R

Uci

CMa

Tb

a

ARRAA

KBFPRSS

1

ritStlctIpf

t

1h

Biochemical Engineering Journal 81 (2013) 47– 53

Contents lists available at ScienceDirect

Biochemical Engineering Journal

jou rna l h om epage: www.elsev ier .com/ locate /be j

egular Article

p-regulated spinosad pathway coupling with the increasedoncentration of acetyl-CoA and malonyl-CoA contributed to thencrease of spinosad in the presence of exogenous fatty acid

haoyou Xuea,1, Xiangmei Zhanga,1, Zhirui Yub, Fanglong Zhaoa,eiling Wanga, Wenyu Lua,∗

Department of Biological Engineering and Key Laboratory of Systems Bioengineering of the Ministry of Education, School of Chemical Engineering andechnology, Tianjin University, Tianjin 300072, ChinaIndustrial Products Safety Center of Tianjin Entry-Exit Inspection and Quarantine Bureau, China

r t i c l e i n f o

rticle history:eceived 2 June 2013eceived in revised form 20 August 2013ccepted 5 October 2013vailable online 14 October 2013

eywords:iosynthesisermentation

a b s t r a c t

Polyketides are important compounds with a staggering range of biological and medicinal activities. Pre-vious studies have demonstrated that the addition of fatty acids can increase polyketides production.However, a detailed metabolic explanation of this phenomenon has not been established. The aim of thisstudy was to explain the positive effect of exogenous fatty acids on polyketides production. Spinosyns arepolyketide-derived macrolides. In our study, spinosyns were used, as an example, to study the positiveeffect of exogenous fatty acids on their production. In the presence of exogenous fatty acids, gene expres-sion assays indicated that the transcription of de novo fatty acid biosynthesis was significantly decreasedand the transcriptions of �-oxidation and spinosad biosynthesis were up-regulated. The decreased de

hysiologyNApinosadaccharopolyspora spinosa

novo fatty acid synthesis transcription and the increased �-oxidation transcription resulted in the increaseof acetyl-CoA and malonyl-CoA. It is the up-regulated spinosad pathway coupling with the enhanced con-centration of acetyl-CoA and malonyl-CoA that contributed to the increase of spinosad. Taken together,a metabolic link among de novo fatty acid synthesis, �-oxidation, and spinosad biosynthesis at the pres-ence of exogenous fatty acids was established. The results presented here enable researchers to betterunderstand why added fatty acids can increase polyketides production.

. Introduction

Polyketides are a remarkable group of structurally diverse natu-al compounds with a staggering range of biological and medicinalmportant activities including antibiotic, antifungal, anticholes-erol, antiparasitic, anticancer, and immunosuppressive properties.ince their discovery, polyketides have been studied as attractiveargets because of their extraordinary pharmacological, and bio-ogical properties [1]. Polyketides are synthesized from repetitiveondensation reactions by multifunctional enzymes called polyke-ide synthases (PKSs). PKSs can be divided into three groups, type

PKSs, type II PKSs and type III PKSs. Although the structures ofolyketides are extraordinary diversity, they can be synthesizedrom a relatively small subset of common building blocks such as

Abbreviations: DCW, cell dry weight; PKSs, polyketide synthases; qPCR, reverseranscription quantitative PCR.∗ Corresponding author. Tel.: +86 22 27892132; fax: +86 22 27400973.

E-mail addresses: wenyulu@tju.edu.cn, luwenyu1973@hotmail.com (W. Lu).1 These authors contributed equally to this work.

369-703X/$ – see front matter © 2013 Elsevier B.V. All rights reserved.ttp://dx.doi.org/10.1016/j.bej.2013.10.004

© 2013 Elsevier B.V. All rights reserved.

acetyl-CoA, propionyl-CoA, malonyl-CoA and methylmalonyl-CoA[2].

Many studies have shown that the addition of fatty acids canincrease polyketides production [3–5]. These studies indicate thatit is the increased concentration of acetyl-CoA, butyryl-CoA orpropionyl-CoA that contributed to the enhancement of polyketides.The �-oxidation of the exogenous fatty acids contributed to theincreased concentration of these common building blocks [6]. How-ever, they have overlooked the influence of the exogenous fattyacids on de novo fatty acid synthesis. De novo fatty acid synthesisneed to be considered because of two reasons: the intermediatesof exogenous fatty acids can be directly used in the synthesis ofcell lipids [7,8]; de novo fatty acid synthesis and PKS systems sharethe same precursors [9,10]. So, a metabolic explanation from theperspective of �-oxidation, de novo fatty acid synthesis and PKSsystems is needed to better understand why the addition of fattyacids can influence polyketides production.

Previous studies chose to add long chain fatty acids (C16–C18)at the beginning of the fermentation process [11,12]. However,polyketides are secondary metabolites who are mainly synthesizedin the middle-to-late stages of fermentation [13]. If fatty acids are

4 nginee

atatitt

dira[bbCs[pdtfd

ctapibctarto

2

2

−osit1iti16dfi

2

aAdpwT

Tseven target genes were normalized to two reference genes, 16SrRNA and rbL13. 16S rRNA and rbL13 were suitable reference genesin this study, which has been determined in another study. The data

Table 1List of primers used in this study.

Primers Sequence 5′ → 3′

fabI-F ATCATCGAACCGGTGGTCTTGfabI-R CTGGGCTGGGACGTCAACfadG-F ATCTTCGACCACACCGAAACCfadG-R GTGGAATTCGGCCATCAGCAGfadA-F TCGGCCTCTTCGAGATCAACfadA-R CGATGCACATGGTCGTGATGfadB1-F CGACTTCGACAATGCCTCfadB1-R ACGCCTGAATCATGTTTGfadE-F GGCTCCAGGTCGACTTTTCCfadE-R AACTGCTGGTTACGGTCGAGSpnA-F ATCGGTCCTTCCGGGATTTTCSpnA-R GCTGGACGAACCGGTACATCTCSpnG-F GGGCACTTCTCACCGACCTACSpnG-R ACGCAGGTACGCAGGAACAG

8 C. Xue et al. / Biochemical E

dded at the beginning of the fermentation process the majority ofhe fatty acids are involved in the primary metabolism [6]. Therere just minor added fatty acids are left when polyketides begino synthesis. How the residual and minor added fatty acids signif-cantly influence polyketides biosynthesis? So, the examination ofhe addition time of fatty acids is important to better understandhe positive effect of added fatty acids on polyketides production.

Spinosyns are polyketide-derived macrolides which are pro-uced by Saccharopolyspora spinosa [14]. One molecule spinosyns

s composed of a 21-carbon tetracyclic lactone, a tri-O-methylatedhamnose, and a forosamine. Spinosad, a mixture of spinosyns And D, is the two major components in S. spinosa fermentation15]. Spinosad is an environmentally friendly pesticide and has aroad-spectrum insecticidal activity [16–18]. In 1999, spinosad-ased insect control pesticide was awarded the Presidential Greenhemistry Challenge Award because of its low risk to non-targetpecies, low environmental impact, and low mammalian toxicity19]. In the past few years, details of the spinosad biosynthesisathway and the genome information of S. spinosa have been eluci-ated by various studies [20,21]. These results make the study abouthe positive effect of exogenous fatty acids on spinosad productionrom the perspective of gene expression assays and intermediatesetermination possible.

The goal of this study was to explain why exogenous fatty acidsan increase the yield of spinosad. Specifically, we studied the addi-ion time of fatty acids (a mixture of linoleic and oleic) and theddition dose of fatty acids. Linoleic and oleic were chosen based onrevious studies. After that, the changes in the expressions of genes

nvolved in de novo fatty acid synthesis, �-oxidation and spinosadiosynthesis were analyzed after fatty acids were added. Then theoncentration of acetyl-CoA and malonyl-CoA between the con-rol group and the experimental group was determined. Finally,

potential metabolic explanation was established based on theseesults. The group without fatty acids addition was set as the con-rol group and the experimental group was added the suitable dosef fatty acids at the suitable time.

. Materials and methods

.1. Bacterial strains and culture conditions

S. spinosa strain LU104 was stored as a glycerol freezer stock at80 ◦C [22]. The spores of S. spinosa LU104 were maintained at 30 ◦Cn ABB13 agar plates containing (per liter) 5 g soytone, 5 g solubletarch, 3 g CaCO3, 2.1 g MOPS, 20 g agar. 25 �l sprore (109/ml) wasnoculated into 30 ml seed medium containing (per liter) 30 g tryp-icase soy broth, 3 g yeast extract, 3 g beef extract, 2 g MgSO4·7H2O,0 g glucose, 2.5 g corn steep liquor, pH 7.2. The seed medium was

ncubated at 30 ◦C for 72 h with constant shaking at 220 rpm, andhen 3 ml was inoculated into 30 ml growth culture (WHC) contain-ng (per liter) 40 g glucose, 10 g beef extract, 1 g MgSO4, 2 g NaCl,5 g soytone, 30 g soluble starch, 2.4 g CaCO3, 0.34 g yeast powder,.34 g peptone, with or without a mixture of linoleic and oleic, asescribed. The ratio of linoleic and oleic in the mixture was 1:2. Thenal pH of WHC was adjusted to 7.2 with 1 M NaOH.

.2. Extraction of intracellular acetyl-CoA and malonyl-CoA

Intracellular acetyl-CoA and malonyl-CoA were extractedccording to the method described with some modifications [23].n aliquot of 1 ml cell culture was collected, chilled on ice imme-

iately, and centrifuged at 10,000 rpm, 4 ◦C for 10 min. Then cellellets were immediately ground to powder in a porcelain mortar,hich was pre-cooled to −80 ◦C, under liquid nitrogen protection.

he frozen powder was stored in liquid nitrogen until used for

ring Journal 81 (2013) 47– 53

analysis. Prior to use, 0.2 g frozen powder was weighed into 1 mlice-cold 10% trichloroacetic acid (TCA) and mixed for 30 s. Precipi-tants were removed by centrifugation at 10,000 rpm, 4 ◦C for 10 minand then supernatants, which were filtered with a 0.45 �m syringefilter, were analyzed by HPLC. Standard acetyl-CoA and malonyl-CoA were purchased from Sigma–Aldrich.

2.3. RNA extraction and cDNA synthesis

For transcriptional studies, 5 ml samples taken at 120, 144, 168,192, 216 and 240 h were mixed with 2 ml RNA protect reagent(Tiange, China) to preserve RNA integrity. Then they were storedin liquid nitrogen. RNA was extracted using the RNeasy minikit(Tiangen, China). The integrity of RNA was confirmed by gel elec-trophoresis and the ratio of A260–A280. The synthesis of cDNAfor reverse transcription-quantitative PCR analysis (RT-qPCR) wascarried out using Maxima H Minus First Strand cDNA Synthe-sis Kit (Fermentas, USA) in a total volume of 20 �l containing4 �l of 5 × RT buffer, 0.25 �l random hexamer primer, 1 �l 10 mMdNTP Mix, 2 �l total RNA and 1 �l reverse transcriptase. Nega-tive reactions were performed using the same mixture withoutthe reverse transcriptase. The reactions were performed as fol-lows: incubate for 10 min at 25 ◦C followed by 15 min at 50 ◦C andthen reactions were terminated by heating at 85 ◦C for 5 min. Thereverse transcription reaction products were stored at −80 ◦C untilused.

2.4. qPCR

The quantification of transcriptional gene expression was deter-mined by qPCR on the LightCycler 480. The primers used inqPCR were designed using Primer3 and are listed in Table 1 [24].Triplicate qPCRs were performed on LightCycler 480 using SuperPreMix Plus (SYBR Green) kit (Tiangen, China). The reaction vol-ume was 20 �l containing 10 �l 2× SuperReal PreMix Plus, 0.6 �leach primer, 1 �l cDNA and 7.8 �l RNase-free ddH2O. QuantitativePCR cycle parameters were as follows: initial denaturation at 95 ◦Cfor 15 min, followed by 40 cycles of 10 s denaturation at 95 ◦C and20 s annealing and extension at 60 ◦C. Fluorescence measurementswere taken between each cycle. Negative controls were analyzed tocheck the residual contaminating genomic DNA. C values of these

16S rRNA-F CCTACGAGCTCTTTACGCCC16S rRNA-R AGAAGCACCGGCTAACTACGrbL13-F GGCGTAGACCTTGAGCTTCrbL13-R GCTCGAAAAGGCGATCAAG

ginee

o

w

2

cptdauaBAttm

2

a

FSsw

C. Xue et al. / Biochemical En

btained were analyzed by applying the 2−��CT method.

−��CT = (CT (trager gene) − CT (reference gene))test

− (CT (traget gene) − CT (reference gene))calibrator

here CT is the threshold cycle number [25].

.5. HPCL analysis of acetyl-CoA and malonyl-CoA

According to a recently reported method with some modifi-ations [26], HPLC analysis of acetyl-CoA and malonyl-CoA waserformed with a 250 mm × 4.6 mm ODS-BP column at 254 nm. Thewo mobile-phase solvents used were buffer A (0.1 M sodium dihy-rogen phosphate and 3% acetonitrile) and buffer B (40% Buffer And 60% methanol). 20 �l samples were injected into the HPLC col-mn using buffer A and buffer B with a flow rate of 1.0 ml/min. Thenalytes were eluted with a gradient of 90% buffer A (10% buffer) for the first 15 min, to 50% buffer A (50% buffer B) in 20 min.fter 20 min buffer A was returned to the original 90% and main-

ained for 10 min to fully purge the column. Standards were givenhe same treatment and used to find the following retention time:

alonyl-CoA, 19.37 min; acetyl-CoA, 6.72 min.

.6. Analysis of spinosad biosynthesis of fermentation cultures

Spinosad in fermentation broth was extracted and determineds described [27]. Briefly, samples were extracted with 4× volume

ig. 1. Effect of the fatty acid addition time of concentration on spinosad production. (pinosad production when different concentrations of fatty acid were added at 96 h; (C) Fquare: dry cell weight of experimental group; gray circle: spinosad production of controas media without oil. The group that 15 g/L fatty acid was added at 96 h was experimen

ring Journal 81 (2013) 47– 53 49

of acetonitrile. Then they were stood at a room temperature forat least 1 h. Finally, they were filtered through a 0.45 �m micron-membrane for HPCL (250 mm × 4.6 mm C18 reverse-phase column)analysis at 254 nm. 20 �l samples were injected into the HPLC col-umn using buffer A (40% methanol, 55% acetonitrile, 5% 80 mMammonium formate) with a flow rate of 1.0 ml/min. Standard devi-ations were calculated from triplicate flasks.

2.7. Statistical analysis

Statistical analyses were performed using Microsoft Excel(2003). All experiments were repeated three times. The data shownin the corresponding tables and figures of the Results and Discus-sion section were the mean values of the three experiments, and itwas indicated that the relative standard deviations were all within±10%.

3. Results

3.1. Effect of fatty acids addition time and concentration onspinosad production and cell growth

First, fatty acids addition time was studied. 10 g/L fatty acids,

which was a mixture of linoleic and oleic, was added to the mediaat 0, 24, 48, 72, 96, 120, 144 and 168 h during spinosad fermen-tation to study the effect of their addition time on the spinosadproduction. As shown in Fig. 1A, the yield of spinosad was enhanced

A) Spinosad production when 10 g/L fatty acid was added at different times; (B)ermentation curve of S. spinosa; gray square: dry cell weight of control group; darkl group; dark circle: spinosad production of experimental group. The control grouptal group.

5 nginee

bTaTfoft

c1tscbits3iib

rt

Ft(bac

0 C. Xue et al. / Biochemical E

y the addition of fatty acids during the whole experiemtal time.he spinosad production reached the highest when fatty acids wasdded at 96 h, the middle-to-late stages of fermentation (Fig. 1A).his time point was the beginning of stationary-phase of S. spinosaermentation. The highest spinosad yield (281 mg/L) was 1.43 foldf that in the control group. Spinosad production in the group thatatty acids were added at 96 h was 1.18 fold of that in the grouphat fatty acidswere added at 0 h.

Previous studies have shown that fatty acids concentrationan influence polyketides biosynthesis [6]. We added 5 g/L, 10 g/L,5 g/L, 20 g/L, 25 g/L, and 30 g/L fatty acids to the media at 96 ho find a suitable concentration of fatty acids. The results werehown in Fig. 1B. The increase of spinosad production was highlyorrelated with the increase of fatty acids concentration at first,ut the concentration of fatty acids higher than 30 g/L had some

nhibition on spinosad production (Fig. 1B). As shown in Fig. 1B,he optimal addition amout was 15 g/L, which resulted in a 63%pinosad enhancement. And the final yield of spinosad reached21 mg/L. As shown in Fig. 1C, the cell dry weight was slightly

ncreased when 15 g/L fatty acids was added at 96 h. So thencrease of spinosad was not resulted from the increased cell num-

er.

The optimal fatty acids addition condition in this currentesearch was as follows: 15 g/L fatty acids were added at 96 h. Inhe following experiments, this addition condition was applied to

ig. 2. Relative gene expression ratios and concentration of acetyl-CoA and malonyl-CoA.wo de novo fatty acid genes (fabG and fabI) at 120, 144, 168, 192, 216 and 240 h; (B) RelatifadD, fadB1 and fadE) at 120, 144, 168, 192, 216 and 240 h; (C) Relative expression ratiiosynthesis genes (SpnA, SpnK, SpnO and gtt) at 120, 144, 168, 192, 216 and 240 h; (D) Cnd experimental group: (1) concentration of aceltyl-CoA in control group (white) and

ontrol group and experimental group (black).

ring Journal 81 (2013) 47– 53

investigate the positive effect of exogenous fatty acids on spinosadproduction.

3.2. Gene expression assays of de novo fatty acid synthesis,ˇ-oxidation and spinosad production

The expression of selected genes involved in de novo fattyacid synthesis (fabI and fabG), �-oxidation (fadD, fadB1 and fadE)and spinosad biosynthesis (SpnA, SpnG, SpnO and gtt) was mon-itored using quantitative reverse transcriptase PCR (RT-qPCR) to(I) look for evidence of the addition of fatty acids can decreasede novo fatty acid biosynthesis, (II) investigate how fatty acidsaddition increase spinosad production, (III) establish a metabolicexplanation from the perspective of de novo fatty acid synthesis,�-oxidation and spinosad biosynthesis. SpnA, SpnK, SpnO and gttinvolved in spinosad biosynthesis pathway were selected as targetgenes because these four genes are rate limited [22]. The expres-sion patterns of all these target genes were compared by 2−��CT

method.Two genes involved in de novo fatty acid synthesis (fabI and

fabG) were studied. As shown in Fig. 2A, the transcript levels of both

fabI and fabG in the experimental group were significantly down-regulated in comparison to the control group. Both the transcriptlevels of these two genes in the experimental group were just lessthan 0.02 fold of that in the control group.

(A) Relative expression ratios, experimental group/control group/control group, ofve expression ratios, experimental group/control group, of three �-oxidation genesos, experimental group/control group/control group, of four rate limited spinosadomparison of intracellular acetyl-CoA and malonyl-CoA levels in the control groupexperimental group (light gray); (2) concentration of malonyl-CoA (dark gray) in

ginee

atgilg

lsls

3

afataosaoosa2tl1tctg0DtDt10mlficf

4

tttOiasbat

i

C. Xue et al. / Biochemical En

In contrast, transcript levels of �-oxidation genes fadD, fadB1nd fadE were up-regulated in the experimental group (Fig. 2B). Theranscript levels of fadD, fadB1 and fadE at 120 h in the experimentalroup were more than 3 fold of that in the control group. Then theyncreased to more than 100 fold at 168 h and 192 h. The transcriptevels of fadD, fadB1 and fadE at 216 h and 240 h in the experimentalroup were almost the same as in the control group.

For the spinosad biosynthesis genes, we studied the transcriptevels of four rate limited genes (SpnA, SpnK, SpnO and gtt) inpinosad biosynthesis pathway. As shown in Fig. 2C, the transcriptevels of SpnA, SpnK, SpnO and gtt in the experimental group wereignificantly increased.

.3. Changes of acetyl-CoA and malonyl-CoA availability

Acetyl-CoA is an intermediate in glycolysis and is the immedi-te precursor of malonyl-CoA. Malonyl-CoA is the direct precursoror de novo fatty acid synthesis and spinosad biosynthesis. Besides,cetyl-CoA is the main products of �-oxidation. Cellular concen-ration of acetyl-CoA and malonyl-CoA must be influenced by theddition of fatty acids, which will in turn contribute to the changesf de novo fatty acid synthesis, �-oxidation and spinosad biosynthe-is. So we determined the intracellular acetyl-CoA and malonyl-CoAvailability using HPLC. The changes of intracellular concentrationsf acetyl-CoA and malonyl-CoA during the fermentation processf S. spinosa in WHC culture without and with fatty acids werehown in Fig. 2D. Clear differences between the experimental groupnd control group can be observed at 120 h, 144 h, 168 h, 192 h,16 h and 240 h. The concentration of malonyl-CoA in experimen-al group was always higher than that in control group. Acetyl-CoAevel in experimental group was higher than that in control group at20 h, 144 h, 168 h, 192 h and 216 h. While at the end of the fermen-ation process acetyl-CoA in these two groups was the same. In theontrol group, the concentration of acetyl-CoA was always main-ained around 0.101–0.726 nmol/mg DCW. For the experimentalroup, acetyl-CoA increased from 0.196 nmol/mg DCW at 120 h to.370 nmol/mg DCW at 168 h and then it fell to 0.099 nmol/mgCW at the end of the fermentation process. The concentra-

ion of malonyl-CoA was maintained ground 0.046–0.078 nmol/mgCW in the control group. While for the experimental group,

he concentration of malonyl-CoA increased rapidly from 120 h to68 h reached 0.387 nmol/mg DCW and then decreased to around.299 nmol/mg DCW at 192 h. After that, the concentration ofalonyl-CoA in the experimental group was maintained at this

evel in the rest of the fermentation process. During the wholeermentation process, the concentrations of acetyl-CoA in exper-mental group were 1.1–3.9 folds of that in the control group. Theoncentrations of malonyl-CoA in experimental group were 1.6–5.4olds of that in the control group.

. Discussion

Studies have suggested that it is the intermediate metabolites ofhe degradation of fatty acids through �-oxidation that contributedo the increase of polyketides [3,4,6]. These studies have overlookedhe influence of the added fatty acids on de novo fatty acid synthesis.ur study demonstrated that de novo fatty acid synthesis was very

mportant in understanding the positive effect of exogenous fattycids on polyketides production. In this study, we described a pos-ible physiological mechanism for this phenomenon in S. spinosay analyzing the gene expressions of �-oxidation, de novo fatty

cid biosynthesis and spinosad biosynthesis and by determininghe concentration of acetyl-CoA and malonyl-CoA.

Spinosad, like other polyketides, is a secondary metabolite thats mainly synthesized during the stationary-phase of fermentation

ring Journal 81 (2013) 47– 53 51

after the cessation of growth [28]. So it is not surprisingto speculate that fatty acids supplementation effect on theincrease of spinosad is time- and concentration-dependent. Theconcentration-dependent effect of exogenous fatty acids on polyke-tides production has been observed in some other systems such asStreptomyces fradiae [29] and Saccharopolyspora erythraea [12]. Mir-jalili et al. showed that the yield of erythromycin was improved themost when the initial concentration of fatty acids was 23 g/L [12].More recently, Mo et al. also pointed out that the concentrationof fatty acids plays an important role in the increase of polyke-tides [30]. Besides, these studies also indicated that a lower doseof fatty acids can improve the yield of polyketieds and an exces-sive dose inhibit or not affect polyketides production. Our resultwas consistent with their results (Fig. 1). In our study, spinosadproduction was concentration dependent and the suitable concen-tration of fatty acids was 15 g/L. However, these studies did notstudy fatty acids addition time in detail. We found that the yieldof spinosad was also time dependent. The suitable time to addfatty acids was at the beginning of stationary-phase of fermenta-tion. Spinosad production reached 281 mg/L when fatty acids wereadded at the beginning of stationary-phase of fermentation. Theyield of spinosad was just 238 mg/L when fatty acids were added atthe initial fermentation. Although Li et al. chose to add fatty acidsat 5th day of fermentation to improve the yield of monensin [3],they just gave a time point in their study. They did not explain whythis time point was chosen. The physiological state of cells at thistime point was also not pointed in their study.

Many studies have reached a common consensus that the pos-itive effect of exogenous fatty acids on polyketides productionwas because of the �-oxidation of fatty acids. For example, Junget al. demonstrated that the concentration of propionyl-CoA wasincreased because of the degradation of added fatty acids. And theincreased propionyl-CoA contributed to the increase of rapamycinproduction in Streptomyces hygroscopicus [31]. The monensin pro-duction was improved because of the increase of butyryl-CoAconcentration [3]. However, these studies have overlooked de novofatty acid synthesis. Our gene transcript results indicated that both�-oxidation and de novo fatty acid synthesis partly contributed theenhancement of polyketides precursors. RT-qPCR results of three�-oxidation genes (fadD, fadB1 and fadE) indicated the transcrip-tion of �-oxidation was significantly increased in fatty acid basedmedia (Fig. 2B). This result was consistent with previous studies.Our results also indicated that the transcription of de novo fattyacid synthesis (fabI and fabG) was significantly decreased after fattyacids were added. We think that the intermediates, which weremainly long carbon acyl-CoA (Fig. 3), of exogenous fatty acids weredirectly involved in de novo fatty acid synthesis. S. spinosa chosethe most efficient way to synthesize cell lipids when fatty acidswere added rather than chose de novo synthesis from acetyl-CoA.So S. spinosa did not completely degraded added fatty acids. S.spinosa chose to partially catabolize exogenous fatty acids into longchain intermediates for cell lipids biosynthesis. Besides, the tran-scription of de novo fatty acid synthesis was partly inhibited byacyl-CoA, which has been demonstrated in E. coli [32,33]. Helmutet al. demonstrated that fabI in E. coli was significantly inhibitedby palmitoyl-CoA [32]. Based on these results, we could concludethat two aspects contributed to the enhancement of acetyl-CoA andmalonyl-CoA in our study: (1) the degradation of exogenous fattyacids through �-oxidation generated acetyl-CoA; (2) the amount ofacetyl-CoA and malonyl-CoA used for de novo fatty acid biosynthe-sis was decreased.

RT-qPCR results of the four rate limited genes involved in

spinosad biosynthesis (SpnA, SpnK, SpnO and gtt) indicated that thetranscription of spinosad pathway was enhanced. Exogenous fattyacids had a large effect on expression levels of SpnA, SpnK, SpnOand gtt (Fig. 2C). These results suggested that the enhanced yield

52 C. Xue et al. / Biochemical Engineering Journal 81 (2013) 47– 53

F acidso ay lip

otsimasrt

5

miftwsiIetdCotucga

ig. 3. The proposed metabolic explanation of the positive effect of exogenous fattyf pathway lines when fatty acid was added. The decreased thickness of the pathwathway lines indicated that the pathway was increased.

f spinosad in the experimental group results, at least in part, fromhe gene up-regulation of spinosad pathway. The mechanism ofpinosad genes up-regulation may relate to the regulation systemn S. spinosa. A recent work showed a connection between the inter-

ediates of exogenous fatty acids and Pseudomonas aeruginosa PsrAutorepressor [34,35]. PsrA autorepressor is related to the expres-ion of rpoS, a RNA polymerase primary-like sigma factor. A similaregulation system may exist in S. spinosa, which is responsible forhe increase of the gene up-regulation of spinosad pathway.

. Conclusions

In summary, we used spinosyns, which are polyketide-derivedacrolides, as an example to explain why exogenous fatty acids can

ncrease the yield of spinosad. We found that the best time to addatty acids was at the beginning of stationary-phase of fermenta-ion, the middle-to-late stages of fermentation. This time point washen polyketides, like spinosad, begin to synthesize. The yield of

pinosad was increased by 63% and cell dry weight just was slightlyncreased when fatty acids were added at this time point (Fig. 1).n the presence of exogenous fatty acids, S. spinosa chose the mostfficient way to synthesize cell lipids rather than chose de novo syn-hesis from acetyl-CoA. Gene expression assays and intermediatesetermination indicated that the enhanced concentration of acetyl-oA and malonyl-CoA coming from two aspects: the transcriptionf de novo fatty acid synthesis was significantly decreased; theranscription of �-oxidation was significantly increased. The gene

p-regulated spinosad pathway coupling with the enhancementoncentration of acetyl-CoA and malonyl-CoA at the experimentalroup contributed to the increase of spinosad. Taking together,

metabolic potential link between de novo fatty acid synthesis,

on spinosad production. Pathway changes were indicated by the thickness changesnes indicated that the pathway was decreased and the increased thickness of the

�-oxidation and spinosad biosynthesis in the presence of exoge-nous fatty acids was established (Fig. 3). The results presented inthis study enable researchers to better understand why fatty acidsaddition can increase polyketides production.

Acknowledgments

This work was supported by the Natural Science Foundationof China (Nos. 21076148 and 31270087), Program for New Cen-tury Excellent Talents in University (NCET-10-0616), Plan of TianjinScience and Technology support (11ZCKFSY0100) and Project sup-ported by the Specialized Research Fund for the Doctoral Programof Higher Education of China (No. 20100032120012).

References

[1] F.T. Wong, C. Khosla, Combinatorial biosynthesis of polyketides—a perspective,Curr. Opin. Chem. Biol. 16 (1) (2012) 117–123.

[2] K.J. Weissman, P.F. Leadlay, Combinatorial biosynthesis of reduced polyketides,Nat. Rev. Microbiol. 3 (12) (2005) 925–936.

[3] C. Li, G. Florova, K. Akopiants, K.A. Reynolds, Crotonyl-coenzyme A reductaseprovides methylmalonyl-CoA precursors for monensin biosynthesis by Strep-tomyces cinnamonensis in an oil-based extended fermentation, Microbiology150 (10) (2004) 3463–3472.

[4] K.I.M.H. Soo, Y.I.N. Park, Lipase activity and tacrolimus production in Strepto-myces clavuligerus CKD 1119 mutant strains, J. Microbiol. Biotechnol. 17 (10)(2007) 1638–1644.

[5] C. Li, C. Hazzard, G. Florova, K.A. Reynolds, High titer production of tetra-cenomycins by heterologous expression of the pathway in a Streptomycescinnamonensis industrial monensin producer strain, Metab. Eng. 11 (6) (2009)

319–327.

[6] S.J. Mo, Y.H. Ban, J.W. Park, Y.J. Yoo, Y.J. Yoon, Enhanced FK506 produc-tion in Streptomyces clavuligerus CKD1119 by engineering the supply ofmethylmalonyl-CoA precursor, J. Ind. Microbiol. Biotechnol. 36 (12) (2009)1473–1482.

ginee

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

C. Xue et al. / Biochemical En

[7] T. Kamiryo, S. Parthasarathy, S. Numa, Evidence that acyl coenzyme Asynthetase activity is required for repression of yeast acetyl coenzyme A car-boxylase by exogenous fatty acids, Proc. Natl. Acad. Sci. 73 (2) (1976) 386–390.

[8] L. Zhang, T.A. Veres-Schalnat, A. Somogyi, J.E. Pemberton, R.M. Maier, Fatty acidcosubstrates provide �-oxidation precursors for rhamnolipid biosynthesis inPseudomonas aeruginosa, as evidenced by isotope tracing and gene expressionassays, Appl. Environ. Microb. 78 (24) (2012) 8611–8622.

[9] D. Fernández, E. Rodríguez, M. Bassas, M. Vinas, A.M. Solanas, J. Llorens, A.Manresa, Agro-industrial oily wastes as substrates for PHA production by thenew strain Pseudomonas aeruginosa NCIB 40045: effect of culture conditions,Biochem. Eng. J. 26 (2) (2005) 159–167.

10] J.E. Cronan, J. Thomas, Bacterial fatty acid synthesis and its relationshipswith polyketide synthetic pathways, Methods Enzymol. 459 (2009) 395–433,112–124.

11] P. Lee, P. Loh, C. Ho, Production of tylosin by Streptomyces fradiae in palm oilmedium, World J. Microb. Biotechnol. 13 (1) (1997) 69–71.

12] N. Mirjalili, V. Zormpaidis, P.F. Leadlay, A.P. Ison, The effect of rapeseed oiluptake on the production of erythromycin and triketide lactone by Saccha-ropolyspora erythraea, Biotechnol. Progr. 15 (5) (1999) 911–918.

13] H. Zhou, Z. Gao, K. Qiao, J. Wang, J.C. Vederas, Y. Tang, A fungal ketoreductasedomain that displays substrate-dependent stereospecificity, Nat. Chem. Biol. 8(4) (2012) 331–333.

14] C. Waldron, P. Matsushima, P.R. Rosteck, M.C. Broughton, J. Turner, K. Mad-duri, K.P. Crawford, D.J. Merlo, R.H. Baltz, Cloning and analysis of the spinosadbiosynthetic gene cluster of Saccharopolyspora spinosa, Chem. Biol. 8 (5) (2001)487–499.

15] J.A. Zahn, R.E. Higgs, M.D. Hilton, Use of direct-infusion electrospray massspectrometry to guide empirical development of improved conditions forexpression of secondary metabolites from actinomycetes, Appl. Environ.Microb. 67 (1) (2001) 377–386.

16] T. Williams, J. Valle, E. Vinuela, Is the naturally derived insecticide Spinosad®

compatible with insect natural enemies? Biocontrol Sci. Technol. 13 (5) (2003)459–475.

17] H.A. Kirst, The spinosyn family of insecticides: realizing the potential of naturalproducts research, J. Antibiot. 63 (3) (2010) 101–111.

18] A. Sanon, N.M. Ba, C.L. Binso-Dabire, B.R. Pittendrigh, Effectiveness ofspinosad (Naturalytes) in controlling the cowpea storage pest, Calloso-bruchus maculatus (Coleoptera: Bruchidae), J. Econ. Entomol. 103 (1) (2010)203–210.

19] K.D. Racke, A reduced risk insecticide for organic agriculture—spinosad casestudy, in: A.S. Felsot, K.D. Racke (Eds.), Crop Protection Products for OrganicAgriculture: Environmental, Health, and Efficacy Assessment, American Chem-ical Society, Washington D.C., 2007, pp. 92–108.

20] K. Huang, L. Xia, Y. Zhang, X. Ding, J.A. Zahn, Recent advances in the biochemistryof spinosyns, Appl. Microbiol. Biotechnol. 82 (1) (2009) 13–23.

21] Y. Pan, X. Yang, J. Li, R. Zhang, Y. Hu, Y. Zhou, J. Wang, B. Zhu, Genome sequenceof the spinosyns-producing bacterium Saccharopolyspora spinosa NRRL 18395,J. Bacteriol. 193 (12) (2011) 3150–3151.

[

ring Journal 81 (2013) 47– 53 53

22] C. Xue, Y. Duan, F. Zhao, W. Lu, Stepwise increase of spinosad production inSaccharopolyspora spinosa by metabolic engineering, Biochem. Eng. J. 72 (2013)90–95.

23] Z.L. Boynton, G.N. Bennett, F.B. Rudolph, Intracellular concentrations of coen-zyme A and its derivatives from Clostridium acetobutylicum ATCC 824 andtheir roles in enzyme regulation, Appl. Environ. Microb. 60 (1) (1994)39–44.

24] S. Rozen, H. Skaletsky, Primer3 on the WWW for general users and for biologistprogrammers, Bioinform. Method Protoc. 132 (1999) 365–386.

25] T.D. Schmittgen, K.J. Livak, Analyzing real-time PCR data by the comparative CTmethod, Nat. Protoc. 3 (6) (2008) 1101–1108.

26] Z.L. Fowler, W.W. Gikandi, M.A.G. Koffas, Increased malonyl coenzyme Abiosynthesis by tuning the Escherichia coli metabolic network and its applica-tion to flavanone production, Appl. Environ. Microb. 75 (18) (2009) 5831–5839.

27] R. Strobel, W. Nakatsukasa, Response surface methods for optimizing Saccha-ropolyspora spinosa, a novel macrolide producer, J. Ind. Microbiol. Biotechnol.11 (2) (1993) 121–127.

28] J. Laville, C. Voisard, et al., Global control in Pseudomonas fluorescens mediatingantibiotic synthesis and suppression of black root rot of tobacco, Proc. Natl.Acad. Sci. 89 (5) (1992) 1562–1566.

29] D.B. Choi, Y. Okabe, M. Park, Effects of rapeseed oil on activity of methylmalonyl-CoA carboxyltransferase in culture of Streptomyces fradiae, Biosci. Biotechnol.Biochem. 62 (5) (1998) 902–906.

30] S. Mo, S.K. Lee, Y.Y. Jin, C.H. Oh, J.W. Shu, Application of a combined approachinvolving classical random mutagenesis and metabolic engineering to enhanceFK506 production in Streptomyces sp. RM7011, Appl. Microbiol. Biotechnol. 97(7) (2013) 1–10.

31] W.S. Jung, Y.J. Yoo, J.W. Park, S.R. Park, A.R. Han, Y.H. Ban, E.J. Kim, E. Kim, Y.J.Yoon, A combined approach of classical mutagenesis and rational metabolicengineering improves rapamycin biosynthesis and provides insights intomethylmalonyl-CoA precursor supply pathway in Streptomyces hygroscopicusATCC 29253, Appl. Microbiol. Biotechnol. 91 (5) (2011) 1389–1397.

32] H. Bergler, S. Fuchsbichler, G. Högenauer, F. Turnowsky, The enoyl-[acyl-carrier-protein] reductase (FabI) of Escherichia coli, which catalyzes a keyregulatory step in fatty acid biosynthesis, accepts NADH and NADPH ascofactors and is inhibited by palmitoyl-CoA, Eur. J. Biochem. 242 (3) (1996)689–694.

33] L. Peacock, C. Ratledge, J. Ward, F.M. Dickinosn, A. Ison, How Streptomyces livi-dansuses oils and sugars as mixed substrates, Enzyme Microb. Technol. 32 (1)(2003) 157–166.

34] H. Savli, A. Karadenizli, T. Skarina, A. Savchenko, M.J. Schurr, T.T. Hoang,Expression stability of six housekeeping genes: a proposal for resistance genequantification studies of Pseudomonas aeruginosa by real-time quantitative RT-

PCR, J. Med. Microbiol. 52 (5) (2003) 403–408.

35] Y. Kang, V.V. Lunin, A. Savchenko, M.J. Schurr, T.T. Hoang, The long-chain fattyacid sensor PsrA, modulates the expression of rpoS and the type III secretionexsCEBA operon in Pseudomonas aeruginosa, Mol. Microbiol. 73 (1) (2009)120–136.