w cai et al. nature 510 , 254 -258 (2014) doi:10.1038/nature 13327

1

W Cai et al. Nature 510, 254-258 (2014) doi:10.1038/nature13327 Multi-model statistics associated with the increase in frequency of extreme pIOD events.

Upload: salaam

Post on 05-Jan-2016

62 views

Category:

Documents

0 download

Report

Download

Embed Size (px):

DESCRIPTION

Multi-model statistics associated with the increase in frequency of extreme pIOD events. W Cai et al. Nature 510 , 254 -258 (2014) doi:10.1038/nature 13327. - PowerPoint PPT Presentation

TRANSCRIPT

Page 1: W Cai et al. Nature 510 , 254 -258 (2014) doi:10.1038/nature 13327

W Cai et al. Nature 510, 254-258 (2014) doi:10.1038/nature13327

Multi-model statistics associated with the increasein frequency of extreme pIOD events.

DJ Ferguson et al. Nature 499 , 70 - 73 (2013) doi:10.1038/nature 12292

Nature , 2008, Doi:10.1038/nature07103

E Ammannito et al. Nature 000 , 1 - 4 (201 3 ) doi:10.1038/nature 12665

Calcium modulates force sensing by the von ... - aj-lab.gitlab.io · ARTICLE nATuRE CommunICATIons | DoI: 10.1038/ncomms1385 nATuRE CommunICATIons | 2:385 | DoI: 10.1038/ncomms1385

Published in Nature Materials (2016) doi:10.1038/nmat4569

DK Simanshu et al. Nature 000 , 1 - 5 (2013) doi:10.1038/nature 12332

Nature Neuroscience: doi:10.1038/nnNtrk2 TTTTTTTAGTTTTTTTTGTTAGTTAATAAA CACATCTCAATAATCAACCACATC BS Nature Neuroscience: doi:10.1038/nn.3976 Author Andrew Gordon Created Date 2/25/2015

Nature Neuroscience: doi:10.1038/nncPC in the distal, medial and proximal part of dCA1. Nature Neuroscience: doi:10.1038/nn.4517 Supplementary Figure 6 Direct long-range GABAergic

DOI: 10.1038/NCHEM - Nature · NATURE CHEMISTRY | 3 DOI: 10.1038/NCHEM.1870 SUPPLEMENTARY INFORMATION S3 1. Syntheses (i) General methods and instrumentation

Nature Genetics doi:10.1038/ng · Aortic stenosis Aortic regurgitation Nature Genetics: doi:10.1038/ng.3618. Cardiomyopathy Hypertrophic card Pericardial Problem Pericarditis Pericardial

P. van der Harst et al. Nature 000 , 1 - 7 (2012) doi:10.1038/nature 11677

Nature Immunology: doi:10.1038/ni · Nature Immunology: doi:10.1038/ni.2987 Supplementary Figure 6 Increased NET release and tissue damage in the lungs of dectin-1-deficient mice

DWJ Thompson et al. Nature 491 , 692-697 (2012) doi:10.1038/nature 11579

Nature, 2008, Doi:10.1038/nature07103 Semrah Kati 09.02.2009

G Zimmermann et al. Nature 000 , 1 - 5 (2013) doi:10.1038/nature 12205

Nature Immunology: doi:10.1038/ni · 2015-02-17 · Nature Immunology: doi:10.1038/ni.3098 Supplementary Figure 1 BK6 TCR variable sequence and SDS-PAGE from size-exclusion chromatography

Nature Research€¦ · NATURE CHEMISTRY | 1 SUPPLEMENTARY INFORMATION DOI: 10.1038/NCHEM.1088 1 [Submitted to Nature Chemistry] Supplementary Information: A

SUPPLEMENTARY INFORMATION - Nature · SUPPLEMENTARY INFORMATION doi: 10.1038/nmat2460 nature materials ... Sulfur outside of structure of ... 10.1038/nmat2460 SUPPLEMENTARY INFORMATION

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/cermak_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3666. Supplementary Figure 13 Comparison of precision

Nature Biotechnology: doi:10.1038/nbt

Nature Neuroscience: doi:10.1038/nn · Nature Neuroscience: doi:10.1038/nn.4463. Supplementary Figure 2 AT1a-positive neurons in area postrema and PVN were not activated under the

Guo et al ., Nature Materials, DOI:10.1038/ nmat3234 (2012)

TJ Schulz et al. Nature 000 , 1-5 (2013) doi:10.1038/nature 11943

DOI: 10.1038/NMAT4204 Supplementary Information...NATURE MATERIALS | . DOI: 10.1038/NMAT4204. , , – – |

Nature Biotechnology: doi:10.1038/nbt...sensitivity to detect MS indels decreases markedly at low allele fractions. Nature Biotechnology: doi:10.1038/nbt.3966 log 10 (KS t est ) log

JLW Morgan et al. Nature 000 , 1 - 6 (2012) doi:10.1038/nature 11744

Nature Biotechnology: doi:10.1038/nbtruminant host shown on individual circles around the tree. Nature Biotechnology: doi:10.1038/nbt.4110 Author Andrew Gordon Created Date 3/12/2018

Nature Structural and Molecular Biology: doi:10.1038/nsmb · Nature Structural and Molecular Biology: doi:10.1038/nsmb.2982 Supplementary Figure 2 Mapped 3 ends of lnc-pri-miR-122

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/stevens_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3697. Supplementary Figure 8 MAR or mass can be used

DOI: 10.1038/NMAT4204 Supplementary Information · SUPPLEMENTARY INFORMATION. DOI: 10.1038/NMAT4204. NATURE MATERIALS | . 1. 1 . Supplementary Information . High-precision realization

G Lu et al. Nature 000 , 1 - 5 (2013) doi:10.1038/nature 12328

K Otsuka & S-I Karato Nature 492 , 243 - 246 (2012) doi:10.1038/nature 11663

Nature Genetics: doi:10.1038/ng - Seth Field's Lab at UCSDsethfield.ucsd.edu/Papers/Bielas..Gleeson NatureGenetics 2009 suppl... · Nature Genetics: doi:10.1038/ng.423. Supplemental

AB Russell et al. Nature 000 , 1 - 5 (2013) doi:10.1038/nature 12074

C Kim et al. Nature 000 , 1 - 6 (2013) doi:10.1038/nature 11799