AP BIOLOGY SUMMER ASSIGNMENT 2012

Welcome to AP Biology and congratulations for choosing to challenge yourself with AP courses! We need to hit the road running, so you will have a number of assignments to complete over the summer. It is to your advantage to begin the assignments as soon as possible, so you do not have an insurmountable task waiting for you as August arrives. Your assignment is divided into several sections. Although all have a final due date of the ______________ of the 2012-13 school year, each also has a suggested date of completion to help you pace yourself throughout the summer.

Recommended Pacing Schedule

Assignment Description

June 25, 2012

Send a personal introduction email to each of these teachers as you may not know yet who your primary teacher may be: kafrontino@msd.k12.ny.us; mbermudez@msd.k12.ny.us; jsoraire@msd.k12.ny.us

Consider this professional communication. Use clearly written, complete sentences. Do not use “text speak”.

Address it to ___________ Make the subject: “APBiology – Introduction to

(your name). Begin with a formal salutation Introduce yourself to your teacher. Include such

things as:-What do you like to do (hobbies, sports, music, interests, etc.)

-Do you have a job? - What is your family like? -What was the last book you read for fun? - What are you looking forward to in AP Biology? -What are you most anxious about in AP Biology?

End with a formal closing. Before sending, attach a picture of yourself that

expresses your personality – serious, silly, athletic, book-lover, daydreamer, go-getter, etc. This may be informal as long as it is appropriate for school.

June 30, 2012

Biology Scavenger Hunt- See project details on attached pages.

July 16, 2012 4 Big Ideas - See assignment details on attached pages.

August 20, 2012

Assemble, proofread, make corrections to all parts of Summer Assignment. Each section of the summer assignment will be due: ___________________.

This assignment can also be found on www.frontinoap.weebly.com

BIOLOGY SCAVENGER HUNT

For this part of your summer assignment, you will be familiarizing yourself with science terms that we will be using at different points throughout the year. The list of terms is on this page and the next. DO NOT LOSE THIS LIST. THIS IS AN ONGOING, YEAR-LONG PROJECT THAT WILL REQUIRE YOU TO REFERENCE IT PERIODICALLY.

1. Your assignment is to collect 40 of the biological items on the following list

2. Your grade will be the point value of the items you collect. Although this assignment is a 120 point assignment, you would be better off collecting MORE than 120 points worth of things to allow for some things possibly not meeting the requirements.

3. To prove that you’ve seen the items, you must submit either;

A photograph of the object (Include your signature item in each photo), or

A hand-drawn image of the object in its found location, or A newspaper or magazine article that has that object as its

primary subject, or An internet article/image of the organism (limited to 5

submissions maximum)

4. Every organism submitted must be labeled with the properly-formatted scientific name and the location of the organism.

For example, a dog in your neighbors yard would be labeled as:o Canis familiaris; 465 Ryan Boulevard, My Town, GA.

Newspaper and magazine articles must include a correct citation for the article and the article must have been written during the summer (June August, 2009).

5. You are encouraged to work with others in the class to complete this project, but each student must turn in his or her own project with a unique set of terms and photos chosen. So working with other students means brainstorming, discussing, going on collecting trips together, etc. It does not mean using the same items! There are over 100 choices…probability says that there is a very slim chance that any two students will have the same terms with the same photos! Do your own work, but find inspiration and encouragement in your team or study group.

CAUTIONS:

* Never touch plants or animals with exposed fingers. Avoid touching the organisms, but if you must, use gloves and/or forceps.

* Remember, we don't want to deplete the environment. Do not kill any organisms! Organisms should be photographed or drawn in their native habitat.

6. The submitted portfolio can be in a scrapbook, photo album, or digital form (ie: PowerPoint presentation or Prezi.)

7. Specimen List: Below are the items you are to collect. An individual organism can only be used once. Humans are acceptable for one category only. You may use internet-based images for no more than 5 of these items.

Grade breakdown:

1 point for each specimen 1 point for each scientific name 1 point for location 40 specimens x 3 pts each specimen = 120 points

1. adaptation of an animal

2. adaptation of a plant

3. abscisic acid

4. actin

5. amniotic egg

6. amylase

7. angiosperm

8. animal that has a segmented body

9. annelid

10. anther & filament of stamen

11. arthropod

12. archaebacteria

13. autotroph

14. auxin producing area of a plant

15. basidiomycete

16. Batesian mimicry

17. biological magnification

18. bryophyte

19. C4 plant

20. Calvin cycle

21. carbohydrate - fibrous

22. cambium

23. cellulose

24. chitin

25. chlorophyta

26. cnidarian

27. coelomate

28. conifer leaf

29. commensalism

30. connective tissue

31. cuticle layer of a plant

32. deciduous leaf

33. deuterostome

34. dicot plant with flower & leaf

35. diploid chromosome number

36. echinoderm

37. ectotherm

38. endosperm

39. endotherm

40. enzyme

41. epithelial tissue

42. ethylene

43. eubacteria

44. eukaryote

45. exoskeleton

46. fermentation

47. flower ovary

48. frond

49. fruit - dry with seed

50. fruit - fleshy with seed

51. gametophyte

52. gastropod

53. genetically modified organism

54. gibberellins

55. glycogen

56. gymnosperm cone

57. haploid chromosome number

58. heartwood

59. hermaphrodite

60. insect

61. K-strategist

62. keratin

63. leaf - gymnosperm

64. Lepidoptera

65. lichen

66. lignin

67. lipid used for energy storage

68. littoral zone organism

69. long-day plant

70. meristem

71. modified leaf of a plant

72. modified root of a plant

73. modified stem of a plant

74. monocot plant with flower & leaf

75. muscle fiber - striated

76. mutualism

77. mycelium

78. mycorrhizae

79. myosin

80. nematode

81. niche

82. nymph stage of an insect

83. parasite

84. parenchyma cells

85. phloem

86. pine cone - female

87. Platyhelminthes

88. pollen

89. pollinator

90. porifera

91. prokaryote

92. protein - fibrous

93. protein - globular

94. protostome

95. pteridophyte

96. r-strategist

97. radial symmetry

98. rhizome

99. scale from animal with two-chambered heart

100. spore

101. sporophyte

102. stem - herbaceous

103. stem - woody

104. stigma & style of carpel

105. tendril of a plant

106. thorn of a plant

107. unicellular organism

108. vascular plant tissue

109. xerophyte

110. xylem

Overarching Themes in Biology: The 4 Big Ideas

Directions: For each “Big Idea,” complete the questions and diagrams provided. When diagrams or charts are not provided, create your own to enhance your answers to the questions.

Big Idea 1: The process of evolution drives the diversity and unity of lifePart I:Cladistics is the study of evolutionary classification. Cladograms show evolutionary relationships among organisms. Comparative morphology investigates characteristics forhomology and analogy to determine which organisms share a recent common ancestor. A cladogram will begin by grouping organisms based on a characteristics displayed by ALL the members of the group. Subsequently, the larger group will contain increasingly smaller groups that share the traits of the groups before them. However, they also exhibit distinct changes as the new species evolve. Further, molecular evidence from genes which rarely mutate can provide molecular clocks that tell us how long ago organisms diverged, unlocking the secrets of organisms that may have similar convergent morphology but do not share a recent common ancestor

1. Which organisms in the cladogram in figure 1 have fur and mammary glands?

2. Which organisms in the cladogram in figure 1 have jaws?

3. Based on the cladogram in figure 1, which shared a common ancestor most recently – a mouseand a lizard or a mouse and a perch?

4. Which two organisms would you expect to have a closer matching DNA sequence for a genethat is NOT under selective pressure in nature – Hagfish and Pigeon or Hagfish and Salamander?Part II: Procedure:1. Using the explanations below, determine the characteristics each animal has. In theData Table provided, place an "x" in the box if the animal has the characteristic.

Explanations of Characteristics: Set #1 : Dorsal nerve cord (running along the back or "dorsal" body

surface) Notochord (a flexible but supporting cartilage-like rod running along the backor "dorsal" surface)

Set #2 : Paired appendages (legs, arms, wings, fins, flippers, antennae);Vertebral column ("backbone")

Set #3 : Paired legs

Set #4 : Amnion (a membrane that holds in the amniotic fluid surrounding the embryo; may or may not be inside an egg shell)

Set #5 : Mammary glands (milk-secreting glands that nourish the young)

Set #6: Placenta (structure attached to inside of uterus of mother and joined to the embryo by the umbilical cord; provides nourishment and oxygen to the embryo)

Set #7 : Canine teeth short (same length as other teeth); Foramen magnum forward (spinal cord opening, located forward, under skull)

Step 1: Complete Data TableAnimals

SETS

TRAITS Kangaroo

Lamprey

Rhesus

Monkey

Bullfrog

Human

Snapping

Turtle

Tuna

1 Dorsal Nerve Cord Notochord

2 Paired appendages Vertebral column

3 Paired legs

4 Amnion (amniotic sac)

5 Mammary glands

6 Placenta7 Canine

teeth short Foramen magnum fwdTotal of Xs ___>

Part III: Using varied evidence to create cladograms:

A: Morphological Evidence: Using your text and prior knowledge, determine the morphological characteristics of the organisms in the following table. For every characteristic the organism possesses, put a check in that box. The table is partially completed for you.

Organism Eukaryote Multicellular Segmented Body

Jaws Limbs/Fins Hair Placenta Has bone

Differences from

ancestor cell

Universal common ancestor

0

AmeobaKangaroo XEarthworm XCat XShark X XDolphin X X XLizard XSponge

Complete the cladogram below using the above organisms and their morphological data. Properly show all organisms and shared morphological characteristics.

B: Molecular Evidence: Cytochrome c is a protein located in the mitochondria of cells nvolved with cellular respiration. Compare each organism’s Cytochrome c DNA sequences with the ancestor cell and each other. Circle or highlight the differences (mutations) present in the cytochrome c DNA sequences from ancestor cell.

Cytochrome c DNA Sequence DataOrganism DNA Sequence # of

mutationsAncestor Cell ATTAGCGACCAGTATATCCTACAATCCGTCTACTTCATT none

Amoeba ATTAGCGACCAGTTTATCCTACAATCCCGTCTACTTCAT

Kangaroo CTAATCCCCCCGTTTATCCTACTTTCCCATCTACTAAGT

Earthworm CTTATCGACCCGTTTATCCTACATTCCCGTCTACTTCGT

Cat TTAATCCCCCCGTTTATCCTACTTTCCCATCTACTAAGT

Shark CTTATCCCCCCGTTTATCCTACTTTCCCGTCTACTTCGT

Dolphin CTAATCCCCCCGTTTATCCTACTTTCCCATGTAGTAAGT

Lizard CTAATCCCCCCGTTTATCCTACTTTCCCGTCTACTTCGT

Sponge ATTATCGACCAGTTTATCCTACATTCCCGTCTACTTCGT

Using the data above, create a cladogram in the space provided below.

Directions: Based on the activities you completed above, answer the following questions:

How did your morphological cladogram compare with your cladogram based on the cytochrome c DNA evidence?

Compare and contrast convergent evolution with divergent evolution. Which two organisms show convergent evolution in the cladogram above? Why might these two organisms have similar morphology despite not sharing a recent common ancestor?

Which type of evidence for evolution is most accurate in determining evolutionary relationships – morphology or molecular and why?

Big Idea 2: Biological systems utilize free energy and molecular building blocks to grow, reproduce and maintain dynamic homeostasis

Part A:1. Draw a Venn diagram displaying the relationship between photosynthesis and respiration. Be sure to include means of capturing and using free energy, raw materials and products, organisms and organelles involved.

2. What type of ecological relationship do “producers” and “consumers” have? Explain how the balance of this relationship determines the stability of biodiversity, carrying capacity and genetic variation. __________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________

________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________Part B:A population of microscopic eukaryotic organisms growing in a large flask had the growth pattern show:

In two paragraphs, explain the biological factors that determine (cause) the shape of the growth pattern shown above in both period 1 and period 2. __________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________

________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________

Big Idea 3: Living systems store, retrieve, transmit, and respond to information essential to life processes

Directions: To be typed and labeled “Big Idea 3”

Each student will choose 3 science research articles from those listed below taken from journals, periodicals or websites dealing with various themes covered in the AP Bio curriculum. For each article, the student will write the following:

1. Source material ( publication, date, author if known)

2. A one to two-paragraph summary or abstract of the article (In your OWN words)

3. Fully explained answers to the following (expect at least half a page typed for each):

a) What are the medical, ethical, or social implications of the work discussed in the article?

b) How would you explain the reasons behind why these advancements in science are being made? In other words, what is the driving force(s) behind these advancements?

c) What do you predict will be the scientific future if the scenario detailed in the article came to fruition and was common practice in society?

http://www.nature.com/scitable/topicpage/dna-damage-repair-mechanisms-for-maintaining-dna-344

http://scienceprogress.org/2011/04/one-step-closer-to-designer-babies/

http://www.hhmi.org/genesweshare/d130.html

http://www.nature.com/scitable/topicpage/gene-therapy-760

http://hci.stanford.edu/jheer/files/2000-Synesthesia-Psych127.pdf

http://discovermagazine.com/2011/nov/11-of-mice-and-men-and-medicines

Big Idea 4: Biological systems interact, and these systems and their interactions possess complex properties

Directions: After reading the following case studies, answer the questions below:

Case: Wearing on Her Nerves: Exploring the Interrelation between the Nervous and Muscular Systems

Part I – Rise and Shine?Kathy, a 20-year-old woman, awakens one morning to a tingling, numb sensation covering both of her feet. This has happened to her a number of times throughout the year. In the past, when experiencing this sensation, within a couple of days to a week the numbness would subside, and so she is not too concerned. About a week later, she notices that the numbness and tingling not only persists, but has also spread up to her knees. Again, she ignores the abnormal sensation. By the end of a month’s time, the numbness spreads to the midline of her body. At this point, she becomes alarmed. Kathy sees the nurse at her college who tells her that she should see a doctor. Kathy calls her doctor’s office to schedule an appointment, but the soonest slot is in two weeks. She makes the appointment and goes about her daily routine. The next morning, Kathy wakes, but when she attempts to get out of bed, she comes crashing to the floor. Because she is still groggy from sleep, she doesn’t really understand what has just happened. As she tries to stand up, the muscles of her left leg engage, but as she also attempts pushing up with her right leg, she again falls to the floor. She sits in bewilderment as she tries to make sense of what has just happened and realizes that she has seriously scraped her knee in her fall. She does not feel the pain from her wound. Kathy thinks about how odd this year has been. She remembers another medical issue she had earlier in the year when she had lost hearing in her right ear and wonders if there is a connection to her current condition. At that time, Kathy underwent extensive testing, but the ear, nose, and throat specialist remained baffled. He thought that a severe inner ear infection could have destroyed her ability to hear on that side, but there was no conclusive evidence to support this. In an attempt to recover

any hearing he could, the doctor prescribed very high dosages of steroids; he told Kathy that she probably wouldn’t see a change, but there were rare occurrences where steroids helped. To both Kathy and her doctor’s surprise, after about a week of steroids, she completely regained hearing in her right ear. It was a “miracle.” Kathy wonders whether she can count on a new miracle to heal her current medical issues.

Questions1. What components of the nervous system are involved in physical sensation? How does sensory impulse move throughout the body?

2. What components of the nervous system are involved in skeletal muscle movement? How does motor impulse move throughout the body? What is a “motor unit”?

3. What movements are involved in the action of standing up? What muscles need to contract to perform these actions?

4. What are the different levels of organization of a muscle down to myofilaments? What is a “sarcomere” and how are its proteins organized?

5. Starting from the release of acetylcholine by the motor neuron, what are the steps in muscle contraction? How is contraction ended?

6. Are Kathy’s medical problems related to her sensory neurons, motor neurons, or both? What in Kathy’s medical history supports your answer?

Part II – Diagnosis and TreatmentKathy realizes that she cannot wait until her appointment to receive medical care; she quickly goes to the emergency room. After a mountain of questions about Kathy’s symptoms and medical history, the doctors decide to admit her for further testing. She is transferred to the neurology unit and the doctors request she undergo a series of laboratory tests, including an MRI and a spinal tap. In the meantime, the doctors prescribe high dosages of steroids to help alleviate the symptoms.Upon reviewing Kathy’s medical history and the results of the various laboratory tests, the neurologists diagnose her with Multiple Sclerosis (MS). They explain to Kathy that MS is an autoimmune disease and that her own immune system has been attacking the myelin sheath that surrounds the nerves of her central nervous system. She remains in the hospital for a week until sensation is fully recovered in her lower body and strength is restored in her legs. She is discharged from the hospital and schedules a follow up appointment with the neurologist.When she returns to the neurologist, they discuss Kathy’s different options for treatment. Because there is no cure for the disease, options in medication vary greatly. She decides to try daily injections of Copaxone, a medication that is similar in structure to a protein found in myelin.Kathy continues to see the neurologist on a regular basis and gives herself an injection every evening. Over the course of seven months of therapy, she only experiences one occurrence of numbness, which subsides after a couple of days.

She tries to stay positive and tries to minimize the disease’s impact on her life.

Questions7. What is myelin and how does it affect the transmission of nerve impulses? Identify the cells responsible for the formation of myelin.

8. What are the “scleroses” in Multiple Sclerosis and where do they occur? How does this influence nerve transmission?

9. How do an MRI and spinal tap help confirm the diagnosis of Multiple Sclerosis?

10. Why did steroids help alleviate Kathy’s symptoms?11. How does Copaxone work as treatment for Multiple Sclerosis? How do other types of medications differ?

12. Why did Kathy experience the altered sensation in her lower body? Was there something wrong with her skin? Why couldn’t she stand? Was there something wrong with the muscles of her right leg?

13. Did Kathy’s hearing loss have anything to do with the Multiple Sclerosis? Why/Why not?