Supplemental Information

Figure S1. A fully bifurcating guide tree for BP&P analysis based on the mtDNA data was difficult to generate because of weakly supported basal relationships within the southern clade (Fig. 1; Supplemental Figure). To deal with this problem, we generated the BP&P guide tree based on the fully-resolved (including weakly supported nodes) ML tree; when bootstrap values were < 70 in this tree, we generated multiple guide trees to of sub-clades to reflect the uncertainty of these relationships. After analyzing the sub-clades, we combined them into a single-results figure. Each sub-clade was strongly supported at the base, and because of the way the rjMCMC algorithm evaluates nested models in BP&P, nodes towards the base of the guide tree will have higher support values (support values cannot decrease towards the base of the tree). This means that joining these sub-clades had no effect on support values between sub-clades. Although not depicted, the same method was performed to unite the sub-clades in the BP&P morphological guide tree.

Figure S2. Results from the AICM model selection in examining the four species-delimitation scenarios in (a) the simulated data and (b) the eight models tested with the empirical data. Boxplots show upper and lower quartiles, median values, and outliers (note the y-axis break).

Figure S3a. BACH1 maximum likelihood tree with each individual represented by two alleles (A and B). Support values at nodes or on branches represent bootstrap proportions. Tip labels denote taxon and location (Sae = S. a. aeneus, Sbi = S. bicanthalis, Sbr = S. s. brownorum North, Sca = S. s. brownorum South, Sch = S. chaneyi, Ssa = S. samcolemani, Ssc = S. s. scalaris, Ssl = S. slevini, Sun = S. s. unicanthalis, Ssu = S. a. subniger; AGUA = Aguascalientes, ARIZ = Arizona, CHIH = Chihuahua, COAH = Coahuila, DURA = Durango, EDDM = Mexico State, HIDA = Hidalgo, JALI = Jalisco, MICH = Michoacán, MORE = Morelos, NEME = New Mexico, NULE = Nuevo León, OAXA = Oaxaca, PUEB = Puebla, QUER = Querétaro, SALP = San Luis Potosí, TAMA = Tamaulipas, VERA = Veracruz).

Figure S3b. EXPH5 maximum likelihood tree with each individual represented by two alleles (A and B). Support values at nodes or on branches represent bootstrap proportions. Tip labels denote taxon and location (Sae = S. a. aeneus, Sbi = S. bicanthalis, Sbr = S. s. brownorum North, Sca = S. s. brownorum South, Sch = S. chaneyi, Ssa = S. samcolemani, Ssc = S. s. scalaris, Ssl = S. slevini, Sun = S. s. unicanthalis, Ssu = S. a. subniger; AGUA = Aguascalientes, ARIZ = Arizona, CHIH = Chihuahua, COAH = Coahuila, DURA = Durango, EDDM = Mexico State, HIDA = Hidalgo, JALI = Jalisco, MICH = Michoacán, MORE = Morelos, NEME = New Mexico, NULE = Nuevo León, OAXA = Oaxaca, PUEB = Puebla, QUER = Querétaro, SALP = San Luis Potosí, TAMA = Tamaulipas, VERA = Veracruz).

Figure S3c. KIF24 maximum likelihood tree with each individual represented by two alleles (A and B). Support values at nodes or on branches represent bootstrap proportions. Tip labels denote taxon and location (Sae = S. a. aeneus, Sbi = S. bicanthalis, Sbr = S. s. brownorum North, Sca = S. s. brownorum South, Sch = S. chaneyi, Ssa = S. samcolemani, Ssc = S. s. scalaris, Ssl = S. slevini, Sun = S. s. unicanthalis, Ssu = S. a. subniger; AGUA = Aguascalientes, ARIZ = Arizona, CHIH = Chihuahua, COAH = Coahuila, DURA = Durango, EDDM = Mexico State, HIDA = Hidalgo, JALI = Jalisco, MICH = Michoacán, MORE = Morelos, NEME = New Mexico, NULE = Nuevo León, OAXA = Oaxaca, PUEB = Puebla, QUER = Querétaro, SALP = San Luis Potosí, TAMA = Tamaulipas, VERA = Veracruz).

Figure S3d. NKTR maximum likelihood tree with each individual represented by two alleles (A and B). Support values at nodes or on branches represent bootstrap proportions. Tip labels denote taxon and location (Sae = S. a. aeneus, Sbi = S. bicanthalis, Sbr = S. s. brownorum North, Sca = S. s. brownorum South, Sch = S. chaneyi, Ssa = S. samcolemani, Ssc = S. s. scalaris, Ssl = S. slevini, Sun = S. s. unicanthalis, Ssu = S. a. subniger; AGUA = Aguascalientes, ARIZ = Arizona, CHIH = Chihuahua, COAH = Coahuila, DURA = Durango, EDDM = Mexico State, HIDA = Hidalgo, JALI = Jalisco, MICH = Michoacán, MORE = Morelos, NEME = New Mexico, NULE = Nuevo León, OAXA = Oaxaca, PUEB = Puebla, QUER = Querétaro, SALP = San Luis Potosí, TAMA = Tamaulipas, VERA = Veracruz).

Figure S3e. NOS1 maximum likelihood tree with each individual represented by two alleles (A and B). Support values at nodes or on branches represent bootstrap proportions. Tip labels denote taxon and location (Sae = S. a. aeneus, Sbi = S. bicanthalis, Sbr = S. s. brownorum North, Sca = S. s. brownorum South, Sch = S. chaneyi, Ssa = S. samcolemani, Ssc = S. s. scalaris, Ssl = S. slevini, Sun = S. s. unicanthalis, Ssu = S. a. subniger; AGUA = Aguascalientes, ARIZ = Arizona, CHIH = Chihuahua, COAH = Coahuila, DURA = Durango, EDDM = Mexico State, HIDA = Hidalgo, JALI = Jalisco, MICH = Michoacán, MORE = Morelos, NEME = New Mexico, NULE = Nuevo León, OAXA = Oaxaca, PUEB = Puebla, QUER = Querétaro, SALP = San Luis Potosí, TAMA = Tamaulipas, VERA = Veracruz).

Figure S3f. R35 maximum likelihood tree with each individual represented by two alleles (A and B). Support values at nodes or on branches represent bootstrap proportions. Tip labels denote taxon and location (Sae = S. a. aeneus, Sbi = S. bicanthalis, Sbr = S. s. brownorum North, Sca = S. s. brownorum South, Sch = S. chaneyi, Ssa = S. samcolemani, Ssc = S. s. scalaris, Ssl = S. slevini, Sun = S. s. unicanthalis, Ssu = S. a. subniger; AGUA = Aguascalientes, ARIZ = Arizona, CHIH = Chihuahua, COAH = Coahuila, DURA = Durango, EDDM = Mexico State, HIDA = Hidalgo, JALI = Jalisco, MICH = Michoacán, MORE = Morelos, NEME = New Mexico, NULE = Nuevo León, OAXA = Oaxaca, PUEB = Puebla, QUER = Querétaro, SALP = San Luis Potosí, TAMA = Tamaulipas, VERA = Veracruz).

Figure S4. Maximum likelihood tree inferred from the concatenated nDNA dataset. Each individual is represented by a single (randomly selected) allele for each locus. Support values at nodes or on branches represent bootstrap proportions. Bootstrap proportions with an asterisk (*) indicate nodes that received bootstrap proportions < 70 and Bayesian posterior probabilities > 0.95. Tip labels denote taxon and location (Sae = S. a. aeneus, Sbi = S. bicanthalis, Sbr = S. s. brownorum North, Sca = S. s. brownorum South, Sch = S. chaneyi, Ssa = S. samcolemani, Ssc = S. s. scalaris, Ssl = S. slevini, Sun = S. s. unicanthalis, Ssu = S. a. subniger; AGUA = Aguascalientes, ARIZ = Arizona, CHIH = Chihuahua, COAH = Coahuila, DURA = Durango, EDDM = Mexico State, HIDA = Hidalgo, JALI = Jalisco, MICH = Michoacán, MORE = Morelos, NEME = New Mexico, NULE = Nuevo León, OAXA = Oaxaca, PUEB = Puebla, QUER = Querétaro, SALP = San Luis Potosí, TAMA = Tamaulipas, VERA = Veracruz).

Figure S5. Mitochondrial gene tree for the Sceloporus scalaris species group inferred under maximum likelihood, rooted with S. undulatus. Nodal support values are bootstrap proportions. Individuals amplified for nDNA are shown in bold. Lineages used in Bayes factor species delimitation are labeled to the right of the tree. Locations for individual samples are as follows: AGS = Aguascalientes, AZ = Arizona, CHIH = Chihuahua, COAH = Coahuila, DF = Federal District, DUR = Durango, HID = Hidalgo, JAL = Jalisco, MEX = Mexico State, MICH = Michoacán, MOR = Morelos, NM = New Mexico, NL = Nuevo León, OAX = Oaxaca, PUE = Puebla, QTO = Querétaro, SLP = San Luis Potosí, TAM = Tamaulipas, TLAX = Tlaxcala, VER = Veracruz.

Figure S6. Multi-locus nuclear network inferred from the six nuclear genes using the program POFAD (Joly and Bruneau 2006). Lineages have been colored to match Figure 1, and the network is rooted with the outgroup Sceloporus clarkii.

Table S1. Sampling localities for each taxon utilized in this study.

Sample Taxon Locality (State, Country)1 S. slevini Sonoita, Arizona (USA)2 S. slevini Cloverdale, New Mexico (USA)3 S. slevini Sierra del Nido, Chihuahua (MEX)4 S. slevini Creel, Chihuahua (MEX)5 S. slevini Mesa de las Navar, Durango (MEX)6 S. samcolemani E San Antonio de las Alazanas, Coahuila

(MEX)7 S. samcolemani Pablillo, Nuevo León (MEX)8 S. samcolemani Sierra Concordia, Coahuila (MEX)9 S. chaneyi Aserradero, Tamaulipas (MEX)10 S. chaneyi Aserradero, Tamaulipas (MEX)11 S. s. brownorum Rancho Santa Barbara, Durango (MEX)12 S. s. brownorum Sierra Fría, Aguascalientes (MEX)13 S. s. brownorum Sierra del Laurel, Aguascalientes (MEX)14 S. s. brownorum Sierra del Laurel, Aguascalientes (MEX)15 S. s. unicanthalis Guadalajara, Jalisco (MEX)16 S. s. scalaris Tapalpa, Jalisco (MEX)17 S. s. scalaris Guadalcazar, San Luis Potosí (MEX)18 S. s. scalaris Alvarez, San Luis Potosí (MEX)19 S. s. scalaris San Jose de Gracía, Michoacán (MEX)20 S. a. subniger El Derramadero, Querétaro (MEX)21 S. a. subniger Pinal de Amoles, Querétaro (MEX)22 S. a. subniger Autódromo del Ángel, Hidalgo (MEX)23 S. a. subniger Pinal de Amoles, Querétaro (MEX)24 S. a. subniger Nevado de Colima, Jalisco (MEX)25 S. a. subniger W Zacapu, Michoacán (MEX)26 S. a. subniger Atlacomulco, Estado de México (MEX)27 S. a. subniger Los Azufres, Michoacán (MEX)28 S. a. subniger Valle de Bravo, Estado de México (MEX)29 S. bicanthalis Tianguistengo, Hidalgo (MEX)30 S. bicanthalis Las Vigas, Veracruz (MEX)31 S. bicanthalis Volcán Iztaccihuatl, Puebla (MEX)32 S. bicanthalis Sierra Negra, Puebla (MEX)33 S. bicanthalis Llano de las Flores, Oaxaca (MEX)34 S. a. aeneus Zempoala, Morelos (MEX)

Table S2. Information for the primers and loci used in this study.

Primer Name Primer Sequence Fragment

Length (bp) Source

BACH1f1 5' GAT TTG AHC CYT TRC TTC AGT TTG C 3'1,254 Townsend et al. (2008)

BACH1r2 5' ACC TCA CAT TCY TGT TCY CTR GC 3'

EXPH5f5' AAT AAA CTK GCA GCT ATG TAC AAA ACA AGT C

3' 965 Portik et al. (2010)EXPH5r 5' AAY CGC CCT TCT GTG AGT GAC CTC T 3'KIF24f 5' SAA ACG TRT CTC CMA AAC GCA TCC 3'

521 Portik et al. (2010)KIF24r 5' WGG CTG CTG RAA YTG CTG GTG 3'NKTRf19 5' GAT GAC ATG GAG ATY TGY ACT CC 3' 617 Townsend et al. (2011)NKTRr18 5' CTY CTD GAY CGA CTT CTT GAG TGA CT 3'NOS1f 5' GTG GGC AGG ATY CAG TGG TCC AAG CT 3'

608 D.H. Leavitt (pers. comm.)NOS1r 5' CTG AGA TTC CCT TTG TTA GTG GC 3'

R35f 5' GAC TGT GGA YGA YCT GAT CAG TGT GGT GCC 3'658 Brandley et al. (2011)

R35r 5' GCC AAA ATG AGS GAG AAR CGC TTC TGA GC 3'C2LF 5' ATCTGCGGGTCAAACCACAG 3' 828 Bryson et al. (2012)C3LR 5' GCGTGTGYTTGGTGGGTCAT 3'ND4 5' CACCTATGACTACCAAAAGCTCATGTAGAAGC 3' 870 Arévalo et al. (1994)Leu 5' CATTACTTTTACTTGGATTTGCACCA 3'