understanding human immunology through the study of primary

UvA-DARE is a service provided by the library of the University of Amsterdam (http://dare.uva.nl)

UvA-DARE (Digital Academic Repository)

Understanding human immunology through the study of primary immune deficiencydisordersde Oliveira Filho, J.B.

Link to publication

Citation for published version (APA):de Oliveira Filho, J. B. (2011). Understanding human immunology through the study of primary immunedeficiency disorders

General rightsIt is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s),other than for strictly personal, individual use, unless the work is under an open content license (like Creative Commons).

Disclaimer/Complaints regulationsIf you believe that digital publication of certain material infringes any of your rights or (privacy) interests, please let the Library know, statingyour reasons. In case of a legitimate complaint, the Library will make the material inaccessible and/or remove it from the website. Please Askthe Library: http://uba.uva.nl/en/contact, or a letter to: Library of the University of Amsterdam, Secretariat, Singel 425, 1012 WP Amsterdam,The Netherlands. You will be contacted as soon as possible.

Download date: 15 Mar 2018

http://dare.uva.nl/personal/pure/en/publications/understanding-human-immunology-through-the-study-of-primary-immune-deficiency-disorders(8105037b-6811-4c2c-8688-510253b682de).html

UNDERSTANDING HUMAN IMMUNOLOGY THROUGHTHE STUDY OF PRIMARY

IMMUNE DEFICIENCY DISORDERS

JOAO BOSCO DE OLIVEIRA FILHO

2011

JOA

O BO

SCO

OLIV

EIRA

MD

2011

Understanding Human Immunology Through the Study of Primary

Immune Deficiency Disorders

João Bosco de Oliveira Filho

Understanding human immunology through the study of primary immunodeficiencies. Thesis, University of Amsterdam ISBN The research presented in this thesis was performed at the Department of Laboratory Medicine, Clinical Center, National Institutes of Health, Bethesda, MD, USA. The research project was financially supported by the National Institutes of Health Intramural Program. The financial support for printing of this thesis of the following institutions is greatly acknowledged: University of Amsterdam

UNDERSTANDING HUMAN IMMUNOLOGY THROUGH THE

STUDY OF PRIMARY IMMUNE DEFICIENCY

DISORDERS

ACADEMISCH PROEFSCHRIFT

ter verkrijging van de graad van doctor

aan de Universiteit van Amsterdam

op gezag van de Rector Magnificus

prof.dr. D.C. van den Boom

ten overstaan van een door het college voor promoties ingestelde

commissie, in het openbaar te verdedigen in de Agnietenkapel

op dinsdag 12 mei 2011, te 10.00 uur

door

Joao Bosco de Oliveira Filho

geboren te Arcoverde, Brazilië

Promotor: Prof. Dr. R.A.W. van Lier

Co-promotor: Prof. Dr. T.A. Fleisher

Overige leden: Prof. Dr. J.G. Borst

Dr. E. F. Eldering

Prof. Dr. T.W. Kujipers

Dr. M.J. Lenardo

Prof. Dr. J.P. Medema

Prof. Dr. M.H.J. van Oers

Faculteit der Geneeskunde, Universiteit van Amsterdam

To my beloved family

Table of Contents

INTRODUCTION .........................................................................................................................................................9

CHAPTER 1 DISORDERS OF PROGRAMMED CELL DEATH IN LYMPHOCYTES.......................... 13

CHAPTER 2 REVISED DIAGNOSTIC CRITERIA AND CLASSIFICATION FOR THE

AUTOIMMUNE LYMPHOPROLIFERATIVE SYNDROME (ALPS): REPORT FROM THE 2009 NIH

INTERNATIONAL WORKSHOP. .......................................................................................................................... 35

CHAPTER 3 NRAS MUTATION CAUSES A HUMAN AUTOIMMUNE LYMPHOPROLIFERATIVE

SYNDROME ............................................................................................................................................................... 51

CHAPTER 4 SOMATIC KRAS MUTATIONS ASSOCIATED WITH A HUMAN NON-MALIGNANT

SYNDROME OF AUTOIMMUNITY AND ABNORMAL LEUKOCYTE HOMEOSTASIS .............................. 77

CHAPTER 5 UTILIZING BIOMARKERS TO PREDICT THE PRESENCE OF FAS MUTATIONS IN

PATIENTS WITH FEATURES OF THE AUTOIMMUNE LYMPHOPROLIFERATIVE SYNDROME

(ALPS) ........................................................................................................................................................................ 91

CHAPTER 6 CRITICAL ROLE OF BIM IN T CELL RECEPTOR RESTIMULATION-INDUCED

DEATH......................................................................................................................................................................105

CHAPTER 7 FAS HAPLOINSUFFICIENCY IS A COMMON DISEASE MECHANISM IN THE HUMAN

AUTOIMMUNE LYMPHOPROLIFERATIVE SYNDROME.............................................................................131

CONCLUDING REMARKS.....................................................................................................................................155

SAMENVATTING ...................................................................................................................................................157

LIST OF PUBLICATIONS......................................................................................................................................160

ACKNOWLEDGMENTS/AGRADECIMENTOS.................................................................................................164

Abbreviations

XLP: X-linked lymphoproliferative disorder

NEMO: NF-κB essential modulator, also called IKK-gamma

SCID: severe combined immunodeficiency

RAG1/2: recombination-activating gene 1 and 2

IL2Rγ: interleukin 2 receptor, gamma chain (common gamma chain)

IL7Rα: interleukin 7 receptor, alpha chain

STAT: signal transducer and activator of transcription

IRAK4: interleukin 1 receptor-associated kinase 4

UNC93B: unc-93 homolog

JAK: Janus kinase

TREC: T cell receptor excision circle

HIV: human immunodeficiency virus

LAD: leukocyte adhesion deficiency

CGD: chronic granulomatous disease

TCR: T cell receptor

ADA: adenosine deaminase

DHR: dihydrorhodamine 123

TLR: toll-like receptor

HLH: histiocytic lymphohistiocytosis

IFNγR1: interferon gamma receptor 1

IFNγR2: interferon gamma receptor 2

ALPS: Autoimmune lymphoproliferative syndrome

DNT: Double-negative T cell

sFASL: Soluble FAS ligand

TNF-α: Tumor Necrosis Factor-alpha

LR: likelihood ratio

IL12Rβ1: interleukin 12 receptor, beta 1

IL12B: interleukin 12, p40

MAC: membrane attack complex

Introduction

9

INTRODUCTION

The human immune system is charged with the daunting task of protecting us from

ubiquitous and harmful microbes without causing excessive damage to the host. As part

of this hard job it has to recognize pathogens and mount appropriately sized responses,

tailored to the threat faced, while also avoiding cross-reactivity with self-derived

molecules. A series of regulatory mechanisms guarantee the perfect functioning of the

immune response in healthy individuals. Primary immunodeficiency disorders (PIDD)

refers to a group of monogenic diseases affecting diverse components of the immune

system resulting in an increased susceptibility to infections, immune hyper-reactivity,

autoimmunity, or a combination of these. Despite the rare nature of these disorders, they

can teach us valuable lessons about human immunology in natural, outbred populations,

which sometimes contrast sharply with findings in mammalian models. The study of

diagnostic, genetic or mechanistic aspects of human primary immunodeficiencies, in

particular defects of cell death, is the unifying theme of the current thesis proposal.

Chapter 1 provides a general introduction to this thesis. An overview of the

processes mediating lymphocyte apoptosis is presented in the first half of the chapter,

followed by a revision of the human inherited disorders of apoptosis, including the

autoimmune lymphoproliferative syndrome (ALPS).

Chapter 2 presents the current classification and diagnostic criteria of the most

well studied human genetic apoptosis defect: ALPS. This consensus document arose from

an international ALPS meeting held by the NIH in 2009 and attended by experts from all

over the world. Extensive modifications to the classification scheme and criteria are

discussed, along with suggestions of flow cytometry and apoptosis protocols to be used

for the clinical diagnosis of ALPS.

Chapter 3 describes the discovery that a mutation in NRAS can cause an ALPS-

like syndrome. The heterozygous somatic Gly13Asp activating mutation of the NRAS

oncogene did not impair FAS-mediated apoptosis, but augmented RAF/MEK/ERK

signaling which markedly decreased the pro-apoptotic protein BIM and attenuated

Introduction

10

intrinsic, nonreceptor-mediated mitochondrial apoptosis. Use of farnesyl-transferase

inhibitors or ERK inhibitors in vitro corrected the apoptotic defect, suggesting possible

therapeutic targets.

Chapter 4 presents the findings that somatic mutations in KRAS can also cause an

ALPS-like disorder in humans. The activating KRAS mutations impaired cytokine-

withdrawal induced T cell apoptosis through the suppression of the pro-apoptotic protein

BIM and facilitated proliferation through p27kip1 downregulation. These defects could be

corrected in vitro by MEK1 or PI3K inhibition. The use of the term RAS-associated

autoimmune leukoproliferative disease (RALD) was suggested, to differentiate these

disorders from ALPS.

Chapter 5 describes the discovery that biomarkers can help to predict the

presence of FAS mutations in patients with ALPS symptoms. The combination of

CD3+CD4-CD8-TCR-alpha/beta+ (αβ-DNT) cell counts, sFasL and vitamin B12 or IL10

plasma levels were strongly linked to the presence or absence of a FAS mutation. The

biomarkers described should aid in the selection of patients with findings of ALPS for

further diagnostic workup. In addition, the presence of a combination of markers strongly

suggestive of a FAS mutation in the setting of a negative genetic test should prompt a

search for somatic mutations in sorted αβ-DNT cells.

Chapter 6 presents our mechanistic work demonstrating that one form of cell

death, induced by the reactivation of T cells, can be mediated by two unrelated apoptotic

pathways. Briefly, a marked increase in the expression of BIM, a pro-apoptotic Bcl-2

family protein known to mediate lymphocyte apoptosis, was noted upon TCR re-

stimulation. Knockdown of BIM expression rescued normal T cells from TCR-induced

death to as great an extent as FAS disruption. The data thus implicated BIM as a critical

mediator of apoptosis induced by restimulation as well as growth cytokine withdrawal.

Chapter 7 describes the mechanistic studies showing that haploinsufficiency is a

common disease mechanism in ALPS patients with FAS mutations affecting extracellular

domains. It was demonstrated that most extracellular-region FAS mutations induced low

FAS expression due to non-sense mediated RNA decay or protein instability resulting in

defective DISC formation and impaired apoptosis. The apoptosis defect could be

corrected by FAS overexpression in vitro. These findings defined haploinsufficiency as

Introduction

11

an alternative to dominant negative interference as a disease mechanism in ALPS

patients.

Finally, in the Concluding Remarks the author briefly discusses his views on the

future developments in the field.

CHAPTER 1

DISORDERS OF PROGRAMMED CELL DEATH IN

LYMPHOCYTES

Helen C. Su1, Joao B Oliveira3 and Michael J. Lenardo2

1Laboratory of Host Defenses and 3Laboratory of Immunology, National Institute of

Allergy and Infectious Diseases; 2Department of Laboratory Medicine, Clinical Center;

National Institutes of Health, Bethesda, MD, USA.

In: Clinical Immunology: Principles and Practice, 3rd edition. Rich RR, Fleisher TA,

Shearer WT, Schroeder HW, Frew AJ, Weyand CM, editors. Philadelphia, Mosby

Elsevier, 2008, pp. 225-234

Chapter 1

14

INTRODUCTION

Normal immune cell homeostasis reflects a dynamic balance between cell proliferation

and cell death. In a lifetime, an individual encounters numerous pathogens and each

encounter perturbs immune cell homeostasis.1 Lymphocyte clones bearing uniquely

rearranged antigen receptors have been estimated at a frequency of up to 1011 to 1018 in

immunologically naïve humans.2 During an immune response to pathogen, antigen-

specific lymphocytes rapidly expand, with an estimated 100- to 5000-fold increase in cell

numbers occurring over the first week. Once infection has resolved, cell numbers rapidly

decline over the first month. This contraction phase is important, because of limited

immunological space.

Cells that escape death during the contraction phase become memory cells poised

to fight future encounters with the same pathogen. During encounter with new antigens, a

clone of specific reactivity must compete with other lymphocytes for access to antigens

on antigen presenting cells, costimulatory signals, and cytokines. Thus, the presence of

previously expanded but non-contracted lymphocytes could potentially hinder

development of an efficient immune response to new antigens. Additionally, an excess of

senescent, damaged, or autoreactive cells could predispose to autoimmunity or neoplasia.

These considerations help explain why programmed cell death mechanisms exist in

lymphocytes to counterbalance growth, progression through cell cycle, and division.

Programmed cell death mechanisms are highly conserved between species with

homologous death genes spanning from mammals to nematodes. These genetic programs

contribute to the proper development of non-immune organ systems.3 Studies of mice

genetically deficient in certain key cell death proteins demonstrate that these mechanisms

contribute to development of the mammalian nervous and reproductive systems and can

be activated in non-immune cells such as hepatocytes.4 Investigations of humans have

established that programmed cell death mechanisms are physiologically important not

only during lymphocyte development, but also in proper homeostasis of mature

peripheral T and B lymphocytes.5 This chapter will focus on our current understanding of

programmed cell death mechanisms in mature lymphocytes as revealed by studies in

humans having rare genetic disorders. For further details, we refer readers to several

recent reviews.6-8

Disorders of programmed cell death

15

FORMS OF PROGRAMMED CELL DEATH

The best studied form of programmed cell death is apoptosis, a term which literally

means “falling leaves,” coined in 1972 by Kerr and colleagues.9 However, Virchow

described this phenomenon as early as 1859. Apoptotic cells exhibit a morphology

characterized by cell shrinkage and rounding, vacuolar and vesicular formation, nuclear

condensation with fragmentation, membrane blebbing, and breakdown of cells into

apoptotic bodies containing nuclear fragments and intact organelles (Figure 1).10 In vivo,

apoptotic bodies are rapidly engulfed by phagocytes and do not elicit an inflammatory

response. Biochemically, these changes result from a highly regulated series of molecular

events, which we describe later.

Figure 1. Transmission electron micrographs showing morphologic features of dying Jurkat T cells. A normal cell is shown for comparison (A). The apoptotic cell in (B) is shrunken and displays chromatin condensation (asterisk at electron dense crescent) and many apoptotic bodies (arrows). Membrane blebbing is not seen in this image. The necrotic cell in (C) is swollen and displays numerous disintegrated organelles and disruption of its plasma membrane (arrows). The chromatin condensation (asterisk) is consistent with secondary necrosis occurring during late apoptosis. Courtesy of Dr. Lixin Zheng, NIAID, NIH.

Chapter 1

16

Table 1. Apoptosis

Key concepts

• Programmed cell death is a normal physiologic process of mature peripheral lymphocytes. The best characterized form of programmed cell death is apoptosis.

• The signaling pathway for apoptosis is conserved among worms, mice, and humans. Apoptosis can proceed through an extrinsic pathway involving death receptors, or an intrinsic pathway involving mitochondria. Both pathways activate caspases in an intracellular enzymatic cascade that leads to the morphological features of cell death.

• Actively cycling lymphocytes are most susceptible to death. This propriocidal mechanism is induced by excess antigen via death receptors, or when antigen becomes limiting and leads to cytokine withdrawal. These mechanisms, as well as apoptosis of dendritic cells, serve to maintain tolerance and prevent autoimmunity in vivo.

Apoptosis signaling pathways

Basic components of a conserved signaling pathway for apoptosis were first identified

genetically in the nematode Caenorhabditis elegans. This discovery was recognized by

the 2002 Nobel Prize in Physiology and Medicine, awarded to Brenner, Horvitz, and

Sulston.3 During C. elegans development, 131 of the 1090 cells generated disappear in

the adult animal. Several key genes – ced-3, ced-4, ced-9, and egl-1 – control the death of

these cells. Remarkably, these genes have mammalian homologs, which are caspases,

APAF-1, BCL-2, and BH3-only proteins of the BCL-2 family, respectively. The proteins

link to form a signaling pathway in which CED-3 kills, CED-4 promotes CED-3 killing,

CED-9 blocks CED-4, and EGL-1 in turn blocks CED-9. These relationships between

these death functions are much the same in mammals, including humans, as in

nematodes.

The outcome – apoptosis – hinges critically upon its last step, activation of

caspases. These key enzymes are cysteinyl proteases that cleave after specific aspartyl

residues. Although certain caspases participate in proinflammatory cytokine maturation,

the rest participate in apoptosis induction. Caspases exist in the cytoplasm as inactive

zymogens, so the key to their regulation is proteolytic processing and rearrangement of

their conformation into a highly active form. Various stimuli can trigger the formation of

signaling platforms anchored by either mitochondria-derived proteins or death receptors


17

(discussed below). Oligomerization into these stoichiometric activation complexes

activates initiator caspases, which in turn cleave and activate effector caspases. Effector

caspases cleave substrates such as poly(ADP-ribose) polymerase (PARP), inhibitor of

caspase-activated DNase (ICAD/DFF45), Rho-associated coil-coil forming kinase I

(ROCK I), nuclear lamins, actin, fodrin, and keratin. These proteins function to repair

DNA, maintain the integrity of plasma membrane and subcellular organelle

compartments, and make up nuclear and cytoskeletal architecture. Proteolysis of

substrates presumably leads to the morphologic changes seen in apoptosis, culminating in

cell death.

In mammals, two principal pathways initiate apoptosis (Figure 2). The core

signaling pathway elucidated in nematodes corresponds more closely to the intrinsic

(mitochondrial) pathway. By contrast, the extrinsic (death receptor) pathway proceeds

separately and is not found in simple invertebrates. Both intrinsic and extrinsic pathways

converge at the step of caspase activation. The precisely ordered sequence of molecular

events that comprise these pathways are discussed below.

Intrinsic (mitochondrial) pathway

Many physiologically important stimuli trigger the intrinsic pathway of apoptosis. These

include negative selection of T cells during thymic education, growth factor or cytokine

deprivation, DNA damage, and treatment with cytotoxic drugs such as chemotherapeutic

agents. Proteins of the B-cell lymphoma 2 (BCL-2) family control the intrinsic

pathway.7,11 The fine balance between the levels and activation status of the pro- and

anti-apoptotic members of this family determines the cell’s fate. Structurally, all

members of the BCL-2 family share one or more of the four known BCL-2 homology

regions (BH). The pro-survival members share three or four BH regions and include

BCL-2, BCL-XL, A1/BFL-1, BCL-w, BOO/DIVA/BCL-B, and MCL-1. The pro-

apoptotic members, which have two or three BH regions, structurally resemble their

prosurvival relatives, and include BAX, BAK, BOK/MTD, Bcl-XS, and Bcl-GL. Finally,

a subgroup of pro-apoptotic members named “BH3-only” proteins contain only one BH

Chapter 1

18

region; this subgroup includes BAD, BID, BIM, BIK/NBK, BLK, HRK/DP5, Bcl-Gs,

BMF, NOXA, and PUMA/BBC3.

Although certain details of how these proteins control the intrinsic apoptosis

pathway remain unclear, we summarize here the most accepted current model (Figure

14.2). The BH-3 only proteins seem to act as sensors for different apoptotic stimuli. For

example, BIM serves as a sensor for growth factor withdrawal, and PUMA for DNA

damage. Activated BH-3 only proteins induce translocation of the pro-apoptotic protein

BAX from cytosol to mitochondria, where it clusters with BAK. This leads to pore

formation in the outer mitochondrial membrane, loss of inner mitochondrial

transmembrane potential, and release of several apoptotic proteins such as

SMAC/DIABLO, apoptosis inducing factor (AIF), and cytochrome c. Released

cytochrome c oligomerizes in the cytosol with APAF-1 and procaspase-9 to form, in the

presence of Ca2+ and ATP, a caspase-9-activating complex called the apoptosome. Once

activated within this complex, the initiator caspase-9 cleaves and activates downstream

effector caspases such as caspase-3. The resulting caspase cascade leads to cell death. It

has been suggested that anti-apoptotic BCL-2 members promote survival by sequestering

and inactivating BH-3 only proteins or other pro-apoptotic proteins, thereby preserving

mitochondrial integrity and cell survival.

Extrinsic (death receptor) pathway

Apoptosis can be triggered by extracellular signals that activate cell surface death

receptors of the tumor necrosis factor (TNF) receptor superfamily.6,12 Members of this

superfamily have cysteine-rich extracellular domains and exist as pre-assembled trimers.

The best characterized death receptors are the prototypical death receptor Fas (CD95, or

Apo1) and TNFR1. Others include DR3 (Apo3), DR4, and DR5 (TRAIL-R2, or Apo2).

Death receptors have cytoplasmic death domains (DD), which bind to DD-containing

adaptor molecules through homotypic interactions (Figure 2). The adaptor molecule

FADD is crucial for signal transduction because it also possesses a death effector domain

(DED). This domain enables FADD to bind homotypically to the initiator caspases-8/10,

which also contain DED. Upon receptor-ligand binding, recruitment of caspases-8/10 into


19

the large death-inducing signaling complex (DISC) causes their oligomerization and

enzymatic activation. Clusters of DISC form higher order signaling protein

oligomerization transduction structures (SPOTS), which promote further caspase

activation. This leads to downstream caspase cascade for cell death.

Figure 2. Extrinsic and intrinsic signaling pathways for apoptosis. Two pathways exist for activating the effector caspases for lymphocyte apoptosis induction and propriocidal regulation. The extrinsic pathway activates initiator caspases-8 and -10 in death-inducing signaling complexes anchored by death receptors. The intrinsic pathway activates initiator caspase-9 within the apoptosome. This structure is assembled when mitochondria are permeabilized. BCL-2 family members either facilitate or antagonize mitochondrial permeability and can link the intrinsic to the extrinsic pathway. See text for more details.

Chapter 1

20

The extrinsic pathway can feed into the intrinsic pathway to amplify signals for

death.13 Activated caspase-8 can cleave BID, a pro-apoptotic BH3-only BCL-2 family

member analogous to the C. elegans egl-1 gene. Truncated BID improves pro-apoptotic

multi-domain BAX and BAK binding to mitochondrial membranes, which increases

mitochondrial permeability. Cells that depend upon this mitochondrial amplification for

death-receptor mediated death include peripheral blood lymphocytes. By contrast, other

cell types that exhibit more efficient DISC formation for caspase-8 and downstream

caspase-3 activation die independently of mitochondrial involvement.

Engagement of death receptors can trigger other cellular responses besides death.

For example, Fas stimulation also activates the transcription factor NF-kB and mitogen-

activated protein kinases (MAPK) p38 and ERK1/2. Activation of these signaling

pathways can counterbalance signals for death. However, Fas mutations generally impair

death signals more so than growth-promoting signals.

Lymphocyte death during an immune response

Mature peripheral lymphocytes vary in their susceptibility to apoptosis. Resting cells and

cells undergoing initial activation are typically refractory t

o death. This property allows an effective immune response to develop against pathogens.

Once cells proliferate and enter late G1/S phase of the cell cycle, they become sensitive

to death. The acquisition of death sensitivity occurs during the height of an ongoing

immune response and at its conclusion. Thus, lymphocytes possess a built-in rheostat that

controls cell death depending upon how rapidly they progress through cell cycle.5

The sensitivity of lymphocytes to antigen-driven cell death during an immune

response, termed propriocidal regulation, is a major negative feedback mechanism

controlling the intensity of immune responses. Two events contribute to antigen receptor

restimulation-induced propriocidal death (Figure 3).5 First, high levels of antigen

stimulate the production of high levels of interleukin (IL)-2, which drives lymphocytes

into cell cycle. Cells respond by undergoing molecular changes rendering them

susceptible to the extrinsic pathway or “active” apoptosis. This process is independent of

new protein or mRNA synthesis, but may involve increased Fas expression and


21

downregulation of anti-apoptotic molecules such as c-FLIP. As a consequence, T and B

lymphocytes are triggered to die when their Fas receptors interact with soluble or

membrane bound FasL. CD8 cells also die when triggered through their TNF receptors.

In addition, the antigen receptor appears to directly connect to the pro-apoptotic molecule

BIM. This mechanism helps limit the magnitude of the immune response, and thereby

protects the host in the presence of continuous or repeated antigenic stimulation.

The second mechanism contributing to death of lymphocytes occurs when an

immune response wanes (Figure 3).5 A falling level of antigen markedly decreases the

amount of IL-2 produced. This in turn decreases CD25 – a component of the high affinity

IL-2 receptor complex whose expression is IL-2-dependent – and renders the cells

increasingly non-responsive to IL-2. Cytokine withdrawal drives the intrinsic pathway of

apoptosis in a process that requires new protein and mRNA synthesis. Death can be

blocked by addition of common g chain receptor cytokines besides IL-2, such as IL-4, IL-

7, and IL-15, or by overexpressing anti-apoptotic BCL-2/BCL-XL proteins that restrain

apoptosis at the mitochondria. This mechanism facilitates contraction of the immune

response when activated lymphocytes have eliminated pathogen and become superfluous.

In summary, actively cycling lymphocytes die through mechanisms involving the

antigen receptor-induced death mediated partly by death receptors Fas and TNF, as well

as cytokine withdrawal. These complementary mechanisms limit the magnitude and

duration of an immune response by eliminating activated cells.

Chapter 1

22

Figure 3. Dynamics of lymphocyte apoptosis. Propriocidal regulation of actively cycling lymphocytes involves apoptosis induced through 1) death receptors at the height of the immune response, and 2) upon cytokine withdrawal at the end of the response.

In vivo importance of apoptosis

Studies in experimental animals and in humans established that apoptosis is a normal

physiological process that maintains immunologic tolerance and prevents development of

autoimmunity.6,14 Lpr (lymphoproliferation) is a naturally arising mouse strain with a

mutation in Fas resulting in its deficiency. Homozygous mutant mice develop

splenomegaly and lymphadenopathy. Depending upon genetic background, they also

develop hypergammaglobulinemia, autoantibodies, glomerulonephritis, polyarteritis,

sialoadenitis, arthritis, or primary biliary cirrhosis. Similar disease features are seen in

another naturally arising mouse strain called gld (generalized lymphoproliferative

disease), which has a homozygous Fas ligand (FasL) mutation. Recently, mice were

generated in which the Fas death receptor pathway is selectively blocked in different

immune cells.15 Surprisingly, disease was most severe in the Fas-blocked dendritic cells

as compared to lymphocytes. Dendritic cell numbers and antigen presentation cell (APC)

function were increased. These results indicate that death of dendritic cells, acting in


23

concert with propriocidal death of lymphocytes, serves to enforce tolerance and prevent

autoimmunity in vivo.

THE AUTOIMMUNE LYMPHOPROLIFERATIVE SYNDROME (ALPS)

Clinical features

In 1992, Sneller and colleagues described a childhood syndrome of immune cell

dysregulation including autoimmunity, hypergammaglobulinemia, lymphadenopathy, and

lymphocytosis, including expansion of an unusual T cell population bearing rearranged

TCR-α/β but lacking CD4 or CD8 co-receptor expression (double-negative T cells,

DNT). This constellation of findings resembled key phenotypic features of lpr and gld

mouse strains, natural models of autoimmune disease later found to harbor Fas and Fas

ligand mutations, respectively. Like lpr mice, the patients with immune cell dysregulation

had FAS mutations leading to the defective lymphocyte apoptosis that was critical for

disease pathogenesis. The human disease was therefore termed autoimmune

lymphoproliferative syndrome (ALPS) (Table 2), and is likely the same clinical entity

characterized in descriptive accounts by Canale and Smith and others in the earlier

literature.

Table 2. Clinical relevance of ALPS

• Autoimmune lymphoproliferative syndrome (ALPS) is a genetic disorder that impairs lymphocyte apoptosis.

• Mutations in FAS underlie most cases of ALPS. A minority of ALPS is caused by mutations in FASL (Fas ligand), CASP10 (caspase 10), or somatic FAS mutations affecting DNT cells. These mutations all impair the Fas-mediated extrinsic pathway of apoptosis.

• ALPS predisposes to autoimmunity and lymphomas. The most typical autoimmune findings are autoantibodies, Coombs positive hemolytic anemia, or chronic idiopathic thrombocytopenic purpura. Hodgkin and non-Hodgkin lymphomas both occur.

• Caspase-8 deficiency state (CEDS) is characterized by combined lymphocyte immunodeficiency with susceptibility to infection, superimposed upon ALPS-like features of lymphoproliferation and apoptotic defects. These findings stem from the participation of caspase-8 in two different signaling complexes – one for death induction, and another for NF-kB activation.

Chapter 1

24

ALPS is a rare condition with variable disease penetrance, affecting a reported

300 persons worldwide. Diagnostic criteria, discussed below, reflect deranged

lymphocyte homeostasis (Table 3; Table 4).6,8,16,17 Patients must present with chronic

non-malignant lymphocyte accumulation, including lymphadenopathy and/or

splenomegaly, elevated DNT numbers in peripheral blood, and defective in vitro

lymphocyte apoptosis. Autoimmunity is often seen, or more rarely lymphoma, but these

are not required for diagnosis.

Table 3. Diagnostic criteria for ALPS

Required criteria -Chronic non-malignant lymphadenopathy and/or splenomegaly -Increased peripheral CD4-CD8-TCRα/β (DNT) cells -Lymphocyte apoptosis defect Supporting criteria -Family history of ALPS -Characteristic histopathology -Autoimmune manifestations -Mutations in FAS, FASLG, CASP10

Signs and symptoms of ALPS usually emerge in infancy or early childhood

(median age of 24 months), when patients undergo medical investigation for unexplained

splenomegaly, lymphadenopathy, or autoimmune destruction of blood cells. Typically

there is painless enlargement of peripheral lymphoid organs, with no fever or weight loss

unless complicated by lymphoma. The thymus or liver can also be enlarged. Although

lymphoid hyperplasia can fluctuate, in general it gradually improves with age, even

without treatment. Up to 80% of ALPS patients have circulating autoantibodies, although

only half have actual autoimmune disease. Coombs positive hemolytic anemia and

chronic immune thrombocytopenic purpura are the most common autoimmune diseases.

These manifestations tend to be severe, but often follow a variable course. When seen at

initial presentation, ALPS can be mistaken for Evans syndrome. Neutropenia can occur,

caused either by hypersplenism or of autoimmune origin, but is usually mild. The high

incidence of anticardiolipin or anti-neutrophil antibodies has no correlation with clinical

manifestations of thrombosis or neutropenia. Rare autoimmune manifestations reported


25

include antinuclear antibodies, rheumatoid factor, glomerulonephritis, optic neuritis or

uveitis, Guillain-Barré, primary biliary cirrhosis, anti-factor VIII antibodies with

coagulopathy, autoimmune hepatitis, vasculitis, and linear IgA dermopathy.

Table 4. ALPS: Clinical pearls

• Classification is based upon findings that may be present or have resolved. • Despite its moniker, only up to 80 % of patients with ALPS have evidence of

autoimmunity. In other words, lack of autoimmunity does not preclude ALPS. • The variable penetrance means that not all individuals with mutations

manifest disease. • TCRγ/δ cells lacking CD4 and CD8 co-receptors may falsely elevate the

double negative T cell (DNT) count and therefore should be excluded. Expression of B220 on DNT cells is a finding specific to ALPS.

• Elevated B12 levels can be used as a simple screen. Other helpful laboratory findings are hypergammaglobulinemia, direct Coombs test, or anti-cardiolipin antibodies.

• Patients without known mutations should be directly analyzed for somatic mutations in sorted DNT cells. Apoptosis cannot be readily assessed by the usual methods, because these cells cannot be maintained in culture.

DNT expansion is peculiar to and required for diagnosis of ALPS. Normally,

DNT comprise less than 1% of lymphocytes in peripheral blood or lymphoid tissue, but

can reach up to 40% in ALPS patients. These cells are distinct from the immature DNT

cells developing in the thymus that have not yet rearranged the genes for or expressed

antigen receptors. They are thought to represent aging mature T cells that have lost CD4

or CD8 co-receptor expression, but the details of their origin are obscure. DNT express

the CD45R isoform B220, a marker normally found on B cells, as well as CD27, CD57,

and human leukocyte antigen (HLA)-DR. In ALPS patients the expanded DNT produce

high levels of IL-10. As elevated IL-4 and IL-5 are also seen, the resulting T helper type

2 (Th2) cytokine profile probably contributes to the observed polyclonal

hyperglobulinemia and autoantibodies. The demonstration that some ALPS patients are

mosaics – with Fas mutations in DNT but not all T cells – implicates DNT in disease

pathogenesis. However, understanding their exact function has been hampered by an

inability to keep them alive in culture, as they do not respond well to most activating and

proliferative stimuli.

Chapter 1

26

Lymphoproliferation in ALPS is not isolated to DNT. Patients have increased

numbers of total T cells, with contributions from CD8 cells expressing CD57 as well as

TCRγ/δ+ cells that lack CD4 and CD8 expression. Both total B cells and CD5+ B cells

are increased. By contrast, CD4+CD25+ cells are low, resulting in no overall change in

CD4 cell numbers. NK cell numbers are also unchanged. Lymph node biopsy reveals a

characteristic histopathology showing follicular hyperplasia with polyclonal

plasmacytosis, and paracortical expansion with infiltrating DNT.18 Besides lymphocyte

immunophenotying, high levels of circulating cobalamin (vitamin B12) can be used as a

simple initial screening test for ALPS, but by itself cannot differentiate from certain other

hematologic disorders including lymphoproliferative and myeloproliferative disorders

(V.K. Rao, J.K. Dale, and S.E. Straus, personal communication).

A definitive diagnosis of ALPS requires the evaluation of lymphocyte apoptosis

in vitro, a test performed only in specialized research laboratories such as the National

Institutes of Health in Bethesda, MD, USA. A key point for the appropriate interpretation

of this test is that cells must be proliferating well in order to become susceptible to death-

inducing stimuli. Thus, poor proliferation can be falsely interpreted as an apparent

apoptosis resistance. We typically activate peripheral mononuclear blood leukocytes

with phytohemaglutinin (PHA) and then drive T cells into cell cycle by culturing for

several more days with IL-2. Most laboratories use Fas agonistic antibodies or TCR

restimulation to induce apoptosis. After induction of apoptosis, a flow cytometer is used

to count propidium iodide-excluding cells (“live” cells) over constant time. This number

is compared to that for untreated cells to calculate a percent cell loss at any given dose of

stimulus. A decrease in percent cell loss at half of normal controls is usually considered

evidence of an apoptosis defect.

Although initially non-malignant, the lymphoproliferation in ALPS predisposes to

lymphoid malignancy, which develops in 10% of ALPS patients. In rare instances, ALPS

patients are diagnosed when they initially present with lymphoma. Compared to the

general population, ALPS patients with FAS mutations (type 1A) have a 51-fold and 14-

fold elevated incidence of Hodgkin and non-Hodgkin lymphoma, respectively. Median

age of diagnosis was 11 years for Hodgkin lymphoma and 21 for non-Hodgkin

lymphoma; however, lymphomas were identified anywhere between 2 to 50 years of age.


27

Lymphomas are of either B or T cell origin and of diverse histological type, thus

betraying a general anti-neoplastic role for propriocidal death of lymphocytes. The

lymphomas display neither loss of heterozygosity for the Fas mutation nor increased

apoptosis resistance. Most patients who develop malignancy have mutations in the DD

region, with severe impairment in Fas-mediated lymphocyte apoptosis but continued Fas-

mediated activation of NF-kB and MAPK for growth promotion.

Molecular etiology and classification

A proposed ALPS classification based on underlying genetic defects is presented in Table

5 and the corresponding molecular mechanisms are discussed below.6,8,16

Table 5. ALPS classification based on the molecular defect

Classification Genetic defect Type Ia FAS (TNFRSF6) Type Ib FASLG (TNFSF6) Type Im somatic FAS mutations Type II CASP10 Type III Unknown

Most ALPS patients bear heterozygous mutations in the FAS (TNFRSF6) gene

located on chromosome 10q24.1. Mutations can be found throughout the gene, either in

coding regions or in splice sites, with the majority (~2/3) affecting the intracellular death

domain (DD) encoded by exon 9. (A description of all mutations can be found in the

ALPS database [ALPSbase: http://research.nhgri.nih.gov/ALPS/].) Autosomal dominant

disease transmission occurs because most mutations exert a dominant interfering effect.

This effect is explained by understanding that pre-association of three normal Fas

molecules in a trimer is required for receptor death signaling function. If 50% of Fas

proteins are abnormal, as is the case for heterozygous mutations, seven out of eight Fas

trimers would contain at least one mutant protein, rendering that trimer ineffective.

Severity is greatest for DD mutations, which disrupt the homotypic interactions required

for FADD and initiator caspase recruitment into the death-inducing signaling complex

(DISC). Those that do not affect DISC formation can impair downstream higher order

Chapter 1

28

signaling protein oligomerization transduction structures (SPOTS) formation, which is

necessary for efficient caspase activation. A few ALPS patients have compound

heterozygous loss-of-function mutations that cause haploinsufficiency. Individuals with

complete loss of function due to homozygous mutations have generally more severe

symptoms. ALPS patients with FAS mutations are classified as type Ia. In some ALPS

patients, FAS somatic mutations have been found in purified DNT cells and a fraction of

peripheral lymphocytes, monocytes and hematopoietic precursors. Notably, their (non-

DNT) T cells lacked FAS mutations and apoptosis defects when expanded in vitro. These

patients are provisionally classified as type Im (for “mosaic”).

A minority of ALPS patients harbor mutations in other components of the Fas

pathway. A heterozygous mutation in Fas ligand (FASLG, TNFSF6) was originally

reported for a patient with systemic lupus erythematosus (SLE), who had

lymphadenopathy, splenomegaly, and defective lymphoctye apoptosis after TCR

restimulation, but no apparent DNT expansion. However, ALPS patients were also

discovered who possessed either heterozygous (JK Dale and SE Straus, personal

communication) or a homozygous FASLG mutations19, and these are classified as type

1b. Although caspase-10 functional polymorphisms may influence disease, at least two

heterozygous caspase-10 mutations in three ALPS patients have been identified that

cause defective apoptosis in lymphocytes and dendritic cells.20 These patients have been

classified as type II.

A subgroup of ALPS patients fulfills diagnostic criteria including increased DNT

but lacks detectable Fas-mediated apoptosis defect or known mutations in the Fas

pathway. These have been termed type III. We have recently identified one such patient

who demonstrated defective lymphocyte apoptosis upon cytokine withdrawal, a stimulus

that triggers the intrinsic pathway (JB Oliveira, TA Fleisher, and MJ Lenardo, personal

communication). The molecular defect underlying disease in this patient is currently

under intensive investigation.

The relationship between genotype and phenotype is complex. Gene mutations

are required, but are not sufficient for disease. In large kindreds, family members with the

same mutation and degree of defective in vitro Fas-mediated apoptosis had very different

clinical manifestations. In-depth analysis revealed that penetrance was greatest with


29

intracellular DD mutations and least with extracellular mutations. This data indicates that

other factors, genetic and/or environmental, influence the clinical phenotype.

ALPS-like disease

Some patients have features overlapping with but not fulfilling diagnostic criteria for

ALPS.6 For instance, the ALPS-variant autoimmune lymphoproliferative disease (ALD)

has lymphoproliferation, autoimmune disease, susceptibility to cancer, and defective

lymphocyte apoptosis, but lacks DNT expansion. The responsible molecular defects are

unknown. In another cohort patients display clinical features of ALPS but lack apparent

apoptosis defects. Apoptotic defects are usually assessed through the Fas death receptor,

which may not reveal defects that would be seen if induced by other stimuli. Apoptotic

defects may also not be readily apparent depending upon the cells used for analyses, for

example in somatic mosaicism. Given recent exciting demonstrations using transgenic

mouse models that dendritic cell apoptosis defects can contribute to disease

pathogenesis,15 we speculate that other diseases resembling ALPS, such as Rosai-

Dorfman disease, may involve mutations within antigen presenting cells.21 In sum, a

proportion of ALPS-like disease likely represents variants of ALPS. However, other

forms of ALPS-like disease probably reflect abnormalities in non-apoptotic pathways that

also regulate lymphocyte growth and activation.

There is a growing realization that certain molecules involved in apoptosis also

function integrally for lymphocyte growth and activation. One such molecule is caspase-

8. Its deficiency, found in two siblings with homozygous mutations, leads to an immune

regulation syndrome we term caspase-8 deficiency state (CEDS).22 Consistent with the

known role of caspase-8 as an initiator caspase in the DISC, these patients had mild

lymphadenopathy and splenomegaly, as well as lymphocyte apoptotic defects. However,

they had inconsistent marginally elevated DNT, raising doubt as to whether they fulfilled

ALPS criteria. More importantly, unlike classical ALPS patients, the CEDS patients had

a prominent combined immunodeficiency with recurrent sinopulmonary infections and

mucocutaneous herpesvirus infections. They had low serum immunoglobulin levels and

poor humoral responses to polysaccharide antigens, as well as impaired activation of T

Chapter 1

30

cells, B cells, and natural killer (NK) cells. Thus, they resembled patients with common

variable immunodeficiency (CVID). We recently found that the impaired lymphocyte

activation resulted from a defect in the kinetics of activation of the critical transcription

factor NF-kB in response to stimulation through antigen receptors, TLR-4, and FcgRIII.22

This is because caspase-8 participates in a signaling complex that includes other proteins

such as Bcl-10, MALT-1, and IKK in an NF-kB activating signalosome. This complex

differs from the DISC and is not affected in classical ALPS patients. It will be important

to identify other patients with caspase-8 deficiency to allow us to define further the

spectrum of this disease given the potential for diagnostic confusion.

Apoptosis in other immunodeficiencies

Although resting lymphocytes are relatively resistant to death, they appear to require

antigen receptor expression with continuous low or intermittent stimulation, in addition to

homeostatic cytokines such as IL-7 and IL-15 for survival.5,13 Mice rendered genetically

deficient in anti-apoptotic BCL-2 family members (such as BCL-2, BCL-X, and MCL-1),

show loss of mature or developing lymphocytes. These results suggest that

inappropriately activated intrinsic pathways of apoptosis may contribute to

immunodeficiency. Several studies demonstrated increased spontaneous apoptosis of

lymphocytes from patients with CVID, ataxia-telangiectasia, adenosine deaminase-severe

combined immunodeficiency (ADA-SCID), Omenn’s syndrome, cartilage-hair

hypoplasia, and DiGeorge syndrome. However, without defining biochemically how

specific gene mutations affect apoptosis, it is difficult to know whether these associations

are simply correlative or indeed causative.

Therapies for ALPS

Although symptoms can remit with age, some ALPS patients require continued treatment

to control autoimmune disease (Table 6).17,23 Treatment for autoimmune cytopenias is

similar to that used in patients without ALPS. A high-dose pulse of corticosteroid (5- 30

mg/kg methylprednisolone i.v.) is useful in bringing autoimmune cytopenias rapidly

under control. This is followed by a low-dose course (1-2 mg/kg prednisone orally) that


31

can be tapered and eventually discontinued after several weeks to months. Adjuncts to

corticosteroids include IVIG for autoimmune thrombocytopenia or hemolytic anemia,

and granulocyte-colony stimulating factor (G-CSF, 1-2 mg/kg from three times a week to

once daily) for autoimmune neutropenia. In some patients, autoimmune disease promptly

recurs after discontinuing corticosteroids; these patients may need to be maintained on a

minimal dose every other day. Alternatively, such patients may benefit by switching to

the immunosuppressant mycophenolate mofetil (~600 mg/M2/dose orally, twice daily) for

long-term maintenance therapy. The long-term corticosteroid- and splenectomy- sparing

effects of this agent are particularly advantageous in children. For patients who fail these

approaches, cytotoxic agents can be tried. Success has been reported using azathioprine,

vincristine, or rituxan (anti-CD20 monoclonal antibody, 375 mg/M2/week i.v. X 4),

although no controlled prospective trials exist to support the widespread use of these

drugs in ALPS patients. Allogeneic bone marrow transplantation has been curative when

undertaken in the rare instances of severely and intractably affected patients with

homozygous FAS mutations and complete absence of Fas. However, given the associated

high risks of complications and death, use of matched unrelated donor allogeneic bone

marrow – which is likely to be required to avoid repopulating with lymphocytes from

family members having the same mutation – should be considered a therapy of last resort.

Although lymphadenopathy and splenomegaly may be unsightly, these disease

manifestations are usually not treated unless medically indicated. Hypersplenism can

contribute to low blood cell counts when splenic pooling exacerbates autoimmune-

mediated destruction. Notably, none of the current agents used to treat ALPS improves

lymph node or spleen size. Splenectomy may be required if immunosuppressant agents

fail to improve cytopenias. A disproportionately increased risk for post-splenectomy

pneumococcal sepsis and death in ALPS patients means that splenectomy should be

undertaken only after extensive discussions with the patient and family. Patients should

be immunized with vaccines against Streptococcus pneumoniae, Haemophilus influenzae,

and Neisseria meningitidies before splenectomy. Following splenectomy, patients should

be re-immunized with conjugate plus polysaccharide pneumococcal vaccines when titers

wane. Lifelong antibiotic prophylaxis with penicillin or fluoroquinolones is essential.

Chapter 1

32

Moreover, splenectomized patients should be instructed to seek immediate medical

attention to rule out bacteremia during febrile illnesses.

Table 6. Therapeutic principles

• Disease can improve with age. • Corticosteroids are useful for rapidly bringing autoimmune disease under control. • If unable to discontinue medications, low-dose corticosteroids given every other day,

or mycophenolate mofetil, may be useful in preventing recurrence of autoimmune disease.

• Splenectomy may be considered only when hypersplenism contributes to severe refractory cytopenias.

• Risk of post-splenectomy sepsis necessitates lifelong antibiotic prophylaxis. • Cytotoxic agents or matched unrelated donor allogeneic bone marrow

transplantation can be considered for worst case scenarios. • Patients should undergo periodic monitoring for development of lymphoma. • Lymphomas respond to conventional therapies.

Given that treatment of ALPS patients aims primarily at controlling autoimmune

manifestations, drugs that control lymphoproliferation or prevent lymphomagenesis are

needed. Several case reports suggested that sulphadoxine-pyrimethamine (Fansidar)

treatment might have utility in patients with ALPS or ALPS-like disease. Regression of

lymphadenopathy and/or splenomegaly, as well as improvement in blood cell counts,

were observed in six of seven treated patients. Two of the treated patients sustained

remission after discontinuing the drug. However, more recent studies in ALPS patients

and the lpr mouse model failed to demonstrate any significant benefit of this agent or

pyrimethamine alone on lymph node or spleen size (VK Rao, KC Dowdell, and SE

Straus, personal communication). Therefore, at present this regimen cannot be considered

recommended therapy.

Finally, the predisposition to lymphoma presents a unique clinical challenge: how

to distinguish a newly developing or relapsed lymphoma from benign lymphadenopathy.

ALPS patients require careful periodic examinations and surveillance by serial computed

tomography (CT) scans. Suspiciously enlarging lymph nodes may necessitate biopsy to

assess for clonality and chromosomal abnormalities. Positron emission tomography

(PET) scans, which detect areas of high cellular glucose uptake, are useful for identifying


33

and following suspicious lesions.24 Fortunately, lymphomas in ALPS patients respond to

conventional therapies and do not have a worse outcome.

CONCLUSION

Programmed cell death is an essential regulatory mechanism to establish equipoise with

growth, differentiation, and proliferation of lymphocytes. Studies in humans with the rare

genetic disorder autoimmune lymphoproliferative syndrome (ALPS) have demonstrated

that apoptosis is physiologically important for maintaining lymphocyte homeostasis,

preventing autoimmunity, and suppressing lymphomagenesis. Studies in ALPS-like

disorders such as caspase-8 deficiency state (CEDS) have revealed that molecules

responsible for death can also participate in other intracellular signaling pathways for

normal lymphocyte function. Defining the genetic abnormalities responsible for ALPS

and related disorders will continue to provide insights into the mechanisms that regulate

immune cell homeostasis in vivo.

References 1. Ahmed R, Gray D. Immunological memory and protective immunity:

understanding their relation. Science. 1996;272(5258):54-60. 2. Davis MM, Bjorkman PJ. T-cell antigen receptor genes and T-cell recognition.

Nature. 1988;334(6181):395-402. 3. Horvitz HR. Nobel lecture. Worms, life and death. Biosci Rep 2003;23(5-6):239-

303. 4. Ranger AM, Malynn BA, Korsmeyer SJ. Mouse models of cell death. Nat Genet

2001;28(2):113-8. 5. Lenardo M, Chan KM, Hornung F, et al. Mature T lymphocyte apoptosis--

immune regulation in a dynamic and unpredictable antigenic environment. Annu Rev Immunol 1999;17:221-53.

6. Bidere N, Su HC, Lenardo MJ. Genetic disorders of programmed cell death in the immune system (*). Annu Rev Immunol. 2006;24:321-52.

7. Danial NN, Korsmeyer SJ. Cell death: critical control points. Cell. 2004;116(2):205-19.

8. Su HC, Lenardo MJ. Lessons from autoimmune lymphoproliferative syndrome. Drug Discovery Today: Disease Mechanisms 2005;2(4):495-502.

9. Formigli L, Conti A, Lippi D. "Falling leaves";: a survey of the history of apoptosis. Minerva Med. 2004;95(2):159-64.

10. Edinger AL, Thompson CB. Death by design: apoptosis, necrosis and autophagy. Curr Opin Cell Biol. 2004;16(6):663-9.

Chapter 1

34

11. Marsden VS, Strasser A. Control of apoptosis in the immune system: Bcl-2, BH3-only proteins and more. Annu Rev Immunol. 2003;21:71-105. Epub 2001 Dec 19.

12. Ashkenazi A, Dixit VM. Death receptors: signaling and modulation. Science 1998;281(5381):1305-8.

13. Opferman JT, Korsmeyer SJ. Apoptosis in the development and maintenance of the immune system. Nat Immunol. 2003;4(5):410-5.

14. Siegel RM, Chan FK, Chun HJ, et al. The multifaceted role of Fas signaling in immune cell homeostasis and autoimmunity. Nat Immunol. 2000;1(6):469-74.

15. Chen M, Wang YH, Wang Y, et al. Dendritic cell apoptosis in the maintenance of immune tolerance. Science. 2006;311(5764):1160-4.

16. Rieux-Laucat F. Inherited and acquired death receptor defects in human Autoimmune Lymphoproliferative Syndrome. Curr Dir Autoimmun. 2006;9:18-36.

17. Sneller MC, Dale JK, Straus SE. Autoimmune lymphoproliferative syndrome. Curr Opin Rheumatol 2003;15(4):417-21.

18. Lim MS, Straus SE, Dale JK, et al. Pathological findings in human autoimmune lymphoproliferative syndrome. Am J Pathol 1998;153(5):1541-50.

19. Del-Rey M, Ruiz-Contreras J, Bosque A, et al. A homozygous Fas ligand gene mutation in a patient causes a new type of autoimmune lymphoproliferative syndrome. Blood. 2006;.

20. Zhu S, Hsu AP, Vacek MM, et al. Genetic alterations in caspase-10 may be causative or protective in autoimmune lymphoproliferative syndrome. Hum Genet. 2006;119(3):284-94. Epub 2006 Jan 31.

21. Maric I, Pittaluga S, Dale JK, et al. Histologic features of sinus histiocytosis with massive lymphadenopathy in patients with autoimmune lymphoproliferative syndrome. Am J Surg Pathol. 2005;29(7):903-11.

22. Su H, Bidere N, Zheng L, et al. Requirement for caspase-8 in NF-kappaB activation by antigen receptor. Science 2005;307(5714):1465-8.

23. Rao VK, Straus SE. Causes and consequences of the autoimmune lymphoproliferative syndrome. Hematology. 2006;11(1):15-23.

24. Rao VK, Carrasquillo JA, Dale JK, et al. Fluorodeoxyglucose positron emission tomography (FDG-PET) for monitoring lymphadenopathy in the autoimmune lymphoproliferative syndrome (ALPS). Am J Hematol. 2006;81(2):81-5.

CHAPTER 2

REVISED DIAGNOSTIC CRITERIA AND CLASSIFICATION FOR

THE AUTOIMMUNE LYMPHOPROLIFERATIVE SYNDROME

(ALPS): REPORT FROM THE 2009 NIH INTERNATIONAL

WORKSHOP.

Oliveira JB1, Bleesing JJ2, Dianzani U3, Fleisher TA1, Jaffe ES4, Lenardo MJ5, Rieux-

Laucat F6, Siegel RM7, Su HC8, Teachey DT9, Rao VK10

1Department of Laboratory Medicine, Clinical Center, National Institutes of Health,

Bethesda, MD, USA; 2 Division of Bone Marrow Transplantation and Immune

Deficiency, Cincinnati Children’s Hospital Medical Center, Cincinnati, OH, USA; 3

Interdisciplinary Research Centre of Autoimmune Diseases, and University of Eastern

Piedmont, Novara, Italy; 4Laboratory of Pathology, Center for Cancer Research, National

Cancer Institute, Bethesda, MD, USA; 5Laboratory of Immunology, National Institute of

Allergy and Infectious Diseases, National Institutes of Health, Bethesda, MD, USA; 6

INSERM U768, Université Paris Descartes, Paris, France; 7Immunoregulation Unit,

Autoimmunity Branch, National Institute of Arthritis and Musculoskeletal and Skin

Diseases, National Institutes of Health, Bethesda, MD; 8Laboratory of Host Defenses,

National Institute of Allergy and Infectious Diseases, National Institutes of Health,

Bethesda, MD, USA; 9Division of Hematology and Oncology, Department of Pediatrics,

Children’s Hospital of Philadelphia, Philadelphia, PA, USA; 10ALPS Unit, Laboratory of

Clinical Infectious Diseases, National Institute of Allergy and Infectious Diseases,

National Institutes of Health, Bethesda, MD, USA.

Blood. 2010;116(14):e35-40.

Chapter 2

36

ABSTRACT

Lymphadenopathy in children for which no infectious or malignant etiology can be

ascertained constitutes a challenging diagnostic dilemma. Autoimmune

lymphoproliferative syndrome (ALPS) is a human genetic disorder of lymphocyte

apoptosis resulting in an accumulation of lymphocytes and childhood onset chronic

lymphadenopathy, splenomegaly, multilineage cytopenias, and an increased risk of

B-cell lymphoma. In 1999, investigators at the National Institutes of Health (NIH)

suggested criteria to establish the diagnosis of ALPS. Since then, with

approximately 500 ALPS patients studied worldwide, significant advances in our

understanding of the disease have prompted the need for revisions to the existing

diagnostic criteria and classification scheme. The rationale and recommendations

outlined here stem from an international workshop held at NIH on September 21-

22, 2009, attended by investigators from the USA, Europe and Australia engaged in

clinical and basic science research on ALPS and related disorders. It is hoped that

harmonizing the diagnosis and classification of ALPS will foster collaborative

research and better understanding of the pathogenesis of autoimmune cytopenias

and B cell lymphomas.

INTRODUCTION

Lymphadenopathy in children with no known infectious or malignant etiology constitutes

a challenging diagnostic dilemma. A recently described entity that defines some children

with previously unexplained lymphadenopathy is the autoimmune lymphoproliferative

syndrome (ALPS)1,2. The clinical antecedents to ALPS entail various syndromes of

familial chronic nonmalignant lymphadenopathy and splenomegaly including

pseudomononucleosis, pseudolymphoma, and the Canale-Smith syndrome3,4,5. In 1992,

Sneller and co-workers recognized that these entities resembled two related mouse strains

with lymphoproliferative phenotypes known as lpr (lymphoproliferation) and gld

(generalized lymphoproliferative disease)6. Earlier that same year the molecular defect of

the lpr mouse was shown to be a loss of function mutation in a “death receptor” gene that

is a member of the tumor necrosis factor receptor (TNFR) superfamily, FAS/CD95/APO-

Revised diagnostic criteria and classification of ALPS

37

1/TNFRSF67. Subsequently, this association was validated in humans when the

underlying defect in two series of patients with a lymphoproliferative disorder was

determined to be a failure of lymphocyte apoptosis due to a mutation in FAS1,2. The

mutations resulted in the accumulation of proliferating lymphocytes with childhood onset

chronic lymphadenopathy, splenomegaly, multilineage cytopenias secondary to

sequestration and autoimmune destruction, and an increased risk of B-cell lymphoma6,8,9.

Laboratory findings included polyclonal hypergammaglobulinemia and expansion of a

unique population of circulating TCRαβ+B220+CD4-CD8- T lymphocytes, referred to as

TCRαβ+ double negative T (TCRαβ+-DNT) cells throughout this paper8,9.

The majority of ALPS patients harbor heterozygous germline mutations in FAS,

inherited in an autosomal dominant fashion10,11. Interestingly, somatic FAS mutations are

the second most common genetic etiology of ALPS12,13. Additionally, mutations in the

genes encoding FAS ligand, caspase 10, caspase 8, and NRAS have been identified in a

minority of patients with ALPS and related disorders14-19. Approximately one third of

ALPS patients have yet unidentified genetic defects.

In 1999, investigators at the National Institutes of Health (NIH) suggested a triad of

criteria to establish the diagnosis of ALPS (Table 1)20,21. Since then, important advances

have been made in our understanding of the disease. Here we would like to propose

several revisions to the current diagnostic criteria and classification system. The

recommendations stem from a workshop held at the NIH in the fall of 2009 attended by

investigators from the USA, Europe and Australia engaged in clinical and basic science

research pertaining to ALPS and related disorders. The changes proposed follow the

deliberations at the meeting leading to a consensus after further teleconferences and

electronic communications among the coauthors of this document. It is hoped that these

modifications will harmonize and simplify the diagnosis and classification of ALPS,

facilitating collaboration and data exchange between different clinicians and research

centers across the globe. A scientific summary of the meeting proceedings has been

published elsewhere22.

Chapter 2

38

Table 1. Diagnostic criteria for ALPS as defined in 1999

Required criteria -Chronic non-malignant lymphadenopathy and/or splenomegaly -Increased peripheral CD3+ TCRαβ+CD4-CD8- (DNT) cells -Lymphocyte apoptosis defect

Supporting criteria -Family history of ALPS -Characteristic histopathology -Autoimmune manifestations

MODIFICATIONS TO THE DIAGNOSTIC CRITERIA OF ALPS

Rationale

Reevaluation of the currently used ALPS diagnostic criteria (Table 1) suggested several

potential problems hindering its widespread use:

1. The lymphocyte apoptosis assay, currently an absolute requirement for diagnosis,

is resource-intensive to perform, available only in selected centers, and may be

unable to identify patients with somatic FAS or germline FASLG mutations;

moreover, methodology is not standardized among centers, often leading to

variable g results;

2. The current definition does not incorporate genetic information or other

biomarkers that have recently been shown to predict ALPS;

3. Evaluation of a large number of control samples in different centers suggests that

a diagnostic cutoff for TCRαβ+DNT cells of 1% of total lymphocytes does not

always accurately predict ALPS;

4. Histopathological findings, highly characteristic of ALPS in some cases, and

compatible family history are not currently utilized for diagnosis.

Recommendations

This revision divides diagnostic criteria for ALPS into two required and six accessory

criteria (Table 2). Required criteria include the presence of lymphadenopathy and/or

splenomegaly, and elevated TCRαβ+-DNT cells. Accessory criteria are subdivided into


39

primary, which include an abnormal lymphocyte apoptosis assay and the presence of

pathogenic mutations in genes of the FAS pathway; and secondary, which include the

presence of elevated circulating biomarkers, characteristic histopathology, the combined

presence of autoimmune cytopenias, polyclonal hypergammaglobulinemia, and family

history compatible with ALPS. These criteria are discussed in detail below.

For a definitive ALPS diagnosis a patient has to meet both required criteria and

one of the primary accessory criteria (Table 2). A probable ALPS diagnosis can be

entertained by the presence of the required criteria and any one of the secondary

accessory criteria. From a clinical perspective, patients with probable ALPS should be

treated and monitored in the same way as patients with a definitive diagnosis, but

physicians are advised to pursue a genetic or apoptosis assay based diagnostic work up

whenever possible.

There is an absolute requirement for the presence of lymphadenopathy and/or

splenomegaly persistent for more than 6 months. If isolated, the lymphadenopathy has to

affect at least two nodal chains. Neoplastic and infectious etiologies must be excluded. In

many cases associated hepatomegaly may also be present, but in isolation it is not a

diagnostic criterion23. The lymphadenopathy in ALPS typically fluctuates and involves

the cervical, axillary and inguinal chains, although mesenteric, retroperitoneal, pelvic,

and mediastinal lymph node expansions are also often noted by imaging studies23.

The second required ALPS criterion is the presence of elevated circulating

TCRαβ+-DNT cells, a hallmark of this disease6. This population must be clearly

distinguished from TCRγδ+DNT cells by co-staining with TCRαβ+ directed antibodies.

Rare conditions unrelated to ALPS may present with an expansion of Natural Killer T

(NKT) cells, which can be CD3+ TCRαβ+CD4-CD8-, and these can be distinguished from

ALPS specific DNTs by co-staining with NKT markers such as CD16, CD56, Vα24Vβ11

or α-GalCer-CD1d tetramers; however, we do not recommend such extended staining

routinely in ALPS investigation. The staining protocol currently used by the NIH

Immunology Service can be found in Supplementary File 1.

Chapter 2

40

Table 2. Revised Diagnostic Criteria for ALPS

REQUIRED 1. Chronic (>6 months), non-malignant, non-infectious lymphadenopathy

and/or splenomegaly. 2. Elevated CD3+ TCRαβ+CD4-CD8- DNT cells (equal to or greater than

1.5% of total lymphocytes or 2.5% of CD3+ lymphocytes) in the setting of normal or elevated lymphocyte counts. ACCESSORY

Primary 1. Defective lymphocyte apoptosis (in 2 separate assays);

2. Somatic or germline pathogenic mutation in FAS, FASLG, or CASP10;

Secondary

1. Elevated plasma sFASL levels (>200 pg/ml) OR elevated plasma IL-10 levels (>20 pg/ml) OR elevated serum or plasma Vitamin B12 levels (>1500 ng/L) OR elevated plasma IL-18 levels above 500 pg/ml;

2. Typical immuno-histological findings as reviewed by an experienced hematopathologist; 3. Autoimmune cytopenias (hemolytic anemia, thrombocytopenia, or neutropenia) AND elevated IgG levels (polyclonal hypergammaglobulinemia);

4. Family history of a non-malignant/non-infectious lymphoproliferation with or without autoimmunity.

Definitive diagnosis: Both required criteria plus one primary accessory criterion.

Probable diagnosis: Both required criteria plus one secondary accessory criterion.

A review of data, including pediatric controls, gathered from different centers

showed that TCRαβ+-DNT levels between 1.0 and 1.5% of total lymphocytes may be

observed in normal individuals or as a reactive phenomenon in conditions such as

systemic lupus erythematosus (SLE), and hence their presence as an isolated finding

should not prompt screening for ALPS24-26 (and Bleesing JJ, personal communication).

As a consequence of these observations, the percentage of TCRαβ+-DNT cells required

for a diagnosis has been revised to be greater than or equal to 1.5% of total lymphocytes

(or 2.5% of T lymphocytes), in the setting of normal or elevated lymphocyte counts. The

presence of lymphopenia invalidates this criterion, as its impact on the relative

distribution of TCRαβ+-DNT cells is unknown. Absolute counts of TCRαβ+-DNT cells


41

will vary by age. Elevations of TCRαβ+DNT cells above 3% of the total lymphocytes (or

>5% of T lymphocyte cells) are rarely, if ever, seen in conditions other than ALPS and

are therefore essentially pathognomonic for this disease24-27. Each testing laboratory

should ideally develop its own reference ranges, adjusted for age, and provide both

percent and absolute numbers of this lymphocyte subset in the patient report.

Primary accessory criteria include an abnormal lymphocyte apoptosis assay

(Table 2). This test is no longer considered essential for the diagnosis of ALPS, as

patients with somatic FAS mutations and germline FASLG mutations typically are found

to have normal FAS-induced apoptosis assays12,14,18. However, the presence of a

reproducible apoptotic defect in patients who fulfill the Required criteria is enough for a

diagnosis of ALPS. Given the high inter-laboratory variability in the protocol used for

this assay, a repeat assay for confirmation is now required. Acceptable apoptosis tests in

cultures of activated primary T cells include direct FAS activation using cross-linked

agonistic antibodies or recombinant Fas ligand or TCR re-stimulation. Detailed

description of the protocols utilized for apoptosis detection and measurement can be

found in recent related publications28. Patient results must be compared to normal

controls set up in parallel and a test is considered abnormal if the patient’s cells

demonstrate consistently 50% or less of the cell death observed in the control.

Additionally, shipped samples should be accompanied by a shipping control.

The demonstration of germline or somatic deleterious mutations in FAS, FASLG,

or CASP10 is now considered a diagnostic criterion. Patients with germline CASP8 and

somatic NRAS mutations are now classified separately (Table 2). Gene sequencing is

generally available by selected commercial laboratories; however, as polymorphisms in

FAS are not uncommon, a diagnostic mutation should be based on prior identification of

the mutation linked to a diagnosis of ALPS or a proven functional consequence of the

change in association with a new mutation. Existing databases of pathogenic FAS

mutations are publicly available and can be used for diagnostic help (NCBI NIH ALPS

website http://www3.niaid.nih.gov/topics/ALPS/). However, isolated discovery of a

heterozygous Fas mutation in a healthy relative of a patient with ALPS is of clinically

uncertain significance at this time.

Chapter 2

42

Based on recent data, the presence of elevated TCRαβ+-DNT cells coupled to high

serum or plasma levels of either interleukin (IL)-10, IL-18, soluble FAS ligand (sFASL)

or vitamin B12 can accurately predict the presence of germline or somatic FAS

mutations24-27. These biomarkers can predict a FAS mutation with a post-test probability

ranging from 85 to 97%, depending on the biomarker used and the number of TCRαβ+-

DNT cells24-27. Given this high specificity, these biomarkers were also incorporated in the

diagnostic criteria and their use should greatly facilitate the diagnosis in settings without

access to advanced genetic analysis or functional testing.

Two common presenting features of ALPS, autoimmune cytopenias and

hypergammaglobulinemia, are now incorporated as diagnostic criteria. A recent

publication suggests that their presence in patients with lymphoproliferation and elevated

TCRαβ+-DNT cells indicates a very high likelihood of ALPS and these patients should be

referred for further testing24. Although autoimmune manifestations of ALPS are typically

limited to hematopoietic elements that lead to multilineage cytopenias, occasionally other

organs, including liver and kidneys, may also be affected29.

Lymph node pathological findings initially described by Jaffe and colleagues are

characteristic of ALPS and are included as a secondary accessory diagnostic criterion30.

These findings include paracortical expansion due to infiltration by polyclonal TCRαβ+-

DNT cells accompanied by follicular hyperplasia and polyclonal plasmacytosis30. Marked

TCRαβ+-DNT cell infiltration in some cases can lead to architectural effacement of

lymph nodes with infiltration of bone marrow and spleen, leading in some instances to an

erroneous diagnosis of peripheral T-cell lymphoma. The diagnostic workup should

include flow cytometric or immunohistochemical evaluation of T-cells for CD3, CD4,

CD8, CD57, CD45RO, and CD45RA using standardized laboratory methods 31. Utilizing

flow cytometry αβ and γδ T-cells should be distinguished, with gating for CD4 and CD8

performed on the respective populations. In addition, polymerase chain reaction studies

of T-cell receptor gene rearrangement should indicate the absence of a clonal T cell

population in ALPS.

The final secondary accessory criterion is a positive family history for non-

malignant and non-infectious lymphadenopathy/splenomegaly with or without


43

autoimmunity, since many ALPS patients have family members with similar clinical

histories.

MODIFICATIONS TO THE CLASSIFICATION OF ALPS AND RELATED

DISORDERS

Rationale

The molecular classification of ALPS has seen many recent additions over time 14-19,

leading to somewhat chaotic nomenclature (Table 3). An ideal classification system

should not only standardize the nomenclature among different centers but also easily

accommodate future discoveries. This revision introduces extensive modifications to the

previously used classification of ALPS and related disorders, as summarized below

(Table 3).

Recommendations

For simplicity, numbers should no longer be used when classifying ALPS based on the

genetic defect (Table 3). Patients harboring germline homozygous, or heterozygous

mutations in FAS, previously classified as ALPS Type 0 and Ia, respectively, are now

unified under ALPS-FAS. Similarly, patients with somatic FAS mutations should be

classified as ALPS-sFAS; patients harboring Fas ligand mutations should be classified as

ALPS-FASLG; and patients with caspase-10 mutations classified as ALPS-CASP10.

Patients who fulfill diagnostic criteria for ALPS but in whom no genetic diagnosis

can be determined should now be classified as ALPS-U (undetermined), instead of ALPS

Type III. We expect new genetic defects to be discovered in this group of patients with

further research. Despite the lack of a genetic diagnosis, our current understanding is that

this group of patients has a clinical course that is similar to other ALPS patients, except

that there is no evidence yet of an increased incidence of lymphoma (VK Rao,

unpublished findings). The diagnostic flow chart shown in Figure 1 should help the

readers to navigate among different ALPS subtypes in their clinical practice.

Chapter 2

44

Table 3. Revised Classification of ALPS

Previous Nomenclature

Revised Nomenclature

Gene Definition

ALPS Type 0 ALPS-FAS FAS Patients fulfill ALPS diagnostic criteria and have germline homozygous mutations in FAS.

ALPS Type Ia ALPS-FAS FAS Patients fulfill ALPS diagnostic criteria and have germline heterozygous mutations in FAS.

ALPS Type Im ALPS-sFAS FAS Patients fulfill ALPS diagnostic criteria and have somatic mutations in FAS.

ALPS Type Ib ALPS-FASLG FASLG Patients fulfill ALPS diagnostic criteria and have germline mutations in FAS ligand.

ALPS Type IIa ALPS-CASP10

CASP10 Patients fulfill ALPS diagnostic criteria and have germline mutations in caspase 10.

ALPS Type III ALPS-U Unknown Patients meet ALPS diagnostic criteria; however, genetic defect is undetermined (no FAS, FASL or CASP10 defect).


45

Figure 1. Suggested algorithm for diagnostic work up for patients with suspected ALPS.

Chapter 2

46

Classification of ALPS-related disorders

Patients with mutations in the gene encoding for caspase-8 (CASP8) present with a

syndrome of lymphadenopathy and splenomegaly, marginal elevation of DNTs, and

defective FAS-induced lymphocyte apoptosis, were previously classified as ALPS Type

IIb15. However, in contrast to other ALPS cases, these patients also demonstrate defective

T, B, and NK cell activation, with consequent recurrent bacterial and viral infections15,32.

Given the distinct phenotype, the previously defined term Caspase-Eight Deficiency State

(CEDS) is now included to describe this disorder (Table 4)29.

Table 4. Revised Classification of ALPS-related disorders

Previous Nomenclature

Revised Nomenclature

Gene Definition

ALPS Type IIb CEDS CASP8 Patients present with lymphadenopathy and/or splenomegaly, marginal DNT elevation, recurrent infections and germline mutations in caspase 8.

ALPS Type IV RALD NRAS Patients present with autoimmunity, lymphadenopathy and/or splenomegaly, elevated or normal DNTs and somatic mutations in NRAS.

DALD DALD Unknown Patients present with autoimmunity, lymphadenopathy and/or splenomegaly, normal DNTs and defective in vitro FAS-mediated apoptosis.

XLP1 XLP1 SH2D1A Patients present with fulminant Epstein-Barr virus infection, hypogammaglobulinemia or lymphoma.

CEDS, caspase-eight deficiency state; RALD, RAS-associated autoimmune leukoproliferative disease; DALD, Dianzani autoimmune lymphoproliferative diease; X-linked lymphoproliferative syndrome.

The clinical syndrome of autoimmune phenomena, lymphocyte accumulation, and

somatic mutations in NRAS, previously designated ALPS Type IV, is now reclassified


47

under a new nosologic entity termed RALD, for RAS-associated autoimmune

leukoproliferative disease (Table 4)19. The main rationale for this change was the

recognition of two additional patients with somatic NRAS mutations who did not

demonstrate elevated TCRαβ+-DNT cells (Oliveira JB and Bleesing JJ, unpublished

observations). Additionally, these patients presented with atypical features such as

elevations in cells of myeloid origin (monocytosis and granulocytosis), and demonstrated

partial overlap with juvenile myelomonocytic leukemia (JMML) as well as lymph node

histopathology not typical of ALPS (Oliveira JB, unpublished observations).

No nomenclature modifications are suggested for the ALPS-related clinical

syndrome known as DALD (Dianzani Autoimmune Lymphoproliferative Disease)33,

characterized by autoimmunity, lymphadenopathy and/or splenomegaly, and defective in

vitro Fas-mediated lymphocyte apoptosis, without elevation in TCRαβ+DNT cells. The

genetic defect is not known, but an inherited component is suggested based on the

defective FAS function displayed by relatives of these patients. Patients may display a

wide range of autoimmune manifestations and an increased risk of cancer has been

reported34,35. Finally, the X-linked lymphoproliferative disease (XLP1), a genetic

immunodeficiency caused by mutations or deletions in the SH2D1A gene, can be

included in the spectrum of ALPS-like disorders. These patients frequently display

defective apoptosis in response to T cell receptor (TCR) restimulation and this pathway

appears to be essential for constraining effector T cell expansion and preventing

immunotoxicity36,37.

CONCLUSION

The modifications in the diagnostic criteria and classification system introduced here

should facilitate diagnosis in locations without access to advanced testing, streamline

diagnostic work up of patients, standardize nomenclature among different centers and

allow easy inclusion of newly discovered genetic defects resulting in classical ALPS.

Acknowledgments

We thank all the participants of the NIH ALPS workshop, conducted on September 21-

22, 2009, which led to further discussions and deliberations leading to the preparation of

Chapter 2

48

this document. This research was supported by the Intramural Research Program of the

NIH (NIAID, NCI, CC) and funding for the ALPS Workshop was provided by NIH

Office of the Rare Diseases (ORD) and Division of Intramural Research, NIAID. Authors

also wish to thank Ugo Ramenghi, Andrew Snow, and Michael Sneller for reviewing this

manuscript.

References 1. Fisher GH, Rosenberg FJ, Straus SE, et al. Dominant interfering Fas gene

mutations impair apoptosis in a human autoimmune lymphoproliferative syndrome. Cell. 1995;81:935-946.

2. Rieux-Laucat F, Le Deist F, Hivroz C, et al. Mutations in Fas associated with human lymphoproliferative syndrome and autoimmunity. Science. 1995;268:1347-1349.

3. Canale VC, Smith CH. Chronic lymphadenopathy simulating malignant lymphoma. J Pediatr. 1967;70:891-899.

4. Rao LM, Shahidi NT, Opitz JM. Hereditary splenomegaly with hypersplenism. Clin Genet. 1974;5:379-386.

5. Gasser G. Pseudomononucleosis. Clinical Pahology. 1967. 6. Sneller MC, Straus SE, Jaffe ES, et al. A novel lymphoproliferative/autoimmune

syndrome resembling murine lpr/gld disease. J Clin Invest. 1992;90:334-341. 7. Watanabe-Fukunaga R, Brannan CI, Copeland NG, Jenkins NA, Nagata S.

Lymphoproliferation disorder in mice explained by defects in Fas antigen that mediates apoptosis. Nature. 1992;356:314-317.

8. Sneller MC, Wang J, Dale JK, et al. Clincal, immunologic, and genetic features of an autoimmune lymphoproliferative syndrome associated with abnormal lymphocyte apoptosis. Blood. 1997;89:1341-1348.

9. Le Deist F, Emile JF, Rieux-Laucat F, et al. Clinical, immunological, and pathological consequences of Fas-deficient conditions. Lancet. 1996;348:719-723.

10. Jackson CE, Fischer RE, Hsu AP, et al. Autoimmune lymphoproliferative syndrome with defective Fas: genotype influences penetrance. Am J Hum Genet. 1999;64:1002-1014.

11. Rieux-Laucat F, Blachere S, Danielan S, et al. Lymphoproliferative syndrome with autoimmunity: A possible genetic basis for dominant expression of the clinical manifestations. Blood. 1999;94:2575-2582.

12. Holzelova E, Vonarbourg C, Stolzenberg MC, et al. Autoimmune lymphoproliferative syndrome with somatic Fas mutations. N Engl J Med. 2004;351:1409-1418.

13. Dowdell KC, Niemela JE, Price S, et al. Somatic FAS mutations are common in patients with genetically undefined autoimmune lymphoproliferative syndrome (ALPS). Blood.


49

14. Del-Rey M, Ruiz-Contreras J, Bosque A, et al. A homozygous Fas ligand gene mutation in a patient causes a new type of autoimmune lymphoproliferative syndrome. Blood. 2006;108:1306-1312.

15. Chun HJ, Zheng L, Ahmad M, et al. Pleiotropic defects in lymphocyte activation caused by caspase-8 mutations lead to human immunodeficiency. Nature. 2002;419:395-399.

16. Wang J, Zheng L, Lobito A, et al. Inherited human Caspase 10 mutations underlie defective lymphocyte and dendritic cell apoptosis in autoimmune lymphoproliferative syndrome type II. Cell. 1999;98:47-58.

17. Wu J, Wilson J, He J, Xiang L, Schur PH, Mountz JD. Fas ligand mutation in a patient with systemic lupus erythematosus and lymphoproliferative disease. J Clin Invest. 1996;98:1107-1113.

18. Bi LL, Pan G, Atkinson TP, et al. Dominant inhibition of Fas ligand-mediated apoptosis due to a heterozygous mutation associated with autoimmune lymphoproliferative syndrome (ALPS) Type Ib. BMC Med Genet. 2007;8:41.

19. Oliveira JB, Bidere N, Niemela JE, et al. NRAS mutation causes a human autoimmune lymphoproliferative syndrome. Proc Natl Acad Sci U S A. 2007;104:8953-8958.

20. Bleesing JJ, Straus SE, Fleisher TA. Autoimmune lymphoproliferative syndrome. A human disorder of abnormal lymphocyte survival. Pediatr Clin North Am. 2000;47:1291-1310.

21. Straus SE, Sneller M, Lenardo MJ, Puck JM, Strober W. An inherited disorder of lymphocyte apoptosis: the autoimmune lymphoproliferative syndrome. Ann Intern Med. 1999;130:591-601.

22. Lenardo MJ, Oliveira JB, Zheng L, Rao VK. ALPS-ten lessons from an international workshop on a genetic disease of apoptosis. Immunity;32:291-295.

23. Rao VK, Straus SE. Causes and consequences of the autoimmune lymphoproliferative syndrome. Hematology. 2006;11:15-23.

24. Seif AE, Manno CS, Sheen C, Grupp SA, Teachey DT. Identifying autoimmune lymphoproliferative syndrome (ALPS) in children with Evans syndrome: a multi-institutional study. Blood.

25. Magerus-Chatinet A, Stolzenberg MC, Loffredo MS, et al. FAS-L, IL-10, and double-negative CD4- CD8- TCR alpha/beta+ T cells are reliable markers of autoimmune lymphoproliferative syndrome (ALPS) associated with FAS loss of function. Blood. 2009;113:3027-3030.

26. Caminha I, Fleisher TA, Hornung RL, et al. Using biomarkers to predict the presence of FAS mutations in patients with features of the autoimmune lymphoproliferative syndrome. J Allergy Clin Immunol.

27. Teachey DT, Manno CS, Axsom KM, et al. Unmasking Evans syndrome: T-cell phenotype and apoptotic response reveal autoimmune lymphoproliferative syndrome (ALPS). Blood. 2005;105:2443-2448.

28. Muppidi J, Porter M, Siegel RM. Measurement of apoptosis and other forms of cell death. Curr Protoc Immunol. 2004;Chapter 3:Unit 3 17.

29. Bidere N, Su HC, Lenardo MJ. Genetic disorders of programmed cell death in the immune system. Annu Rev Immunol. 2006;24:321-352.

Chapter 2

50

30. Lim MS, Straus SE, Dale JK, et al. Pathological findings in human autoimmune lymphoproliferative syndrome. Am J Pathol. 1998;153:1541-1550.

31. Jaffe ES, Banks PM, Nathwani B, Said J, Swerdlow SH. Recommendations for the reporting of lymphoid neoplasms: a report from the Association of Directors of Anatomic and Surgical Pathology. Mod Pathol. 2004;17:131-135.

32. Su H, Bidere N, Zheng L, et al. Requirement for caspase-8 in NF-kappaB activation by antigen receptor. Science. 2005;307:1465-1468.

33. Dianzani U, Bragardo M, DiFranco D, et al. Deficiency of the Fas apoptosis pathway without Fas gene mutations in pediatric patients with autoimmunity/lymphoproliferation. Blood. 1997;89:2871-2879.

34. Ramenghi U, Bonissoni S, Migliaretti G, et al. Deficiency of the Fas apoptosis pathway without Fas gene mutations is a familial trait predisposing to development of autoimmune diseases and cancer. Blood. 2000;95:3176-3182.

35. Campagnoli MF, Garbarini L, Quarello P, et al. The broad spectrum of autoimmune lymphoproliferative disease: molecular bases, clinical features and long-term follow-up in 31 patients. Haematologica. 2006;91:538-541.

36. Snow AL, Marsh RA, Krummey SM, et al. Restimulation-induced apoptosis of T cells is impaired in patients with X-linked lymphoproliferative disease caused by SAP deficiency. J Clin Invest. 2009;119:2976-2989.

37. Lenardo M, Chan KM, Hornung F, et al. Mature T lymphocyte apoptosis--immune regulation in a dynamic and unpredictable antigenic environment. Annu Rev Immunol. 1999;17:221-253.

CHAPTER 3

NRAS MUTATION CAUSES A HUMAN AUTOIMMUNE

LYMPHOPROLIFERATIVE SYNDROME

João B. Oliveira,1 Nicolas Bidère,2 Julie E. Niemela,1 Lixin Zheng,2 Keiko Sakai,2

Cynthia P. Nix,2 Robert L. Danner,3 Jennifer Barb,4 Peter J. Munson,4 Jennifer M. Puck,5

Janet Dale,6 Stephen E. Straus,6 Thomas A. Fleisher,1 Michael J. Lenardo2

1Department of Laboratory Medicine, Clinical Center; 2Molecular Development Section,

Laboratory of Immunology, National Institute of Allergy and Infectious Diseases; 3Functional Genomics and Proteomics Facility, Critical Care Medicine Department,

Clinical Center; 4Mathematical and Statistical Computing Laboratory, Center for

Information Technology; 5Genetics and Molecular Biology Branch, National Human

Genome Research Institute; 6Laboratory of Clinical Infectious Diseases, National

Institute of Allergy and Infectious Diseases. National Institutes of Health, Bethesda, MD,

20892, USA

Proc Natl Acad Sci U S A. 2007;104(21):8953-8.

Chapter 3

52

ABSTRACT

The p21 RAS subfamily of small GTPases, including KRAS, HRAS, and NRAS,

regulates cell proliferation, cytoskeletal organization and other signaling networks,

and is the most frequent target of activating mutations in cancer. Activating

germline mutations of KRAS and HRAS cause severe developmental abnormalities

leading to Noonan, cardio-facial-cutaneous and Costello syndrome, and somatic

events are associated with many forms of cancer. Autoimmune lymphoproliferative

syndrome (ALPS) is the most common genetic disease of lymphocyte apoptosis and

causes autoimmunity as well as excessive lymphocyte accumulation, particularly of

CD4-, CD8- ab T cells. Mutations in ALPS typically affect CD95 (Fas/APO-1)-

mediated apoptosis, one of the extrinsic death pathways involving tumor necrosis

factor receptor (TNFR) superfamily proteins, but certain ALPS individuals have no

such mutations. We show here that the salient features of ALPS as well as a

predisposition to hematological malignancies can be caused by a heterozygous

somatic Gly13Asp activating mutation of the NRAS oncogene that does not impair

CD95-mediated apoptosis. The increase in active, GTP-bound NRAS augments

RAF/MEK/ERK signaling which markedly decreases the pro-apoptotic protein BIM

and attenuates intrinsic, nonreceptor-mediated mitochondrial apoptosis. Thus,

somatic activating mutations in NRAS can be associated with a non-tumoral

phenotype in humans. Our observations on the effects of NRAS activation indicate

that RAS-inactivating drugs, such as farnesyl-transferase inhibitors (FTIs) should

be examined in human autoimmune and lymphocyte homeostasis disorders.

INTRODUCTION

The RAS genes (NRAS, KRAS, and HRAS) encode 21-kDa proteins that are members of

the superfamily of small GTP-binding proteins, which have diverse intracellular signaling

functions including control of cell proliferation, growth, and apoptosis1. Somatic

activating mutations in RAS are present in up to 30% of all human cancers2. Germline

RAS pathway mutations have only recently been described as causing the related

Costello (HRAS), Noonan (PTPN11, KRAS, SOS1), and cardiofaciocutaneous syndromes

(KRAS, BRAF, MEK1, and MEK)3-7. Individuals with these syndromes typically present

NRAS in an ALPS-like syndrome

53

with severe developmental anomalies in various combinations of facial abnormalities,

heart defects, short stature, skin and genital abnormalities, and mental retardation8.

Defects in the immune system have not been reported. Patients with Costello and Noonan

syndromes have an increased propensity to solid and hematopoietic tumors, respectively 3,8. Germline mutations in NRAS have not yet been described.

The autoimmune lymphoproliferative syndrome (ALPS) (OMIM 601859/603909)

is the most common genetic disorder of lymphocyte apoptosis and is characterized by

chronic accumulation of nonmalignant lymphocytes, defective lymphocyte apoptosis, and

an increased risk for the development of hematological malignancies9. A signature of the

disease is the accumulation of αβ T cells lacking the CD4 and CD8 coreceptors that are

termed “double-negative” T cells (DNTs: CD4− CD8− TCRαβ+ cells). These cells bear no

known relationship to thymic DNTs, a stage that occurs before αβ TCR gene

rearrangements in ontogeny10. According to genotype, ALPS can be classified as types

Ia, Ib, and II, which are due to germline mutations in CD95 (TNFRSF6), CD95 ligand

(TNFSF6), and caspase 10 (CASP10), respectively11-15. Additionally, somatic mutations

of CD95 in αβ DNTs can also cause ALPS of type Im (mosaic)16. All of these mutations

impair extrinsic, Fas receptor-mediated apoptosis. An enigma has been the ALPS

individuals who have no defects in CD95 pathway apoptosis (some ALPS type III

patients)17. This group encompasses a large number of individuals and is probably

genetically heterogeneous. In an attempt to unveil new genetic defects, we investigated

alternative apoptosis pathways in ALPS type III and identified one ALPS patient with a

unique defect in cytokine withdrawal-induced apoptosis due to an activating somatic

NRAS mutation affecting hematopoietic cells.

METHODS

Cells and treatments

Patients were studied under an NIH IRB approved ALPS research protocol after

obtaining informed consent. Peripheral blood lymphocytes (PBL) were isolated by Ficoll-

Hypaque gradient centrifugation, and cultured in RPMI-1640 media (supplemented with

2µM L-glutamine, 10 mM HEPES, 100 IU/ml penicillin, 100 µg/ml streptomycin, 10%

fetal bovine serum). PBL were activated with 1 µg/ml of anti-CD3 (OKT3, Ortho

Chapter 3

54

Biotech, Bridgewater, NJ) and 25 IU/ml of recombinant human IL-2 (Roche Applied

Science, Indianapolis, IN) for 3 days. The activated cells were washed twice with PBS

and cultured for at least 3 additional days in complete media supplemented with 100

IU/ml of IL-2. Cells were used for experiments between the 6th and 21st days in culture.

For cytokine withdrawal assays, IL-2-containing media was changed 24 h prior to

experiments. The IL-2-treated cells were then washed 3 times with PBS and re-suspended

at 1x106 cells/ml in complete media without IL-2 and cultured for different periods of

time. For other apoptosis assays, activated lymphocytes were treated with staurosporine

(Calbiochem, EMD Biosciences San Diego, CA), an agonistic anti-Fas antibody Apo1.3

(Alexis, San Diego, CA) or γ-irradiated. Apoptosis was determined by measuring plasma

membrane integrity and loss of the mitochondrial transmembrane potential, through

simultaneous staining with 50 ng/ml of propidium iodide (PI), and 40 nM of 3, 3'-

dihexyloxacarbocyanine iodide (DiOC6) (Calbiochem, EMD Biosciences) for 15 min at

37oC. Live cells (PI negative and DiOC6 positive) were collected by flow cytometry

using a constant time acquisition. The % of cell loss was calculated according to the

formula: ([number of live cells before treatment – number of live cells after treatment] /

number of live cells before treatment) x 100. “Cell survival” was calculated as: 100 - %

cell loss. Resting T cells were purified by negative selection using CD4 T cell separation

kit II (Miltenyi Biotec, Auburn, CA). Resting B cells and monocytes were isolated by

positive selection using PE-conjugated anti-CD19 or anti-CD14 antibodies (BD) and then

anti-PE magnetic beads (Miltenyi Biotec). The purity of separated cell populations was

assessed by flow cytometry and it varied from 90 to 95% for T cells and 75 to 85% for B

cells and monocytes. Chemical inhibitors PD98059, U0126, LY294002 and FTI-277

were from Calbiochem.

Immunoblotting

Stimuli were terminated by addition of ice-cold PBS and cell pellets were lysed

immediately with RIPA buffer (10 mM Tris-HCl pH 7.0, 150 mM NaCl, 0.1% NP40,

0.1% sodium dodecyl sulfate, 1% sodium deoxycholate) containing 1x protease inhibitor

cocktail (Complete Mini, Roche) and nuclease (Benzonase, Novagen, EMD

Biosciences). Samples were incubated on ice for 30 min and spun at 12,000xg for 5 min


55

at 4-8oC. The lysates were utilized immediately or stored at –80oC. Protein concentration

was determined by the Bradford method (Micro BCA, Pierce, Rockford, IL) and 20 µg of

protein was separated by polyacrylamide gel electrophoresis (Invitrogen, Carlsbad, CA).

Proteins were transferred onto a nitrocellulose membrane, and incubated with blocking

buffer (0.1% Tween 20, 5% non-fat dry milk in PBS) at room temperature (RT) for 1h.

Membranes were then incubated at 4oC overnight with primary antibodies diluted in

blocking buffer under constant agitation. Membranes were washed 3 times with 5 min

intervals using PBS-T (0.1% Tween 20 in PBS), and incubated with HRP-conjugated

secondary antibodies at RT for 1h. Membranes were then washed 3 times, incubated with

chemiluminescent reagents and exposed to film. Antibodies and sources are: anti-BIM,

anti-BAK (Stressgen, Ann Arbor, MI); anti-BCL-2, anti-p27kip1, anti-MCL-1, anti-β-

actin, anti-BAX, anti-cytochrome c (clone 7H8.2C12), anti-cytochrome c oxidase IV

subunit II, anti-BCL-XL (BD Biosciences, San Jose, CA); anti-PUMA (Axxora, San

Diego, CA); anti-AIF, anti-N-RAS (Clone F155) (Santa Cruz, Santa Cruz, CA).

Quantitative Real-Time PCR

Total RNA was extracted using RNeasy mini kit (Qiagen, Valencia, CA) according to the

manufacturer’s protocol. To minimize genomic DNA contamination and amplification,

we performed an on-column DNAse I (Qiagen) treatment, and used primers spanning

exon-exon boundaries and included non-reverse-transcriptase controls in all reactions.

First strand complementary DNA (cDNA) synthesis was accomplished by using

Superscript III (Invitrogen), and the cDNA was used immediately used for quantitative

polymerase chain reaction (qPCR) or stored at -20oC. qPCR was done on a 7700 ABI

PRISM instrument with all the probes and primers purchased from the same company

(Applied Biosystems). In brief, 1/20th (1 µL) per well of the cDNA reaction was

aliquoted in triplicate in 96-well optical plates, and a mixture was added containing

TaqMan(R) universal PCR master mix and the final concentrations of 0.9 µM of specific

primers and 0.25 µM of the fluorescent probe, for a final volume of 50 µL. Thermal cycle

conditions were as follows: 2 min at 50oC, 10 min at 95oC, and 40 cycles of 15 sec at

95oC and 1 min at 60oC. Relative gene expression was calculated using the 2-ΔΔCt

method after normalization using a housekeeping gene (18S rRNA), as described18. The

Chapter 3

56

values were again normalized against one normal controls in each experiment, thus to

calculate the fold changes in contrast to the normal. Controls for exogenous

contamination (no template) were included in all qPCR experiments. Additionally, the

efficiency of the primer/probe pair used for a targeting gene was compared to that of the

housekeeping gene for each new set of primer and probes.

Subcellular fractionation

Cytosolic extracts were prepared by a selective digitonin-based plasma membrane

permeabilization technique. An amount of 5 x 106 cells was washed twice in PBS and

incubated on ice with extraction buffer (20 µg/ml digitonin, 250 mM sucrose, 20 mM

HEPES, 10 mM KCl, 1.5 mM MgCl2, 1 mM EDTA, 1 mM EGTA, pH 7.5, 1 x protease

inhibitor cocktail) for 5 min. Permeabilization was monitored by trypan blue

incorporation until at least 80% of the cells became trypan-blue positive. Cells were then

spun at 300x g for 10 min at 4oC and the supernatant was collected (cytosolic fraction).

The pellet (membrane fraction) was lysed using 3% SDS-containing RIPA buffer at room

temperature for 30 min. The purity of cytosolic fraction was evaluated by blotting for

mitochondrial cytochrome oxidase II or Ox P4.

Small-interfering RNA and transient transfections

Normal human PBL were separated and activated as described above. Activated PBL

were transfected with either a small interfering oligonucleotide RNA (siRNA) or a

scrambled non-silencing control oligo (nsRNA). siRNAs were designed online using the

software BLOCK-iTTM RNAi designer from Invitrogen

(https://rnaidesigner.invitrogen.com/rnaiexpress/setOption.do?designOption=stealth) and

synthesized by the same company. Transfection of activated T cells was carried out by

electroporation using the Nucleofection system (Amaxa, Koln, Germany), according to

the manufacturer’s protocol. Briefly, 4 x 106 lymphocytes were resuspended in 100 µl of

T cell nucleofector solution (Human T Cell Nucleofector kit, Amaxa) containing 200

pmol of double-stranded siRNA or nsRNA and electroporated using the program T23.

Assessment of knockdown efficiency and experiments were performed 3 days later by

immunoblotting. The sequence of the sense oligonucleotides used to knockdown BIM


57

are: #1 GGAUCGCCCAAGAGUUGCGGCGUAU and #2

GGCCUAUUCUCAGAGGAUUAUGUAA. For N-ras knockdown we used: #1

GCGCACUGACAAUCCAGCUAAUCCA; #2

CCAGCUAAUCCAGAACCACUUUGUA; #3

GGACAUACUGGAUACAGCUGGACAA. Scrambled oligonucleotides were used as

non-silencing controls. Plasmids expressing human wild-type NRAS (kindly provided by

Silvio Gutkind, NIDCR) and G13D mutant were transiently transfected into primary

human PBL (kit T, Amaxa), Jurkat A3 (kit V, Amaxa) and H-9 (BTX) by electroporation.

Immunofluorescence

Cells were fixed with 4% paraformaldehyde in PBS at 4 °C for 20 min, and cytospun

onto slides. Cells were then permeabilized with 0.05% Triton X-100 (or CHAPS 0.001%,

for BAX staining) at RT for 5 min, washed and blocked with 10% fetal calf serum in PBS

for 30 min. Samples were then incubated with primary antibodies diluted in 0.5% BSA at

RT for 45 min. After 3 washes with PBS, cells were incubated with

fluorochromeconjugated secondary antibodies diluted in 0.5% BSA at RT for 45 min.

After a new round of washes, nuclei were stained with 40 ng/ml Hoechst 33342

(Molecular Probes, Invitrogen, Eugene, OR). Slides were then washed in PBS and

mounted with a coverslip using Fluoromount-G (Southern Biotechnology, Birmingham,

AL). Images were acquired on a Leica TCS-NT/SP confocal microscope using a 63x oil

immersion objective. For enumeration, a blinded observer using a conventional

fluorescence microscope counted at least 200 cells per sample. Antibodies used: anti-

cytochrome c (6H2.B4, BD Pharmingen), anti-HSP60 (E-1, Santa Cruz), and anti-BAX

(NT, Upstate, Charlottesville, VA).

Active NRAS pull down

Active GTP-bound NRAS was immunoprecipitated using the EZ detection Ras activation

kit (Pierce), according to the manufacture’s protocol. The immunoprecipitated proteins

were separated by SDS-PAGE and probed with an anti-NRAS antibody (F-155, Santa

Cruz).

Chapter 3

58

DNA Sequencing

DNA samples were isolated from P58 and an unrelated, healthy individual (wild-type

control). Selected regions of the following loci were amplified using puReTaq Ready-To-

Go PCR beads (Amersham Biosciences, Piscataway, NJ): BCL2L11 (BIM), MAPK3

(ERK1), MAPK1 (ERK2), MAPK14 (p38a), MAPK11 (p38b), MAPK8 (JNK1), MAPK9

(JNK2), MAP2K3 (MKK3), MAP2K6 (MKK6), MAP2K4 (MKK4), MAP2K7 (MKK7),

DUSP1 (CL100/MKP1), DUSP2 (PAC1), DUSP4 (hVH2/MKP2), DUSP5 (B23/hVH3),

DUSP6 (MKP3), DUSP7 (PYST2/MKPX), DUSP9 (MKP4), FOXO3A, FOXO1A,

FOXO4, SOS1 and NRAS. The PCR products were directly sequenced using ABI Prism

BigDye (v 1.1) terminators and analyzed on an ABI 3100 Sequencer (PE Applied

Biosystems, Foster City, CA). Primer sequences and annealing temperatures are available

upon request. The sequencing data for the patient and wild-type control was compared

with Ensembl (http://www.ensembl.org) data (v. 35 - Nov2005) for each locus. All

identified mutations/SNPs were confirmed by sequencing a second PCR product.

Microarray Analysis

RNA expression in lymphocytes from P58 was compared to that in 2 normal controls

(NL1, NL2) at 0 and 24 hours post IL-2 withdrawal. Total RNA was extracted, reverse

transcribed, biotin labeled, fragmented, and hybridized to human Affymetrix

U133Plus2.0 microarrays following standard Affymetrix procedures (Affymetrix, Santa

Clara, CA). After staining with streptavidin-phycoerythrin (Molecular Probes) and

biotinylated anti-streptavidin antibody (Vector Laboratories), microarrays were scanned

in the CCMD/CC Functional Genomics and Proteomics Facility using the Affymetrix

GeneChip Scanner. Summary probe set intensities were computed from the resulting

images using GCOS version 1.2 software. Results were deposited into the NIHLIMS

database, then retrieved and analyzed using the MSCL Analyst's Toolbox

(http://affylims.cit.nih.gov) and the JMP statistics package (SAS, Inc., Cary, NC).

Briefly, signal intensities were quantile-normalized and transformed using an adaptive

variance stabilizing transform, termed "S10"19. A two-way ANOVA on time (0, 24 hr)

and patient group (NL, P58) was performed on each gene. The difference between P58

and NL was calculated along with the significance of the patient group variable. Genes


59

were selected if this difference was greater than two-fold and the change among the three

patient groups reached P < 0.05, unadjusted. This resulted in a list of 205 probe sets,

corresponding to 158 unique genes and 31 probe sets without usable annotations. A

hierarchical cluster analysis on the difference from mean expression for the 205 probe

sets was used to construct a heatmap and dendrogram, using the six samples from the NL

and P58 groups, thus highlighting groups of similarly behaving genes. This gene list was

then thematically explored using Ingenuity Pathways Analysis 3.0 (Ingenuity Systems).

RESULTS

Defective IL-2 Withdrawal-Induced Apoptosis in a Patient with Clinical and Laboratory

Hallmarks of ALPS

The intrinsic mitochondrial pathway of apoptosis can be triggered by developmental cues

in the thymus or bone marrow, cytokine deprivation, DNA damage, or treatment with

cytotoxic drugs20,21. To screen for defects in this pathway, we exposed activated

lymphocytes from individuals with salient features of ALPS (lymphadenopathy and

increased αβ DNTs) but normal CD95-mediated apoptosis, to inducers of intrinsic

apoptosis including staurosporine, γ-radiation, and cytokine withdrawal. We identified an

individual whose lymphocytes clearly resisted death induced by IL-2 withdrawal (Fig.

1A).

The affected individual [National Institutes of Health (NIH) cohort patient 58,

P58] is a 49-year-old male with lifelong overexpansion of lymphocytes, and an unusual

history of two malignancies: childhood leukemia and early adulthood lymphoma, both

successfully treated (Table 1). Peripheral blood immunophenotyping revealed a mild but

sustained elevation in αβ DNT cells over several years and other findings frequently seen

in ALPS, including an elevated percentage of CD5+ B cells and low numbers of CD27+ B

cells22. However, other features such as low CD25/HLA-DR ratio and high numbers of

CD3+CD57+ were not seen (Table 1). Lymph node biopsy performed elsewhere and

reviewed at the NIH revealed reactive follicular hyperplasia and sinus histiocytosis, but

DNT cells were not prominent. Several serum autoantibodies were detected and

elevations of several T helper 2 cytokines including IL-5, -6, -8, -10, and -13 were

observed (Tables 1 and data not shown). Based on the published NIH ALPS diagnostic

Chapter 3

60

criteria of elevated DNT on peripheral blood, chronic lifelong nonmalignant hyperplasia

and defective lymphocyte apoptosis, P58 received a provisional clinical diagnosis of

ALPS, with recognition that this is not a typical clinical presentation of this disease.

Despite defective IL-2 withdrawal death, we found no abnormalities in apoptosis

induced by an agonistic anti-APO-1 (CD95) antibody (Apo1.3), staurosporine, or γ-

radiation (Fig. 1B–D). Moreover, activated T cells did not spontaneously proliferate or

secrete cytokines, but did show persistent proliferation after IL-2 withdrawal compared

with normal cells (Fig 2. and data not shown). Thus, lymphocytes from P58 demonstrated

a specific defect in the intrinsic pathway of apoptosis.

Table 1. Clinical and laboratory findings in P58

Clinical history

Lifelong lymphadenopathy and splenomegaly

Marked leukocytosis (≥100,000 cels/mm3) with 40 % blasts noted on peripheral smear at

8 months of age treated with oral agents, resolution by age 4 years

Large, non-cleaved, non-Hodgkinʼs B cell-lymphoma at 32 years of age

Currently well at 48 years with persistent lymphadenopathy

Laboratory findings*

Positive autoantibodies: direct antiglobulin test, ANA, ACA IgG and IgM, rheumatoid

factor

Total leukocytes (3,300-9,600/mm3) = 9,630/mm3

Total lymphocytes (460-4,700/mm3) = 3,929/mm3

CD3+/CD4+ (28.6-57.2%/358-1259/mm3) = 19.9 % (782/mm3)

CD3+/CD8+ (12.9-46.9%/194-836/mm3) = 7.8 % (306/mm3)

CD3+/CD4-/CD8-/TCRαβ+ (<1%%/<20/mm3) = 2.4% (94/mm3)

CD20+ (3.7-15.5%/49-424/mm3) = 57.5 % (2259/mm3)

* Adult reference range for each value is shown in parentheses. ANA, antinuclear antibodies; ACA, anticardiolipin antibodies


61

Figure 1. Defective cytokine withdrawal-induced apoptosis in P58 lymphocytes. (A–D) Activated peripheral blood mononuclear cells (PBLs) from normal volunteers (NL A and B), from a patient with an inactivating Fas mutation (ALPS 1A), and from P58 were cultured in media without IL-2 for the indicated periods of time (A); or treated for 18 h with anti-Fas (Apo1.3) antibody (B), staurosporine (C), or γ-irradiation (D) at the indicated doses. (E) (a–d) Merged views of active BAX (green) and Hoechst nuclear staining (blue) of cells from P58 and a normal control (NL) at 0 h

(a and b) and 72 h after cytokine withdrawal (c and d). (e–h) Merged views of staining with the mitochondrial marker Hsp60 (green), cytochrome c (red), and Hoechst staining (blue) at 0 h (e andf) or 72 h after IL-2 withdrawal (g and h). (F) Quantitation using fluorescence microscopy of the relative proportion of cells in the experiment in E showing active BAX expression (activ. BAX), diffuse cytochrome c (diff. cyt. c), or apoptotic (apop.) nuclei. Data shown are the representative of two or three independent experiments. Shown is mean ± SD.

Chapter 3

62

Figure 2. In vitro cellular proliferation and viability of P58 lymphocytes. (A) Activated lymphocytes from 4 normal donors (NL 1 to 4), an ALPS 1A patient and P58 were cultured in media containing 100 IU/ml of IL-2, and incorporation of [3H]-thymidine analyzed 18 h later. (B) Activated lymphocytes from NL1, NL2, an ALPS 1A patient and P58 were cultured as described in A and total cell numbers counted daily by flow cytometry. (C) [3H]-thymidine incorporation by activated lymphocytes from a NL and P58 that were cultured in media without IL-2 for 24h. (D) Activated lymphocytes from 3 normal donors (NL1-3), an ALPS 1A patient and P58 were cultured in media without IL-2 and cell death was measured by staining with propidium iodide (PI) and 3, 3'-dihexyloxacarbocyanine iodide (DiOC6) followed by flow cytometric analysis.

During cytokine withdrawal, the proapoptotic B cell lymphoma 2 (BCL-2) family

members BAX and BAK are activated and oligomerize at mitochondrial surfaces,

causing permeabilization of the outer membrane, which releases cytochrome c and

triggers apoptosis20,21. After IL-2 withdrawal, we found that P58 cells were markedly

defective in BAX activation and mitochondrial cytochrome crelease, correlating with a


63

decreased percentage of apoptotic nuclei compared with control cells after cytokine

withdrawal, but not staurosporine treatment, clearly indicating a selective mitochondrial

apoptosis defect (Fig. 1E and F, and Fig. 3A and B

Figure 3. Analysis of cytosolic release of cytochrome c and AIF by subcellular fractionation. Immunoblotting of cytochrome c (Cyt C), apoptosis inducing factor (AIF), Cox IV, and β-actin in the cytosols of activated T lymphocytes from a NL, an ALPS 1A patient, and P58 that have been deprived of IL-2 for 72 h (A) or treated with 500 nM of staurosporine (STS) for 2 h (B). The degree of purity of the cytosolic fractions is demonstrated by probing with the mitochondrial proteins CoxIV (A) or OxP4 (B), CW, cytokine withdrawal.

Diminished BCL-2-Interacting Mediator of Cell Death (BIM) Levels in P58

Critical initiators of intrinsic apoptosis that act upstream of BAX and BAK are the BCL-2

homology 3 (BH3) subclass of the BCL-2 family20. Knockout mice lacking BIM, a BH3-

only protein, manifest immune abnormalities including lymphocyte accumulation,

autoimmunity, and various apoptosis defects, especially cytokine withdrawal-induced cell

death23. We therefore measured BIM levels and found markedly reduced basal and

induced levels after IL-2 withdrawal from activated T cells in P58 compared with normal

or ALPS type 1A controls (Fig. 4A). This defect was specific to BIM because other

proapoptotic (PUMA, BAX) and antiapoptotic (BCL-2, BCL-XL, MCL-1) BCL-2 family

members were unaffected (Fig. 4A). We also observed a constitutive BIM deficiency in

resting peripheral blood lymphocytes (PBLs) as well as purified T and B cells from P58

(Fig. 4B).

Chapter 3

64

In an additional effort to demonstrate the importance of BIM for mitochondrial

apoptosis in human cells, we used small interfering RNA (siRNA) to silence BIM

expression in otherwise normal human lymphocytes. BIM suppression caused resistance

to IL-2 withdrawal-, but not Fas- or staurosporine-induced apoptosis, as seen in P58 (Fig.

4C and data not shown). Taken together, these data demonstrate that cells from P58 have

a selective decrease of the proapoptotic protein BIM, which seems critical for cytokine

withdrawal-induced apoptosis.

P58 Has a Gain-of-Function NRAS Mutation

To uncover the genetic basis of the BIM defect in P58, we sequenced the genomic locus

of BIM and some of its regulators, including FOXO3a, FOXO1, FOXO4, ERK1/2,

and JNK1/2, but found no mutations20,24. We then carried out an unbiased screen by

interrogating mRNA expression patterns in healthy controls and P58 lymphocytes at 0

and 24 h after IL-2 withdrawal by using microarrays. Two hundred and five probe sets

were differentially expressed in P58 compared with controls (Fig. 5A; the microarray

dataset is deposited in the GEO public database). Surprisingly, the gene expression

pattern in P58 indicated the possible constitutive activation of the small GTPase,

neuroblastoma RAS (NRAS) (Fig. 5B). This included up-regulation of two dual-

specificity phosphatases (DUSP4 and -6) that are inhibitors of ERK signaling and were

previously shown to be overexpressed in tumor cell lines containing somatic activating

mutations in NRAS25.


65

Figure 4. BIM down-regulation in P58 lymphocytes. (A) Analysis by immunoblotting of BIM and other BCL-2 members expression after IL-2 withdrawal (CW) in PBLs from a NL, P58, and an ALPS 1A patient. The isoforms extra-long (EL), long (L), and short (S) are indicated. β-Actin is a loading control. (B) Resting ex vivo PBLs and purified T and B cells from normals (NL) and P58 were lysed and assessed for BIM expression by immunoblotting. (C) Activated human lymphocytes were transfected with either nonsilencing RNAi (nsRNAi) or with a small interfering

oligonucleotide directed at BIM (BIM RNAi) for 3 days, and then deprived of IL-2 or treated with anti-Fas antibody. Silencing efficiency

was assessed by immunoblotting (Lower Right) for the nonspecific (ns) and the silencing (si) transfections. Data shown are the representative of three independent experiments. Shown is mean ± SD.

We examined the nucleotide sequence of NRAS in P58 and found a single

heterozygous G-to-A transition causing a nonconservative aspartic acid substitution for

glycine at codon 13 (G13D) (Fig. 5C). To exclude the possibility that this mutation was a

Chapter 3

66

somatic event, we analyzed genomic DNA from various cells and tissues including

lymphoblasts, unseparated resting peripheral blood mononuclear cells, purified

monocytes, EBV-transformed B cells generated years before the diagnosis, as well as

buccal epithelial cells (Fig. 5C and data not shown). The mutation was found in all

hematopoietic samples but not in the epithelial cells, suggesting a somatic event affecting

only the hematopoietic compartment. Accordingly, neither of the patient's parents, his

sibling, or his two children harbored the mutant allele (data not shown). Importantly, the

very same amino acid change in NRAS arises somatically in human pediatric and adult

myeloid and lymphoid malignancies, but was never before documented in nonmalignant

cells or tissues 26,27.

Mutations in codons 12, 13, and 61 are known to stabilize RAS proteins in an

active, GTP-bound state by reducing intrinsic GTPase activity and causing resistance to

GTPase-activating proteins28,29. Consistent with the genetic alteration, we found that

active NRAS was increased in P58 lymphocytes in serum-rich and, especially, in serum-

poor conditions (Fig. 5D). We therefore hypothesized that the “gain-of-

function” NRAS mutation may result in hyperactivation of the RAS/RAF/ERK pathway,

which can negatively regulate BIM expression30-32

Hyperactive NRAS Induces BIM Down-Regulation Through ERK in Human Lymphocytes

To investigate the relationship between hyperactive NRAS and BIM suppression, we

transfected human lymphocytes with wild-type (NRAS WT) or mutant NRAS (NRAS G13D).

Overexpression of NRASWT and especially NRASG13D reduced BIM in H-9 cells and

primary normal human lymphocytes (Fig. 6A and B), reminiscent of HRAS

overexpression in epithelial cells33. We consistently observed a 3- to 4-fold reduction in

BIM, although this could be an underestimate of the effect because the transfection

efficiency did not reach 100% in all cases.


67

Figure 5. Identification of a de novo gain-of-function NRAS mutation in P58. (A) Heat map and relational dendrogram results of a microarray study demonstrating the 205 probe sets differentially expressed by cells from P58 compared with cells from two normal subjects, NL1 and NL2. Activated lymphocytes were lysed at 0 and 24 h after IL-2 withdrawal, and mRNA expression was analyzed by using microarrays (B) Diagram demonstrating differential expression in P58 cells of genes in the NRAS/RAF/ERK pathway. Red and green arrows indicate the genes up- or down-regulated in P58, respectively, compared with controls. (C) Sequencing of NRAS by using genomic DNA from P58 lymphoblasts and monocytes demonstrating the heterozygous G-to-A, G13D substitution. (D) Active GTP-bound NRAS was immunoprecipitated before and after serum withdrawal in a NL and P58, by using a Raf-1 (RBD)-GST fusion protein as bait. The total quantity of NRAS in cell lysates before immunoprecipitation is also shown.

Chapter 3

68

Figure 6. BIM down-regulation by NRAS through ERK. (A and B) Expression constructs for hemagglutinin (HA)-tagged wild type (WT) or active mutant (G13D) NRAS were transfected into the human lymphoid cell line H-9 (A) or primary human activated lymphocytes (B), followed 48 h later by quantification of BIM expression by immunoblotting. The numbers beneath each lane are the relative intensities of the bands in arbitrary units compared to the corresponding control lane. (C) Activated lymphocytes from two NL and from P58 were deprived of IL-2 and treated with either the DMSO vehicle or MEK1 inhibitors PD98059 (PD) (20 µM) or U0126 (10 µM) for 18 h, after which expression of BIM and BAX were analyzed by immunoblotting. (D) Lymphocytes from P58 and a normal control (NL) were deprived of IL-2 and treated daily with DMSO or PD98059 (20 µM). Apoptosis was measured daily by flow cytometry. Data shown are representative of three or more independent experiments. Shown is mean ± SD. EV, empty vector.

The most widely studied RAS effector proteins are either in the RAF/MEK/ERK

pathway or the phosphatidylinositol 3-kinase pathway1,2. We found that chemical

inhibition of MEK1, the MAP kinase kinase immediately upstream of ERK1/2, by using

the drugs PD98059 or U0126 rescued BIM protein expression in P58 lymphocytes and

NRAS-overexpressing H9 cells (Fig. 6C and data not shown). Remarkably, ERK

inhibition also restored apoptosis after IL-2 withdrawal in P58 lymphocytes (Fig. 6D).

Despite the strong increase in BIM protein levels after MEK inhibition, BIM mRNA

varied little (Fig. 7A), consistent with a posttranscriptional, rather than transcriptional,


69

down-regulation of BIM by ERK. This was also true when resting lymphocytes from P58

were treated with MEK inhibitors in IL-2-rich conditions, and BIM protein and mRNA

levels were measured (Fig. 7B and C). By contrast, the inhibitors LY294002 and

wortmannin had no effect on BIM levels in P58 lymphocytes indicating that the

phosphatidylinositol 3-kinase pathway was not involved (Fig. 7D and data not shown).

Thus, active NRAS down-regulates BIM through the induction of the RAF/MEK/ERK

pathway.

Correction of the Apoptotic Defect by Farnesylation Inhibition and NRAS Silencing

To further demonstrate the causative role of active NRAS in decreased BIM and

defective lymphokine withdrawal apoptosis, we used two approaches. First, we used

farnesyltransferase inhibitors (FTIs) that block the membrane localization and function of

RAS proteins and are currently under clinical investigation for the treatment of human

cancers34. Treatment with one such pharmaceutical, FTI-277, corrected the apoptotic

defect and increased BIM levels in P58 lymphocytes (Fig. 8A). This drug had a

negligible effect on apoptosis and BIM levels in normal cells (Fig. 8A).

Second, we decreased NRAS expression in P58 lymphocytes by using siRNA.

Each of three different siRNA oligonucleotides reduced NRAS expression and restored

BIM levels and sensitivity to apoptosis in P58 cells (Fig. 8B and C). By contrast, NRAS

siRNAs had no significant effect on BIM or sensitivity to IL-2 withdrawal in normal cells

(data not shown). These results verify that the heterozygous mutation causes an abnormal

gain-of-function that is reversed by silencing or functional inactivation of NRAS.

Chapter 3

70

Figure 7. Effects of MEK1 and PI3K manipulation in P58 cells. (A) Activated lymphocytes from two NL and from P58 were deprived of IL-2 and treated with either the DMSO vehicle or MEK1 inhibitors PD98059 (PD) (20 mM) or U0126 (10 mM) for 18 h, after which expression of BIM mRNA was measured by qPCR. (B) Samples from a NL and P58 were maintained in IL-2-rich media and treated with either DMSO or PD98059 for 18 h, and BIM expression was assessed by immunoblotting. (C) Quantitative real-time PCR analysis of BIM mRNA in a NL and P58 from the experiment described in (B). Results are representative of three experiments. Shown is mean ±SD. (D) Activated lymphocytes from a NL, an ALPS 1A patient and P58 were cultured under the described conditions in the presence or absence of the PI3-K inhibitor LY294002. BIM, BCL-2 and p27kip1 expression were analyzed by immunoblotting. The upregulation of p27kip1 expression upon cytokine withdrawal and in response to PI3-K inhibition served as a positive control for the treatments.

D


71

Figure 8. Correction of the apoptotic defect in P58 by inhibition of farnesylation and RNA silencing. (A) Activated lymphocytes from P58 and a normal control (NL) were deprived of IL-2

and treated daily with DMSO or FTI-277 (5 µM). (Inset) Resting lymphocytes from P58 were treated with DMSO (−) or 2, 5, or 10 µM FTI-277, and BIM expression was analyzed by immunoblotting. (B) Activated lymphocytes from a NL and P58 were transfected with nonsilencing (nsRNAi) or three different NRAS-targeted siRNA oligonucleotides (NRAS#1/2/3), and BIM expression was measured 3 days later by immunoblotting. (C) Activated lymphocytes from a NL and P58 were

transfected as described in B and subjected to IL-2 withdrawal, and apoptosis was measured daily for the indicated period of time. Data shown are representative of three or more independent experiments. Shown is mean ± SD.

Chapter 3

72

DISCUSSION

NRAS was identified as a transforming factor in neuroblastoma and other malignancies,

but its principal physiological role in humans has been uncertain1. Our genetic evidence

suggests that an activating somatic NRAS mutation causes BIM down-regulation and

defective intrinsic mitochondrial apoptosis prominently in lymphocytes, leading to the

key features resembling ALPS and hematopoietic malignancies.

Given the somatic origin of the NRAS mutation in our patient, the clinical

phenotype contrasts with the previously known human genetic disorders due to mutations

in p21 RAS oncoprotein pathways, including Costello syndrome (HRAS), Noonan

syndrome (PTPN11, KRAS, SOS1) and cardiofaciocutaneous syndrome

(MEK1, MEK2, B-RAF, and KRAS) that comprise developmental aberrations and

neoplastic transformation of various mesodermal and ectodermal tissues3-7. Transgenic

mice bearing activating NRAS mutations develop several hematological tumors, such as

leukemia, lymphoma, mastocytosis, and rare mammary carcinomas35,36.

Our observations reveal a vital role of intrinsic mitochondrial apoptosis in

peripheral lymphocyte homeostasis and tolerance in humans. Although gene

manipulation in rodents suggested that this pathway was important for peripheral immune

homeostasis, our human data validate the hypothesis with some surprising twists.

The NRAS mutation caused a clinical phenotype that, in several important aspects, is

similar to other ALPS patients, with modestly elevated TCR-αβ+CD4−CD8− T cells,

chronic lymphoid accumulation, and a clear propensity to hematological tumors.

However, certain other immunophenotypic and histological features of ALPS were not

seen such as marked expansions of DNTs in the lymph nodes and elevated HLA-DR+ T

cells and CD57+ T cells in the periphery37. The apoptosis defect is also clearly different

from all previous ALPS cases and underscores a confusing point in the literature.

Originally, the ALPS phenotype was based on defects in TCR-induced apoptosis

indicating a deficiency of the propriocidal regulatory mechanism. Because many cases

over the years were identified with mutations in the Fas receptor, it was generally

assumed that ALPS could be defined by a defect in Fas-induced apoptosis. If we adopt a

broader view of apoptosis defects that could disturb peripheral lymphocyte homeostasis,


73

then P58 reveals another derangement of this regulatory process. Because we favor this

view, it is reasonable to consider P58's lymphocyte apoptosis defect to fulfill one of the

diagnostic criteria of ALPS. Because he also exhibits increased αβDNTs and expanded

secondary lymphoid tissue, he would manifest all of the required features for a diagnosis

of ALPS. Because his overall phenotype and genotype are distinctive, and clearly

different from ALPS types I and II, we provisionally name this condition ALPS, type IV

(type III represents undefined molecular pathogenesis).

The active NRAS phenotype we observed is different from homozygous

deficiency of BIM in rodents, because the latter does not cause an increase in

CD4−CD8− αβ T cells, and induces the expansion of other cell types, such as

granulocytes23. These differences may reflect either the residual expression of BIM or the

stimulatory effects of NRAS on ERK and other downstream RAS effectors, which could

have direct mitogenic effects that are not triggered by BIM modulation. Moreover, there

are several regulatory levels between NRAS and BIM where other factors could account

for the difference between the BIM knockout mice and P58.

The mechanism of BIM suppression under conditions of hyperactive NRAS is not

clear. In other cellular models of hyperactive KRAS, BIM is down-regulated through

phosphorylation, ubiquitination, and degradation by the proteasomal machinery32. Here,

we show that BIM protein levels are severely depressed in resting and activated T cells

from P58 compared with normals, despite equivalent basal mRNA levels. Additionally,

the usual up-regulation of BIM mRNA after IL-2 withdrawal was impaired in cells from

P58. Also, BIM protein returned to almost normal levels on MEK/ERK blockage, but

mRNA remained the same. In our preliminary experiments (data not shown), there was

no change in BIM levels on proteasomal blockade in lymphocytes from P58. Taken

together, these data suggest a double mechanism for BIM suppression via hyperactive

NRAS: inhibition of up-regulation of mRNA and translational inhibition, but this remains

to be formally shown. Our new understanding of NRAS suggests that RAS antagonists

such as FTIs could have beneficial effects on disorders of lymphocyte homeostasis and

autoimmunity in addition to cancer.

References

Chapter 3

74

1. Malumbres M, Barbacid M. RAS oncogenes: the first 30 years. Nat Rev Cancer.

2003;3:459-465. 2. Barbacid M. ras genes. Annu Rev Biochem. 1987;56:779-827. 3. Aoki Y, Niihori T, Kawame H, et al. Germline mutations in HRAS proto-

oncogene cause Costello syndrome. Nat Genet. 2005;37:1038-1040. 4. Rodriguez-Viciana P, Tetsu O, Tidyman WE, et al. Germline mutations in genes

within the MAPK pathway cause cardio-facio-cutaneous syndrome. Science. 2006;311:1287-1290.

5. Schubbert S, Zenker M, Rowe SL, et al. Germline KRAS mutations cause Noonan syndrome. Nat Genet. 2006;38:331-336.

6. Niihori T, Aoki Y, Narumi Y, et al. Germline KRAS and BRAF mutations in cardio-facio-cutaneous syndrome. Nat Genet. 2006;38:294-296.

7. Tartaglia M, Pennacchio LA, Zhao C, et al. Gain-of-function SOS1 mutations cause a distinctive form of Noonan syndrome. Nat Genet. 2007;39:75-79.

8. Gelb BD, Tartaglia M. Noonan syndrome and related disorders: dysregulated RAS-mitogen activated protein kinase signal transduction. Hum Mol Genet. 2006;15 Spec No 2:R220-226.

9. Oliveira JB, Fleisher T. Autoimmune lymphoproliferative syndrome. Curr Opin Allergy Clin Immunol. 2004;4:497-503.

10. Sneller MC, Straus SE, Jaffe ES, et al. A novel lymphoproliferative/autoimmune syndrome resembling murine lpr/gld disease. J Clin Invest. 1992;90:334-341.

11. Fisher GH, Rosenberg FJ, Straus SE, et al. Dominant interfering Fas gene mutations impair apoptosis in a human autoimmune lymphoproliferative syndrome. Cell. 1995;81:935-946.







18. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25:402-408.


75

19. Munson P. A consistency test for determining the significance of gene expression changes on replicate samples and two convenient variance- stabilizing transformations. . In: Program and abstracts of the GeneLogic Workshop of Low Level Analysis of Affymetrix GeneChip Data, Bethesda, MD. 2001.

20. Strasser A. The role of BH3-only proteins in the immune system. Nat Rev Immunol. 2005;5:189-200.

21. Danial NN, Korsmeyer SJ. Cell death: critical control points. Cell. 2004;116:205-219.

22. Bleesing JJ, Brown MR, Dale JK, et al. TcR-alpha/beta(+) CD4(-)CD8(-) T cells in humans with the autoimmune lymphoproliferative syndrome express a novel CD45 isoform that is analogous to murine B220 and represents a marker of altered O-glycan biosynthesis. Clin Immunol. 2001;100:314-324.

23. Bouillet P, Metcalf D, Huang DC, et al. Proapoptotic Bcl-2 relative Bim required for certain apoptotic responses, leukocyte homeostasis, and to preclude autoimmunity. Science. 1999;286:1735-1738.

24. Strasser A, Pellegrini M. T-lymphocyte death during shutdown of an immune response. Trends Immunol. 2004;25:610-615.

25. Bloethner S, Chen B, Hemminki K, et al. Effect of common B-RAF and N-RAS mutations on global gene expression in melanoma cell lines. Carcinogenesis. 2005;26:1224-1232.

26. Bos JL, Toksoz D, Marshall CJ, et al. Amino-acid substitutions at codon 13 of the N-ras oncogene in human acute myeloid leukaemia. Nature. 1985;315:726-730.

27. Lubbert M, Mirro J, Jr., Miller CW, et al. N-ras gene point mutations in childhood acute lymphocytic leukemia correlate with a poor prognosis. Blood. 1990;75:1163-1169.

28. Rodriguez-Viciana P, Tetsu O, Oda K, Okada J, Rauen K, McCormick F. Cancer targets in the Ras pathway. Cold Spring Harb Symp Quant Biol. 2005;70:461-467.

29. Vetter IR, Wittinghofer A. The guanine nucleotide-binding switch in three dimensions. Science. 2001;294:1299-1304.

30. Ley R, Balmanno K, Hadfield K, Weston C, Cook SJ. Activation of the ERK1/2 signaling pathway promotes phosphorylation and proteasome-dependent degradation of the BH3-only protein, Bim. J Biol Chem. 2003;278:18811-18816.

31. Ley R, Ewings KE, Hadfield K, Howes E, Balmanno K, Cook SJ. Extracellular signal-regulated kinases 1/2 are serum-stimulated "Bim(EL) kinases" that bind to the BH3-only protein Bim(EL) causing its phosphorylation and turnover. J Biol Chem. 2004;279:8837-8847.

32. Ley R, Ewings KE, Hadfield K, Cook SJ. Regulatory phosphorylation of Bim: sorting out the ERK from the JNK. Cell Death Differ. 2005;12:1008-1014.

33. Tan TT, Degenhardt K, Nelson DA, et al. Key roles of BIM-driven apoptosis in epithelial tumors and rational chemotherapy. Cancer Cell. 2005;7:227-238.

34. Karp JE, Lancet JE. Targeting the process of farynesylation for therapy of hematologic malignancies. Curr Mol Med. 2005;5:643-652.

35. Johnson L, Greenbaum D, Cichowski K, et al. K-ras is an essential gene in the mouse with partial functional overlap with N-ras. Genes Dev. 1997;11:2468-2481.

Chapter 3

76

36. Esteban LM, Vicario-Abejon C, Fernandez-Salguero P, et al. Targeted genomic disruption of H-ras and N-ras, individually or in combination, reveals the dispensability of both loci for mouse growth and development. Mol Cell Biol. 2001;21:1444-1452.

37. Bleesing JJ, Brown MR, Straus SE, et al. Immunophenotypic profiles in families with autoimmune lymphoproliferative syndrome. Blood. 2001;98:2466-2473.

CHAPTER 4

SOMATIC KRAS MUTATIONS ASSOCIATED WITH A HUMAN

NON-MALIGNANT SYNDROME OF AUTOIMMUNITY AND

ABNORMAL LEUKOCYTE HOMEOSTASIS

Julie E. Niemela1*, Lianghao Lu1*, Thomas A. Fleisher1, Joie Davis2, Iusta Caminha1, Marc

Natter, Laurel A. Beer1, Kennichi C.Dowdell2, Stefania Pittaluga3, Mark Raffeld3, V.

Koneti Rao2, João Bosco Oliveira1

From the 1Department of Laboratory Medicine, Warren Grant Magnuson Clinical Center; 2ALPS Unit, Laboratory of Clinical Infectious Diseases, National Institute of Allergy and

Infectious Diseases; 3Laboratory of Pathology, Center for Cancer Research, National

Cancer Institute, National Institutes of Health, Bethesda, Maryland, USA.

Blood. 2011; 117(10):2883-2886.

Chapter 4

78

ABSTRACT

Somatic gain-of-function mutations in members of the RAS subfamily of small

GTPases are found in more than 30% of all human cancers. We recently described

a syndrome of chronic non-malignant lymphadenopathy, splenomegaly and

autoimmunity associated with a mutation in NRAS affecting hematopoietic cells,

and initially classified the disease as a variant of the autoimmune

lymphoproliferative syndrome (ALPS). Here we demonstrate that somatic

mutations in the related KRAS gene can also be associated with a non-malignant

syndrome of autoimmunity and breakdown of leukocyte homeostasis. The activating

KRAS mutation impaired cytokine-withdrawal induced T cell apoptosis through the

suppression of the pro-apoptotic protein BIM and facilitated proliferation through

p27kip1 downregulation. These defects could be corrected in vitro by MEK1 or PI3K

inhibition. We suggest the use of the term RAS-associated autoimmune

leukoproliferative disease (RALD) to differentiate this disorder from ALPS.

INTRODUCTION

The autoimmune lymphoproliferative syndrome (ALPS) is characterized by childhood

onset chronic lymphadenopathy, splenomegaly, multilineage cytopenias secondary to

sequestration and autoimmune destruction, and an increased risk of B-cell lymphoma1.

Laboratory findings include polyclonal hypergammaglobulinemia and expansion of a

unique population of circulating TCRαβ+B220+CD4-CD8- T (αβ+-DNT) lymphocytes2,3.

The majority of ALPS patients harbor heterozygous autosomal dominant germline

mutations in FAS, with somatic FAS mutations representing the second most common

genetic etiology4,5,6,7. Germline mutations in the genes encoding FAS ligand and caspase

10 have been identified in a small minority of patients8-13. In our cohort, about one-third

of the ALPS patients have an undetermined genetic basis. In addition, there is a group of

genetically undetermined ALPS-like patients without αβ+-DNT cell elevation.

We recently reported one individual among these latter patients with a syndrome

of lymphoproliferation, autoimmunity and minimally increased αβ+-DNT cells caused by

a somatic mutation in the NRAS gene resulting in defective lymphocyte apoptosis13. Here

Somatic KRAS mutations causing an ALPS-like syndrome

79

we demonstrate that somatic mutations in the homologous KRAS gene can also be

associated with a syndrome consisting of autoimmune phenomena and dysregulated

leukocyte homeostasis, with normal αβ+-DNT cells. The activating KRAS mutation, like

the previously described NRAS mutation, impaired intrinsic T cell apoptosis through the

suppression of the pro-apoptotic protein BIM and facilitated cellular proliferation by

repression of p27kip1.

METHODS


All patients were studied at the National Institutes of Health under IRB approved

protocols (93-I-0063 and 95-I-0066). DNA sequencing, apoptosis assays,

immunoblotting and active RAS pull down were performed as previously described13.

Plasmids and transfection

The plasmids pCEFL-KZ-AU5-KRAS-wt and pCEFL-KZ-AU5-KRAS-V12 were kindly

provided by Silvio Gutkind (NIDCR, NIH, Bethesda, MD). AU5-tagged KRAS G13C

plasmid was constructed by site-directed mutagenesis using the QuickChange kit

(Stratagene; La Jolla, CA) according the manufacturer’s instructions. Transient

transfections in human 293T and Jurkat cells were performed with the TransIT-LT1

reagent (MirusBio; Madison, WI) and Lonza solution V kit, respectively. Assays were

performed 48h after transfection.

Immunohistochemistry

Images were taken using an Olympus BX41 microscope, objective UPlanFI 40x/0.75

∞/0.17 with an Olympus U-TV0.63xC to a digital camera Q-Imaging micropublisher 5.0

RTV and acquired with QCapture and imported through Adobe Photoshop 7.0.

RESULTS AND DISCUSSION

Somatic gain-of-function KRAS mutation in two patients with ALPS-like symptoms

Chapter 4

80

To identify novel genes linked to persistent lymphadenopathy, splenomegaly and

autoimmunity, we sequenced NIH patients with ALPS-like syndromes for candidate

genes and identified activating KRAS mutations in two patients. Patient 1 demonstrated a

c.37G>T, p.G13C mutation, present in lymphoid and myeloid cell types (Fig. 1A), but

not in heart tissue (data not shown). Patient 2 showed a c.35G>A, p.G12D mutation in

peripheral blood mononuclear cells (PBMCs) but not in buccal swab cells (Fig. 1B). This

indicated a somatic origin probably at the hematopoietic stem cell level. No mutations in

FAS, NRAS or HRAS were detected in either patient. Gain-of-function for G13C was

confirmed in Patient 1 by the increased amount of active RAS present in cells after

transfection with a plasmid encoding mutant G13C versus wild type KRAS (Fig. 1C).

KRAS G12D is already described to produce a gain-of-function14.

Clinical history and laboratory findings

Patient 1

This Caucasian female patient had a history of lymphadenopathy and splenomegaly first

noted at 4 years of age at the time of a tonsillectomy and adenoidectomy for recurrent

upper respiratory tract infections. Splenomegaly, autoimmune hemolytic anemia and

thrombocytopenia (Evan’s syndrome) were diagnosed at follow-up. She was evaluated at

the NIH at 9 years of age and found to have positive serology for several autoantibodies

and polyclonal hypergammaglobulinemia as well as persistent splenomegaly and

lymphadenopathy (Table 1). Flow cytometry did not reveal the hallmark elevation of

αβ+-DNTs seen in ALPS, but documented B cell lymphocytosis and monocytosis (Table

1). Lymph node biopsy demonstrated plasmacytosis but no paracortical infiltration by

αβ+-DNTs (Fig. 2). The patient had a history of recurrent infections including bronchitis,

otitis media (several episodes), cellulitis, lymphadenitis and pneumonia (one episode

each) without documentation of an infectious agent. She died at the age of 13 after an

episode of fever followed 48 hours later by acute loss of consciousness and cardiac arrest

at home. Autopsy studies could not determine the cause of death but ruled out

malignancy.


81

C

Figure 1. Gain-of-function somatic KRAS mutations. (A) Cell subsets were sorted by flow cytometry and used for DNA sequencing; (B) Peripheral blood mononuclear cell were lysed and used for DNA sequencing; a buccal swab was also sequenced to rule out a germline mutation. The very small mutant peak seen in the buccal sample probably reflects the presence of hematopoietic cells in the cell mixture; (C) Active GTP-bound KRAS was immunoprecipitated by using a Raf-1 (RBD)-GST fusion protein as bait from 293T cells transfected with wild-type, G13C or the positive control G12V pCEFL-KZ-AU5-KRAS plasmids. Total RAS in cell lysates before immunoprecipitation is also shown, along with AU5 (plasmid expression control) and β-actin (loading control). Data shown are representative of two independent experiments.

Chapter 4

82

Figure 2. Histopathological findings. A core lymph node biopsy revealed polyclonal plasmacytosis (see hematoxiline/eosin and kappa and lambda stains) with reactive secondary B follicles. There is no expansion of double negative T cells in the paracortex by immunostains (see CD3 showing the T cells with CD4 positive cells greater than CD8 positive cells).

Patient 2

This patient is a Caucasian female of Italian ancestry who was first noted to have

splenomegaly with neutropenia, monocytosis, reticulocytosis, thrombocytopenia, and

hyperuricemia when evaluated for a routine respiratory tract infection with facial rash at

5 years of age. Serologies were positive for Parvovirus B19 and EBV and the findings

were attributed to acute viral infection, with hematologic parameters returning to near

normal levels five months later. The patient remained well with the exception of periodic,

painful, erythematous bilateral swelling of the ankles progressing to ecchymosis over a

short period, which occurred once to twice yearly and was associated with swimming and

beach activities. Following an abrupt increase in the frequency and severity of these

symptoms at 7 years of age, the patient was referred for further evaluation and found to

have pancytopenia, massive splenomegaly with bulky intra-abdominal and inguinal

lymphadenopathy, marked hypergammaglobulinemia and anticardiolipin and anti-ß2-

glycoprotein-I antibodies. Bone marrow examination showed only a hyperreactive state.

Hematological malignancy and lysosomal storage diseases were excluded. A diagnosis of

Evan’s syndrome was considered based upon presence of anti-neutrophil and anti-platelet


83

antibodies. She had normal cognitive and motor development throughout these episodes.

Weight and height were normal at birth, decreasing progressively to ~3%ile currently.

She continued to the present with rash of the lower extremities presumed to represent a

vasculopathy secondary to antiphospholipid syndrome, but is otherwise well.

Table 1. Laboratory findings.

Analyte Patient 1 Patient 2 Earliest

(01/2001) Latest (03/2003)

Earliest (02/2008)

Latest (07 and 09/2010)

White blood cells (4.23-9.07 x103Cells/mm3)

2.62 2.67 3.2 4.5

Hemoglobin (11.2-15.7 g/dL)

10.2 10.6 10.6 9.9

Platelets (173-369 K/mm3)

78 71 66 99

Lymphocytes (19.3-51.7%;1.1-3.74 K/mm3)

44.8% (1.1 K/mm3)

37.5% (1.0 cells/mm3)

34% (1.09 K/mm3)

37% (1.7 K/mm3)

CD3+ cells (60-83.7%;714-2266 cells/mm3)

46.1% (541 cells/mm3)

38.8% (329 cells/mm3)

N.D. 51.2% (768 cells/mm3)

CD3+ CD4+ cells (31.9-62.2%;359-1565 cells/mm3)

39.1% (459 cells/mm3)

31.2% (312 cells/mm3)

N.D. 37.6% (565 cells/mm3)

CD3+ CD8+ cells (11.2-34.8%;178-853 cells/mm3)

8.7% (102 cells/mm3)

6.5% (65 cells/mm3)

N.D. 11.2% (167 cells/mm3)

CD20+ B cells (3-19%;59-329 cells/mm3)

49.9% (586 cells/mm3)

53.5% (535 cells/mm3)

N.D. 33.1% (497 cells/mm3)

CD27+CD20+ B cells (0.8-3.6%;12-68 cells/mm3)

1.3% (10 cells/mm3)

1.8% (18 cells/mm3)

N.D. 1.8% (26 cells/mm3)

ΤCRαβ+-DNT cells (0.3-1.3%;6-23 cells/mm3)

0.8% (9 cells/mm3)

0.6% (6 cells/mm3)

N.D. 1.4% (21 cells/mm3)

Neutrophils (34-71.1%;1.56-6.13 K/mm3)

19.9% (0.74 K/mm3)

30.7% (0.82 cells/mm3)

31% (0.99 K/mm3)

19% (0.9 K/mm3)

Monocytes (4.7-12.5%;0.24-0.36 K/mm3)

23% (0.85 K/mm3)

27% (0.72 cells/mm3)

26% (0.83 K/mm3)

43% (1.9 K/mm3)

Eosinophils (0.7-5.8%;0.04-0.36 K/mm3)

2.9% (0.1 K/mm3)

3.5% (0.09 cells/mm3)

0 1% (0.1 K/mm3)

Basophils (0.1- 0.3% (0.01 1.2% (0.03 0 0

Chapter 4

84

1.2%;0.01-0.08 K/mm3) K/mm3) cells/mm3) Vitamin B12 (256-1320 pg/ml pg/ml)

2303 1611 N.D. 1576

IL-10 (0-20 pg/ml) 18 N.D. IgG (642-1730 mg/dL) 1880 2130 N.D. 2190 IgM (34-342 mg/dL) 275 254 N.D. 381 IgA (91-499 mg/dL) 544 451 N.D. 253 IgE (0-90 mg/dL) 29 18 N.D. ND ANA (Negative < 1) Positive (1.8) Non-reactive N.D. Non-reactive ANCA N.D. Negative Rheumatoid factor (Negative ≤ 13)

Positive (23) Positive (20) N.D. Negative

Anticardiolipin IgM (Negative ≤ 12)

Positive (22) N.D. N.D. Positive (49.8)

Anti-β2 glycoprotein-I (Negative ≤ 20)

N.D. N.D. N.D. Positive (IgG=28.2 and IgM=39)

Lupus anticoagulant (Negative)

Positive N.D. N.D. Negative

Anti-platelet antibodies (Negative)

Positive N.D. N.D. Positive

Anti-neutrophil antibodies (Negative)

N.D. N.D. N.D. Positive

Coombs test (Negative) Positive N.D. N.D. Negative Karyotype (bone marrow)

Normal N.D. N.D. Normal

Hemoglobin F N.D. N.D. Normal- 0.7%

N.D.

Uric Acid (2.0-5.5 mg/dL)

N.D. N.D. 6.5 7.6

KRAS mutation impaired lymphocyte apoptosis and increased proliferation

We evaluated lymphocyte apoptosis and proliferation in samples from Patient 1 and

found the KRAS G13C mutation did not impair FAS mediated apoptosis but induced

resistance to apoptosis triggered by IL-2 withdrawal of activated T lymphocytes (Fig. 3A,

B). As BIM, a pro-apoptotic protein of the BCL-2 family, is the main mediator of this

form of apoptosis15, we checked the patient’s cells and found markedly reduced BIM

levels compared to normal controls or ALPS-FAS patients (Fig. 3C). These findings are

reminiscent of our previous work describing a patient with a mutation in NRAS13. We


85

speculate that low BIM levels underlie the accumulation of B-cells and monocytes in

these patients, given the critical role for this protein in leukocyte homeostasis in murine

models15.

Apoptosis resistance in Patient 1 was at least partially mediated by downstream

ERK and PI3K hyperactivation, as the addition of MEK1 (PD98059, 20 µM) or PI3K

(LY294002, 10 µM) inhibitors almost completely abrogated the apoptotic defect in vitro

(Fig. 3D)16. Myeloid cells from patients with somatic KRAS mutations associated with

juvenile myelomonocytic leukemia, unlike normal myeloid cells, expand in the presence

of low GM-CSF concentrations17. We hypothesized that a similar phenomenon could be

present with the patient’s cells and cultured activated primary lymphocytes under limiting

IL-2 concentrations and demonstrated increased proliferation compared to controls (Fig.

3E). This was linked to low levels of the cell cycle inhibitor protein p27kip1 in primary

cells and transfected cell lines, as previously described for cancer cells (Fig. 3F)18,19.

As any missense mutation at certain RAS codons including 12,13, and 61 are

known prevent interactions with GTPase-activating proteins and thus greatly decrease

GTP hydrolysis, resulting in constitutively active RAS20, it is reasonable to speculate that

the KRAS G12D mutation in Patient 2 also impairs apoptosis and proliferation.

Moreover, the G12V control demonstrated repressed p27kip1 levels.

Chapter 4

86

Figure 2. Functional evaluation of Patient 1 lymphocytes. Activated peripheral blood mononuclear cells (PBMCs) from normal volunteers (NL), a patient with an inactivating Fas mutation (FAS mut), a patient with a gain of function somatic NRAS mutation (NRAS mut) and from Patient 1 (KRAS mut) were treated for 18 h with anti-Fas (Apo1.3) antibody (A) or cultured in media without IL-2 for the indicated periods of time (B); (C) Analysis by BIM immunoblotting under IL-2 rich “+” (100 IU/ml) or low “-”(1 IU/ml) conditions in PBMCs from a normal control (NC), a patient with a FAS mutation (FASm), a patient with an NRAS mutation (NRASm) and Patient 1 (KRASm). β-actin is a loading control (continuing next page);


87

(continued from previous page) (D) Activated lymphocytes from a normal control (NL) and Patient 1 (KRASm) were cultured in media without IL-2 and treated with DMSO, PD98059 (20 µM) or LY294002 (10µM) for the indicated periods of time. Apoptosis was measured

daily by flow cytometry; (E) Activated PBMCs from normal volunteers (NL), a patient with an inactivating Fas mutation (FAS mut), a patient with a gain of function NRAS mutation (NRAS mut) and from Patient 1 (KRAS mut) were cultured in media the indicated concentrations of IL-2 and total cell counts were determined at baseline and 72h later; (F) p27kip1 expression was interrogated by immunoblotting in PBMCs (upper panel) under IL-2 rich “+” (100 IU/ml) or low “-”(1 IU/ml) conditions; and also in Jurkat T cell lines (lower panel) transfected with 1 or 6 µg of plasmids encoding GFP-only (negative control), or wild-type, G13C or G12V (positive

control) KRAS. Error bars represent SE. Data shown are representative of two (A-E) independent experiments.

Chapter 4

88

The spectrum of clinical manifestations associated with somatic RAS mutations

KRAS is a member of the p21 small GTPase family of proteins that also includes HRAS

and NRAS. Germline RAS mutations are associated with specific developmental

disorders including Noonan, Costello and cardio-facio-cutaneous syndromes21. Somatic

RAS mutations are seen in more than 30% of all human cancers16. In the hematopoietic

system, somatic KRAS and NRAS mutations are commonly observed in aggressive tumors

such as multiple myeloma or juvenile myelomonocytic leukemia (JMML)22.

This report and our previous work13 suggest that activating somatic mutations in

NRAS or KRAS can be associated with a non-malignant hematological syndrome, which

we refer to as RAS-associated autoimmune leukoproliferative disease (RALD)23. The

factors determining which patients with somatic RAS mutations develop hematological

malignancy versus RALD are unknown, but a previous report also demonstrated that

patients with somatic NRAS or KRAS mutations could follow a more benign clinical

course24.

The clinical entity described here seems distinct from ALPS in several respects:

the characteristic αβ+-DNT cells are present at normal levels or only marginally elevated

in the peripheral blood, and absent in lymph nodes; there is no defect in the FAS pathway

of apoptosis; biomarkers typically associated with ALPS such us IL-10 and sFASL25,26

are normal; and monocytosis, reminiscent of JMML, was seen in all the patients

evaluated to date (Table 2).

We suggest that RALD should be considered in the differential diagnosis of

patients with autoimmune cytopenias, monocytosis and lymphoid organ expansion. These

patients may in the future benefit from therapies directed at blocking ERK and/or RAS

that are under development as cancer therapeutics.


89

Table 2. Clinical characteristics of RALD patients

References 1. Sneller MC, Straus SE, Jaffe ES, et al. A novel lymphoproliferative/autoimmune

syndrome resembling murine lpr/gld disease. J Clin Invest. 1992;90:334-341. 2. Le Deist F, Emile JF, Rieux-Laucat F, et al. Clinical, immunological, and

pathological consequences of Fas-deficient conditions. Lancet. 1996;348:719-723.

3. Sneller MC, Wang J, Dale JK, et al. Clincal, immunologic, and genetic features of an autoimmune lymphoproliferative syndrome associated with abnormal lymphocyte apoptosis. Blood. 1997;89:1341-1348.




7. Dowdell KC, Niemela JE, Price S, et al. Somatic FAS mutations are common in patients with genetically undefined autoimmune lymphoproliferative syndrome (ALPS). Blood.



Patient/gene

Adenopathy HSM !DNTs Autoimmunity Granulocytosis /Monocytosis

B-Cell lymphocytosis

Apoptosis defect

Lymph Node Histopathology

Specific Findings

P58 -NRAS G13D

+ + +/-("2%)

Autoantibodies + + + No DNTs/plasmacytosis

Transient cryoglobulinemic vasculitis; Cutaneous B-cell lymphoma

P260- NRAS G13D*

- + - HA + + + No DNTs/granulocytes

JMML-like

NRAS Q61P*

+ + - Severe ITP/ colitis

+ + N.D. No DNTs/granulocytes

JMML-like; BMT at the age of 8y

KRAS G13C

+ + - HA/ITP Autoantibodies

+ + + No DNTs/plasmacytosis

Recurrent infections; Mild Factor XI deficiency

KRAS G12D

+ + - HA/ITP Autoantibodies

+ + N.D. N.D. Cutaneous vasculitis

*Unpublished cases; HA, hemolytic anemia; HSM, hepatosplenomegaly; JMML, juvenile myelomonocitic leukemia; DNTs, double-negative lymphocytes; ITP, immune thrombocytopenia; ANA, antinuclear antibodies; RF, rheumatoid factor; BMT, bone marrow transplantation.

Chapter 4

90





14. Braun BS, Tuveson DA, Kong N, et al. Somatic activation of oncogenic Kras in hematopoietic cells initiates a rapidly fatal myeloproliferative disorder. Proc Natl Acad Sci U S A. 2004;101:597-602.

15. Bouillet P, Metcalf D, Huang DC, et al. Proapoptotic Bcl-2 relative Bim required for certain apoptotic responses, leukocyte homeostasis, and to preclude autoimmunity. Science. 1999;286:1735-1738.

16. Barbacid M. ras genes. Annu Rev Biochem. 1987;56:779-827. 17. Emanuel PD, Bates LJ, Castleberry RP, Gualtieri RJ, Zuckerman KS. Selective

hypersensitivity to granulocyte-macrophage colony-stimulating factor by juvenile chronic myeloid leukemia hematopoietic progenitors. Blood. 1991;77:925-929.

18. Winston JT, Coats SR, Wang YZ, Pledger WJ. Regulation of the cell cycle machinery by oncogenic ras. Oncogene. 1996;12:127-134.

19. Fan J, Bertino JR. K-ras modulates the cell cycle via both positive and negative regulatory pathways. Oncogene. 1997;14:2595-2607.

20. Scheffzek K, Ahmadian MR, Kabsch W, et al. The Ras-RasGAP complex: structural basis for GTPase activation and its loss in oncogenic Ras mutants. Science. 1997;277:333-338.

21. Zenker M. Genetic and pathogenetic aspects of Noonan syndrome and related disorders. Horm Res. 2009;72 Suppl 2:57-63.

22. Le DT, Shannon KM. Ras processing as a therapeutic target in hematologic malignancies. Curr Opin Hematol. 2002;9:308-315.

23. Oliveira JB, Bleesing JJ, Dianzani U, et al. Revised diagnostic criteria and classification for the autoimmune lymphoproliferative syndrome: report from the 2009 NIH International Workshop. Blood.

24. Matsuda K, Shimada A, Yoshida N, et al. Spontaneous improvement of hematologic abnormalities in patients having juvenile myelomonocytic leukemia with specific RAS mutations. Blood. 2007;109:5477-5480.


26. Magerus-Chatinet A, Stolzenberg MC, Loffredo MS, et al. FAS-L, IL-10, and double-negative CD4-CD8-TCR alpha/beta+ T cells are reliable markers of ALPS associated with FAS loss of function. Blood. 2009.

CHAPTER 5

UTILIZING BIOMARKERS TO PREDICT THE PRESENCE OF FAS

MUTATIONS IN PATIENTS WITH FEATURES OF THE

AUTOIMMUNE LYMPHOPROLIFERATIVE SYNDROME (ALPS)

Iusta Caminha1; Thomas A. Fleisher1; Ronald L. Hornung2; Janet K. Dale3; Julie E.

Niemela1; Susan Price4; Joie Davis4; Katie Perkins5; Kennichi C. Dowdell6; Margaret R.

Brown1; V. Koneti Rao4 and João B. Oliveira1.

1Department of Laboratory Medicine, Clinical Center, National Institutes of Health,

Bethesda, MD, 20892; 2Clinical Services Program, SAIC-Frederick, Inc., NCI-Frederick,

Frederick, MD, 21702; 3Office of Clinical Research, Division of Allergy, Immunology

and Transplantation, 4ALPS Unit and 6Medical Virology Section, Laboratory of Clinical

Infectious Diseases, National Institute of Allergy and Infectious Diseases, National

Institutes of Health, Bethesda, MD, 20892; and 5Clinical Monitoring Research Program,

SAIC-Frederick, Inc., NCI-Frederick, Frederick, MD, 21702.

Journal of Allergy and Clinical Immunology. 2010;125:946-949

Chapter 5

92

ABSTRACT

Background: The autoimmune lymphoproliferative syndrome (ALPS) is

characterized by lymphadenopathy, splenomegaly, autoimmune cytopenias, and an

increased risk for lymphoid malignancies. Only two-thirds of the ALPS patients

have a mutation in the FAS gene. There are currently no biomarkers that predict

the presence or absence of FAS mutations in patients with clinical symptoms of

ALPS. Objective: To develop a biomarkers-based algorithm capable of predicting

FAS mutations in ALPS patients. Methods: A cohort of 562 ALPS patients and

their relatives was studied. Plasma levels of 14 cytokines and soluble FAS ligand

(sFASL) were measured. Peripheral blood immunophenotyping data and serum

vitamin B12 results were reviewed. The Wilcoxon-Mann-Whitney test was used for

statistical calculations. Likelihood ratios, probabilities and ROC curves were

calculated for selected biomarkers. Results: Compared to controls, ALPS patients

with either germline or somatic FAS mutations had higher serum vitamin B12

(p<0.0001), sFASL (p<0.0001), IL-10 (p<0.0001), IL-18 (p<0.0001) and TNF-alpha

(p<0.001) levels. A ratio of CD20+CD27+ to CD20+ cells >0.16 (16%) made the

diagnosis of ALPS unlikely (LR-=0.17). Patients with a combination of DNT>4%

and IL10 >40pg/ml or B12 >1500ng/L or sFASL >300pg/ml had a 97% chance of

harboring a FAS mutation. Conversely, patients with DNTs<2% and sFASL

<200pg/ml carried only a 1.7% chance of having a FAS mutation. Conclusion: The

combination of DNT counts with sFASL, vitamin B12 or IL10 levels is strongly

linked to the presence or absence of a FAS mutation. Also, elevated TNF-a and IL-

18 levels represent additional biomarkers associated with ALPS.

INTRODUCTION

The autoimmune lymphoproliferative syndrome (ALPS) is characterized by chronic

lymphadenopathy, splenomegaly, autoimmune cytopenias and expansion of

TCRa/b CD3+CD4-CD8- T (a/b-double-negative [DNT]) cells (Table E1). Approximately

two-thirds of the patients with ALPS symptoms are genetically characterized, and most

have germline (ALPS Ia) or somatic (ALPS Ia-s) TNFRSF6 (FAS) mutations. A small

Biomarkers in ALPS

93

number of patients have defects in genes encoding Fas ligand (ALPS Ib), caspase-10

(ALPS II) or NRAS (ALPS IV). In addition, a large group of patients with ALPS

findings remain genetically uncharacterized (ALPS III) and yet another has an undefined

ALPS-like syndrome (ALPS-phenotype) (Table 1)1, 2. Given the clinical similarities

among all these groups, we sought to develop a biomarkers-based algorithm to predict the

presence or absence of FAS mutations in this setting.

METHODS

Subjects

Five hundred and sixty two subjects studied at the NIH under an IRB approved protocol

were included in this study. All patients presented with lymphadenopathy and/or

splenomegaly and αβ-DNT cells above 1% of the total lymphocytes, typically associated

to autoimmune cytopenias.

Biomarkers

Immunophenotyping, mutation analysis and apoptosis assays were performed as

previously described2, 3. Vitamin B12 levels, immunoglobulin measurements and

monocyte and eosinophil counts were obtained by reviewing medical and laboratory

records of all participants. For patients with repeated measurements the first available

result was used, regardless of the clinical status or ongoing therapy.

The quantification of plasma interleukins was performed by ELISA following the

manufacturer’s instructions. sFASL, TNFα, IL-2, IL-7, IL-13 and IL-15 kits were from

R&D Systems (Minneapolis, MN); IL-18 was from MBL Co. , LTD (Naku-ku Nagoya,

Japan); IL-10, IL-1b, IL-4, IL-5, IL-6 and IFNγ kits were from Endogen; IL-12 from

Biosource International (Camarillo, CA) and IL-23 from Bender Medsystems (Vienna,

Austria). The measurements were performed on frozen plasma samples and for patients

with more than one sample available, the first collected sample was used for testing.

Statistical analysis

Statistical analysis was performed using Prism (Graphpad software, San Diego,

CA), JMP-7 (SAS, Cary, NC), and the statistical and graphics language R version 2.9.0

(http://www.R-project.org). The Wilcoxon-Mann-Whitney test was used to compare

Chapter 5

94

groups. Sensitivity and specificity of each biomarker to detect ALPS and FAS mutations

were obtained and likelihood ratios (LR+ = sensitivity/100-specificity; LR- = 100-

sensitivity/specificity), odds ratios (odds post-test = odds pre-test x LR) and probabilities

((odd / 1+odd) x100) were calculated. Pre-test odds and probability for having a FAS

mutation were obtained by calculating the prevalence of FAS mutations on our whole

cohort of patients, and found to be 1.7 and 63%, respectively. When associating more

than one biomarker, the post-test odd was calculated by multiplying the pre-test odds by

the combination of likelihood ratios (odds post-test = odds pre-test x LR1 x LR2 x ... x

LRn). Receiver operating characteristic (ROC) curves were used to evaluate the best level

of vitamin B12, IL-10, sFASL and ab-DNT able to differentiate FAS mutants from no

mutants and to evaluate the accuracy of the biomarkers.

Table 1. Description of ALPS patients and control groups included in the study

Classification Definition Subjects

ALPS Ia Patients with ALPS and germline FAS mutations 162

ALPS Ia-s Patients with ALPS and somatic FAS mutations 9

Healthy Mutation Positive Relatives (HMPR)

Healthy relatives of ALPS Ia patients who carry a FAS mutation

115

Mutation negative relatives (MNR)

Healthy relatives of ALPS Ia patients who do not carry a FAS mutation.

179

ALPS III Patients who fulfill criteria for ALPS but have no causative mutation identified

52

ALPS-phenotype Patients with autoimmune cytopenias, lymphadenopathy/splenomegaly and ab-DNTs >1%, without genetic abnormalities or defective apoptosis assay

40


We investigated 26 parameters including immunophenotyping, eosinophil and monocyte

counts, serum or plasma vitamin B12 (B12), soluble FAS ligand (sFASL),

immunoglobulins and levels of 14 cytokines in 562 subjects classified into 6 categories

(Table 1). The number of measurements, medians and 1º and 3º quartiles are presented in

Tables 2 and 3.

Biomarkers in ALPS

95

Table 2. Medians, first and third quartiles of the biomarkers evaluated

ALPS Ia ALPS Ia-s ALPS III ALPS-phenotype HMPR MNR

N

Median 1º/3º

quartile N

Median 1º/3º

quartile N

Median 1º/3º

quartile N

Median 1º/3º

quartile N

Median 1º/3º

quartile N

Median 1º/3º

quartile

DNT (#) 162 101 48 / 239 9 94

44 / 212 49 30 20 / 61 38 39

20 / 64 106 16 8 / 29 134 10

6 / 17

DNT % 162 5.1 2.6 / 8.4 9 7.7

4.8 / 10.6 49 1.6 1.1 / 2.4 38 1.7

1.5 / 2.3 109 0.8 0.5 / 1.7 138

0.5 0.3 / 0.77

CD20+% 149 15 8.5 / 20.6 8 18.4

11.9 / 27.6 45 15 8.4 / 21 35

17.5 7.9 / 24.2

108 10.15 7.4 / 14.6

138 10.8 7.9 / 14

CD20+CD27+ /CD20+ 121 0.06

0.03 / 0.1 6 0.055

0.052 / 0.07

35 0.10

0.05 / 0.15

31 0.09

0.04 / 0.15

66 0.17

0.13 / 0.22

79 0.25

0.18 / 0.31

CD3+CD25+% 147 16.2

10.2 / 23.9

8 11.9 8.6 / 16.6 46 12.6

8.9 / 18.3 36 13.6 9.8 / 22.8

106 24.4

17.2 / 33.8

131 25.8

16.3 / 32.4

CD3+HLA-DR+% 147

20 13.9 / 27.9

8 15 11.7 / 21 46

14.3 10.5 / 28.9

36 14.7 7.8 / 26.8

106 11.6 7.9 / 16.1

131 9

6.5 / 13.5

B12 ng/L 115 2259

1151 / /5216

8 1653

1154 / 2153

16 759

561 / 1185

13 943

590 / 1163

46 570

338 / 1022

52 474

321 / 709

sFasL pg/ml 142 1114 476 / 1892

8 1329 608 / 1732 39 208

125 / 312 31 174

104 / 256

74 207

132 / 354

44 104 79 / 139

IL 10 pg/ml 146 58 25 / 126 8

187 104.5 / 246.2

43 17 9 / 35.5 35 11

6 / 24.5 100 7 3 / 16 146 4

1 / 8

IL 1b pg/ml 48 0 0 / 1 2 0

0 / 0 13 0 0 / 1 7 1

0 / 1.7 43 1 0 / 2.3 67 0

0 / 1.9

IL 2 pg/ml 143 0 0 / 5.5 8 0

0 / 0.5 43 0 0 / 2 35 1

0 / 6 102 0 0 / 16.7 141 0

0 / 23

IL 4 pg/ml 37 0 0 / 0 2 0

0 / 0 8 0 0 / 0 4 0

0 / 0 25 0 0 / 0 41 0

0 / 0

IL 5 pg/ml 33 0 0 / 2 1 0

0 / 0 9 0 0 / 1.6 5 0

0 / 0 39 0 0 / 0 71 0

0 / 0

IL 6 pg/ml 140 0 0 / 2 8 0.5

0 / 1.25 42 0 0 / 2 34 0.5

0 / 2.75 102 0 0 / 1 142 0

0 / 2

IL 7 pg/ml 24 2 1 / 4 1 0.8 9 1

0 / 2.8 5 2 1 / 14 31 2

0.6 / 4 37 1 1 / 3

Chapter 5

96

IL 12 pg/ml 10 0.29 0 / 0.9 0 N.D. 3 1

0.5 / 2.5 2 7

3.5 / 10.5

14 0 0 / 0 34 0

0 / 0

IL 13 pg/ml 38 0 0 / 8.25 1 0

0 / 0 7 0 0 / 31.5 7 0

0 / 7 14 0 0 / 10.5 32 0

0 / 0

IL 15 pg/ml 73 1 0 / 2 5 1

1 / 1 27 1 0.5 / 2 22 1.5

1 / 2 45 2 0 / 2 47 1

0 / 2

IL 18 pg/ml 59 1041 684/1495 6 1526

1031/1806 13 521 249/1558 17 702

399/117 36 530 295/998 35 208

168/355

IL 23 pg/ml 32 183 92 / 439.7

1 89 12

116 63.5 / 325.2

14 343

299 / 526

24 151

58.7 / 280.7

13 208 69 / 445

TNFa pg/ml 133 5 0 / 11 8 9

7.5 / 9.7 41 8 3 / 18 34

7 1.8 / 24.5

95 2 0 / 5 129 1.3

0 / 3

IFNg pg/ml 142 0 0 / 4 8 3.5

1.5 / 6.25 43 0 0 / 3 35 1

0 / 4.5 101 0 0 / 3 142 0

0 / 2

IgG mg/dl 109 1480

1070 / 1930

8 1900

1260 / 2475

15 1040 803 / 1490

13 1190 827 / 2050

46 1215 10.2 / 1350

54 1010 907 / 1187

IgE IU/ml 91 64 11 / 424 7 29

8.5 / 83 11 19 5 / 37.5 9 5

5 / 18 33 20 7 / 59 47 32

19 / 66

Eosinophils K/ul 123

0.24 0.12 / 0.43

8 0.15 0.06 / 0.23 31 0.15

0.1 / 0.36 27 0.14

0.08 / 0.35

67 0.13

0.07 / 0.21

83 0.17 0.1 / 0.22

Monocytes K/ul 118 0.6

0.4 / 1 8 0.43 0.34 / 0.65 31

0.55 0.44 / 1.09

28 0.62

0.51 / 0.85

69 0.44

0.35 / 0.54

87 0.45

0.36 / 0.56

N, number of subjects studied; N.D., not determined; HMPRs, healthy mutation positive

relatives; MNRs, mutation negative relatives.

Biomarkers in ALPS

97

Table 3. Biomarkers in ALPS patients types Ib, II and IV

Parameter ALPS Ib ALPS II ALPS IV

# of patients 1 1 1

DNT (#) 66 838 88

DNT % 1.5 27 2.2

CD20+% 17 14.1 49

CD20+CD27+ /CD20+ N.D. 0.2 0.03

CD3+CD25+% 6.6 5.8 18.7

CD3+HLA-DR+% 36.7 58.9 4.9

B12 ng/L 1457 4086 392

sFASL pg/ml 86 165 104

IL 10 pg/ml 27 353 9

IL 1b pg/ml 1 5 0

IL 2 pg/ml 11 0 15

IL 4 pg/ml 10 0 N.D.

IL 5 pg/ml N.D. N.D. 0

IL 6 pg/ml 0 N.D. 6

IL 7 pg/ml N.D. N.D. 4

IL 12 pg/ml N.D. N.D. N.D.

IL 13 pg/ml 350 N.D. N.D.


IL 18 pg/ml N.D. N.D. 2678


TNFa pg/ml 15 6.5 6

IFNg pg/ml 5 53.6 0

IgG mg/dl 417 2710 1750

IgE IU/ml 10 N.D. 5

Eosinophils K/ul 0.7 0.66 0.08

Monocytes K/ul 1.4 1.059 2.1

N.D., not determined.

Chapter 5

98

Elevated αβ-DNT cells are a hallmark of ALPS but its utility for predicting FAS

mutations had not been previously evaluated3. ALPS Ia and Ia-s patients had a high

percentage of αβ-DNTs, with median values 5.1% and 7.7%, respectively, compared to

0.5% for control MNRs (mutation negative relatives) (p<0.0001) (Figure 1A and Table

2). The αβ-DNT level was predictive of FAS mutations, with values >4% found in 60%

(90/152) of type Ia and in the majority of type Ia-s patients (7/9), but in only 13% (11/85)

of ALPS type III and phenotype patients (Figure 1A). This value was associated with a

positive likelihood ratio (LR) of 5.0 and a post-test probability of 89.3% for harboring

FAS mutations. Conversely, the presence of αβ-DNT cells in the 1-2% range decreased

the post-test probability to 25%, with a LR=0.19 (Figure 2B, 2C and Table 4).

In line with previous reports, ALPS patients, regardless of mutation status, had

<16% of circulating B cells expressing the memory marker CD27 (Figure 1B) 4. Finding

memory B cells >16% made the diagnosis of ALPS very unlikely (LR=0.17). Other

described abnormalities including increased CD3+HLA-DR+ to CD3+CD25+ ratio and

high number of B cells had no additional diagnostic utility4.

We also evaluated serum B12 levels in ALPS patients and found very elevated

median levels in ALPS Ia and Ia-s (2259 ng/L, 1653 ng/L) compared to control MNR

(474 ng/L, p<0.0001) and HMPR (healthy mutation positive relatives) (570 ng/L,

p<0.0001). A modest but statistically significant increase was also noted in ALPS III and

-phenotype, with medians of 759 ng/L and 943 ng/L, respectively (Figure 1C). Levels

above 1500 ng/L were observed in only 15% (4/28) of the ALPS type III and -phenotype

patients, contrasting with 63% (72/114) of ALPS Ia patients. The LR for a FAS mutation

with B12 levels >1500 ng/L was 4.0, with a post-test probability of 87%. In contrast,

having B12 levels <1000 ng/L diminished the post-test probability to 35% (Figure 2D,

2E and Table 4).

Analysis of plasma cytokines revealed two additional biomarkers for ALPS: IL-

18 and TNF-a. Median plasma IL-18 levels were elevated in ALPS Ia and Ia-s patients,

as compared to control MNRs (1041 pg/ml, 1526 pg/ml and 208 pg/ml, respectively;

p<0.0001). ALPS III and -phenotype patients had median values of 521 pg/ml and 702

pg/ml, respectively (p<0.001 compared with MNR) (Figure 1D). Furthermore, IL-18

Biomarkers in ALPS

99

<500 pg/ml was rarely seen in ALPS patients with FAS mutations (7/56), with an

associated negative LR of 0.19. TNF-a levels were higher in all ALPS groups with

median values of 5 pg/ml for ALPS Ia (p<0.0001), 9 pg/ml for ALPS Ia-s (p<0.05), 8

pg/ml for ALPS III (p<0.0001) and 7 pg/ml for ALPS-phenotype (p<0.0001), as

compared to 1.3 pg/ml for MNRs (Figure 1E).

Figure 1. Biomarkers in ALPS patients and control groups. Dashed lines represent cut off values used to calculate likelihood ratios. Bars denote median values. P values for the differences between groups were obtained by Mann-Whitney test and are shown above each graph (*** p <0.0001; ** p <0.001; * p <0.05). MNR, mutation negative relatives; HMPR, healthy mutation positive relatives.

Chapter 5

100

Figure 2. sFASL levels and combinations of biomarkers accurately predict FAS mutations in ALPS patients. (A) Scatter plot showing sFASL levels. Increasing (B) and decreasing (C) probabilities for having a FAS mutation according to the percentage of ab-DNTs, levels of vitamin B12, IL-10, IL-18, sFASL, and results of FAS-induced apoptosis assay. P values for the differences between groups were obtained by Mann-Whitney test and are shown above each graph (*** p <0.0001; ** p <0.001; * p <0.05).

As previously reported, IL-10 was markedly elevated in ALPS Ia and Ia-s

compared to MNRs (p<0.0001) and ALPS III and -phenotype patients (p<0.0001)5, 6

(Figure 1F). Sixty percent (83/139) of the ALPS Ia and all ALPS Ia-s patients exhibited

values >40 pg/ml, contrasting with 26% (10/38) of ALPS III and -phenotype patients. For

Biomarkers in ALPS

101

levels of IL-10 >40 ng/ml, the positive LR was 3.8, with a post-test probability of 85%

for having a FAS mutation. Notably, only 20% (29/141) of ALPS Ia and no ALPS Ia-s

patients had IL-10 values <20 pg/ml, giving a negative LR of 0.31 and a post-test

probability of 33% for FAS mutations (Figure 2B, 2C and Table 4).

Table 4. Probabilities, likelihood ratios, and odds ratios for having a FAS mutation

associated with different biomarker levels

Biomarker(s) FAS mutation probability (%)

Likelihood ratio Odds ratio

DNT >1% and clinical findings 63 1.7

Abnormal apoptosis assay 71 1.46 2.5

IL-10 >40 pg/mL 85 3.28 5.6

IL-10 <20 pg/mL 33 0.31 0.49

B12 >1500 ng/L 87 3.99 6.8

B12 <1000 ng/L 35 0.31 0.54

DNT >4% 89 5.00 8.5

DNT <2% 24 0.19 0.32

IL-18 >500 ng/L 77 2.05 3.48

IL-18 <500 ng/L 25 0.19 0.33

sFASL >300 pg/mL 88 4.5 7.7

sFASL <200 pg/mL 7.7 0.05 0.08

DNT >2% and IL-10 >20 pg/mL 88.4 4.5 7.62

DNT >2% and IL-10 >40 pg/mL 93.2 8.06 13.7

DNT >4% and IL-10 >20 pg/mL 93.9 9.16 15.58

DNT >4% and IL-10 >40 pg/mL 97 16.47 27.9

DNT >2% and B12 >1000 ng/L 89.4 4.9 8.40

DNT >2% and B12 >1500 ng/L 94.3 9.8 16.65

DNT >4% and B12 >1000 ng/L 94.5 10.1 17.19

Chapter 5

102

Biomarker(s) FAS mutation probability (%)

Likelihood ratio Odds ratio

DNT >4% and B12 >1500 ng/L 97 20 33.9

DNT >2% and IL-18 >500 pg/mL 89.52 5.02 8.54

DNT >4% and IL-18 >500 pg/mL 94 10.28 17.47

DNT >2% and sFasL >200 pg/mL 89.3 4.91 8.36

DNT >2% and sFasL >300 pg/mL 95 11.09 18.9

DNT >4% and sFASL >200 pg/mL 94.7 10.05 17.09

DNT >4% and sFASL >300 pg/mL 97 22.7 38.59

DNT <2% and IL-10 <20 pg/mL 9 0.06 0.10

DNT <2% and B12 <1000 ng/L 9 0.06 0.10

DNT <2% and IL-18 <500 ng/L 6.0 0.037 0.06

DNT <2% and sFASL <200 pg/mL 1.6 0.009 0.016

A recent report documented high levels of sFASL in ALPS patients7. We

expanded these findings analyzing more than 200 patients and controls. Ninety seven

percent of ALPS Ia (136/140) and all ALPS Ia-s patients had plasma sFASL >200 pg/ml,

with median values of 1114 pg/ml and 1329 pg/ml, respectively, compared with control

MNR levels of 104 pg/ml (p<0.0001 for both groups). Only modest elevations of sFASL

were seen in ALPS III and -phenotype patients, as well as HMPRs, with median values of

208 pg/ml, 174 pg/ml and 207 pg/ml, respectively (Figure 2A). These findings make

sFASL the most sensitive biomarker to rule out a FAS mutation, with values <200 pg/ml

associated with a negative LR of 0.05 and a post-test probability of 7.7% (Figure 2C and

Table E4). Soluble FASL also showed a strong positive correlation with IL-10 (r=0.8,

p<0.0001) and a moderate correlation with αβ-DNTs (r=0.6, p<0.0001) and B12 levels

(r=0.69, p<0.0001) (Figure E1A in the Online Repository). The area under the ROC

curve for sFASL, αβ-DNT cells, B12 and IL-10 levels were calculated to evaluate how

well they discriminate patients with a FAS mutation from those without (Figure E1B in

Biomarkers in ALPS

103

the Online Repository). The area under the curve for sFASL was 0.9 (defines an excellent

test) and for αβ-DNTs was 0.81. B12 and IL-10 exhibited areas significantly less than

sFASL (p <0.05), with values of 0.76 and 0.77.

Figure 3. Correlation and ROC curves. (A) Correlation plots and curves of sFASL with vitamin B12, IL-10 and ab-DNTs; (B) Receiver operating characteristic (ROC) curves for sFASL, ab-DNTs, IL-10 and vitamin B12.

We next evaluated if combinations of αβ-DNTs, B12, IL-10, IL-18 and sFASL

would have increased power to predict or exclude FAS mutations in patients suspected of

ALPS (Figure 2B, Table E4). The combination of αβ-DNTs>4% with B12 >1500 ng/L or

IL-10 >40 pg/ml or IL-18 >500 ng/ml or sFASL >300 pg/ml was associated with >95%

probability of having a FAS mutation. Conversely, having αβ-DNTcells <2% in

combination with IL-10 <20 pg/ml or B12 <1000 ng/L or IL-18 < 500 ng/ml decreased

the probability of a FAS mutation to less than 10% (Figure 2C, Table E4). Finally,

finding αβ-DNT cells <2% and sFASL <200 pg/ml resulted in <2% probability for a FAS

mutation.

In conclusion, the biomarkers described should aid in the selection of patients

with findings of ALPS for further diagnostic workup. Additionally, the presence of a

Chapter 5

104

combination of markers strongly suggestive of a FAS mutation in the setting of a negative

genetic test should prompt a search for somatic mutations in sorted αβ-DNT cells.

References 1. Bidere N, Su HC, Lenardo MJ. Genetic disorders of programmed cell death in the

immune system. Annu Rev Immunol 2006; 24:321-52. 2. Oliveira JB, Bidere N, Niemela JE, Zheng L, Sakai K, Nix CP, et al. NRAS

mutation causes a human autoimmune lymphoproliferative syndrome. Proc Natl Acad Sci U S A 2007; 104:8953-8.

3. Sneller MC, Straus SE, Jaffe ES, Jaffe JS, Fleisher TA, Stetler-Stevenson M, et al. A novel lymphoproliferative/autoimmune syndrome resembling murine lpr/gld disease. J Clin Invest 1992; 90:334-41.

4. Bleesing JJ, Brown MR, Straus SE, Dale JK, Siegel RM, Johnson M, et al. Immunophenotypic profiles in families with autoimmune lymphoproliferative syndrome. Blood 2001; 98:2466-73.

5. Lopatin U, Yao X, Williams RK, Bleesing JJ, Dale JK, Wong D, et al. Increases in circulating and lymphoid tissue interleukin-10 in autoimmune lymphoproliferative syndrome are associated with disease expression. Blood 2001; 97:3161-70.

6. Fuss IJ, Strober W, Dale JK, Fritz S, Pearlstein GR, Puck JM, et al. Characteristic T helper 2 T cell cytokine abnormalities in autoimmune lymphoproliferative syndrome, a syndrome marked by defective apoptosis and humoral autoimmunity. J Immunol 1997; 158:1912-8.

7. Magerus-Chatinet A, Stolzenberg MC, Loffredo MS, Neven B, Schaffner C, Ducrot N, et al. FAS-L, IL-10, and double-negative CD4- CD8- TCR alpha/beta+ T cells are reliable markers of autoimmune lymphoproliferative syndrome (ALPS) associated with FAS loss of function. Blood 2009; 113:3027-30.

CHAPTER 6

CRITICAL ROLE OF BIM IN T CELL RECEPTOR

RESTIMULATION-INDUCED DEATH

Snow AL,1* Oliveira JB, 2* Zheng L,1 Dale D,3 Straus SE,3 Fleisher TA, Lenardo MJ. 1

*co-first authors;

1Molecular Development Section, Laboratory of Immunology, National Institute of

Allergy and Infectious Diseases; 2Department of Laboratory Medicine, Clinical Center; 3

Laboratory of Clinical Infectious Diseases, National Institute of Allergy and Infectious

Diseases, National Institutes of Health, Bethesda, MD 20892-1508, USA

Biology Direct. 2008; v.3, p.34-44, 2008.

Chapter 6

106

ABSTRACT

Background: Upon repeated or chronic antigen stimulation, activated T cells

undergo a T cell receptor (TCR)-triggered propriocidal cell death important for

governing the intensity of immune responses. This is thought to be chiefly mediated

by an extrinsic signal through the Fas-FasL pathway. However, we observed that

TCR restimulation still potently induced apoptosis when this interaction was

blocked, or genetically impaired in T cells derived from autoimmune

lymphoproliferative syndrome (ALPS) patients, prompting us to examine Fas-

independent, intrinsic signals. Results: Upon TCR restimulation, we specifically

noted a marked increase in the expression of BIM, a pro-apoptotic Bcl-2 family

protein known to mediate lymphocyte apoptosis induced by cytokine withdrawal. In

fact, T cells from an ALPS type IV patient in which BIM expression is suppressed

were more resistant to restimulation-induced death. Strikingly, knockdown of BIM

expression rescued normal T cells from TCR-induced death to as great an extent as

Fas disruption. Conclusion: Our data implicates BIM as a critical mediator of

apoptosis induced by restimulation as well as growth cytokine withdrawal. These

findings suggest an important role for BIM in eliminating activated T cells even

when IL-2 is abundant, working in conjunction with Fas to eliminate chronically

stimulated T cells and maintain immune homeostasis.

INTRODUCTION

Proper homeostasis is achieved during an immune response by controlling the

appropriate size and activity of the effector T cell pool to maximize immunity and

minimize immunopathology. After an immune response, homeostasis depends on the

efficient contraction of the expanded T effector pool. Both processes require the selective

death of effector T cells1-5. When resting T cells become activated and proliferate under

the influence of growth cytokines, they display heightened sensitivity to apoptosis2,4,6.

The mechanisms by which apoptosis is provoked have been thought to differ depending

on the level of antigen in the T cell milieu. In one simple schema, T cell apoptosis

proceeds through either an "intrinsic" (Bcl-2 superfamily/mitochondrial-dependent)

Role of BIM in RAICD

107

program when antigen levels are low, or an "extrinsic" (Fas/CD95/APO-1/death receptor-

mediated) pathway under conditions of high or repeated antigen stimulation1,4,5,7. In the

first case, antigen clearance at the conclusion of an immune response results in

diminished growth and survival cytokines (such as interleukin-2 (IL-2)), thus activating

the mitochondrial death program. Cytokine withdrawal apoptosis (CWA) dramatically

reduces the expanded T effector population to re-establish homeostasis, but permits a

small population to persist as memory T cells. CWA is principally regulated by the pro-

and anti-apoptotic members of the Bcl-2 family. In particular, the pro-apoptotic "BH3-

only" proteins Bim and Puma have been implicated in CWA, as revealed by expanded

memory T cells in knockout mice8-10. These "BH3 only" members of the Bcl-2

superfamily cause caspase activation and apoptosis by binding pro-survival congeners

and releasing the proapoptotic proteins Bax and Bak11. Moreover, we recently discovered

that a gain-of-function mutation in N-RAS, which suppresses Bim expression via

constitutive extracellular signal-related kinase (ERK) activation, could cause a novel

form of ALPS in humans12. Indeed, Bim expression is tightly controlled by several

transcriptional and post-translational mechanisms that underscore its role in central and

peripheral T cell tolerance13.

On the other hand, the extrinsic apoptosis pathway involves restimulation of

activated T cells with high doses of antigen during the immune response; a pathway often

referred to as "activation-induced cell death (AICD)"1,7,14. However, it is important not to

obfuscate the critical functional distinction between "activation" – the process entrained

to the antigen receptor that causes resting cells to cycle, expand, and acquire effector

function – and the death mechanism induced by TCR restimulation of those effector T

cells that counterposes their expansion. So the term "TCR restimulation" or "TCR-

induced" apoptosis will be used herein. The key immunoregulatory consideration is why

restimulation by same antigen that produced the immune response, can kill the

participating T cells in a highly specific way. At first glance, this event would seem to

debilitate the immune response since the antigen, and presumably its pathogenic source,

are still present. However, it is best understood as a negative feedback mechanism that

constrains effector T cell proliferation to avoid immunopathology, previously termed

"propriocidal" regulation2,5,6. Propriocidal or TCR-induced death increases

Chapter 6

108

proportionately with high or persistent levels of antigen in IL-2. TCR-induced death has

hitherto been primarily equated with the Fas death receptor. Indeed, the upregulation of

Fas ligand (FasL) on the surface of restimulated T cells engages Fas on effector T cells

in cis ("suicide") or in trans ("fratricide") leading to apoptosis15-18. Moreover, debilitating

mutations in Fas or FasL result in defective lymphocyte homeostasis and autoimmunity

first characterized in mice (lpr and gld, respectively) and later in humans with ALPS type

Ia or Ib19,20.

The Bim vs. Fas paradigm recently restated for intrinsic vs. extrinsic T cell

apoptosis is appealing in its simplicity but illusory. For instance, other BH3-only proteins

such as PUMA are likely instrumental in CWA9,10. Also, the evidence suggests that Fas

may not be the sole mediator of TCR-induced death and that TNF or nonapoptotic

pathways may be involved21,22. Data from conditional knockout mice in which Fas is

ablated or blocked in distinct hematopoietic compartments indicate that Fas-mediated

apoptosis may also counter autoimmunity by ensuring the removal of antigen presenting

cells, including B cells and dendritic cells rather than T cells23,24. Although autoreactive T

cells accumulate in T cell-specific Fas knockout mice, surprisingly, loss of Fas confers no

selective survival advantage for T cells exposed to repeated antigen challenge24. Also,

Fas engagement can intersect with the intrinsic pathway through a caspase-8 activating

cleavage of Bid – a Bcl-2 superfamily member that can trigger mitochondrial apoptosis.

Based on these insights, we asked whether death effector pathways other than Fas,

including intrinsic signals routed through mitochondrial activation, were important for

TCR-induced death of human T cells.

In re-examining human T cells in which FAS signaling is blocked or genetically

impaired, we found that TCR-induced apoptosis can proceed through rapid induction of

BIM expression in the absence of FAS signals, which contributes to mitochondrial

permeabilization and cell death in the presence of IL-2. Knockdown of BIM expression

partially rescued cells from TCR-induced death, particularly for CD8+ human T cells.

Moreover, we show that TCR-induced apoptosis is normal for ALPS Ia patients

displaying elevated BIM expression, but impaired in an ALPS type IV patient in which

BIM expression is repressed. Collectively, these data indicate that FAS and BIM can

cooperate as independent effector molecules in TCR-induced apoptosis. Our results show


109

BIM plays a key role in T cell contraction even when cytokines are abundant, indicating

that FAS- and BIM-mediated T cell apoptosis are not mutually exclusive pathways as

recently reinforced in the literature7.

METHODS


Patients were enrolled and blood samples were obtained with informed consent under

protocols approved by the National Institutes of Health (NIH). Peripheral blood

lymphocytes (PBL) from normal donors were isolated by Ficoll density gradient

centrifugation, and T cells were activated by either 5 µg/ml ConA or 1 µg/ml OKT3 mAb

(Ortho Biotech, Raritan, NJ) plus 25 U/ml rhIL-2 (Peprotech, Rocky Hill, NJ), washed

3× in PBS, then cultured in 100 U/ml rhIL-2 for at least 7 days before apoptosis assays

were performed. Activated T cell subsets were separated using CD4 or CD8 Microbeads

and MACS magnetic bead cell separation (Miltenyi Biotec, Auburn, CA). In some

experiments, inhibitors to caspase 8 (IETD-fmk) or caspase 9 (LEHD) (BioVision, Palo

Alto, CA) were added at 20 µM. Caspase 9 enzymatic activity was measured using a

Caspase 9 Colorimetric Assay Kit (BioVision) according to the manufacturer's

instructions.

Flow Cytometry

Apoptosis assays were performed as previously described [12]. Briefly, activated T cells

were resuspended in fresh media + IL-2 and stimulated for 24 h with soluble OKT3 mAb,

agonistic anti-Fas mAb APO1.3 (Alexis, San Diego, CA) plus 200 ng/ml Protein A, or

2 µM staurosporine. In some experiments, 1 µg/ml of an antagonistic Fas blocking Ab

(clone SM1/23, Alexis) was added to cells 30 minutes prior to OKT3 restimulation. The

level of apoptosis was determined by staining with 1 µg/ml propidium iodide and flow

cytometry analysis using constant time acquisition as previously described.

Mitochondrial permeability was measured by staining with 40 nM 3,3'-

dihexyloxacarbocyanine iodide (DiOC6) (EMD Biosciences, San Diego, CA) for 15 min

at 37°C before flow cytometry analysis. For surface staining, cells were stained with 5 µg

Chapter 6

110

anti-CD4-fluorescin isothiocyanate (FITC), anti-CD8-phycoerythrin (PE), or anti-CD95-

PE (BD Biosciences).

Electron Microscopy

Treated cells (5 × 106) were pelleted and overlaid with 2% glutaraldehyde in 0.1 M

cacodylate buffer fixative for 2 h at room temperature (RT). Sample preparation and

electron microscopy was performed at the Image Analysis Laboratory of the National

Cancer Institute (Frederick, MD).

Mircoarray Analysis

RNA was isolated from two normal donor activated T cells at 0 or 6 h after OKT3

restimulation using Trizol (Invitrogen) and RNeasy mini-columns (Qiagen, Valencia,

CA). Purified RNA was amplified using the Ovation Aminoallyl Amplification System

(NuGEN, San Carlos, CA), labeled with Cy5 using the Cy5 Reactive Dye Pack (GE

Healthcare, Piscataway, NJ), and cleaned up using Vivaspin columns (VivaScience AG,

Hanover, Germany). Amplified RNA (2 µg) was hybridized to Hsbb 23K human spotted

arrays (NIAID Mircoarray Research Facility) versus Cy3-labeled reference RNA pooled

from six normal donor cycling T cells. Data was analyzed using GenePix and mAdb

software.

Immunoblotting

Cells were lysed in 1% NP-40 lysis buffer for 15 min on ice, then cleared by

centrifugation. Protein concentration was determined by BCA assay (Pierce, Rockford,

IL), and 20–30 µg total protein was separated by SDS-PAGE. Blots were probed with the

following antibodies (Abs): anti-BIM (Stressgen, Ann Arbor, MI); anti-BAX, anti-

cytochrome c (clone 7H8.2C12), anti-BCL-xL, anti-BCL-2, anti-MCL-1 (BD

Pharmingen); anti-PUMA (Alexis); anti-β-actin (clone AC-15, Sigma). Bound Abs were

detected using appropriate horseradish peroxidase-conjugated secondary Abs (Southern

Biotech, Birmingham, AL) and ECL (Pierce).


111

siRNA Transfections

Activated human PBL were transfected with 200 pmol of either specific small interfering

RNA oligoribonucleotides (siRNA) or a non-specific (NS) control oligo (Invitrogen,

Carlsbad, CA) using the Amaxa Nucleofection system (Amaxa, Koln, Germany).

Assessment of knockdown efficiency and all subsequent assays were performed 4 days

(human) post-transfection. siRNA sequences are available from Invitrogen (Stealth

Select).


TCR restimulation induces apoptosis signals independent of FAS

To examine TCR-induced death in human T cells, activated peripheral blood

lymphocytes (PBL) from normal donors were restimulated with the anti-CD3 mAb

OKT3 after cycling in IL-2 for 7–14 days. The majority of these cells are CD4+ and

CD8+ T cells, with the latter generally more abundant in culture. Data was obtained for

numerous human donors. We found that apoptosis was readily induced in restimulated T

cells, marked by chromatin condensation and shrinkage (Fig. 1A). This was followed by

loss of membrane integrity due to secondary necrosis. Apoptosis was verified by PI

exclusion; however, we noted that blocking FAS with an antagonistic Ab (SM1/23)

provided only partial protection against TCR-induced (Fig. 1B) Flow cytometric analysis

of restimulated T cells also confirmed cell shrinkage and loss of mitochondrial membrane

potential, as indicated by decreased DiOC6 staining following 12 h of OKT3 treatment,

signifying apoptosis (Fig. 1C) Again, blocking Fas with an antagonistic Ab (SM1/23)

only partially rescued this drop in mitochondrial membrane potential and cell viability.

Remarkably, T cells from an ALPS Ia patient with a FAS death domain mutation also

showed only a modest loss of mitochondrial membrane potential and viability (Fig. 1C),

suggesting a mitochondria-dependent apoptotic signal could proceed despite

compromised FAS function. Similarly, cytochrome c released from mitochondria in

response to OKT3 restimulation was only modestly decreased by FAS blockade (Fig.

1D). We also tested caspase 9 activation, which occurs downstream of cytochrome c

release and "apoptosome" formation. As expected, caspase 9 activation was only partially

reduced in restimulated cells in the presence of FAS blocking Ab, but completely

Chapter 6

112

abrogated in the presence of the caspase 9 specific inhibitor LEHD-fmk (Fig. 1E). In

contrast, the SM1/23 Ab effectively blocked APO1.3 anti-Fas induced apoptosis,

indicating that the cells were competent for FAS-mediated death (Fig. 2). Taken together,

our data confirms that TCR-induced death relies in part on intrinsic mitochondrial signals

triggered independently of FAS-FASL interactions.

Role for BIM induction in TCR-induced death

Initial studies of AICD indicated that de novo transcription was required for the execution

of apoptosis in response to T cell restimulation17. Since our data pointed toward a

mitochondrial component, we surveyed expression of several pro- and anti-apoptotic

BCL-2 family members using microarrays following TCR restimulation of activated

human PBL for 6 h. As a positive control, we detected significant induction of FASL

expression. Notably, we detected an even greater increase (> 5 fold) in BIM transcription

in response to OKT3 stimulation (Fig. 3A) Only BCL-xL was also increased with

restimulation, whereas other BCL-2 family members remained largely unchanged or

slightly decreased. The expression of all three BIM protein isoforms (extra long (EL),

long (L), and short (S)) also increased substantially over time with OKT3 restimulation,

whether Fas blockade was applied or not (Fig. 3B) Although BCL-xL protein levels also

increased, the ratio of BIM:BCL-xL expression rose substantially over time, suggesting

heightened Bim expression represents a "tipping point" for overcoming the anti-apoptotic

function of BCL-xL and related proteins in driving mitochondrial depolarization.

PUMAβ levels also showed a minor increase (Fig. 3B). Remarkably, the quick induction

of BIM upon restimulation occurred in the presence of IL-2, which is required for TCR-

induced death6. IL-2 signaling alone can destabilize BIM mRNA or promotes BIM

protein degradation via Raf/ERK or phosphoinositide kinase 3 (PI-3K) signaling

pathways25-27. However, our results suggest the TCR restimulation overrides this signal to

allow for rapid BIM upregulation. These data are consistent with previous observations

indicating BIM expression can be induced upon TCR triggering in human CTL clones,

depending on the agonistic peptide used28,29. However, these studies did not establish

whether loss of BIM expression had functional consequences for TCR-induced apoptosis

sensitivity, or how this related to FAS-FASL signaling.


113

Figure 1. TCR re-stimulation signals mitochondrial-dependent apoptosis independent of FAS. (A) Electron micrographs (upper panels, 2500× magnification or lower panels, 10000×) of activated human PBL either not restimulated (NRS) or restimulated with OKT3 mAb for 18 h. Arrows indicate apoptotic cells. (B) Activated human T cells were untreated (NRS) or restimulated with OKT3 for 24 h in the presence of FAS blocking Ab (SM1/23) or isotype control Ab. Cells were stained with PI and analyzed by flow cytometry; gates indicate % viable cells. (C) Activated human T cells from a normal donor or ALPS 1a patient were untreated (NRS) or restimulated with OKT3 for 12 h in the presence of FAS blocking Ab (SM1/23) or isotype control Ab. Cells were stained with DiOC6 and analyzed by flow cytometry (right panels). Viable gates are shown at left, and the percentage of DiOC6 low cells are indicated in the histograms on the right. (D) Cytosolic extracts from activated human PBL were immunoblotted for the presence of cytochrome c following stimulation with OKT3 or staurosporine (STS) for the indicated timepoints, in the presence or absence of SM1/23 Ab. (E) Lysates prepared as described in (D) were incubated with the caspase 9 specific substrate LEHD-pNA for 2 h, and caspase 9 enzymatic activity was quantitated as OD at 405 nm minus background (OD405 at 5 min).

Chapter 6

114

Figure 2. Blockade of Fas-induced apoptosis in SM1/23 treated PBL. Activated PBL were pre-treated with 1 ug/ml SM1/23 Ab prior to addition of increasing amounts of APO1.3 Ab. Percent cell loss was calculated 24 h later by PI exclusion in triplicate.

To definitively test whether BIM contributes to the TCR-induced apoptosis

signal, we silenced BIM expression by RNA interference (RNAi) in activated PBL and

restimulated them with OKT3 with or without FAS blockade. Knockdown of BIM

expression significantly reduced the sensitivity of activated PBL to TCR-induced death

(Fig. 3C). Control immunoblots showed that BIM expression was silenced effectively in

cells that received BIM-specific siRNA both before and after restimulation (Figure 3D,

Figure 4). As noted above, FAS blockade also partially rescued cells from death in these

experiments, and had an additive protective effect when BIM expression was reduced

(Fig. 3C). The protective effects of BIM suppression and Fas blockade were noted in

multiple human donors (Fig. 3E). Knockdown of FAS associated death domain (FADD)

rescued cells from TCR-induced death to a similar extent, further illustrating that death

receptor signaling is only part of the apoptotic signal triggered by TCR restimulation

(Fig. 5). In addition, knockdown of PUMA also provided some protection from TCR-

induced death (Fig. 6) although this effect was variable in different donors tested.

Collectively, our data definitively shows that intrinsic apoptosis mediators, particularly

BIM, are required for optimal apoptosis triggered by TCR re-engagement separate from

extrinsic FAS-induced apoptotic signals.


115

Figure 3. Induction of BIM expression contributes to TCR-induced apoptosis. (A) Mircoarray analysis of designated Bcl-2 family members was performed using RNA purified from activated human PBL either untreated (0 h) or stimulated with OKT3 for 6 h. Relative expression values normalized to reference RNA from normal human PBL are shown at left, fold change following TCR restimulation is quantitated at right. (B) Activated human PBL were stimulated with OKT3 for the indicated times, and whole cell lysates were prepared and immunoblotted for the proteins indicated on the right. All three isoforms of BIM (extra-long (EL), long (L), short (S)) were detected. Spot densitometry analysis of the ratio of BIM-EL to BCL-xL (normalized to β-actin loading control) is plotted below. (C) Activated human PBL were transfected with nonspecific (NS) or Bim-specific siRNA, rested 4 days, and then restimulated for 24 h with increasing doses of OKT3 in the presence or absence of SM1/23. Percent cell loss was calculated in triplicate by PI exclusion. Differences in apoptosis sensitivity (relative to NS alone) were statistically significant for each dose of OKT3 (p < 0.04), except for SM1/23 treated NS cells at 1 µg/ml. (D) Lysates from cells transfected in (C) were immunoblotted for BIM as in (B). β-actin serves as a loading control. (E) Average extent of TCR-induced apoptosis inhibition (relative to NS siRNA alone) is shown for each condition described in (D) for 6 different normal donor PBL tested.

Chapter 6

116

Figure 4. Bim siRNA effectively suppresses restimulation-induced BIM expression in activated T cells. Activated human PBL, purified CD4+ and CD8+ T cells were transfected with nonspecific (NS) or Bim-specific siRNA and rested for 4 days. Lysates were made from cells left untreated (0 h) or restimulated for 8 h with 100 ng/ml OKT3. Knockdown of protein expression was confirmed by immunoblotting.

Figure 5. Knockdown of FADD or Bim expression results in partial resistance to TCR-induced death. Activated human PBL were transfected with nonspecific (NS), FADD-specific, or Bim-specific siRNA, rested for 4 days, and then restimulated for 24 h with increasing doses of OKT3 in the presence or absence of Fas blocking Ab (SM1/23). Percent cell loss was calculated in triplicate by PI exclusion (left panel). Knockdown of protein expression was confirmed by immunoblotting in whole lysates 4 days post-transfection (right panel).


117

Figure 6. Knockdown of PUMA results in partial resistance to TCR-induced death. Activated human PBL were transfected with nonspecific (NS), Puma-specific, or Bim-specific siRNA, rested for 4 days, and then restimulated for 24 h with increasing doses of OKT3 in the presence or absence of Fas blocking Ab (SM1/23). Percent cell loss was calculated in triplicate by PI exclusion (left panel). Knockdown of protein expression was confirmed by immunoblotting in whole lysates 4 days post-transfection (right panel).

Relative contribution of BIM in CD4+ versus CD8+ TCR-induced death

We next tested whether BIM induction played a role in TCR-induced death of both

CD4+ and CD8+ T cells. Purified CD4+ and CD8+ T cells sorted from activated PBL were

transfected with NS or BIM-specific siRNA and tested for sensitivity to OKT3-induced

death. Whereas Fas blockade alone substantially rescued the apoptosis of purified CD4+ T

cells, knockdown of Bim expression had little effect (Fig. 7A). Conversely, CD8+ T cells

relied on both FAS and BIM for TCR-induced apoptosis signaling. Although BIM

expression was consistently higher in CD4+ T cells compared to CD8+ T cells from

multiple donors (Fig. 7B) BIM induction from steady state levels was as good or better in

CD8+ T cells upon restimulation (Fig. 4 & data not shown). We cannot rule out that

residual BIM expression in CD4+ T cells following BIM siRNA transfection contributed

to the Fas-independent of apoptosis observed. However, other experiments revealed that

BIM knockdown using the same siRNA provided greater protection from IL-2

withdrawal apoptosis in CD4+ T cells (Fig. 8) suggesting BIM levels could be sufficiently

depleted to hinder BIM-dependent death. Collectively, the data suggests that human

CD8+ T cells rely on BIM more extensively for TCR-induced deletion than CD4+ T cells,

Chapter 6

118

which are largely dependent on FAS signaling. This idea agrees with landmark studies

that implicated FAS in TCR-induced apoptosis, which focused primarily on CD4+ T cell

lines or clones from humans or mice15-18. Moreover, our data potentially explain new

studies suggesting BIM drives Ag-specific CD8+ T cell deletion in establishing peripheral

tolerance in both mice and humans30,31.

Figure 7. Bim is important for TCR-induced apoptosis of CD8+ T cells. (A) CD4+ or CD8+ T cells purified from activated human PBL were transfected with NS or Bim-specific siRNA, rested 4 days, then restimulated with increasing doses of OKT3 in the presence or absence of SM1/23. Percent cell loss was calculated in triplicate by PI exclusion. Differences in apoptosis sensitivity were statistically significant for SM1/23 treated CD4+ cells (NS and Bim) compared to NS cells alone (p < 0.007), except for SM1/23 treated NS cells at 1 µg/ml OKT3 (p < 0.07). Differences in apoptosis sensitivity for CD8+ T cells (relative to NS alone) were all statistically significant (p < 0.05). (B) Lysates from cells transfected in (A) were immunoblotted for BIM. β-actin serves as a loading control.

Bim and Fas cooperate in TCR-induced apoptosis of murine T cells

In light of our findings in human T cells, we re-examined TCR-induced death in murine

T cells. Surprisingly, we observed that activated splenic T cells from Fas-

deficient lpr mice showed only minor resistance to anti-CD3-induced death induced by

restimulation, whereas bim knockout mice showed no difference in sensitivity compared

to WT cells (Fig. 9A). We also tested for Bim induction in restimulated WT and lpr T

cells in the presence of IL-2. Consistent with data in human T cells, activated mouse T

cells (WT or lpr) showed a clear increase in BimEL expression after 6 hours of

restimulation (Fig. 9B). We also detected a change in the migration of BimEL and BimL


119

isoforms, suggesting post-translational modifications may affect of bim function in mice,

perhaps via phosphorylation.

Figure

8. BIM siRNA impairs IL-2 withdrawal apoptosis in both CD4+ and CD8+ T cells. Purified CD4+ and CD8+ T cells were transfected with nonspecific (NS) or Bim-specific siRNA and rested 24 hrs in IL-2. IL-2 was removed by thorough washing, and percent cell loss was calculated 72 and 96 hrs later by PI exclusion (left panel). The percent of apoptosis inhibition afforded by BIM siRNA (relative to NS) is graphed in the right panel.

Next, we reasoned that differences in apoptosis sensitivity caused by loss of Fas

or Bim may differ in CD4+ and CD8+ T cell cultures, as noted in for human T cells.

Therefore, we assayed TCR-induced apoptosis sensitivity in purified CD4+ and CD8+ T

cells from WT, lpr, and bim-/- mice. As expected from previous reports, CD4+ lpr cells

showed a profound defect in restimulation-induced death (Fig. 9C). This concurred with

our results in human CD4+ T cells using Fas blocking Ab (Fig. 7A) indicating Fas is

necessary for CD4+ T cell restimulation apoptosis. In contrast, there were no differences

in CD8+ T cell death between restimulated WT and lpr cells, explaining the cumulatively

minor rescue of TCR-induced death in total splenic T cells when Fas is absent.

Furthermore, genetic ablation of bim had little protective effect for activated CD4+ T cells

upon TCR restimulation, and no discernible effect on apoptosis in CD8+ T cells (Fig. 9D).

Chapter 6

120

Figure 9. Fas and Bim cooperate in driving TCR-induced apoptosis of murine T cells. (A) Activated splenic T cells from wild-type (WT), lpr, or bim-/- mice were restimulated with platebound anti-CD3 for 24 h. Percent cell loss was calculated in triplicate by PI exclusion. (B) Lysates from splenic T cells from the indicated genetic backgrounds left untreated or restimulated with platebound anti-CD3 for 6 h were immunoblotted for Bim isoform expression. β-actin serves as a loading control; asterisk indicates non-specific band. (C, D) CD4+ and CD8+ T cells were purified from activated WT, lpr, or bim-/-

splenocytes and restimulated with platebound anti-CD3 for 24 h. Percent cell loss was calculated in triplicate by PI exclusion. (E) Splenic T cells from WT or lpr mice were stimulated for 48 h with platebound anti-CD3/anti-CD28, washed, and transfected with NS or Bim-specific siRNA. Three days post-transfection, cells were restimulated with 100 ng/ml platebound anti-CD3; percent cell loss was calculated in triplicate by PI exclusion. Differences in apoptosis sensitivity (relative to NS-treated WT cells) were statistically significant (p < 0.04). Lysates made from cells three days post-transfection were assessed for Bim knockdown by immunoblotting, right.

We hypothesized that loss of Bim from development, through germline gene

ablation, may permit T cells to "compensate" accordingly via enhanced expression or


121

function of pro-apoptotic molecules. Therefore, we acutely silenced Bim using RNAi in

activated WT and lpr T cells. Knockdown of Bim significantly protected activated WT

and lpr T cells from apoptosis induced by 100 ng/ml anti-CD3 stimulation (Fig. 9E, left

panel), demonstrating that Bim can play a prominent role in this apoptosis pathway. This

effect was also noted in purified CD4+ and CD8+ T cell populations (data not shown),

even though loss of Fas alone reduced sensitivity only in CD4+ T cells again as expected.

Control blots showed that Bim siRNA effectively suppressed Bim protein expression in

both WT and lpr T cells (Fig. 9E, right panel). This protective effect was less pronounced

at higher doses of anti-CD3 stimulation (data not shown), suggesting stronger

restimulation may override Bim siRNA effects and/or trigger alternative death effector

pathways. Thus, our data suggests that Fas or Bim may partially compensate for the loss

of one or the other from development in murine T cells during development.

Relative BIM expression correlates with sensitivity to TCR-induced death in ALPS

patients

Based on our aforementioned results, we revisited TCR restimulation-induced apoptosis

in PBL derived from several ALPS patients. Similar to controls, PBL cultures from

ALPS Ia patients were primarily comprised of CD8+ T cells (data not shown).

Surprisingly, we found that PBL from several ALPS Ia patients displayed normal or

slightly more death in response to OKT3 titration compared to normal controls, despite

impaired apoptosis upon direct Fas crosslinking. (Fig. 10A). Similarly, T cells derived

from an ALPS Ib patient harboring a dominant interfering mutation in FASL32 were also

killed effectively upon TCR restimulation (Fig. 10B). Consistent with defective FASL

function, TCR-induced apoptosis was unaffected by Fas blockade. These results exposed

a glaring contradiction in the concept that FAS mediates most or all TCR-induced death.

Chapter 6

122

Figure 10. Suppression of Bim expression in ALPS type IV patient causes resistance to TCR-induced death. (A) Activated human PBL from normal control donors (NC1, NC2), or 6 ALPS type Ia patients were restimulated with increasing doses of OKT3 for 24 h. Percent cell loss was calculated in triplicate by PI exclusion. (B) Activated human PBL from an ALPS type Ib patient or a normal control donor (NC) were treated as in (A). Percent cell loss was calculated in triplicate by PI exclusion. (C) Activated human PBL from normal control donors (NC1, NC2), or 6 ALPS type Ia patients restimulated with 100 ng/ml OKT3 for 0 (-) or 8 h (+), lysed and immunoblotted for BIM. β-actin serves as a loading control. Spot densitometry analysis of the ratio of BIM (EL isoform) to β-actin (normalized to NC1 untreated, dashed line) is plotted below. (D) Activated human PBL from normal control donors (NC1, NC2), an ALPS type Ia patient, and an ALPS Type IV patient (P58) were restimulated with OKT3 for 24 h. Percent cell loss was calculated in triplicate by PI exclusion. Differences in apoptosis sensitivity (relative to NC1 or NC2) were statistically significant (p < 0.01). (E) Activated human PBL as in (D) were restimulated with 100 ng/ml OKT3 for 0 (-) or 8 h (+), lysed and immunoblotted for BIM. β-actin serves as a loading control.


123

We next assessed the relative expression of BIM before and after restimulation of

PBL in ALPS Ia patients. In general, we noted higher BIM protein expression in

restimulated ALPS Ia T cells relative to controls (Fig. 10C). In 4/6 ALPS Ia patients,

steady-state BIM expression was also elevated relative to controls. Using spot

densitometry, we estimated that ALPS Ia T cells had between 30–80% more BIM protein

than normal controls both before and after TCR ligation (Fig. 10C, bottom panel). BIM

siRNA treatment did not result in a significantly greater rescue of TCR-induced death in

ALPS Ia cells compared to normal controls (data not shown), perhaps due to incomplete

depletion of BIM or compensation by other mediators (e.g. PUMA). Nevertheless,

elevated BIM levels in cycling T cells with defective FAS function may suggest that

these T cells are "primed" for apoptotic deletion through a compensatory increase in BIM

expression.

Finally, we tested TCR-induced apoptosis in T cells derived from an ALPS Type

IV patient (P58) with a gain-of-function, germline NRAS mutation that constitutively

activates ERK and suppresses BIM expression. We recently demonstrated that P58 T

cells are resistant to apoptosis induced by IL-2 withdrawal due to BIM suppression12.

Remarkably, P58 T cells displayed partial resistance to TCR-induced death when

compared to normal donor and ALPS Ia cells, despite comparable expression of FAS on

the cell surface (Fig. 10D, Fig. 11). Moreover, BIM expression was attenuated in P58 T

cells and could not be rescued by TCR restimulation (Fig. 10E), providing stronger

evidence that BIM serves a physiologically relevant role in the restimulation apoptosis

pathway, especially for CD8+ T cell homeostasis. Moreover, our data implies that relative

BIM expression may represent an important determinant of TCR-induced apoptosis

sensitivity, independently of FAS. However, we concede that NRAS/ERK dysregulation

in P58 could alter TCR-induced death through BIM-independent mechanisms as well.

Indeed, pharmacological ERK inhibitors actually provided a small but reproducible

rescue of TCR-induced death in both normal and P58 T cells.

Chapter 6

124

Figure 11. ALPS Type IV patient T cells express functional FAS. (A) Activated PBL from a normal control donor (NC, open histogram), an ALPS type Ia patient (gray), or ALPS type IV (P58, black) were stained with FITC-conjugated anti-CD95 or isotype control Ab (dashed line) and analyzed by flow cytometry. (B) Activated PBL from a normal donor (NC), an ALPS type IV patient (P58) and an ALPS type Ia patient were treated with 20 or 200 ng/ml APO1.3 mAb plus 200 ng/ml Protein A. Percent cell loss was calculated in triplicate by PI exclusion.

The physiological function of Bim was originally revealed from characterization

of Bim-deficient mice, from which T cells were profoundly resistant to lymphokine

withdrawal death8. The pro-apoptotic function of Bim also enforces immune tolerance

through thymocyte negative selection, CD8+ T cell cross tolerance, and the regulation of

antigen presenting cells including B cells and dendritic cells23,33-35. Here we demonstrate

that BIM also plays a significant role in TCR-induced death of activated human T cells,

working in tandem with FAS signaling as a separate signal to kill T cells. This provides a

new mechanism besides the cleavage of BID for an extrinsic signal to activate the

intrinsic mitochondrial death program. This paradigm may be distinct from Bim-

dependent "activated T cell death" described by Hildeman et al. in mice challenged with a

single dose of superantigen36, which may be interpreted as predominantly cytokine

withdrawal apoptosis, not restimulation-induced death with repeated Ag dosing. On the

other hand, the marked accumulation and persistence of Bim-deficient murine CD8+ T

cells in chronic viral infection models could be connected to failed deletion in response to

repeated TCR stimulation37,38.


125

Our results show that direct signals from the TCR program T cells to die through

Bim, which is fundamentally different from the secretion of death cytokines such as FasL

that engage external death receptors. This has some interesting implications. First, it may

be advantageous in conditions where Fas may not be effective. For example, Bim has a

greater influence in CD8+ T cells that can utilize FasL:Fas as a calcium-independent

cytolytic mechanism against infected target cells and therefore may be inured to its lethal

effects. Second, the direct molecular connection inside the cell may make the Bim

pathway more efficient. Careful investigation of the temporal effects of killing after TCR

engagement may reveal differences between Fas and Bim effectiveness. Third, as Bim

expression is extensively regulated post-translationally, the fact that translation inhibitors

only partially block TCR-induced death could indicate there is a direct death pathway

entrained to TCR restimulation that does not require new protein synthesis17. Finally, pro-

apoptotic mediators like Bim or Puma acting at the convergence of TCR and CWA may

help to restrain these pathways at a focal point for tight control of those T cells escape

death and emerge as memory T cells.

Recently, three groups reported that loss of both Bim and Fas in mice results in

massive lymphadenopathy/splenomegaly, early onset of SLE-like autoimmune

manifestations, and even greater accumulation of antigen-specific CD8+ T cells upon

chronic viral infection39-41. These experiments reprised earlier work that obtained very

similar results when transgenic Bcl-2 overexpressing mice were crossed onto

an lprbackground42,43. However, their general conclusions still emphasized the traditional

model, reiterated in an accompanying review, that Fas and Bim control T cell

homeostasis through two distinct pathways: restimulation-driven versus IL-2 withdrawal-

induced apoptosis, respectively5,7,19. Our study illustrates that death of activated T cells

via Fas or Bim are not mutually exclusive pathways, as both can operate in IL-2

dependent TCR-induced apoptosis. During infections this combination of potent extrinsic

and intrinsic signals may act to ensure rapid and efficient killing of hyper-responsive or

cross-reactive autoimmune T cells upon repeated antigen encounter, thus preventing

immunotoxicity and maintaining peripheral tolerance. Another intriguing possibility

relates to the potential of Bim and Fas to partially compensate for one another in driving

TCR-induced apoptosis. This applies to situations where either gene function is lost from

Chapter 6

126

development, such as in lpr or bim-/- mice, and may explain why only acute knockdown

of Bim resulted in significant reduction of TCR-induced apoptosis in murine T cells in

vitro. The idea that Bim participates in ensuring T cell homeostasis both during and after

effector T cell responses may also explain why Bcl-2 Tg lpr mice described years ago

have strikingly worse lymphocyte accumulation compared to either Bcl-2 Tg or lpr mice

alone43. Our results provide a new interpretation of the mouse studies by revealing that

the infection-induced derangement of T cell homeostasis caused by Bim-deficiency could

be accounted for by an impairment of both intrinsic and extrinsic apoptosis. It is also

notable that ALPS patients show wide variability in conventional CD3+ T cell numbers,

with a substantial fraction showing no increases. By contrast, the fraction and absolute

number of "double negative" (CD4-CD8-) α/β T cells are invariably elevated44. This may

reflect that alternative effectors such as BIM could preserve equipoise in the conventional

T cell compartment.

In humans, our data are consistent with previous studies suggesting that TCR-

induced death involves multiple effector molecules, and clearly includes components

other than FAS or BIM that remain to be elucidated22. We have previously noted a role

for tumor necrosis factor-alpha (TNF-α) in this process for murine CD8+ T cells21;

however, blockade of this pathway in human T cells had little demonstrable effect (data

not shown), which requires further exploration. A recent paper from Mateo et al.

implicated perforin and cytotoxic granules in the execution of TCR-induced death,

particularly for ALPS Ia patient cells45. Other inputs implicated in control of AICD

sensitivity, including NF-κB regulation through HPK-1 or generation of reactive oxygen

species (ROS), likely relate more to the regulation of FasL or Bim expression46,47.

However, we are studying patients with impaired TCR-induced apoptosis despite normal

induction of FASL and BIM, and normal apoptosis triggered by FAS ligation or IL-2

deprivation (A.L. Snow, unpublished data). Insights gleaned from such patients may

further advance our understanding of the biochemical complexity and physiological

relevance of apoptosis in different immune cell compartments. Nevertheless, our current

findings further elucidate FAS-independent signals for the restimulation-induced death of

activated T cells via BIM induction.


127

CONCLUSION

Although Fas-FasL signaling is often considered synonymous with TCR restimulation-

induced death, the data provided herein show it has a quantitatively lesser role than

previously acknowledged, and support a critical role for BIM induction in the execution

of antigen-driven "extrinsic" apoptosis. Increased BIM expression following TCR

restimulation, even with a surfeit of IL-2, works in parallel to FAS signaling in driving

mitochondrial depolarization, caspase 9 activation, and eventual apoptosis. Like FAS

blockade, suppression of BIM induction via RNAi or increased NRAS activity in an

ALPS variant patient results in partial resistance to TCR-induced death. These data build

upon previous work from Sandalova and colleagues by demonstrating that BIM is

indispensable for maximum sensitivity to restimulation-induced apoptosis of human T

cells. More importantly, our findings revise previous models in showing that FAS and

BIM both participate in eliminating activated T cells through this IL-2 dependent,

propriocidal death pathway.

References 1. Strasser A, Pellegrini M. T-lymphocyte death during shutdown of an immune

response. Trends Immunol. 2004;25:610-615. 2. Boehme SA, Lenardo MJ. Propriocidal apoptosis of mature T lymphocytes occurs

at S phase of the cell cycle. Eur J Immunol. 1993;23:1552-1560. 3. Arnold R, Brenner D, Becker M, Frey CR, Krammer PH. How T lymphocytes

switch between life and death. Eur J Immunol. 2006;36:1654-1658. 4. Lenardo MJ. Fas and the art of lymphocyte maintenance. J Exp Med.

1996;183:721-724. 5. Lenardo M, Chan KM, Hornung F, et al. Mature T lymphocyte apoptosis--

immune regulation in a dynamic and unpredictable antigenic environment. Annu Rev Immunol. 1999;17:221-253.

6. Lenardo MJ. Interleukin-2 programs mouse alpha beta T lymphocytes for apoptosis. Nature. 1991;353:858-861.

7. Green DR. Fas Bim boom! Immunity. 2008;28:141-143. 8. Bouillet P, Metcalf D, Huang DC, et al. Proapoptotic Bcl-2 relative Bim required

for certain apoptotic responses, leukocyte homeostasis, and to preclude autoimmunity. Science. 1999;286:1735-1738.

9. Erlacher M, Labi V, Manzl C, et al. Puma cooperates with Bim, the rate-limiting BH3-only protein in cell death during lymphocyte development, in apoptosis induction. J Exp Med. 2006;203:2939-2951.

Chapter 6

128

10. Fischer SF, Belz GT, Strasser A. BH3-only protein Puma contributes to death of antigen-specific T cells during shutdown of an immune response to acute viral infection. Proc Natl Acad Sci U S A. 2008;105:3035-3040.

11. Fletcher JI, Huang DC. Controlling the cell death mediators Bax and Bak: puzzles and conundrums. Cell Cycle. 2008;7:39-44.


13. Puthalakath H, Strasser A. Keeping killers on a tight leash: transcriptional and post-translational control of the pro-apoptotic activity of BH3-only proteins. Cell Death Differ. 2002;9:505-512.

14. Green DR, Droin N, Pinkoski M. Activation-induced cell death in T cells. Immunol Rev. 2003;193:70-81.

15. Alderson MR, Tough TW, Davis-Smith T, et al. Fas ligand mediates activation-induced cell death in human T lymphocytes. J Exp Med. 1995;181:71-77.

16. Brunner T, Mogil RJ, LaFace D, et al. Cell-autonomous Fas (CD95)/Fas-ligand interaction mediates activation-induced apoptosis in T-cell hybridomas. Nature. 1995;373:441-444.

17. Dhein J, Walczak H, Baumler C, Debatin KM, Krammer PH. Autocrine T-cell suicide mediated by APO-1/(Fas/CD95). Nature. 1995;373:438-441.

18. Ju ST, Panka DJ, Cui H, et al. Fas(CD95)/FasL interactions required for programmed cell death after T-cell activation. Nature. 1995;373:444-448.


20. Oliveira JB, Fleisher T. Autoimmune lymphoproliferative syndrome. Curr Opin Allergy Clin Immunol. 2004;4:497-503.

21. Zheng L, Fisher G, Miller RE, Peschon J, Lynch DH, Lenardo MJ. Induction of apoptosis in mature T cells by tumour necrosis factor. Nature. 1995;377:348-351.

22. Davidson WF, Haudenschild C, Kwon J, Williams MS. T cell receptor ligation triggers novel nonapoptotic cell death pathways that are Fas-independent or Fas-dependent. J Immunol. 2002;169:6218-6230.

23. Chen M, Wang YH, Wang Y, et al. Dendritic cell apoptosis in the maintenance of immune tolerance. Science. 2006;311:1160-1164.

24. Stranges PB, Watson J, Cooper CJ, et al. Elimination of antigen-presenting cells and autoreactive T cells by Fas contributes to prevention of autoimmunity. Immunity. 2007;26:629-641.

25. Brunet A, Bonni A, Zigmond MJ, et al. Akt promotes cell survival by phosphorylating and inhibiting a Forkhead transcription factor. Cell. 1999;96:857-868.

26. Ley R, Balmanno K, Hadfield K, Weston C, Cook SJ. Activation of the ERK1/2 signaling pathway promotes phosphorylation and proteasome-dependent degradation of the BH3-only protein, Bim. J Biol Chem. 2003;278:18811-18816.

27. Matsui H, Asou H, Inaba T. Cytokines direct the regulation of Bim mRNA stability by heat-shock cognate protein 70. Mol Cell. 2007;25:99-112.


129

28. Sandalova E, Wei CH, Masucci MG, Levitsky V. Regulation of expression of Bcl-2 protein family member Bim by T cell receptor triggering. Proc Natl Acad Sci U S A. 2004;101:3011-3016.

29. Sandalova E, Hislop AD, Levitsky V. T-cell receptor triggering differentially regulates bim expression in human lymphocytes from healthy individuals and patients with infectious mononucleosis. Hum Immunol. 2006;67:958-965.

30. Lopes AR, Kellam P, Das A, et al. Bim-mediated deletion of antigen-specific CD8 T cells in patients unable to control HBV infection. J Clin Invest. 2008;118:1835-1845.

31. Redmond WL, Wei CH, Kreuwel HT, Sherman LA. The apoptotic pathway contributing to the deletion of naive CD8 T cells during the induction of peripheral tolerance to a cross-presented self-antigen. J Immunol. 2008;180:5275-5282.


33. Bouillet P, Purton JF, Godfrey DI, et al. BH3-only Bcl-2 family member Bim is required for apoptosis of autoreactive thymocytes. Nature. 2002;415:922-926.

34. Davey GM, Kurts C, Miller JF, et al. Peripheral deletion of autoreactive CD8 T cells by cross presentation of self-antigen occurs by a Bcl-2-inhibitable pathway mediated by Bim. J Exp Med. 2002;196:947-955.

35. Enders A, Bouillet P, Puthalakath H, Xu Y, Tarlinton DM, Strasser A. Loss of the pro-apoptotic BH3-only Bcl-2 family member Bim inhibits BCR stimulation-induced apoptosis and deletion of autoreactive B cells. J Exp Med. 2003;198:1119-1126.

36. Hildeman DA, Zhu Y, Mitchell TC, et al. Activated T cell death in vivo mediated by proapoptotic bcl-2 family member bim. Immunity. 2002;16:759-767.

37. Grayson JM, Weant AE, Holbrook BC, Hildeman D. Role of Bim in regulating CD8+ T-cell responses during chronic viral infection. J Virol. 2006;80:8627-8638.

38. Pellegrini M, Belz G, Bouillet P, Strasser A. Shutdown of an acute T cell immune response to viral infection is mediated by the proapoptotic Bcl-2 homology 3-only protein Bim. Proc Natl Acad Sci U S A. 2003;100:14175-14180.

39. Hughes PD, Belz GT, Fortner KA, Budd RC, Strasser A, Bouillet P. Apoptosis regulators Fas and Bim cooperate in shutdown of chronic immune responses and prevention of autoimmunity. Immunity. 2008;28:197-205.

40. Hutcheson J, Scatizzi JC, Siddiqui AM, et al. Combined deficiency of proapoptotic regulators Bim and Fas results in the early onset of systemic autoimmunity. Immunity. 2008;28:206-217.

41. Weant AE, Michalek RD, Khan IU, Holbrook BC, Willingham MC, Grayson JM. Apoptosis regulators Bim and Fas function concurrently to control autoimmunity and CD8+ T cell contraction. Immunity. 2008;28:218-230.

42. Reap EA, Felix NJ, Wolthusen PA, Kotzin BL, Cohen PL, Eisenberg RA. bcl-2 transgenic Lpr mice show profound enhancement of lymphadenopathy. J Immunol. 1995;155:5455-5462.

Chapter 6

130

43. Strasser A, Harris AW, Huang DC, Krammer PH, Cory S. Bcl-2 and Fas/APO-1 regulate distinct pathways to lymphocyte apoptosis. Embo J. 1995;14:6136-6147.

44. Straus SE, Sneller M, Lenardo MJ, Puck JM, Strober W. An inherited disorder of lymphocyte apoptosis: the autoimmune lymphoproliferative syndrome. Ann Intern Med. 1999;130:591-601.

45. Mateo V, Menager M, de Saint-Basile G, et al. Perforin-dependent apoptosis functionally compensates Fas deficiency in activation-induced cell death of human T lymphocytes. Blood. 2007;110:4285-4292.

46. Brenner D, Golks A, Becker M, et al. Caspase-cleaved HPK1 induces CD95L-independent activation-induced cell death in T and B lymphocytes. Blood. 2007;110:3968-3977.

47. Kaminski M, Kiessling M, Suss D, Krammer PH, Gulow K. Novel role for mitochondria: protein kinase Ctheta-dependent oxidative signaling organelles in activation-induced T-cell death. Mol Cell Biol. 2007;27:3625-3639.

CHAPTER 7

FAS HAPLOINSUFFICIENCY IS A COMMON DISEASE

MECHANISM IN THE HUMAN AUTOIMMUNE

LYMPHOPROLIFERATIVE SYNDROME

Hye Sun Kuehn1, Iusta Caminha1, Julie E. Niemela1, V. Koneti Rao2, Joie Davis2, Thomas

A. Fleisher1, João B. Oliveira1*

From the 1 Department of Laboratory Medicine, Clinical Center, National Institutes of

Health, Bethesda, Maryland USA; 2 Laboratory of Clinical Infectious Diseases, National

Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda,

Maryland, USA

The Journal of Immunology, in press.

Chapter 7

132

ABSTRACT

The autoimmune lymphoproliferative syndrome (ALPS) is characterized by early-

onset lymphadenopathy, splenomegaly, immune cytopenias, and an increased risk

for B-cell lymphomas. Most ALPS patients harbor mutations in the FAS gene,

which regulates lymphocyte apoptosis. These are commonly missense mutations

affecting the intracellular region of the protein and have a dominant-negative effect

on the signaling pathway. However, analysis of a large cohort of ALPS patients

revealed that approximately 30% have mutations affecting the extracellular region

of FAS and among these 70% are nonsense, splice site or insertions/deletions with

frameshift for which no dominant-negative effect would be expected. We evaluated

the latter patients to understand the mechanism(s) by which these mutations

disrupted the FAS pathway and resulted in clinical disease. We demonstrated that

most extracellular-region FAS mutations induce low FAS expression due to

nonsense mediated RNA decay or protein instability resulting in defective DISC

formation and impaired apoptosis, although to a lesser extent as compared to

intracellular mutations. The apoptosis defect could be corrected by FAS

overexpression in vitro. Our findings define haploinsufficiency as a common disease

mechanism in ALPS patients with extracellular FAS mutations.

INTRODUCTION

The autoimmune lymphoproliferative syndrome (ALPS) is characterized by early onset

development of benign lymphadenopathy and splenomegaly, multilineage cytopenias due

to autoimmune peripheral destruction and splenic sequestration of blood cells, and

increased risk for B-cell lymphomas1-3. Patients typically accumulate a hallmark

population of mature TCRαβ+ T cells that are CD4 and CD8 negative4,5. ALPS is caused

by defects in proteins involved in the FAS pathway of lymphocyte apoptosis. Most

(~65%) patients have mutations in the FAS (TNFRSF6/APO1/CD95) gene (ALPS-FAS),

while a minority has mutations in the gene encoding FAS ligand (ALPS-FASLG) or

caspase-10 (ALPS-CASP10)6-12. Germline mutations in CASP8 or somatic mutations in

NRAS or KRAS cause ALPS-related syndromes currently classified separately12-15

FAS haploinsufficiency in ALPS

133

The FAS gene contains 9 exons spanning 26Kb on chromosome 10q24.116. The first 5

exons encode the extracellular portion of the protein containing three cysteine-rich

domains that are involved in receptor trimerization and FASL binding required for

triggering of the apoptotic signal. Exon 6 codes for the transmembrane domain and the

intracellular portion is encoded by exons 7 through 9. The FAS death domain (DD), an

85-amino acid long structure encoded by exon 9, is required for FAS induced apoptosis

of lymphocytes under physiological conditions17.

The majority of FAS defects associated with ALPS are heterozygous missense

mutations that affect the intracellular death domain, allowing for the expression of a

defective protein with a dominant-negative effect on the signaling pathway7,18. These

mutations demonstrate high penetrance for clinical symptoms including refractory

cytopenias and an increased risk for lymphoma2,18. However, evaluation of a large cohort

of ALPS patients at our center has revealed a significant sub-population harboring

mutations affecting the extracellular region of the protein, and these are commonly

nonsense, or insertions, deletions and splice site mutations with frameshift (Figure 1).

These mutations are predicted to abolish protein expression and hence are not expected to

result in dominant-negative interference, and the mechanism by which this affects FAS

apoptosis signaling is not clearly defined. FAS haploinsuficiency is one possible disease

mechanism in ALPS associated with extracellular mutations but currently there are only

very limited data supporting this mechanism19,20. In fact, FAS haploinsuficiency was

clearly demonstrated in only one ALPS patient to date, such that the prevalence, long

term clinical impact and biochemical consequences are unknown19.

To understand the mechanism by which extracellular region FAS mutations disrupt the

apoptotic machinery, we analyzed the functional impact of twenty-nine representative

mutations across all regions of FAS using patient-derived B-cell lines. We demonstrate

that most (eight of the eleven) mutations affecting the extracellular regions of the FAS

receptor we studied are associated with haploinsufficiency. These mutations induced less

severe disruption of the FAS mediated apoptosis signaling platform when compared to

missense intracellular mutations, and the apoptotic defect could be rescued in vitro by

FAS overexpression. These findings define haploinsuficiency as an ALPS-causing

Chapter 7

134

disease mechanism, in addition to the well-documented dominant-negative interference

seen with intracellular mutations.

METHODS

Patient samples, cell culture and gene sequencing

All patients were studied at the National Institutes of Health under IRB approved

protocols (93-I-0063 and 95-I-0066). Genomic DNA samples were PCR-amplified and

sequenced as previously described21. For mRNA sequencing, cDNA was prepared from

EBV transformed B-cells lines using RNeasy plus mini kit (Qiagen). To rule out the

presence of contaminating DNA, RNA samples were subjected to PCR-amplification

using intron-specific primers; the absence of amplified product (DNA) was confirmed by

denaturing agarose gel electrophoresis (data not shown). cDNA was PCR-amplified

(Forward: 5’-GTGAGGGAAGCGGTTTACGAGTGA-3’, Reverse: 5’-

AGTGGGGTTAGCCTGTGGATAGAC-3’) and the products were subjected to

sequencing (primer sequences available upon request). To determine the ratio of mutant

to wild type FAS transcripts, cDNA was amplified and cloned into the pcDNA 3.0-HA

vector (modified from pcDNA3.0 (Invitrogen)) with EcoRI and XhoI enzyme sites. After

transformation, we picked 10-20 colonies and performed sequencing. Three samples with

death domain mutations (D260N, Q276X, L294Dfs) were used as controls. For functional

studies, EBV transformed B-cell lines from the patients were cultured in RPMI media

with 10% FBS, 100 Units/ml Penicillin, 100 µg/ml Streptomycin, 2mM L-Glutamine

(Gibco, Invitrogen).

Apoptosis measurement

EBV-transformed B-cells (200,000/well) were aliquoted in triplicate into 96 well plates

and cultured with or without APO-1-3 (1 µg/ml) (ENZO Life Sciences) in the presence of

protein A (1 µg/ml). After 24 hours, cell loss was determined by measuring the loss of

the mitochondrial transmembrane potential using 3,3’-Dihexyloxacarbocyanine iodide

(DiOC6) (Calbiochem, EMC Biosciences) staining. Briefly, cells were incubated with 40

nM DiOC6 for 15 minutes at 37 °C and live cells (DiOC6 high) were counted by flow

cytometry (Becton Dickinson FACSCanto II) by constant time acquisition. The


135

percentage of cell loss was calculated according to the following formula: (number of

live cells without APO-1-3 treatment - number of live cells with APO-1-3 treatment/

number of live cells without APO-1-3 treatment) × 100.

FAS cell surface expression

To determine FAS (CD95) expression, EBV-transformed B-cells (0.5 × 106 cells

/sample) were washed with PBS and incubated with 10 µg/ml of Phycoerythrin (PE)-

CD95 (BD Biosciences) or IgG control for 30 minutes at 4°C (dark) in 100 µl 5% FCS in

PBS. After washing with PBS two times, 10,000 live cells were analyzed by flow

cytometry. Absolute number of FAS molecules on the cell surface was established by

developing a mean equivalent soluble fluorochrome (MESF) standard curve using

QuantiBRITE PE (BD Biosciences) beads run in parallel for each experiment, according

to the manufacturer’s protocol

Immunoprecipitation

EBV-transformed B-cells (3 × 106 cells /sample) were cultured with or without APO-1-3

(0.5 µg/ml) in the presence of protein A (1 µg/ml) for 20 minutes at 37°C.

Immunoprecipitation was performed according to manufacturers’ instructions (Pierce

Classic IP Kit, Thermo Scientific). Briefly, after exposure, cells were washed with cold

PBS and lysed and spun down (13,000 rpm, 4°C, 20 minutes). Supernatants were

incubated with anti-FAS antibody (Santa Cruz, A-20) and protein A/G agarose for 2

hours after which the immune complexes were washed and proteins were separated by

electrophoresis on 4–12% NuPAGE Bis–Tris gels (Invitrogen), transferred to

nitrocellulose membranes and probed utilizing the anti-FADD (BD Biosciences) or anti-

Caspase-8 (Cell Signaling Technology) antibodies. To quantitate changes in protein level,

the ECL films were scanned using a Quantity One scanner (Bio-Rad).

FAS transfection

EBV-transformed B-cells (3 × 106 cells /sample) were transfected with 5 µg of GFP

(pmaxGFP) or 5 µg of YFP-FAS (pEYFP-N1-FAS) using Amaxa Human B-cell

Nucleofector kit (Program U-015). Twenty-four hours after transfection, medium was

Chapter 7

136

replaced with fresh complete medium. After 48 hours of transfection, expression of FAS

on the cell surface was determined by flow cytometry as described above gating on live

GFP or YFP transfected cells. To evaluate apoptosis the transfected cell lines were

treated with vehicle or APO-1.3 in the presence of protein A (as above) and live GFP+ or

YFP+ cells counted as described above.

Biomarkers

The quantification of IL-10, soluble Fas ligand, vitamin B 12, IL-18, TNF-α and

TCRαβ+CD4-CD8- T cells on patient samples was performed as previously described22.

Statistical analysis

Data are represented as the mean ± S.E.M, except were noted. The statistical analyses

were performed by unpaired Student’s t-test or Mann-Whitney rank-sum test. Differences

were considered significant when p<0.05.

RESULTS

FAS cell surface expression in ALPS-associated FAS mutations

We reviewed genetic data from 108 ALPS probands and identified 84 distinct mutations

(27 extracellular, 5 transmembrane, 24 intracellular non-DD, 28 intracellular DD

mutations) (Figure 1). The majority of the non-DD mutations were either nonsense

(11/57), or splice site or insertions/deletions (indels) with predicted frameshifts

(36/57). More importantly, most (19/27) of the mutations affecting the extracellular

regions of the protein were also nonsense, indels or splice site with frameshifts. We

selected 29 mutations across all regions to determine their functional effect (Fig.1 and

Table I). To assess the impact of the different FAS mutations on the expression of FAS,

we determined the number of FAS molecules on the cell surface of patient-derived EBV-

transformed B-cell lines using a flow cytometry-based assay. The majority of the

mutations affecting the extracellular region (8 out of 11) demonstrated significantly

reduced FAS expression (Fig. 2A). The mutation W176X, which abolishes the entire

transmembrane region, also resulted in low FAS expression (Fig. 2B). The mutation

H111R and the inframe deletion G66_H111 affect the FAS ligand binding domain, and


137

were not expected to result in lower protein expression. As predicted, most mutations

affecting intracellular regions of the FAS protein did not significantly change cell surface

FAS expression (Fig. 2B and C). Exceptions included the intracellular nonsense

mutations R250X and L294X, which significantly reduced FAS surface expression (Fig.

2B and C). Taken together these data suggested haploinsufficiency as a possible disease

mechanism in ALPS caused by FAS extracellular region mutations.

Figure 1. Schematic representation of FAS mutations in ALPS patients. TM, transmembrane. Red text indicates mutations evaluated in this study. Blue text indicates complex mutations. Black diamonds represents the number of families with same mutation.

Chapter 7

138

Figure 2. Cell surface expression of FAS on EBV-transformed B-cells. A-C. Cells (0.5 × 106) were stained for FAS expression using 10 µg/ml of Phycoerythrin (PE)-conjugated anti-CD95 or PE-conjugated isotype-matched IgG for 30 minutes at 4°C. After washing two times with PBS, 10,000 live cells were analyzed by flow cytometry. FAS expression was quantified using QuantiBRITE PE. Data were represented as means + S.E of three to four separate experiments. *, p < 0.05 and **, p < 0.01 by Student's t-test for comparison with normal cell lines.


139

Low FAS expression is associated with apoptosis dysfunction due to impaired DISC

formation

We next evaluated the functional impact of the 29 selected mutations in the FAS pathway

by the treatment of EBV-transformed B-cell lines with the agonistic anti-FAS antibody

APO-1-3 followed by cross linking. All cell lines with extracellular, transmembrane or

intracellular mutations showed significant resistance to FAS-mediated cell death when

compared to control cell lines (Fig. 3A-C). The apoptotic defect could also be observed

on primary cultured T cells (data not shown). Mutations in the extracellular domains

resulted in milder apoptotic defects when compared to intracellular mutations, with

median cell losses of 62% and 29%, respectively (Fig. 3D). However, this difference did

not reach statistical significance (p=0.17), likely due to the large data spread in the

extracellular group and the limited sample number in each group.

To further dissect the impact of FAS mutations on the downstream signaling

pathways, we evaluated death-inducing signaling complex (DISC) formation in response

to FAS activation. This complex includes FADD together with caspase-8/10 and is

formed within seconds following FAS stimulation, resulting in the processing and

activation of caspase-8/10 with propagation of the apoptotic signal. Following FAS

activation with APO-1-3 and protein A, immunoprecipitated protein complexes were

examined by western blotting to measure the levels of co-immunoprecipitated FADD and

caspase-8 bound to the intracellular portion of the FAS receptor. Compared to mutations

affecting the intracellular region (Fig.4 B and C), the extracellular mutations (Fig. 4A)

showed consistent but more limited impairment in FADD (p=0.032) and caspase-8

(p=0.02) recruitment to the signaling complex, based on multiple experiments (Fig. 4D).

These data demonstrate that extracellular mutations with low FAS expression attenuate

downstream signaling and impair apoptosis, although to a lesser extent when compared to

the intracellular mutations, and confirm interference of apoptosis by haploinsufficiency at

the molecular level.

Chapter 7

140

Figure 3. Sensitivity of EBV-transformed B-cells to CD95-induced cell death. A-C. EBV-transformed B-cells from ALPS patients and three different normal controls were stimulated with APO-1-3 (1 µg/ml) and protein A (1 µg/ml) for 24 hours. Cell death was determined by measuring the loss of the mitochondrial transmembrane potential using DiOC6 by flow cytometry. D. Comparison of the degree of apoptotic defect between cells with extracellular mutations (including W176X) affecting FAS expression (EC, n=9) and intracellular mutations with normal FAS expression (IC, n=16), with numbers normalized to the value in normal cells. The Data A-C were represented as means + S.E of three separate experiments. The data on D were presented as medians and interquartile ranges, and medians were compared using Mann-Whitney test. All the results from ALPS patients showed significant reduction in FAS-mediated cell death compared with normal cell lines.

D


141

Chapter 7

142

Figure 4. DISC formation in EBV-transformed B-cells of ALPS patients. A-C. Cells were stimulated with APO-1-3 (0.5 µg/ml) or isotype control IgG in the presence of protein A (1 µg/ml) for 20 minutes. After lysis, cell lysates were incubated with anti-FAS antibody and protein A/G agarose for 2 hours. The immunocomplexes were then subjected to western blotting using anti-FADD and anti-Caspase-8 (CASP8). Caspase-8 band represents cleaved caspase-8 (~43 Kda). Since FAS size overlaps with IgG heavy chain, we couldn’t show immunoprecipitated FAS. D. Comparison of the degree of recruitment of FADD or Caspase-8 to the FAS receptor upon stimulation between cells with extracellular mutations affecting FAS expression (EC, n=9) and intracellular mutations with normal FAS expression (IC, n=16). All the numbers were normalized to the value in normal cells. Densitometry data (A-C) are presented as means ± S.E. of (n=3) separate experiments, and compared by Student's t-test. The data on D were presented as medians and interquartile ranges, and medians were compared using Mann-Whitney test. *p < 0.05, ** p < 0.01, ***p<0.001.

Different mechanisms mediate low FAS expression

To gain insight into the mechanism(s) responsible for low cell surface FAS protein

expression associated with extracellular FAS mutations, we first evaluated mRNA

stability of mutant and wild type alleles by performing FAS cDNA cloning followed by

sequencing. Although rare mRNAs harboring premature stop codons escape the

degradation pathway, most transcripts containing a premature stop codon followed by a

spliceable intron undergo nonsense-mediated mRNA decay (NMD)23. Accordingly, we

detected almost exclusively wild type FAS cDNA in cells with the E45X, C63X, Y91X

and C149Nfs mutations (Table 1), suggesting these mutated transcripts underwent NMD.

However, the nonsense mutations A16X, L18X, W176X, R250X, L294X and F133Ifs

and, as expected, the missense L7P and C135Y, allowed both wild-type and mutant allele

expression at varying ratios, suggesting that alternative mechanisms other than NMD also

lead to low FAS expression seen with specific extracellular FAS mutations.


143

Table 1. Summary of FAS mutations and their effects

ID

cDNA

Protein

Location

Surface Fas (% normal)

Apoptosis (% normal)

FADD recruitment (% normal)

Caspase 8 recruitment (% normal)

RNA stability (% mutant clones)*

127 c.20T>C p.L7P Exon 1 54 74 117 98 Stable (44.5) 220 c.46_47delGC p.A16X Exon 2 39 65 45 46 Stable (15) 74 c.53T>G p.L18X Exon 2 33 1 21 30 Stable (31) 153 c.133G>T p.E45X Exon 2 69 75 99 82 Unstable (0) 50 c.189T>A p.C63X Exon 2 48 73 85 71 Unstable (0) 111 c.197(-1)g>a p.G66_H111

del Intron 2

98 70 89 70 Stable

89 c.273C>A p.Y91X Exon 3 36 19 36 30 Unstable (8) 180 c.332A>G p.H111R Exon 3 101 47 83 66 Stable 77 c.397_398delT

TinsA p.F133IfsX54 Exon 4

45 42 63 42 Stable (15)

205 c.404G>A p.C135Y Exon 4 53 62 49 50 Stable (22) 34 c.444(-1)g>c p.C149NfsX3

2 Intron 4

37 21 64 42 Unstable (0)

175 c.528G>A p.W176X Exon 6 24 77 51 33 Stable (6) 4 c.569(-2)a>c p.V190GfsX2 Intron 6 64 31 80 70 Stable 45 c.585_595del1

1 p.Q196TfsX12

Exon 7 97 24 14 24

Stable

72 c.607A>T p.R203X Exon 7 112 26 15 24 Stable 149 c.651(+2)t>a p.V190GfsX1

1 Intron 7

106 17 14 15 Stable

62 c.676(+2)t>c p.E218MfsX4

Intron 8 109 9 13 17

Stable

98 c.686delT+690_694del5

p.L229X Exon 9 84 10 13 16

Stable

3 c.721A>C p.T241P Exon 9 63 32 28 27 Stable 110 c.722C->A p.T241K Exon 9 67 28 6 14 Stable 29 c.749G>A p.R250Q Exon 9 69 6 24 22 Stable 31 c.749G>C p.R250P Exon 9 104 63 70 57 Stable 55 c.748C>T p.R250X Exon 9 44 8 21 15 Stable (37.5) 197 c.778G>A p.D260N Exon 9 145 29 11 11 Stable (28.6) 137 c.779A>G p.D260V Exon 9 100 59 8 13 Stable 33 c.826C>T p.Q276X Exon 9 90 36 18 15 Stable (60) 121 c.879_880del

AT p.L294DfsX2 Exon 9

115 44 74 48 Stable (60)

30 c.880delT p.L294X Exon 9 48 54 38 25 Stable (28) 17 c.929T>G p.I310S Exon 9 94 71 98 92 Stable

*Stable : Both wt and mutant forms were detected; Unstable : More than 90% of the clones were wild-type.

Chapter 7

144

Ectopic expression of L18X and F133Ifs in 293 T cells resulted in small amounts

of truncated proteins that did reach the cell surface (Fig. 5 and data not shown). L16X is

believed to behave in a similar manner. W176X also resulted in a short protein missing

the transmembrane region that did not anchor on the cell surface (Fig. 5 and data not

shown). Interestingly, ectopic expression of R250X and L294X resulted in subnormal

surface expression of the mutant FAS (Fig. 5), similar to that observed in the EBV B-cell

lines (Fig. 2). These findings suggest that these two latter mutations may result in a

combination of haploinsufficiency and dominant-negative inhibition.

L7P is located in the signal peptide, and it is plausible that impaired intracellular

trafficking to the endoplasmic reticulum (ER) and Golgi apparatus prevents normal

surface FAS expression, as it has been demonstrated for other proteins(24,25. However, we

could not detect any clear accumulation of FAS in the ER or Golgi by confocal

microscopy (data not shown). These experiments were complicated by the fact that the

mutation is heterozygous, such that 50% of the proteins are expected to traffick normally.

Lastly, C135Y affects a cystein residue within the third cysteine-rich domain, possibly

resulting in an abnormally folded protein. Ectopic expression of this mutant did result in

surface FAS expression, but at lower levels as compared to controls (Fig. 5).

Taken together these data suggest that haploinsufficiency associated with

extracellular mutations can diminish FAS expression by inducing NMD, protein

instability and, potentially, abnormal intracellular trafficking.


145

Figure 5. Overexpression of Fas or Fas mutant into 293T cells. pcDNA3.0-HA-Fas or Fas mutants were prepared as described in ‘Materials and Methods’. HEK293T cells were transfected with indicated wild-type or mutant FAS for 24 hours and then cells were stained for FAS expression using APC-conjugated anti-CD95 or APC-conjugated isotype-matched IgG. Live cells were then analyzed by flow cytometry. Numbers inside plots represent geometric mean channel fluorescence. These data are representative data of n=3.

Chapter 7

146

Figure 6. Biomarkers in patients with haploinsufficient or dominant-negative mutations. Dashed lines represent normal values. EC, extracellular mutations with low FAS; IC, intracellular mutations with dominant-negative effect. The data were presented as means + S.E of EC and IC groups. Vit. B12, vitamin B12; sFas ligand, soluble Fas ligand.


147

Clinical and laboratory findings in patients with haploinsufficient alleles

We next analyzed the impact of the different FAS mutations on clinical and laboratory

parameters in ALPS patients. Extracellular mutations are known to result in lower

penetrance and variable expressivity, and these were not re-addressed in this study18,26.

We evaluated recently described biomarkers associated with FAS mutations, including

percentage of TCRαβ+CD4-CD8- (DNT) T cells as well as levels of soluble FAS ligand,

IL-10, IL-18, TNF-α and vitamin B1227,28. No statistically significant differences were

noticed between patients with null extracellular or missense intracellular mutations (Fig.

6). However, one additional clinical finding that appeared to distinguish the two groups

was the absence of lymphomas in patients with extracellular FAS mutations. Among over

189 patients from108 families with FAS mutations in the NIH cohort, all 21 lymphomas

documented to date occurred in patients with intracellular mutations29. Additionally,

lymphoma occurred in one patient with a somatic mutation in NRAS14. This finding

suggests that the residual apoptotic function observed in haploinsufficiency-associated

extracellular mutations may translate clinically not only into lower penetrance and

expressivity but also into a lower risk for lymphomagenesis.

Overexpression of FAS in haploinsufficient samples corrects the apoptotic defect

To conclusively demonstrate haploinsufficiency as a disease mechanism, we transfected

YFP-tagged wild type FAS or an empty GFP-expressing plasmid into selected EBV-

transformed cell lines that showed reduced FAS expression and reduced sensitivity to

FAS-induced cell death. Transfection efficiency ranged from 10-25% (data not shown).

Forty-eight hours after transfection we measured cell surface FAS expression by flow

cytometry on live-gated GFP+ or YFP+ transfected cells (Fig. 7). Cell surface FAS

expression was increased after transfection with YFP-FAS, and this corrected the

apoptotic defect, as compared with control GFP-transfected cells and normal controls.

These results suggest that the level of surface FAS expression is a crucial determinant of

the sensitivity to FAS-induced cell death.

Chapter 7

148

Figure 7. Overexpression of wt-FAS into FAS

haploinsufficient samples. A-F. Normal and patient EBV-transformed B-cells (3 × 106 cells /sample) were transfected with 5 µg of GFP (pEGFP-C1) or 5 µg of YFP-FAS (pEYFP-N1-wt FAS) using Amaxa Human B-cell Nucleofector. Forty-eight hours of

transfection, overexpressed FAS on the cell surface was determined by flow cytometry using PE-CD95, and cells were stimulated with APO-1-3 (1 µg/ml) and protein A (1 µg/ml) for 24 hours. Cell death was determined by flow cytometry. Analysis was performed by gating on live GFP or YFP-FAS transfected cells. Data were presented as means of two experiments. N, normal control.


149

DISCUSSION

Missense mutations affecting the death domain of the FAS gene are the most common

genetic abnormality detected in patients with ALPS and disrupt the apoptosis pathway by

dominant-negative interference7,18,30. This occurs because FAS is present on the cell

surface as a pre-associated homotrimeric receptor, such that in the presence of a

heterozygous mutation 7 out of 8 trimers will contain at least one mutant copy of the FAS

protein and this prevents adequate signaling31. However, analysis of our extensive cohort

of patients revealed that a significant proportion of ALPS patients harbor null mutations

in the extracellular portion of the FAS protein. These mutations were not expected to

have a dominant-negative effect, as no mutant protein expression was anticipated, and

alternative mechanisms were explored. We analyzed the impact of disease-associated,

naturally occurring FAS mutations on the apoptotic signaling pathway and associated

clinical and laboratory findings in ALPS patients. This was, to our knowledge, the first

comprehensive effort to understand the functional consequences of a large group of non-

death domain ALPS-associated FAS mutations.

Our findings demonstrate that haploinsufficiency is associated with nonsense or

frameshift FAS mutations, primarily located in gene regions encoding for the

extracellular portion of the FAS protein. From 11 extracellular mutations associated with

a defect in apoptosis, only 3 did not result in decreased FAS expression. Among these is

E45X, a truncation that did not reduce surface FAS levels to statistical significance and

correspondingly did not affect FAS signaling in any measurable way. It is possible that

even a mild decrease in FAS expression may result in dysfunction in vivo although the

underlying mechanism for disease in this patient remains to be fully understood. The

recurrent mutation H111R and the in-frame G66_H111 deletion also did not reduce FAS

expression but are predicted to affect the FAS ligand binding site, providing a possible

explanation for the clinical and cellular phenotype. Curiously, despite having documented

apoptosis defects for all mutations tested, no impairment in DISC formation could be

detected for the extracellular mutations L7P, E45X, H111R and G66_H111del, and the

intracellular I310S. This may reflect a low sensitivity of the immunoprecipitation assay

used in the study to very mild but still clinically significant functional defects.

Chapter 7

150

Previous case reports lend support to the concept that haploinsufficiency is a

pathogenetic mechanism in ALPS. Vaishnaw et al. suggested that haploinsufficiency was

at play in two patients with a nonsense mutation in the extracellular domain, and Roesler

et al. demonstrated haploinsufficiency in another ALPS patient with a transmembrane

mutation that prevented FAS expression19,20. Studies in lpr mice, which harbor

spontaneous mutations in the Fas gene, also indirectly support our findings. Although

commonly considered an exclusively recessive phenotype, a heterozygous lpr mutation

does induce the development of autoimmunity in certain backgrounds, with autoantibody

production, glomerulonephritis, sialoadenitis and lymphoid accumulation32,33. At odds

with human disease, lpr heterozygous mice do not appear to develop DNT cell

accumulation, but the mutation was crossed to only a limited number of genetic

backgrounds, as compared to the outbred human population32,33.

Haploinsufficiency has been commonly reported for genes involved in non-linear

signaling processes, such as DNA transcription and assembly of macromolecular

complexes34. Accordingly, productive FAS signaling requires the assembly of large

signaling platforms on the cell surface35. This is thought to be required to concentrate

pro-caspase-8 in close proximity allowing for self-cleavage, activation and propagation

of the apoptotic signal36,37. Thus, lower amounts of surface FAS may prevent the

formation of a critical threshold of these complexes resulting in a disrupted apoptotic

signal. Indeed, we showed that DISC formation is adversely affected in most of these

patients, although to a lesser extent than in patients with intracellular mutations.

The milder nature of the apoptotic defect seen in haploinsufficiency-associated

FAS mutations can be molecularly explained by the fact that the intact allele will allow

expression of normal FAS proteins on the cell surface, which will presumably pre-

associate through their PLAD domains and form functional trimers, albeit at levels

roughly 50% that seen in healthy controls. In contrast, missense intracellular mutations

with dominant-negative effect will result in the incorporation of mutant proteins in 7 out

of 8 FAS trimers on the cells surface, rendering them non-functional.

The residual FAS function seen in ALPS patients with haploinsufficiency-

associated extracellular mutations can potentially explain the incomplete clinical

penetrance and variable expressivity, typical also of other diseases associated with


151

haploinsufficient alleles18,20,30,34. More strikingly, the absence of lymphoma cases to date

in patients with FAS EC mutations suggests that this level of residual FAS function may

be sufficient for tumor suppression, placing these patients at a lower cancer risk(3, 29).

However, further long term follow up of ALPS patients at our and other centers will be

necessary to fully substantiate this initial observation.

It is plausible that modifying factors including genetic, epigenetic or

environmental, may make a larger contribution to disease phenotype in patients with EC

mutations as compared to more severe dominant-negative mutations. Along these lines,

Magerus-Chatinet et al. demonstrated in recent work that a group of ALPS patients with

low-penetrance EC mutations present with a somatic event in the second FAS allele in

double-negative T cells, and this was associated with the presence of clinical symptoms38.

Lastly, one can also speculate that the definition of haploinsufficiency as a

common disease mechanism in ALPS makes gene therapy a future possibility for this

group of patients, based on the finding that increasing FAS cell surface expression can re-

establish normal apoptosis. In contrast, the current approach of viral vector gene insertion

would likely not be effective in correcting the apoptotic defect associated with dominant-

negative FAS mutations.

Acknowledgements

We thank the patients and their families for their contributions to the study. We also

thank Richard Siegel for the FAS-YFP plasmid construct.

References 1. Sneller MC, Wang J, Dale JK, et al. Clincal, immunologic, and genetic features of

an autoimmune lymphoproliferative syndrome associated with abnormal lymphocyte apoptosis. Blood. 1997;89:1341-1348.

2. Le Deist F, Emile JF, Rieux-Laucat F, et al. Clinical, immunological, and pathological consequences of Fas-deficient conditions. Lancet. 1996;348:719-723.

3. Straus SE, Jaffe ES, Puck JM, et al. The development of lymphomas in families with autoimmune lymphoproliferative syndrome with germline Fas mutations and defective lymphocyte apoptosis. Blood. 2001;98:194-200.

4. Sneller MC, Straus SE, Jaffe ES, et al. A novel lymphoproliferative/autoimmune syndrome resembling murine lpr/gld disease. J Clin Invest. 1992;90:334-341.

Chapter 7

152

5. Bleesing JJ, Brown MR, Straus SE, et al. Immunophenotypic profiles in families with autoimmune lymphoproliferative syndrome. Blood. 2001;98:2466-2473.







12. Oliveira JB, Bleesing JJ, Dianzani U, et al. Revised diagnostic criteria and classification for the autoimmune lymphoproliferative syndrome: report from the 2009 NIH International Workshop. Blood.



15. Niemela JE, Lu L, Fleisher TA, et al. Somatic KRAS mutations associated with a human non-malignant syndrome of autoimmunity and abnormal leukocyte homeostasis. Blood.

16. Behrmann I, Walczak H, Krammer PH. Structure of the human APO-1 gene. Eur J Immunol. 1994;24:3057-3062.

17. Chinnaiyan AM, O'Rourke K, Tewari M, Dixit VM. FADD, a novel death domain-containing protein, interacts with the death domain of Fas and initiates apoptosis. Cell. 1995;81:505-512.

18. Jackson CE, Fischer RE, Hsu AP, et al. Autoimmune lymphoproliferative syndrome with defective Fas: genotype influences penetrance. Am J Hum Genet. 1999;64:1002-1014.

19. Roesler J, Izquierdo JM, Ryser M, et al. Haploinsufficiency, rather than the effect of an excessive production of soluble CD95 (CD95{Delta}TM), is the basis for ALPS Ia in a family with duplicated 3' splice site AG in CD95 intron 5 on one allele. Blood. 2005;106:1652-1659.


153

20. Vaishnaw AK, Orlinick JR, Chu JL, Krammer PH, Chao MV, Elkon KB. The molecular basis for apoptotic defects in patients with CD95 (Fas/Apo-1) mutations. J Clin Invest. 1999;103:355-363.

21. Niemela JE, Hsu AP, Fleisher TA, Puck JM. Single nucleotide polymorphisms in the apoptosis receptor gene TNFRSF6. Mol Cell Probes. 2006;20:21-26.

22. Caminha I, Fleisher TA, Hornung RL, et al. Using biomarkers to predict the presence of FAS mutations in patients with features of the autoimmune lymphoproliferative syndrome. J Allergy Clin Immunol;125:946-949 e946.

23. Chang YF, Imam JS, Wilkinson MF. The nonsense-mediated decay RNA surveillance pathway. Annu Rev Biochem. 2007;76:51-74.

24. Siggaard C, Rittig S, Corydon TJ, et al. Clinical and molecular evidence of abnormal processing and trafficking of the vasopressin preprohormone in a large kindred with familial neurohypophyseal diabetes insipidus due to a signal peptide mutation. J Clin Endocrinol Metab. 1999;84:2933-2941.

25. Birney E, Stamatoyannopoulos JA, Dutta A, et al. Identification and analysis of functional elements in 1% of the human genome by the ENCODE pilot project. Nature. 2007;447:799-816.

26. Rieux-Laucat F, Blachere S, Danielan S, et al. Lymphoproliferative syndrome with autoimmunity: A possible genetic basis for dominant expression of the clinical manifestations. Blood. 1999;94:2575-2582.


28. Magerus-Chatinet A, Stolzenberg MC, Loffredo MS, et al. FAS-L, IL-10, and double-negative CD4-CD8-TCR alpha/beta+ T cells are reliable markers of ALPS associated with FAS loss of function. Blood. 2009.

29. Rao VK PS, Davis J, Perkins K, Gill F, Pittaluga S, Fleisher T, Jaffe E. Development of lymphomas in families with autoimmune lymphoproliferative syndrome (ALPS) [abstract]. Pediatric Blood and Cancer. 2010;54.

30. de Villartay JP, Rieux-Laucat F, Fischer A, Le Deist F. Clinical effects of mutations to CD95 (Fas): relevance to autoimmunity? Springer Semin Immunopathol. 1998;19:301-310.

31. Siegel RM, Frederiksen JK, Zacharias DA, et al. Fas preassociation required for apoptosis signaling and dominant inhibition by pathogenic mutations. Science. 2000;288:2354-2357.

32. Carlsten H, Tarkowski A, Jonsson R, Nilsson LA. Expression of heterozygous lpr gene in MRL mice. II. Acceleration of glomerulonephritis, sialadenitis, and autoantibody production. Scand J Immunol. 1990;32:21-28.

33. Ogata Y, Kimura M, Shimada K, et al. Distinctive expression of lprcg in the heterozygous state on different genetic backgrounds. Cell Immunol. 1993;148:91-102.

34. Veitia RA, Birchler JA. Dominance and gene dosage balance in health and disease: why levels matter! J Pathol;220:174-185.

35. Siegel RM, Muppidi JR, Sarker M, et al. SPOTS: signaling protein oligomeric transduction structures are early mediators of death receptor-induced apoptosis at the plasma membrane. J Cell Biol. 2004;167:735-744.

Chapter 7

154

36. Muzio M, Chinnaiyan AM, Kischkel FC, et al. FLICE, a novel FADD-homologous ICE/CED-3-like protease, is recruited to the CD95 (Fas/APO-1) death--inducing signaling complex. Cell. 1996;85:817-827.

37. Muzio M, Stockwell BR, Stennicke HR, Salvesen GS, Dixit VM. An induced proximity model for caspase-8 activation. J Biol Chem. 1998;273:2926-2930.

38. Magerus-Chatinet A, Neven B, Stolzenberg MC, et al. Onset of autoimmune lymphoproliferative syndrome (ALPS) in humans as a consequence of genetic defect accumulation. J Clin Invest;121:106-112.

Concluding remarks

155

CONCLUDING REMARKS Recent conceptual advances and new technologies are driving an unprecedented

expansion in the field of primary immunodeficiencies (PIDs). The number of known

genetic defects is growing rapidly each year, counting more than 160 in 2011 (ref. 1 and

unpublished observations). One recent major technological advance that will have, in the

author’s view, strong impact in the coming years is the application of second-generation

(“next-gen”) sequencing for the study of primary immunodeficiencies2. Several examples

of how next-gen will revolutionize the study of PIDs and other monogenic disorders are

starting to appear in the literature3-6. This technology makes possible the sequencing of a

large number of candidate genes or whole genomes or exomes at a reasonable cost,

allowing an unprecedented insight into human genetics. The author’s laboratory is

currently sequencing whole exomes in small groups of patients with unexplained

recurrent infections or autoimmune disorders, and has already found promising candidate

genes, under intense study.

With the widespread use of this technology the author believes that in the next

decade the genetic basis of the individual susceptibility to infectious diseases will be

mostly defined. By the sequencing of whole genomes in large cohorts of patients one will

be able to pinpoint the isolated rare or collection of common genetic events making up

the elusive “genetic background” often blamed for the large variation in infectious

susceptibility. Obviously such studies will have to take into consideration other relevant

factors such as the type and genetic constitution of the pathogen and environmental

influences.

The author also believes that some of the rare primary immunodeficiencies seen

today will be associated not only with strong mutations in individual genes, but also with

a combination of two or more hits, which in isolation are not considered pathogenic, in

genes of the same or complementary signaling pathways. The author’s laboratory is

making efforts on that direction by linking every mutation found by whole exome

sequencing to correlational databases that classify genes by their function/pathway, and

looking for intersections between patients with similar clinical phenotype.

Concluding remarks

156

Despite the fast pace of these basic discoveries, novel therapies for PIDs are not

being developed as expected. Immunoglobulin production defects are still being treated

essentially as suggested by Col. Ogden Bruton almost 60 years ago, and the use of

antibiotics and hematopoietic stem cell transplant still constitute the cornerstone

treatment of most severe PIDs7, 8. Promising areas, such as gene therapy, have been

plagued by serious side effects and will need substantial work before becoming routine

practice in the future9. Likewise, the use of targeted biologicals, common practice in

rheumatic disorders, has not made its way into the treatment of PIDs, with the exception

of the autoinflammatory syndromes. Attempts such as the use of recombinant CD40L for

patients with Hyper IgM syndrome have thus far failed. For these reasons, passed this

exciting phase of gene discovery, the community should change focus and employ its

best efforts on the therapeutic arena. Early and precise diagnosis, coupled to effective

treatment, can undoubtedly save countless human lives.

References 1. Notarangelo LD, Fischer A, Geha RS, et al. Primary immunodeficiencies: 2009

update. J Allergy Clin Immunol;124:1161-1178. 2. Mardis ER. A decade's perspective on DNA sequencing technology. Nature.

2011;470:198-203. 3. Byun M, Abhyankar A, Lelarge V, et al. Whole-exome sequencing-based

discovery of STIM1 deficiency in a child with fatal classic Kaposi sarcoma. J Exp Med. 2010;207:2307-2312.

4. Bolze A, Byun M, McDonald D, et al. Whole-exome-sequencing-based discovery of human FADD deficiency. Am J Hum Genet. 2010;87:873-881.

5. Ng SB, Buckingham KJ, Lee C, et al. Exome sequencing identifies the cause of a mendelian disorder. Nat Genet. 2010;42:30-35.

6. Ng SB, Bigham AW, Buckingham KJ, et al. Exome sequencing identifies MLL2 mutations as a cause of Kabuki syndrome. Nat Genet. 2010;42:790-793.

7. Bruton OC. Agammaglobulinemia. Pediatrics. 1952;9:722-728. 8. Notarangelo LD. Primary immunodeficiencies. J Allergy Clin Immunol.

2010;125:S182-194. 9. Hacein-Bey-Abina S, Hauer J, Lim A, et al. Efficacy of gene therapy for X-linked

severe combined immunodeficiency. N Engl J Med. 2010;363:355-364.

Samenvatting

157

SAMENVATTING

Het menselijk immuunsysteem heeft de taak om ons te beschermen tegen

alomtegenwoordige, schadelijke microben zonder de gastheer overmatige schade te

berokkenen. Als deel van deze functie moet het afweersysteem pathogenen herkennen en

op de juiste wijze reageren, op een manier die afgestemd is op de te bestrijden

bedreiging, terwijl het tevens kruisreactiviteit met lichaamseigen moleculen vermijdt.

Een serie regulerende mechanismen zorgt ervoor dat de immuunrespons in gezonde

personen perfect werkt. Primaire immunodeficiëntie (PIDD) verwijst naar een groep

monogenetische aandoeningen met invloed op diverse onderdelen van het

immuunsysteem die leiden tot een grotere vatbaarheid voor infecties, hyperreactiviteit

van het immuunsysteem, auto-immuniteit of een combinatie daarvan. Ondanks de

zeldzame aard van deze aandoeningen kunnen ze ons waardevolle lessen leren over de

menselijke immunologie in natuurlijke, genetisch diverse populaties, die soms scherp

contrasteren met bevindingen in experimentele diermodellen. De bestudering van

diagnostische, genetische of mechanistische aspecten van primaire immunodeficiënties

bij de mens, specifiek op het gebied van bepaalde defecten van celdood, is het

overkoepelende thema van dit proefschrift..

Hoofdstuk 1 is een algemene inleiding tot deze dissertatie. In de eerste helft van

het hoofdstuk wordt een overzicht gegeven van de processen die apoptose (gereguleerde

celdood) van lymfocyten mediëren, gevolgd door een bespreking van de erfelijke

aandoeningen van apoptose bij de mens, waaronder het auto-immuun lymfoproliferatief

syndroom (ALPS).

Hoofdstuk 2 geeft de huidige classificatie en diagnostische criteria van het meest

bestudeerde defect van apoptose bij de mens: ALPS. Dit zogenaamde

consensusdocument is ontstaan naar aanleiding van een internationale ALPS-bijeenkomst

die in 2009 door de NIH is gehouden en door experts van overal ter wereld is

bijgewoond. Uitvoerige modificaties van classificatieschema en -criteria komen aan de

orde, samen met suggesties van flowcytometrie- en apoptoseprotocollen die voor de

klinische diagnose van ALPS worden gebruikt.

Samenvatting

158

Hoofdstuk 3 beschrijft de ontdekking dat een mutatie in NRAS een ALPS-achtig

syndroom kan veroorzaken. De heterozygote somatische Gly13Asp-activerende mutatie

van het NRAS-oncogen verstoort de Fas-gemedieerde apoptose niet. Echter, de

versterking van de RAF/MEK/ERK-signalering vergroot verlaagt zowel het

proapoptotische eiwit BIM aanzienlijk als ook de intrinsieke, niet-receptorgemedieerde

mitochondriale apoptose. In vitro gebruik van farnesyltransferaseremmers of ERK-

remmers kan het apoptotische defect corrigeeren, wat mogelijkheden suggereert voor

therapeutische doeleinden.

Hoofdstuk 4 presenteert de bevindingen dat ook somatische mutaties in KRAS

een ALPS-achtige aandoening in mensen kunnen veroorzaken. Activerende KRAS-

mutaties verstoren geïnduceerde apoptose van T-cellen door de suppressie van het

proapoptotische eiwit BIM. Daarnaast wordt proliferatie bevorderd via downregulatie van

p27kip1. Deze defecten zouden in vitro kunnen worden gecorrigeerd door remming van

MEK1 of PI3K. Gesuggereerd wordt de term RAS-geassocieerde auto-immune

leukoproliferatieve aandoening (RALD) te gebruiken, om deze aandoening van ALPS te

onderscheiden.

Hoofdstuk 5 beschrijft de ontdekking dat biomarkers de aanwezigheid van Fas-

mutaties in patiënten met symptomen van ALPS kunnen helpen voorspellen. De

combinatie van CD3+CD4-CD8-TCR-alfa/bèta+ (αβ-DNT)-celtellingen, sFasL en

vitamine B12 of IL10 plasmaspiegels is in hoge mate gekoppeld aan de aan- of

afwezigheid van een Fas-mutatie. De beschreven biomarkers moeten helpen bij de

selectie van patiënten met tekenen van ALPS voor nader diagnostisch onderzoek.

Bovendien dient de aanwezigheid van een combinatie van markers die in hoge mate duidt

op een Fas-mutatie in de context van een negatieve genetische test ertoe te leiden dat er

naar somatische mutaties in gesorteerde αβ-DNT-cellen wordt gezocht.

Hoofdstuk 6 presenteert mechanistische werk dat aantoont dat één vorm van

celdood, geïnduceerd door de reactivering van T-cellen, gemedieerd kan worden via twee

niet-gerelateerde apoptotische routes. Bij herstimulatie van TCR wordt een duidelijke

toename waargenomen in de expressie van BIM, een proapoptotisch Bcl-2-eiwit waarvan

bekend is dat het apoptose van lymfocyten medieert. De uitschakeling van BIM-expressie

redt normale T-cellen een evenals als Fas-disruptie van TCR geïnduceerde dood. De

Samenvatting

159

gegevens wijzen dus op BIM als kritieke mediator van apoptose die zowel door

herstimulatie als de onttrekking van groeicytokinen geïnduceerd wordt.

Hoofdstuk 7 beschrijft de mechanistische onderzoeken die aantonen dat haplo-

insufficiëntie een veelvoorkomend ziektemechanisme is bij ALPS-patiënten met Fas-

mutaties met invloed op extracellulaire domeinen. Het is aangetoond dat de meeste Fas-

mutaties in het extracellulaire gebied lage Fas-expressie geven vanwege nonsense-

gemedieerd RNA-verval of eiwit-instabiliteit, wat geleid heeft tot een defecte DISC-

vorming en verstoorde apoptose. Het apoptosedefect kan gecorrigeerd worden door een

overexpressie van Fas in vitro. Deze bevindingen hebben haplo-insufficiëntie

gedefinieerd als alternatief voor dominante negatieve interferentie als ziektemechanisme

bij ALPS-patiënten.

Tot slot bespreekt de schrijver in het laatse hoofdstuk in het kort zijn visie op de

toekomstige ontwikkelingen op dit gebied.

List of publications

160

LIST OF PUBLICATIONS

Original Articles KUEHN HS, CAMINHA I, NIEMELA JE, RAO VK, DAVIS J, FLEISHER TA, OLIVEIRA JB. FAS haploinsufficiency is a common disease mechanism in the human autoimmune lymphoproliferative syndrome. The Journal of Immunology. In press.

NIEMELA JE, LU L, FLEISHER TA, DAVIS J, CAMINHA I, NATTER M, BEER LA, DOWDELL KC, PITTALUGA S, RAFFELD M, RAO VK, OLIVEIRA JB. Somatic KRAS mutations associated with a human non-malignant syndrome of autoimmunity and abnormal leukocyte homeostasis. Blood. 2011;7:2883-6

BURBELO PD, BROWNE SK, SAMPAIO EP, GIACCONE G, ZAMAN R, KRISTOSTURYAN E, RAJAN A, DING L, CHING KH, BERMAN A, OLIVEIRA JB, HSU AP, KLIMAVICZ CM, IADAROLA MJ, HOLLAND SM. Anti-cytokine autoantibodies are associated with opportunistic infection in patients with thymic neoplasia. Blood. 2010;116:4848-58.

OLIVEIRA JB, BLEESING JJ, DIANZANI U, FLEISHER TA, JAFFE ES, LENARDO MJ, RIEUX-LAUCAT F, SIEGEL RM, SU HC, TEACHEY DT, RAO VK. Revised diagnostic criteria and classification for the autoimmune lymphoproliferative syndrome (ALPS): report from the 2009 NIH International Workshop. Blood. 2010;116:e35-40.

DOWDELL KC, NIEMELA JE, PRICE S, DAVIS J, HORNUNG RL, OLIVEIRA JB, PUCK JM, JAFFE ES, PITTALUGA S, COHEN JI, FLEISHER TA, RAO VK. Somatic FAS mutations are common in patients with genetically undefined autoimmune lymphoproliferative syndrome. Blood. 2010;115:5164-9.

LENARDO MJ, OLIVEIRA JB, ZHENG L, RAO VK. ALPS-ten lessons from an international workshop on a genetic disease of apoptosis. Immunity. 2010;32(3):291-5.

CAMINHA I, FLEISHER TA, HORNUNG RL, DALE JK, NIEMELA JE, PRICE S, DAVIS J, PERKINS K, DOWDELL KC, BROWN MR, RAO VK, OLIVEIRA JB. Using biomarkers to predict the presence of FAS mutations in patients with features of the autoimmune lymphoproliferative syndrome (ALPS). Journal of Allergy and Clinical Immunology. 2010;125:946-949.e6.

SANTOS AR, WAKIM V, JACOB CM, PASTORINO A, CUNHA JM, COLLANIERI AC, NIEMELA JE, GRUMACH AS, DUARTE AJS, MORAES-VASCONCELOS D, OLIVEIRA JB. Molecular Characterization of Patients with X-linked Hyper-IgM Syndrome: Description of Two Novel CD40L Mutations. Scandinavian Journal of Immunology. 2009;69:169-73.


161

JESUS AA, SILVA CA, SEGUNDO,GR, AKSENTIJEVICH I, FUJIHIRA E, WATANABE M, CARNEIRO-SAMPAIO M, DUARTE AJS, OLIVEIRA JB. Phenotype-Genotype Analysis of Cryopyrin-Associated Periodic Syndromes (CAPS): Description of a Rare Non-Exon 3 and a Novel CIAS1 Missense Mutation. Journal of Clinical Immunology. 2008;28:134-138.

JESUS AA,* OLIVEIRA JB,* # AKSENTIJEVICH I, FUJIHIRA E, CARNEIRO-SAMPAIO MM, DUARTE AJS, SILVA CAA#. TNF receptor-associated periodic syndrome (TRAPS): Description of a novel TNFRSF1A mutation and response to etanercept. European Journal of Pediatrics. 2008;167:1421-1425. *co-first authors; #Corresponding authors.

UZEL G, TNG E, ROSENZWEIG SD, HSU AP, SHAW JM, HORWITZ ME, LINTN GF, ANDERSON SM, KIRBY MR, OLIVEIRA JB, BROWN MR, FLEISHER TA, LAW SKA, HOLLAND SM. Reversion mutations in patients with leukocyte adhesion deficiency type-1 (LAD-1). Blood. 2008;111:209-18.

SNOW AL,* OLIVEIRA JB,* # ZHENG L, DALE D, STRAUS SE, FLEISHER TA, LENARDO MJ. Critical role of BIM in T cell receptor restimulation-induced death. Biology Direct. 2008;3:34-44. *co-first authors; #Corresponding author.

OLIVEIRA JB, BIDERE N, NIEMELA JE, ZHENG L, SAKAI K, NIX CP, DANNER RL, BARB J, MUNSON PJ, PUCK JM, DALE J, STRAUS SE, FLEISHER TA, LENARDO MJ. NRAS mutation causes a human autoimmune lymphoproliferative syndrome. Proceedings of the National Academy of Sciences. 2007:104:8953-8958.

Invited Reviews (Peer-reviewed)

JESUS AA, OLIVEIRA JB, HILÁRIO MO, TERRERI MT, FUJIHIRA E, WATASE M, CARNEIRO-SAMPAIO M, SILVA CA. Pediatric hereditary autoinflammatory syndromes. J Pediatr (Rio J). 2010;86:353-66.

OLIVEIRA JB, FLEISHER TA. Molecular- and flow cytometry-based diagnosis of primary immunodeficiency disorders. Current Allergy Asthma Reports. 2010;10:460-7.

OLIVEIRA JB, FLEISHER TA. Laboratory evaluation of primary immunodeficiencies. Journal of Allergy and Clinical Immunology. 2010;125:S297-305.

FLEISHER TA, OLIVEIRA JB. Functional flow cytometry testing: an emerging approach for the evaluation of genetic disease. Clin Chem. 2009;55:389-90.

CARNEIRO-SAMPAIO M, LIPHAUS BL, JESUS AA, SILVA CAA, OLIVEIRA JB, KISS, MH. Understanding Systemic Lupus Erythematosus Physiopathology in the Light of Primary Immunodeficiencies. Journal of Clinical Immunology. 2008;28:34-41.


162

OLIVEIRA JB, GUPTA S. Disorders of Apoptosis: Mechanisms for Autoimmunity in Primary Immunodeficiency Diseases. Journal of Clinical Immunology. 2008;28:20-28.

JESUS AA, DUARTE AJS, OLIVEIRA JB. Autoimmunity in Hyper-IgM Syndrome. Journal of Clinical Immunology. 2008;28:62-66.

OLIVEIRA JB, NOTARANGELO LD, FLEISHER TA . Applications of flow cytometry for the study of primary immune deficiencies. Current Opinion in Allergy and Clinical Immunology. 2008;8:499-509.

SUZUMURA EA, OLIVEIRA JB, BUEHLER AM, CARBALLO M, BERWANGER O. How to critically assess intensive care cohort studies? Revista Brasileira de Terapia Intensiva. 2008;20:93-98. (not indexed in PubMed)

BERWANGER O, SUZUMURA EA, BUEHLER AM, OLIVEIRA JB. How to critically assess systematic reviews and meta-analyses? Revista Brasileira de Terapia Intensiva. 2008;19:475-480. (not indexed in PubMed)

Book Chapters

FLEISHER TA, OLIVEIRA JB, TORGERSON, T. Congenital Immune Dysregulation Disorders. In press

OLIVEIRA JB. Hereditary Periodic Fever Syndromes. In: Alergia e Imunologia na Infância e Adolescência, 2nd edition. Grumach, AS, editor. São Paulo: Atheneu, 2009, pp. 683-694.

OLIVEIRA JB, FLEISHER TA. Genetic Disturbances of Apoptosis. In: Alergia e Imunologia na Infância e Adolescência, 2nd edition. Grumach, AS, editor. São Paulo: Atheneu, 2009, pp. 695-703

OLIVEIRA JB, DANTAS AT, LUCENA V. Systemic Lupus Erythematosus. In: Condutas em Clínica Médica, 4rd ed. Filgueira NA et al, editors. Rio de Janeiro, Editora Médici, 2007. pp.346-364.

SU H, OLIVEIRA JB, LENARDO MJ. Programmed cell death in lymphocytes. In: Clinical Immunology: Principles and Practice, 3rd edition. Rich RR, Fleisher TA, Shearer WT, Schroeder HW, Frew AJ, Weyand CM, editors. Philadelphia, Mosby Elsevier, 2008, pp. 225-234

FLEISHER TA, OLIVEIRA JB. Flow cytometry. In: Clinical Immunology: Principles and Practice, 3rd edition. Rich RR, Fleisher TA, Shearer WT, Schroeder HW, Frew AJ, Weyand CM, editors. Philadelphia, Mosby Elsevier, 2008, pp. 1435-1446

OLIVEIRA JB, STETLER-STEVENSON M, BROWN M, FLEISHER TA. Flow cytometry. In: Clinical Hematology, Young NS, Gerson SL, High KA, editors.


163

Philadelphia: Mosby Elsevier, 2006, pp.

Ackowledgements/Agradecimentos

164

ACKNOWLEDGMENTS/AGRADECIMENTOS To Dr. Fleisher, which opened the doors of his laboratory to me twice, initially as a fellow and again as staff clinician. His support, encouragement, positive criticism and friendship made this whole work possible. Tom, I could never thank you enough. To Michael Lenardo, for having received me in his laboratory as a post-doc, where I could be exposed to science with high technical and ethical standards, done by people with a smile on their faces. To my friends Nicolas Bidere, Lixin Zheng, Keiko Sakai and Andy Snow, for being so patient during my training in diverse bench techniques. To the Flow Cytometry laboratory, specially Maggie Brown, Shakuntala Gurprasad, Jackie Cleary and Jennifer Stoddard, for teaching me so much flow and feeding me with cookies and cakes. To the NIH ALPS group, specially Koneti Rao, Joie Davis and Susan Price, for the long and continuing collaboration over these years. MINHA FAMÍLIA: Christianine, você foi a pedra fundamental desse trabalho. Sem você nada teria acontecido, e eu sequer teria exisitido como pesquisador. Obrigado por todo o amor, sacrifício e paciência. Te amo. Agradeço aos meus filhinhos Filipe e Davi, simplesmente por existirem e me trazerem tanta alegria, encherem os meus dias de significado. Mamãe, obrigado por enfrentar a distância dos seus netos e de nós, e assim mesmo me dar apoio. Lembro de você em todos os momentos da minha vida. Pai, obrigado pela força, mesmo sem ter a minima idéia do que estou fazendo nos EUA. Janinne, Janilton e Jarbinhas (por ordem de senioridade!), mesmo à distancia o seu amor e torcida me mantiveram indo em frente. Obrigado por me apoiarem integralmente.

understanding human immunology through the study of primary

Documents