pathway is malfunctioning, the activity of the additional signal pathways will ensure repression. Moreover, several UAS elements (i.e., UASru, IREu, UASrm), each regulated in a distinct manner, activate transcription in the absence of glucose. (2) The activity of line 1 is repressed in the presence of glucose by two distinct mechanisms: phosphorylation of Imel by the Cln/Cdc28 kinase sequesters the protein from the nucleus, and functional interaction between Imel and Ume6, which promotes transcriptional activation, is inhibited in the presence of glucose and nitrogen. The presence of nitrogen also prevents translation of lME1 mRNA and entry of Imel into the nucleus.

The presence of glucose also inhibits the function of Ime2. Normally Ime2 is available only under meiotic conditions, but cells developed mechanisms to ensure that in the presence of nutrients accidental expression of Ime2 will not lead to entry and completion of meiosis. In the presence of glucose activated Gpa2 binds to and inhibits the function of Ime2. Furthermore, Ime2 is a nonstable protein, thus under growth conditions the low level of Ime2 does not suffice for initiation of meiosis in the absence of Imel.

158

TABLE I List of Positive and Negative Regulators of Transcription of Meiosis-Specific Genes

KASSIR ETAL.

Name Description of function

ABF1

AMA1

BCY1

CDC25

CDC28

CDC35

GCN5

GPA2

HST1

IDS2

IME1

IME2

IME4

ISW2

ITC1

MCK1

MDS3

MSN2/4

An essential DNA-binding protein required for DNA replication and the transcription of several meiosis-specific genes carrying its binding site (UASH)

A meiosis-specific subunit of APC/C that is required for degradation of CLB1 in the meiotic cycle. Required for the transcription of LMG

The regulatory subunit of PKA. Positive regulator for 1ME1 transcription and sporulation

Ras GDP/GTP exchange factor. Positive activator of PKA, negative regulator of IME1

transcription. Transmits the nitrogen signal to UCS 1 and the glucose signal to IREu elements in IME1 promoter

Cyclin-dependent kinase that regulates initiation and progression in the mitotic cell cycle. In a complex with Cln phosphorylates Imel and sequesters it out of the nuclei. Required to activate Ime2 at the time cells enter the meiotic division

Adenylate cyclase. Positive activator of PKA, negative regulator of IME1 transcription and sporulation

Histone acetylase required for the transcription of EMG

A Ga protein that associates, when GTP bound, with Ime2. An inhibitor of Ime2 kinase activity

Histone deacetylase. Represses the transcription of MMG following recruitment by Suml

A positive regulator of Ime2 activity

The master regulator gene of meiosis. A transcriptional activator; recruited by Ume6 to the URS 1 element in EMG, and is required for their transcription. The transcription of IME1 depends on the presence of Matal and Mata2 as well as on glucose and nitrogen depletion. Translation and activity of Imel are regulated by nutrients

An early meiosis-specific gene encoding serine/threonine kinase, homologous to the human CDK2. Required for timely and high level transcription of EMG, and for the transcription of MMG and LMG. Negative regulator of Imel stability

A positive transcriptional regulator oflME1 whose transcription depends on the presence of Matal and Mata2 and nitrogen depletion

In a complex with Itcl functions as an ATP-dependent chromatin-remodeling factor. Required for the repression of EMG under vegetative growth conditions. Physically associate with Ume6 that recruits it to URS1 elements

In a complex with Isw2 functions as an ATP-dependent chromatin-remodeling factor. Required for the repression of EMG under vegetative growth conditions

Protein kinase required for efficient transcription of IME1, expression of EMG, MMG, and spore maturation. Homologous to mammalian glycogen synthase kinase 3 and S. cerevisiae, RIMl l, YOL128c, and MRK1. Required for phosphorylation of Ume6 and sporulafion in cells deleted for RIMll and MRK1

Negative regulator of 1ME1 transcription. Redundant function with its homolog, PMD1

Zinc finger transcriptional activators, which share redundant function and bind STRE elements. Negative regulators of mitosis. Positive regulators of meiosis and 1ME1 transcription through the IREu element in IME1 promoter. Targets of the cAMP/PKA pathway


TABLE I (continuod)

159


MRK1

NDT80

PMD 1

PTP2,3

RAS2

RES1

RGR1

R1M1

R1M4

R1M8

RIM9

RIM11

RIM13

R1M20

RIM15

RME1

ROX3

RPD3

SIN3

SIN4

Protein kinase homologous to mammalian glycogen synthase kinase 3 and S. cerevisiae, RIMl l , YOL128c, and MCK1. Required for phosphorylation of Ume6 and sporuladon in cells deleted for RIMl l and MCK1

A meiosis-specific transcriptional activator that binds the MSE element in MMG. An early MMG

Negative regulator oflME1 transcription. Redundant function with its homologue, MDS3

Tyrosine phosphatases, required for Mckl dephosphorylation as well as for high-level transcription oflME1 and IME2, and for expression of MMG and LMG

Small G protein that activates the cAMP/PKA and the MAPK signal pathways. Negative regulator of IME1 transcription

A dominant mutation in this gene bypasses MAT regulation for the transcription of IME1

A component of the RNA polymerase SRB mediator complex. Required for the repression activity of Rmel

A C2H2 zinc finger protein required for high-level expression o f l M E l and efficient sporulation. Required for mitochondria DNA replication and maintenance. Activity is regulated by cleavage that depends on Rim8, Rim9, Riml3, and Rim20

An early meiosis-specific gene required for high-level expression of EMG. Sequence identifies two RNA recognition motifs that are essential for function

Positive regulator of IME1 transcription. Required for activating Rim1

Positive regulator of 1ME1 transcription. Required for activating Rim 1

Tyrosine/serine/threonine kinase that is homologous to mammalian glycogen synthase kinase 3 and S. cerevisiae, MCK1, YOL128c, and MRK1. Required for the interaction between Imel and Ume6, and consequently for the transcription of EMG. Associates and phosphorylates both Imel and Ume6

Positive regulator oflME1 transcription. Required for activating Riml

Positive regulator of 1ME1 transcription. Required for activating Riml

A serine/threonine kinase whose activity is inhibited by PKA phosphorylation. Positive regulator for the transcription of IME1 and for the interaction between Imel and Ume6. Phosphorylates Ume6

A Zinc finger DNA-binding protein that represses the transcription of IME1 through the UCS4 element in IMEI promoter. The transcription of RME1 is negatively regulated by the Matal/Mata2 complex

A component of the RNA polymerase SRB mediator complex. Required for repressing the transcription of mid-late meiosis-specific genes

Histone deacetylase. Required for repression of EMG in media supporting vegetative growth. Positive regulator of MMG

Negative regulator that is required for repression of EMG in media supporting vegetative growth. Recruits Rpd3 to EMG due to its association with both Ume6 mad Rpd3. Positive regulator of MMG

A component of the RNA polymerase SRB mediator complex. Required for the repression activity of Rmel, and for repressing the transcription of mid-late meiosis-specific genes

(continues)

160

TABLE I (continued)

KASSIR ET AL


SNF1

SNF2

SOK2

SSN6

SUM1

SWI1

TPK1,2,3

TUP1

UME2

UME3

UME5

UME6

YHP 1

WTM1,2,3

YVH1

Serine/threonine protein kinase whose activity is inhibited by high levels of glucose. Required for the transcription of both IME1 and 1ME2, and for spore formation

Component of the Swi/Snf transcriptional activation complex. Required for high-level expression of IME1

Transcriptional repressor that binds SCB-like sequences. Positive regulator in the mitotic cell cycle. Negative regulator of pseudohyphal growth, meiosis, and IME1 transcription. Sok2 function as a repressor depends on phosphorylation by PKA

A general transcriptional repressor that regulates the transcription of IME1. Forms a repression complex with Tupl

A transcriptional repressor of MMG that binds the MSE* element. Recruits histone deacetylase activity by association with Hstl

Component of the Swi/Snf transcriptional activation complex. Required for high-level expression of IME1

Three genes encoding the catalytic subunit of PKA

A general transcriptional repressor that regulates the transcription of IME1. Forms a repression complex with Ssn6

A component of the SRB subcomplex of RNA polymerase II holoenzyme. Negative regulator of EMG transcription

A cyclin C homologue that associates with the cyclin-dependent kinase, Ume5. An integral component of the SRB subcomplex of RNA polymerase II holoeuzyme. Required to repress transcription of EMG in vegetative growth media. Degraded in meiotic conditions

A cyclin-dependent kinase that associates with the cyclin C homologue, Ume3. An integral component of the SRB subcomplex of RIgA polymerase II holoenzyme. Required to repress transcription of EMG in vegetative growth media

A C6Zn2 DNA-binding protein. Binds to URS 1 element. Functions as a negative regulator by recruiting the Sin3/Rpd3 and Isw2 complexes, and as a positive regulator by recruiting Imel

Homeodomain protein that binds to UASv, a specific region in the IME1 51 region. It is not required for the transcription of IME1

Transcriptional repressors that repress the transcription of IME2 synergistically

Tyrosine phosphatase whose transcription is induced upon nitrogen depletions. Has redundant function with Ptp2 in regulating sporulation

Yeast cells use the same regulators, but in reverse directions, to control alterna-

t ive deve lopmenta l pathways. Ime2 is a posi t ive regulator o f meios i s that prevents

pseudohyphae deve lopment in growth media wi th acetate as the sole carbon source

(Donzeau and Bandlow, 1999). The act ivi ty o f the c A M P / P K A signal pa thway is a

major p layer in de termining the deve lopmenta l choice yeas t cells make. Entry into

mitosis wi th ei ther the yeas t fo rm or f i lamentous morpho logy requires h igh act ivi ty


of this pathway (Gancedo, 2001), whereas entry into meiosis requires low PKA activity (Matsumoto et al., 1983). Sok2 is a positive regulator of mitosis (Ward et al., 1995) and a negative regulator for the transcription of 1ME1, meiosis, and filamentous growth (Shenhar and Kassir, 2001; Ward et al., 1995). The negative role of Sok2 in pseudohyphae formation is not clear as its Candida albicans homologue, Efgl, which is a negative regulator of meiosis when expressed in S. cerevisiae (complementing sok2A; Shenhar and Kassir, 2001), is a positive regulator of filamentous growth in both S. cerevisiae and C. albicans (Stoldt et aL, 1997). Msn2/4 exhibit reverse tasks, functioning as a negative regulator of the mitotic cell cycle (Smith et al., 1998) and filamentous growth (Stanhill et al., 1999) and as a positive regulator for the transcription of IME1 and meiosis (Shenhar and Kassir, 2001). The activity of Sok2 and Msn2/4 in growing cells requires their phosphorylation by PKA (Gorner et al., 1998; Shenhar and Kassir, 2001; Smith et al., 1998; Ward et al., 1995). The use of the same regulators, but in reverse directions for different developmental pathways, ensures that one pathway will be an alternative to the other one. When cells enter mitosis, meiosis will be repressed, whereas when ceils enter meiosis, mitosis will be blocked. Thus, a single signal transduction pathway, the cAMP/PKA, is sufficient to control two alternative developmental pathways.

Acknowledgments

We thank M. Foiani for his hospitality while writing this review, for fruitful discussions, and for critical reading of the review.

References

Anderson, S. F., Steber, C. M., Esposito, R. E., and Coleman, J. E. (1995). UME6, a negative regulator of meiosis in Saccharomyces cerevisiae, contains a C-terminal Zn2Cys6 binuclear cluster that binds the URS1 DNA sequence in a zinc-dependent manner. Protein Sci. 4, 1832-1843.

Beck, T., and Hall, M. N. (1999). The TOR signalling pathway controls nuclear localization of nutrient- regulated transcription factors. Nature 402, 689-692.

Ben-Dov, N. (1994). The translational regulation oflME1 in the yeast Saccharomyces cerevisiae. M.Sc. thesis, Technion, Haifa, Israel.

Benjamin, K. R., Zhang, C., Shokat, K. M., and Herskowitz, I. (2002). Control of landmark events in meiosis by the CDK Cdc28 and the meiosis-specific kinase Ime2. Submitted.

Benni, M. L., and Neigeborn, L. (1997). Identification of a new class of negative regulators affecting sporulation-specific gene expression in yeast [published erratum appears in Genetics 1998; 148(1), 537]. Genetics 147, 1351-1366.

Berger, K. H., and Yaffe, M. P. (2000). Mitochondrial DNA inheritance in Saccharomyces cerevisiae. Trends Microbiol. 8, 508-513.

Bishop, D. K., Park, D., Xu, L., and Kleckner, N. (1992), DMCI: A meiosis-specific yeast homolog of E. coli recA required for recombination, synaptonemal complex formation, and cell cycle progression. Cell 69, 439-456.

162 KASSIR ETAL

Blumental-Perry, A., Li, W., Simchen, G., and Mitchell, A. R (2002). Repression and activation domains of Rmelp structurally overlap, but differ in genetic requirements. MoL Biol. Cell 13, 1709-1721.

Bogengrnber, E., Eichberger, T., Briza, E, Dawes, I. W., Breitenbach, M., and Schricker, R. (1998). Spornlation-specific expression of the yeast DIT1/D1T2 promoter is controlled by a newly identified repressor element and the short form of Riml01p. Eur. J. Biochem. 258, 430-436.

Boger-Nadjar, E. (2000). Regulation of DNA replication in mitosis and meiosis in the budding yeast Saccharomyces cerevisiae. Ph.D. thesis, Technion--Israel Institute of Technology, Haifa, Israel.

Bolte, M., Steigemann, E, Brans, G. H., and Irniger, S. (2002). Inhibition of APC-mediated proteolysis by the meiosis-specific protein kinase Ime2. Proc. Natl. Acad. Sci. USA 99, 4385-4390.

Bowdish, K. S., and Mitchell, A. E (1993). Bipartite structure of an early meiotic upstream activation sequence from Saccharomyces cerevisiae. Mol. Cell. BioL 13, 2172-2181.

Bowdish, K. S., Yuan, H. E., and Mitchell, A. E (1994). Analysis ofRIMl l , a yeast protein kinase that phosphorylates the meiotic activator IME1. Mol. Cell. Biol. 14, 7909-7919.

Bowdish, K. S., Yuan, H. E., and Mitchell, A. E (1995). Positive conlxol of yeast meiotic genes by the negative regulator UME6. Mol. Cell. Biol. 15, 2955-2961.

Briza, E, Breitenbach, M., Ellinger, A., and Segall, J. (1990). Isolation of two developmentally regulated genes involved in spore wall maturation in Saccharomyces cerevisiae. Genes Dev. 4, 1775-1789.

Broach, J. R. (1991). RAS genes in Saecharomyces cerevisiae: Signal transduction in search of a pathway. Trends Genet. 7, 28-33.

Brock, D., Toda, T., Michaeli, T., Levin, L., Birchmeier, C., Zoller, M., Powers, S., and Wigler, M. (1987). The S. cerevisiae CDC25 gene product regulates the RAS/adenylate cyclase pathway. Cell 48, 789-799.

Burgess, S. M., Ajimura, M., and Kleckner, N. (1999). GCN5-dependent histone H3 acetylation and RPD3-dependent histone H4 deacetylation have distinct, opposing effects on IME2 transcription, during meiosis and during vegetative growth, in budding yeast. Proc. Natl. Acad. Sci. USA 96, 6835-6840.

Cairns, B. (1998). Chromatin remodeling machines: Similar motors, ulterior motives. Trends Biochem. Sci. 23, 20-25.

Carlson, M., and Laurent, B. C. (1994). The SNF/SWI family of global transcriptional activators. Curt. Opin. Cell Biol. 6, 396-402.

Chu, S., and Herskowitz, I. (1998). Gametogenesis in yeast is regulated by a transcriptional cascade dependent on Ndt80. Mol. Cell 1, 685-696.

Chu, S., DeRisi, J., Eisen, M., Mulholland, J., Botstein, D., Brown, E O., and Herskowitz, I. (1998). The transcriptional program of sporulation in budding yeast [published erratum appears in Science 1998; 282(5393):1421]. Science 282, 699-705.

Colomina, N., Gaff, E., Gailego, C., Herrero, E., and Aldea, M. (1999). G1 cyclins block the Imel pathway to make mitosis and meiosis incompatible in budding yeast. EMBO J. 18, 320-329.

Cooper, K. E, and Stfich, R. (1998). Functional analysis of the Ume3p/Srbl Ip-RNA polymerase II holoenzyme interaction. Gene Expr. 8, 43-57.

Cooper, K. F., Mallory, M. J., Smith, J. B., and Strich, R. (1997). Stress and developmental regulation of the yeast C-type cyclin Ume3p (Srbl lp/Ssn8p). EMBO J. 16, 4665-4675.

Cooper, K. E, Mallory, M. J., Egeland, D. B., Jarnik, M., and Strich, R. (2000). Amalp is a meiosis- specific regulator of the anaphase promoting complex/cyclosome in yeast. Proc. Natl. Acad. Sci. USA 97, 14548-14553.

Covitz, E A., and Mitchell, A. R (1993). Repression by the yeast meiotic inhibitor RME1. Genes Dev. 7, 1598-1608.

Covitz, R A., Herskowitz, I., and Mitchell, A. P. (1991). The yeast RME1 gene encodes a putative zinc finger protein that is directly repressed by al-alpha 2. Genes Dev. 5, 1982-1989.

Covitz, R A., Song, W., and Mitchell, A. R (1994). Requirement for RGR1 and SIN4 in RMEl-dependent repression in Saccharomyces cerevisiae. Genetics 138, 577-586.


Davis, L., Barbera, M., McDonnell, A.. McIntyre, K., Sternglanz, R., Jin, Q., Loidl, J.. and Engebrecht. J. (2001). The Saccharomyces cerevisiae MUM2 gene interacts with the DNA replication machinery and is required for meiotic levels of double strand breaks. Genetics 157, 1179-1189.

Deng, C., and Saunders, W. S. (2001). RIM4 encodes a meiotic activator required for early events of meiosis in Saccharomyces cerevisiae. Mol. Genet. Genomics 266, 497-504.

De Silva-Udawatta, M. N., and Cannon, J. E (2001). Roles of trehalose phosphate synthase in yeast glycogen metabolism and sporulation. Mol. Microbiol. 40, 1345-1356.

Dirick, L., Goetsch, L., Ammerer, G., and Byers, B. (1998). Regulation of meiotic S phase by Ime2 and a Clb5,6-associated kinase in Saccharomyces cerevisiae. Science 281, 1854-1857.

Donzeau, M., and Bandlow, W. (1999). The yeast trimeric guanine nucleotide-binding protein alpha subunit, Gpa2p, controls the meiosis-specific kinase Ime2p activity in response to nutrients. Mol. Cell. Biol. 19, 6110-6119.

Elford, H. L. (1968). Effect of hydroxyurea on ribonucleotide reductase. Biochem. Biophys. Res. Commun. 33, 129-135.

Engebrecht, J., and Roeder, G. S. (1990). MER1, a yeast gene required for chromosome pairing and genetic recombination, is induced in meiosis. Mol. Cell. Biol. 10, 2379-2389.

Engebrecbt, J., Masse, S., Davis, L., Rose, K., and Kessel, T. (1998). Yeast meiotic mutants proficient for the induction of ectopic recombination. Genetics 148, 581-598.

Estruch. E, and Carlson, M. (1993). Two homologous zinc finger genes identified by multicopy suppression in a SNF1 protein kinase mutant of Saccharomyces cerevisiae. MoI. Cell. Biol. 13, 3872-3881.

Fields, S. (1990). Pheromone response in yeast. Trends Biochem. Sci. 15, 270-273. Foiani, M., Liberi, G., Lucchini, G., and Plevani, R (1995). Cell cycle-dependent phosphorylation

and dephosphorylation of the yeast DNA polymerase alpha-primase B subunit. Mol. Cell. Biol. 15, 883-891.

Foiani, M., Nadjar-Boger, E., Capone, R., Sagee, S., Hashimshoni, T., and Kassir, Y. (1996). A meiosis- specific protein kinase, Ime2, is required for the correct timing of DNA replication and for spore formation in yeast meiosis. Mol. Gen. Genet. 253, 278-288.

Frenz, L. M., Johnson, A. L., and Johnston, L. H. (2001). Rmel, which controls CLN2 expression in Saccharomyces cerevisiae, is a nuclear protein that is cell cycle regulated. MoL Genet. Genomics 266, 374-384.

Friesen, H., Hepworth, S. R., and Segall, J. (1997). An Ssn6-~upl-dependent negative regulatory element controls sporulation-specific expression of DIT1 and DIT2 in Saccharomyces cerevisiae. Mol. Cell. Biol. 17, 123-134.

Friesen, H., Tanny, J. C., and Segall, J. (1998). Spe3, which encodes spermidine synthase, is required for full repression through NRE(DIT) in Saccharomyces cerevisiae. Genetics 150, 59-73.

Gailus-Durner, V., Xie, J., Chintamaneni, C., and Vershon, A. K. (1996). Participation of the yeast activator Abfl in meiosis-specific expression of the HOP1 gene. Mol. Cell. Biol. 16, 2777- 2786.

Gancedo, J. M. (200l). Control of pseudohyphae formation in Saccharomyces cerevisiae. FEMS Microbiol. Rev. 25, 107-123.

Goetsch, L., and Byers, B. (1982). Meiotic cytology ofSaccharomyces cerevisiae in protoplast lysates. Mol. Gen. Genet. 187, 54-60.

Goldmark, J. R, Fazzio, T. G., Estep, R W., Church, G. M., and Tsuldyama, T. (2000). The Isw2 chromatin remodeling complex represses early meiotic genes upon recruitment by Ume6p. Cell 103, 423-433.

Golemis, E. A., and Brent, R. (1992). Fused protein domains ilkhibit DNA binding by LexA. Mol. Cell. Biol. 12, 3006-3014.

Gorner, W., Durchschlag, E., Martinez-Pastor, M. T., Estruch, E, Ammeter, G., Hamilton, B., Ruis, H., and Schnller, C. (I 998). Nuclear localization of the C2H2 zinc finger protein Msn2p is regulated by stress and protein kinase A activity. Genes Dev. 12, 586-597.

164 KASSIR ETAL.

Gorner, W., Durchschlag, E., Wolf, J., Brown, E. L., Ammerer, G., Ruis, H., and Schuller, C. (2002). Acute glucose starvation activates the nuclear localization signal of a stress-specific yeast transcription factor. EMBO J. 21, 135-144.

Goutte, C., and Johnson, A. D. (1988). al protein alters the DNA binding specificity of alpha 2 repressor. Cell 52, 875-882.

Granot, D., Margolskee, J. E, and Simchen, G. (1989). A long region upstream of the IME1 gene regulates meiosis in yeast. Mol. Gen. Genet. 218, 308-314.

Guan, K., Hakes, D. J., Wang, Y., Park, H. D., Cooper, T. G., and Dixon, J. E. (1992). A yeast protein phosphatase related to the vaccinia virus VH1 phosphatase is induced by nitrogen starvation. Proc. Natl. Acad. Sci. USA 89, 12175-12179.

Gustafsson, C. M., Myers, L. C., Li, Y., Redd, M. J., Lui, M., Erdjument-Bromage, H., Tempst, R, and Kornberg, R. D. (1997). Identification of Rox3 as a component of mediator and RNA polymerase II holoenzyme. J. Biol. Chem. 272, 48-50.

Guttmann-Raviv, N., and Kassir, Y. (2002). Ime2, a meiosis-specific kinase in yeast, is required for destabilization of its transcriptional activator, Irnel. Mol. Cell. Biol. 22, 2047-2056.

Guttmann-Raviv, N., Boger-Nadjar, E., Edri, I., and Kassir, Y. (2001). Cdc28 and Ime2 possess redundant functions in promoting entry into premeiotic DNA replication in Saccharomyces cerevisiae. Genetics 159, 1547-1558.

Hajji, K., Clotet, J., and Arino, J. (1999). Disruption and pheuotypic analysis of seven ORFs from the left arm of chromosome XV of Saccharomyces cerevisiae, Yeast 15, 435-441.

Hamasaki-Katagiri, N., Tabor, C. W., and Tabor, H. (1997). Spermidine biosynthesis in Saccharomyces cerevisiae: Polyamine requirement of a null mutant of the SPE3 gene (spermidine synthase). Gene 187, 35-43.

Hanna-Rose, W., and Hansen, U. (1996). Active repression mechanisms of eukaryotic transcription repressors. Trends Genet. 12, 229-234.

Henchoz, S., Chi, Y., Catarin, B., Herskowitz, I., Deshaies, R. J., and Peter, M. (1997). Phosphorylation- and ubiquitin-dependent degradation of the cyclin-dependent kinase inhibitor Far lp in budding yeast. Genes Dev. 11, 3046-3060.

Hepworth, S. R., Ebisuzaki, U K., and Segall, J. (1995). A 15-base-pair element activates the SPS4 gene midway through sporulation in Saccharomyces cerevisiae. Mol. Cell. Biol. 15, 3934-3944.

Hepworth, S. R., Friesen, H., and Segall, J. (1998). NDT80 and the meiotic recombination checkpoint regulate expression of middle sporulation-specific genes in Saccharomyces cerevisiae. Mol. Cell. Biol. 18, 5750-5761.

Herskowitz, I. (1995). MAP kinase pathways in yeast: For mating and more. Cell 80, 187-197. Honigberg, S. M., and Lee, R. H. (1998). Snfl kinase connects nutritional pathways controlling meiosis

in Saccharomyces cerevisiae. Mol. Cell. Biol. 18, 4548-4555. Irniger, S., and Nasmyth, K. (1997). The anaphase-promoting complex is required in G1 arrested yeast

cells to inhibit B-type cyclin accumulation and to prevent uncontrolled entry into S-phase. J. Cell Sci. 110, 1523-1531.

Jeffrey, R D., Russo, A. A., Polyak, K., Gibbs, E., Hurwitz, L, Massague, J., and Pavletich, N. R (1995). Mechanism of CDK activation revealed by the structure of a cyclinA-CDK2 complex. Nature 376, 313-320.

Jiang, R., and Carlson, M. (1996). Glucose regulates protein interactions within the yeast SNF1 protein kinase complex. Genes Dev. 10, 3105-3115.

Johnson, A. D., and Herskowitz, I. (1985). A repressor (MAT alpha 2 product) and its operator control expression of a set of cell type specific genes in yeast. Cell 42, 237-247.

Johnston, L. H., Johnson, A. L., and Barker, D. G. (1986). The expression in meiosis of genes which are transcribed periodically in the mitotic cell cycle of budding yeast. Exp. Ceil Res. 165, 541-549.

Johnston, M., and Carlson, M. (1992). Regulation of carbon and phosphate utilization. In "Molecular and Cellular Biology of the Yeast Saccharomyees'" (E. W. Jones, J. R. Pringle, and J, R. Broach, Eds.), Vol. 2, pp. 193-281.


Jung, U. S., and Levin, D. E. (1999). Genome-wide analysis of gene expression regulated by the yeast cell wall integrity signalling pathway. Mol, MicrobioL 34, 1049-1057.

Kadosh, D., and Struhl, K. (1997). Repression by Ume6 involves recruitment of a complex containing Sin3 corepressor and Rpd3 histone deacetylase to target promoters. Cell 89, 365-371.

Kadosh, D., and Smahl, K. (1998). Targeted recruitment of the Sin3-rpd3 histone deacetylase complex generates a highly localized domain of repressed chromatin in vivo. MoL Cell, Biol. 18, 5121-5127.

Kao, G., Shah, J. C., and Clancy, M. J. (1990). An RMEl-independent pathway for sporulation control in Saccharomyces cerevisiae acts through IME1 transcript accumulation. Genetics 126, 823-835.

Kassir, Y., and Simchen, G. (1976). Regulation of mating and meiosis in yeast by the mating-type region. Genetics 82, 187-206.

Kassir, Y., and Simchen, G. (1985). Mutations leading to expression of the cryptic HMRa locus in the yeast Saccharomyces cerevisiae [published erratum appears in Genetics 1987; 116(1): 181 ]. Genetics 109, 481-492.

Kassir, Y., and Simchen, G. (1991). Monitoring meiosis and sporulation in Saccharomyces cerevisiae. Methods Enzymol. 194, 94-110.

Kassir, Y., Granot, D., and Simchen, G. (1988). IME1, a positive regulator gene of meiosis in S. cerevisiae. Cell 52, 853-862.

Kasten, M. M., Dorland, S., and Stillman, D. J. (1997). A large protein complex containing the yeast Sin3p and Rpd3p transcriptional regulators. MoL Cell. Biol. 17, 4852-4858.

Kawaguchi, H., Yoshida, M., and Yamashita, I. (1992). Nutritional regulation of meiosis-specific gene expression in Saccharomyces cerevisiae. Biosci. Biotechnol. Biochem. 56, 289-297.

Keleher, C. A., Redd, M. J.. Schultz, J., Carlson, M., and Johnson, A. D. (1992). Ssn6-Tupl is a general repressor of transcription in yeast. Cell 68, 709-719.

Kelley, L. A., MacCallum, R. M., and Sternberg, M. J. (2000). Enhanced genome annotation using structural profiles in the program 3D-PSSM J. Mol. Biol. 229, 499-520.

Kihara, K., Nakamura, M., Akada, R., and Yamashita, I. (1991). Positive and negative elements upstream of the meiosis-specific ghicoamylase gene in Saccharomyces cerevisiae. Mol. Gen. Genet. 226, 383-392.

Kominami, K., Sakata, Y., Sakal, M., and Yamashita, I. (1993). Protein ldnase activity associated with the IME2 gene product, a meiotic inducer in the yeast Saccharomyces cerevisiae. Biosci. Biotechnol. Biochem. 57, 1731-1735.

Kornberg, R. D. (1999). Eukaryotic transcriptional control. Trends CellBiol. 9, M46--49. Kunoh, T., Kaneko, Y., and Harashima, S. (2000). YHP1 encodes a new homeoprotein that binds to the

IME1 promoter in Saccharomyces cerevisiae. Yeast 16, 439-449. Kupiec, M., Byers, B., Esposito, R. E., and Mitchell, A. P. (1997). "Meiosis and Sporulation in

Saccharomyces cerevisiae". Vol. 3. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

Lamb, T. M., and Mitchell, A. R (2001). Coupling of Saccharomyces cerevisiae early meiotic gene expression to DNA replication depends upon RPD3 and SIN3. Genetics 157, 545-556.

Law, D. T., and Segall, J. (1988). The SPSIO0 gene of Saccharomyces cerevisiae is activated late in the spornlation process and contributes to spore wall maturation. MoL Cell. Biol. 8, 912-922.

Lengeler, K. B., Davidson, R. C., D'Souza, C., Harashima, T., Slien, W. C., Wang, R, Pan, X., Wangh, M., and Heitman, J. (2000). Signal transduction cascades regulating fungal development and viru- lence. Microbiol. Mol. Biol. Rev. 64, 746-785.

Lesage, R, Yang. X., and Carlson, M. (1996). Yeast SNF1 protein kinase interacts with SIP4, a C6 zinc cluster transcriptional activator: A new role for SNF1 in the glucose response. Mol. Cell. Biol. 16, 1921-1928.

Len, J. Y., and Roeder, G. S. (1999). The pachytene checkpoint in S. cerevisiae depends on Swel- mediated phosphorylation of the cyclin-dependent kinase Cdc28. Mol. Cell 4, 805-814.

Lew, D. J., Weinert, T., and Pringle, J. R. (1997). "Cell Cycle Control in Saccharomyces cerevisiae," Vol. 3. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.


Ozsarac, N., Straffon, M. J., Dalton, H. E., and Dawes, I. W. (1997). Regulation of gene expression during meiosis in Saccharomyces cerevisiae: SPR3 is controlled by both ABF1 and a new sporulation control element. MoL Cell, Biol. 17, 1152-1159.

Pak, J., and Segall, J. (2002a). Regulation of the prenfiddle and middle phases of expression of the NDT80 gene during sporulation of Saccharomyces cerevisiae. Mol. Cell Biol. 22, 6417-6429.

Pak, J., and Segall, J. (2002b). Role of Ndt80, Suml, and Swel as targets of the meiotic recombination checkpoint that control exit from pachytene and spore formation in Saccharomyces cerevisiae. Mol, Cell Biol. 22, 6430-6440.

Pan, X., and Heitman, J. (2000). Sok2 regulates yeast pseudohyphal differentiation via a transcription factor cascade that regulates cell-cell adhesion. Mol. Cell. Biol. 20, 8364-8372.

Pan, X., Harashima, T., and Heitman, J. (2000). Signal transduction cascades regulating pseudohyphal differentiation of Saccharomyces cerevisiae. Curr. Opin. Microbiol. 3, 567-572.

Park, H. D., Lnche, R. M., and Cooper, T. G. (1992). The yeast UME6 gene product is required for transcriptional repression mediated by the CAR1 URS1 repressor binding site. Nucleic Acids Res. 20, 1909-1915.

Park, H. D., Beeser, A. E., Clancy, M. J., and Cooper, T. G. (1996). The S. cerevisiae nitrogen starvation- induced Yvhlp and Ptp2p phosphatases play a role in control of sporulation. Yeast 12, 1135-I 151.

Patton, E. E., Willems, A. R., and Tyers, M. (1998). Combinatorial control in ubiquitin-dependent proteolysis: Don't Skp the F-box hypothesis. Trends Genet. 14, 236-243.

Pazin, M. J., and Kadonaga, J. T. (1997). What's up and down with histone deacetylation and transcription? Cell 89, 325-328.

Pemberton, L. E, and Blobel, G. (1997). Characterization of the Wtm proteins, a novel family of Saccharomyces cerevisiae transcriptional modulators with roles in meiotic regulation and silencing. MoL Cell. BioL 17, 4830-4841.

Pierce, M., Wagner, M., Xie, J., Gailus-Durner, V., Six, J., Vershon, A. K., and Winter, E. (1998). Transcriptional regulation of the SMK1 mitogen-activated protein kinase gene during meiotic development in Saccharomyces cerevisiae. Mol. CelL BioL 18, 5970-5980.

Pijnappel, W. W., Schaft, D., Roguev, A., Shevchenko, A., Tekotte, H., Wilm, M., Rigant, G., Seraphin, B., Aasland, R., and Stewart. A. E (2001). The S. cerevisiae SET3 complex includes two histone deacetylases, Hos2 and Hstl, and is a meiotic-specific repressor of the sporulation gene program. Genes Dev. 15, 2991-3004.

Primig, M., Williams, R. M., Winzeler, E. A., Tevzadze, G. G., Conway, A. R., Hwang, S. Y., Davis, R. W, and Esposito, R. E. (2000). The core meiotic transcriptome in budding yeasts. Nat. Genet. 26, 415-423.

Rabitsch, K. P., Toth, A., Galova, M., Schleiffer, A., Schaffner, G., Aigner, E., Rupp, C., Penkner, A. M., Moreno-Borchart, A. C., Primig, M., Esposito, R. E., Kleir, E, Knop, M., and Nasmyth, K. (2001). A screen for genes required for meiosis and spore formation based on whole-genome expression. Curr. BioL 11, 1001-1009.

Rayner, T. E, Gray, J. V., and Thomer, J. W. (2002). Direct and novel regulation of cAMP-dependent protein kinase by Mcklp, a yeast glycogen synthase kinase-3. J. BioL Chem. 277, 16814-16822.

Reinders, A., Burckert, N., Hohmann, S., Thevelein, J. M., Boiler, T., Wiemken, A., and De Virgilio, C. (1997). Structural analysis of the subunits of the trehalose-6-phosphate synthase/phosphatase complex in Saccharomyces cerevisiae and their function during heat shock. Mol. Microbiol. 24, 687-695.

Reinders, A., Burckert, N., Boiler, T., Wiemken, A., and De Virgilio, C. (1998). Saccharomyces cerevisiae cAMP-dependent protein kinase controls entry into stationary phase through the Riml5p protein kinase. Genes Dev. 12, 2943-2955.

Rine, J., and Herskowitz, I. (1987). Four genes responsible for a position effect on expression from HML and HMR in Saccharomyces cerevisiae. Genetics 116, 9-22.

Rine, J., Sprague, G. E, Jr., and Herskowitz, I. (1981). rmel mutation of Saccharomyces cerevisiae: Map position and bypass of mating type locus control of sporulation. Mol. Cell. Biol. 1, 958-960.

168 KASSIR ETAL.

Roeder, G. S. (1997). Meiotic chromosomes: It takes two to tango. Genes Dev. 11, 2600-2621. Roeder, G. S., and Bailis, J. M. (2000). The pachytene checkpoint. Trends Genet. 16, 395-403. Roman, H., and Sands, S. (1953). Heterogeneity of clones of Saccharomyces derived from haploid

ascospores. Proc. Natl. Acad. Sci. USA 39, 171-179. Roth, R., and Fogel, S. (1971). A system selective for yeast mutants deficient in meiotic recombination.

Mol. Gen. Genet. 112, 295-305. Rubin-Bejerano, I., Mandel, S., Robzyk, K., and Kassir, Y. (1996). Induction of meiosis in Sac-

charomyces cerevisiae depends on conversion of the transcriptional repressor Ume6 to a positive regulator by its regulated association with the transcriptional activator Imel. Mol. Cell. Biol. 16, 2518-2526.

Rundlett, S. E., Carmen, A. A., Suka, N., Turner, B. M., and Grnnstein, M. (1998). Transcriptional repression by UME6 involves deacetylation of lysine 5 of histone H4 by RPD3. Nature 392, 831-835.

Rusche, L. N., and Rine, J. (2001). Conversion of a gene-specific repressor to a regional silencer. Genes Dev. 15, 955-967.

Sagee, S., Sherman, A., Shenhar, G., Robzyk, K., Ben-Doy, N., Simchen, G., and Kassir, Y. (1998). Multiple and distinct activation and repression sequences mediate the regulated transcription of IME1, a transcriptional activator of meiosis-specific genes in Saccharomyces eerevisiae [published erratum appears in MoL Ceil. Biol. 1998; 18(6):3645]. Mol. Cell. Biol. 18, 1985-1995.

Schmitt, A. P., and McEntee, K. (1996). Msn2p, a zinc finger DNA-binding protein, is the transcriptional activator of the multistress response in Saccharomyees cerevisiae. Proc. Natl. Acad. Sci. USA 93, 5777-5782.

Schwob, E., and Nasmyth, K. (1993). CLB5 and CLB6, a new pair of B cyclins involved in DNA replication in Saccharomyces cerevisiae. Genes Dev. 7, 1160-1175.

Segal, M., Clarke, D. J., Maddox, E, Salmon, E. D., Bloom, K., and Reed, S. I. (2000). Coordinated spindle assembly and orientation requires Clb5p-dependent kinase in budding yeast. J. Cell Biol. 148, 441-452.

Shah, J. C., and Clancy, M. J. (1992). 1ME4, a gene that mediates MAT and nutritional control of meiosis in Saccharomyces cerevisiae. Mol. Cell. BioL 12, 1078-1086.

Shefer-Vaida, M., Sherman, A., Ashkenazi, T., Robzyk, K., and Kassir, Y. (1995). Positive and negative feedback loops affect the transcription of IME1, a positive regulator of meiosis in Saccharomyces cerevisiae. Dev. Genet. 16, 219-228.

Shenhar, G. (2001). Transcriptional regulation of IME1, the master regulator of meiosis in budding yeast. Ph.D. thesis, Technion--Israel Institute of Technology, Haifa, Israel.

Shenhar, G., and Kassir, Y. (2001). A positive regulator of mitosis, Sok2, functions as a negative regulator of meiosis in Saccharomyces cerevisiae. Mol. Cell. Biol. 21, 1603-1612.

Sherman, A. (1992). The regulation and time of action of the gene IMEl--inducer of meiosis in the yeast Saccharomyces cerevisiae. Ph.D. thesis, Hebrew University, Jerusalem.

Sherman, A., Shefer, M., Sagee, S., and Kassir, Y. (1993). Post-transcriptional regulation of IME1 determines initiation of meiosis in Saccharomyces cerevisiae. Mol. Gen. Genet. 237, 375-384.

Shilo, V., Simchen, G., and Shilo, B. (1978). Initiation of meiosis in cell cycle initiation mutants of Saccharomyces cerevisiae. Exp. Cell Res. 112, 241-248.

Shimizu, M., Hara, M., Murase, A., Shindo, H., and Mitchell, A. E (1997a). Dissection of the DNA binding domain of yeast Zn-finger protein Rmelp, a repressor of meiotic activator IME1. Nucleic Acids Syrup. Ser. 37, 175-176.

Shimizu, M., Li, W., Shindo, H., and Mitchell, A. E (1997b). Transcriptional repression at a distance through exclusion of activator binding in vivo. Proe. Natl. Acad. Sci. USA 94, 790-795.

Shimizu, M., Li, W., Covitz, E A., Hara, M., Shindo, H., and Mitchell, A. P. (1998). Genomic foot- printing of the yeast zinc finger protein Rmelp and its roles in repression of the meiotic activator IME1. Nucleic Acids Res. 26, 2329-2336.

Sia, R. A., and Mitchell, A. E (1995). Stimulation of later functions of the yeast meiotic protein kinase Ime2p by the 1DS2 gene product. Mol. Cell. Biol. 15, 5279-5287.


Simchen, G. (1974). Are mitotic functions required in meiosis? Genetics 76, 745-753. Slater. M. L. (1973). Effect of reversible inhibition of deoxyribonucleic acid synthesis on the yeast cell

cycle. J. Bacteriol. 113, 263-270. Smith, A., Ward, M. P., and Garrett, S. (1998). Yeast PKA represses Msn2p/Msn4p-dependent gene

expression to regulate growth, stress response and glycogen accumulation. EMBO J. 17, 3556- 3564.

Smith, H. E., and Mitchell, A. E (1989). A transcriptional cascade governs entry into meiosis in Saccharomyces cerevisiae. MoL Cell. Biol. 9, 2142-2152.

Smith, H. E., Su, S. S., Neigeborn, L., Driscoll, S. E., and Mitchell, A. E (1990). Role of IME1 expression in regulation of meiosis in Saccharomyces cerevisiae. Mol. Cell. Biol. 10, 6103-6113.

Smith, H. E., Driscoll, S. E., Sia, R. A., Yuan, H. E., and Mitchell, A. E (1993). Genetic evidence for transcriptional activation by the yeast IME1 gene product. Genetics 133, 775-784.

Song, W., and Carlson, M. (1998). Srb/mediator proteins interact functionally and physically with transcriptional repressor Sftl. EMBO J. 17, 5757-5765.

Sopko, R., Raithatha, S., and Stuart, D. (2002). Phosphorylation and maximal activity of Saccharomyces cerevisiae meiosis-specific transcription factor Ndt80 is dependent on Ime2. Mol. CelL BioL 22, 7024-7040.

Soushko, M., and Mitchell, A. E (2000). An RNA-binding protein homologue that promotes spornlation-specific gene expression in Saccharomyces eerevisiae. Yeast 16, 631-639.

Sprague, G. E, Jr. (1991). Signal transduction in yeast mating: Receptors, transcription factors, and the kinase connection. Trends Genet. 7, 393-398.

Stanhill, A., Schick, N., and Engelberg, D. (1999). The yeast ras/cyclic AMP pathway induces invasive growth by suppressing the cellular stress response. MoL Cell. Biol. 19, 7529-7538.

Stark, M. R., and Johnson, A. D. (1994). Interaction between two homeodomain proteins is specified by a short C- terminal tail. Nature 371, 429-432.

Steber, C. M., and Esposito, R. E. (1995). UME6 is a central component of a developmental regulatory switch controlling meiosis-specific gene expression. Proc. Natl. Acad. Sci. USA 92, 12490-12494.

Stoldt, V. R., Sonnebom, A., Leuker, C. E., and Ernst, J. E (1997). Efglp, an essential regulator of morphogenesis of the human pathogen Candida albicans, is a member of a conserved class of bHLH proteins regulating morphogenetic processes in fungi. EMBO J. 16, 1982-1991.

S trathern, J., Hicks, J., and Herskowitz, I. (1981). Control of cell type in yeast by the mating type locus. The alpha 1- alpha 2 hypothesis. J. Mol. Biol. 147, 357-372.

Strich, R., Slater, M. R., and Esposito, R. E. (1989). Identification of negative regulatory genes that govern the expression of early meiotic genes in yeast. Proc. Natl. Acad. Sci. USA 86, 10018- 10022.

Strich, R., Surosky, R. T., Steber, C.. Dubois, E:, Messenguy, E, and Esposito, R. E. (1994). UME6 is a key regulator of nitrogen repression and meiotic development. Genes Dev. 8, 796-810.

Stuart, D., and Wittenberg, C. (1998). CLB5 and CLB6 are required for premeiotic DNA replication and activation of the meiotic S/M checkpoint. Genes Dev. 12, 2698-2710.

Sn, S. S., and Mitchell, A. E (1993a). Identification of functionally related genes that stimulate early meiotic gene expression in yeast. Genetics 133, 67-77.

Su, S. S., and Mitchell, A. E (1993b). Molecular characterization of the yeast meiotic regulatory gene R1M1. Nucleic Acids Res. 21, 3789-3797.

Svetlov, V., and Cooper, T. (I 995). Review: Compilation and characteristics of dedicated transcription factors in Saccharomyces cerevisiae. Yeast 11, 1439-1484.

Sym, M., Engebrecht, J. A., and Roeder, G. S. (1993). ZIP1 is a synaptonemal complex protein required for meiotic chromosome synapsis. Cell 72, 365-378.

Szent-Gyorgyi, C. (1995). A bipartite operator interacts with a heat shock element to mediate early meiotic induction of Saccharomyces cerevisiae HSP82. MoI. Cell. Biol. 15, 6754-6769.

Thevelein, J. M., and de Winde, J. H. (1999). Novel sensing mechanisms and targets for the cAMP- protein kinase A pathway in the yeast Saccharomyees cerevisiae. Mol. MierobioL 33, 904-918.

170 KASSIR ETAL.

Thompson-Jaeger, S., Francois, J., Gaughran, J. R, and Tatchell, K. (1991). Deletion of SNF1 affects the nutrient response of yeast and resembles mutations which activate the adenylate cyclase pathway. Genetics 129, 697-706.

Toda, T., Uno, I., Ishikawa, T., Powers, S., Kataoka, T., Brock, D., Cameron, S., Broach, J., Matsumoto, K., and Wigler, M. (1985). In yeast, RAS proteins are controlling elements of adenylate cyclase. Cell 40, 27-36.

Toda, T.. Cameron, S., Sass, E, Zoller, M., Scott, J. D., McMnllen, B., Hurwitz, M., Krebs, E. G., and Wigler, M. (1987a). Cloning and characterization of BCY1, a locus encoding a regulatory subunit of the cyclic AMP-dependent protein kinase in Saccharomyces cerevisiae. Mol. Cell. Biol. 7, 1371- 1377.

Toda, T., Cameron, S., Sass, R, ZoUer, M., andWigler, M. (1987b). Three different genes in S. cerevisiae encode the catalytic subunits of the cAMP-dependent protein kinase. Cell 50, 277-287.

Toone, W. M., Johnson, A. L., Banks, G. R., Toyn, J. H., Stuart, D., Wittenberg, C., and Johnston, L. H. (1995). Rmel, a negative regulator of meiosis, is also a positive activator of G1 cyclin gene expression. EMBO J. 14, 5824-5832.

Trachtulcova, P., Janatova, I., Kohlwein, S. D., and Hasek, J. (2000). Saccharomyces cerevisiae gene ISW2 encodes a microtubule-interacting protein required for premeiotic DNA replication. Yeast 16, 35-47.

Treinin, M., and Simchen, G. (1993). Mitochondrial activity is required for the expression ofIME1, a regulator of meiosis in yeast. Curn Genet. 23, 223-227.

Treitel, M. A., Kuchin, S., and Carlson, M. (1998). Snfl protein kinase regulates phosphorylation of the Migl repressor in Saccharomyces cerevisiae. Mol. Cell. Biol. 18, 6273-6280.

Tsuboi, M. (1983). The isolation and genetic analysis of sporulation-deficient mutants in Saccha- romyces cerevisiae. Mol. Gen. Genet. 191, 17-21.

Tung, K. S., Hong, E. J., and Roeder, G. S. (2000). The pachytene checkpoint prevents accumulation and phosphorylation of the meiosis-specific transcription factor Ndt80. Proc. Natl. Acad. Sci. USA

97, 12187-12192. Uetz, R, Giot, L., Cagney, G., Mansfield, T. A., Judson, R. S., Knight, J. R., Lockshon, D., Narayan,

V., Srinivasan, M., Pochart, E, QureshiErnili, A., Li, Y., Godwin, B., Conover, D., Kalbfleisch, T., Vijayadamodar, G., Yang, M. J., Johnston, M., Fields, S., and Rothberg, J, M. (2000). A compre- hensive analysis of protein-protein interactions in Saccharomyces cerevisiae. Nature 403, 623-627.

Van Dyck, E., Foury, E, Stillman, B., and Brill, S. J. (1992). A single-stranded DNA binding protein required for mitochondrial DNA replication in S. cerevisiae is homologous to E. coli SSB. EMBO J. 11, 3421-3430.

Versele, M., Lemaire, K., and Thevelein, J. M. (2001). Sex and sugar in yeast: Two distinct GPCR systems. EMBO Rep. 2, 574-579.

Vershon, A. K., Hollingsworth, N. M., and Johnson, A. D. (1992). Meiotic induction of the yeast HOP1 gene is controlled by positive and negative regulatory sites. Mol. Ceil. Biol. 12, 3706-3714.

Vidal, M., and Gaber, R. E (1991). RPD3 encodes a second factor required to achieve maximum positive and negative transcriptional states in Saccharomyces cerevisiae. Mol. Cell. Biol. 11, 6317- 6327.

Vidan, S., and Mitchell, A. R (1997). Stimulation of yeast meiotic gene expression by the glucose- repressible protein kinase Riml5p. Mol. Cell. Biol. 17, 2688-2697.

Wang, H., and Stillman, D. J. (1993). Transcriptional repression in Saccharomyces cerevisiae by a SIN3-LexA fusion protein. Mol. Cell. Biol. 13, 1805-1814.

Ward, M. R, Gimeno, C. J., Fink, G. R., and Garrett, S. (1995). SOK2 may regulate cyclic AMP- dependent protein kinase-stimulated growth and pseudohyphal development by repressing transcription. Mol. Cell. Biol. 15, 6854-6863.

Washburn, B. K., and Esposito, R. E. (2001). Identification of the Sin3-binding site in Ume6 defines a two-step process for conversion of Ume6 from a transcriptional repressor to an activator in yeast. Mol. Ceil. Biol. 21, 2057-2069.


Xiao, Y., and Mitchell, A. E (2000). Shared roles of yeast glycogen synthase kinase 3 family members in nitrogen-responsive phosphorylation of meiotic regulator ume6p. Mol. CelL Biol. 20, 5447- 5453.

Xie, J., Pierce, M., Gailus-Durner, V., Wagner, M., Winter, E., and Vershon, A. K. (1999). Suml and Hstl repress middle sporulation-specific gene expression during mitosis in Saccharomyces cerevisiae. EMBO J. 18, 6448-6454.

Xu, L., Ajimura, M., Padmore, R., Klein, C., and Kleckner, N. (1995). NDT80, a meiosis-specific gene required for exit from pachytene in Saccharomyces cerevisiae. Mol, Cell, Biol. 15, 6572-6581.

Xu, W., and Mitchell, A. E (2001). Yeast PalA/AIPI/Alix homolog Rim20p associates with a PEST-like region and is required for its proteolytic cleavage. J. Bacteriol. 183, 6917-6923.

Yoshida, M., Kawaguchi, H., Sakata, Y., Kominami, K., Hirano, M., Shima, H., Akada, R., and Yamashita, I. (1990). Initiation of meiosis and sporulation in Saccharomyces cerevisiae requires a novel protein kinase homologue. Mol. Gen. Genet. 221, 176-186.

Yosfiimoto, H., Wada, H., and Yamashita, I. (1993). Transcriptional regulation of meiosis-inducing 1ME1 and 1ME2 genes by GAM gene products in Saccharomyces cerevisiae. Biosci. Biotechnol. Biochem. 57, 1784-1787.

Zhan, X. L., Hong, Y., Zhu, T., Mitchell, A, E, Deschenes, R. J., and Guan, K. L. (2000). Essential functions of protein tyrosine phosphatases ptp2 and ptp3 and rimll tyrosine phosphorylation in Saceharomyces cerevisiae meiosis and sporulation. Mol. Biol. Cell 11, 663-676.

transcriptional regulation of meiosis in budding yeast · regulation of meiosis in budding yeast...

Documents