tropical geometry for biology lior pachter and bernd sturmfels department of mathematics u.c....
Post on 30-Jan-2016
223 views
TRANSCRIPT
![Page 1: Tropical Geometry for Biology Lior Pachter and Bernd Sturmfels Department of Mathematics U.C. Berkeley](https://reader033.vdocuments.net/reader033/viewer/2022051116/56649d3a5503460f94a142a6/html5/thumbnails/1.jpg)
Tropical Geometry for Biology
Lior Pachter and Bernd SturmfelsDepartment of Mathematics
U.C. Berkeley
![Page 2: Tropical Geometry for Biology Lior Pachter and Bernd Sturmfels Department of Mathematics U.C. Berkeley](https://reader033.vdocuments.net/reader033/viewer/2022051116/56649d3a5503460f94a142a6/html5/thumbnails/2.jpg)
Tropical arithmetic• Annotation is sequence labeling• Annotation is important for biology• Annotation is tropical arithmetic
Tropical geometry• Tree basics• Tree reconstruction is important for biology • Tree space is the tropical Grassmanian
Back to the data
![Page 3: Tropical Geometry for Biology Lior Pachter and Bernd Sturmfels Department of Mathematics U.C. Berkeley](https://reader033.vdocuments.net/reader033/viewer/2022051116/56649d3a5503460f94a142a6/html5/thumbnails/3.jpg)
What is annotation?
QuickTime™ and aTIFF (LZW) decompressor
are needed to see this picture.
INPUT: ..t..r…o..p..i..c..a..a..l...g..e..e..t..r..y..OUTPUT: ..t..r…o..p..i..c..a..a..l...g..e..e..t..r..y..
Annotation is the labeling of the input sequence,in this case with 3 colors:
ome
![Page 4: Tropical Geometry for Biology Lior Pachter and Bernd Sturmfels Department of Mathematics U.C. Berkeley](https://reader033.vdocuments.net/reader033/viewer/2022051116/56649d3a5503460f94a142a6/html5/thumbnails/4.jpg)
TAAT ATGTCCACGG TTGTACACGGCA G GTATTGAGGTATTGAG ATGTAAC TGAA
Input: TAATATGTCCACGGGTATTGAGCATTGTACACGGGGTATTGAGCATGTAATGAA
Biology example: gene annotation
Output:
Leucine
![Page 5: Tropical Geometry for Biology Lior Pachter and Bernd Sturmfels Department of Mathematics U.C. Berkeley](https://reader033.vdocuments.net/reader033/viewer/2022051116/56649d3a5503460f94a142a6/html5/thumbnails/5.jpg)
x
y
z
Best annotation for TAAT is obtained by evaluating
Example: assign “scores”, say x,y,z to each color regardless of letter
Finding a good annotationwith tropical arithmetic
![Page 6: Tropical Geometry for Biology Lior Pachter and Bernd Sturmfels Department of Mathematics U.C. Berkeley](https://reader033.vdocuments.net/reader033/viewer/2022051116/56649d3a5503460f94a142a6/html5/thumbnails/6.jpg)
Tropical arithmetic• Annotation is sequence labeling• Annotation is important for biology• Annotation is tropical arithmetic
Tropical geometry• Tree basics• Tree reconstruction is important for biology • Tree space is the tropical Grassmanian
Back to the data
![Page 7: Tropical Geometry for Biology Lior Pachter and Bernd Sturmfels Department of Mathematics U.C. Berkeley](https://reader033.vdocuments.net/reader033/viewer/2022051116/56649d3a5503460f94a142a6/html5/thumbnails/7.jpg)
What is a phylogenetic X-tree?
In Darwin’s exampleX = {A,B,C,D,1}
![Page 8: Tropical Geometry for Biology Lior Pachter and Bernd Sturmfels Department of Mathematics U.C. Berkeley](https://reader033.vdocuments.net/reader033/viewer/2022051116/56649d3a5503460f94a142a6/html5/thumbnails/8.jpg)
Tree basics1 3
2 4
1 2
3 4
1 2
4 3
In general, the number of trees is the Schröder number(2n-5)!! = (2n-5)*(2n-7)*… 3*1
12
34
0.1
0.2
0.40.2
0.3
![Page 9: Tropical Geometry for Biology Lior Pachter and Bernd Sturmfels Department of Mathematics U.C. Berkeley](https://reader033.vdocuments.net/reader033/viewer/2022051116/56649d3a5503460f94a142a6/html5/thumbnails/9.jpg)
Data
![Page 10: Tropical Geometry for Biology Lior Pachter and Bernd Sturmfels Department of Mathematics U.C. Berkeley](https://reader033.vdocuments.net/reader033/viewer/2022051116/56649d3a5503460f94a142a6/html5/thumbnails/10.jpg)
Metrics and trees
[ dij ]Distance between species i and j
![Page 11: Tropical Geometry for Biology Lior Pachter and Bernd Sturmfels Department of Mathematics U.C. Berkeley](https://reader033.vdocuments.net/reader033/viewer/2022051116/56649d3a5503460f94a142a6/html5/thumbnails/11.jpg)
A primate tree from genome sequences
![Page 12: Tropical Geometry for Biology Lior Pachter and Bernd Sturmfels Department of Mathematics U.C. Berkeley](https://reader033.vdocuments.net/reader033/viewer/2022051116/56649d3a5503460f94a142a6/html5/thumbnails/12.jpg)
Tree space is the tropical Grassmanian
![Page 13: Tropical Geometry for Biology Lior Pachter and Bernd Sturmfels Department of Mathematics U.C. Berkeley](https://reader033.vdocuments.net/reader033/viewer/2022051116/56649d3a5503460f94a142a6/html5/thumbnails/13.jpg)
Example: X={1,2,3,4,5}
31
2
4 5
![Page 14: Tropical Geometry for Biology Lior Pachter and Bernd Sturmfels Department of Mathematics U.C. Berkeley](https://reader033.vdocuments.net/reader033/viewer/2022051116/56649d3a5503460f94a142a6/html5/thumbnails/14.jpg)
Back to the data
![Page 15: Tropical Geometry for Biology Lior Pachter and Bernd Sturmfels Department of Mathematics U.C. Berkeley](https://reader033.vdocuments.net/reader033/viewer/2022051116/56649d3a5503460f94a142a6/html5/thumbnails/15.jpg)
![Page 16: Tropical Geometry for Biology Lior Pachter and Bernd Sturmfels Department of Mathematics U.C. Berkeley](https://reader033.vdocuments.net/reader033/viewer/2022051116/56649d3a5503460f94a142a6/html5/thumbnails/16.jpg)
Alignment
Phylogeny
AnnotationMulti HMM Generalized HMM
Tree Markov models
GeneralizedMulti HMM
Evol. HMM Generalized hidden MarkovPhylogeny
Graphical Models
Final message: Tropical mathematics is important for comparative genomics.
![Page 17: Tropical Geometry for Biology Lior Pachter and Bernd Sturmfels Department of Mathematics U.C. Berkeley](https://reader033.vdocuments.net/reader033/viewer/2022051116/56649d3a5503460f94a142a6/html5/thumbnails/17.jpg)
For more on mathematics and tropical geometry (and combinatorics and algebra and statistics…):L. Pachter and B. Sturmfels, Tropical Geometry of Statistical Models, PNAS 101, 2004L. Pachter and B. Sturmfels, Parametric Inference for Biological Sequence Analysis, PNAS 101, 2004D. Speyer and B. Sturmfels, The Tropical Grassmanian, Advances in Geometry 4, 2004.L. Pachter and B. Sturmfels, Mathematics of Phylogenomics, arxiv math.ST/0409132, 2004.
and coming soon:
Book (to be published by Cambridge University Press)
Algebraic Statistics for Computational Biologyedited by Pachter and Sturmfels