welcome and setting a context - genome.govwelcome and opening remarks author: eric green subject:...
TRANSCRIPT
![Page 1: Welcome and Setting a Context - Genome.govWelcome and Opening Remarks Author: Eric Green Subject: Genomics of model organisms and human biology: Insights from the modENCODE Project](https://reader033.vdocuments.net/reader033/viewer/2022060900/609dc8d04ffa33002c17af32/html5/thumbnails/1.jpg)
Eric Green, M.D., Ph.D. Director, NHGRI
Welcome and Setting a Context
![Page 2: Welcome and Setting a Context - Genome.govWelcome and Opening Remarks Author: Eric Green Subject: Genomics of model organisms and human biology: Insights from the modENCODE Project](https://reader033.vdocuments.net/reader033/viewer/2022060900/609dc8d04ffa33002c17af32/html5/thumbnails/2.jpg)
Past Future
Genomics Landscape
Present
![Page 3: Welcome and Setting a Context - Genome.govWelcome and Opening Remarks Author: Eric Green Subject: Genomics of model organisms and human biology: Insights from the modENCODE Project](https://reader033.vdocuments.net/reader033/viewer/2022060900/609dc8d04ffa33002c17af32/html5/thumbnails/3.jpg)
Human Genome Project Begins
October, 1990
Human Genome Project
![Page 4: Welcome and Setting a Context - Genome.govWelcome and Opening Remarks Author: Eric Green Subject: Genomics of model organisms and human biology: Insights from the modENCODE Project](https://reader033.vdocuments.net/reader033/viewer/2022060900/609dc8d04ffa33002c17af32/html5/thumbnails/4.jpg)
Model Organisms
Multicellular Biology
Unicellular Biology
Human Biology
Mammalian Biology
500 Myr
80 Myr
1,000 Myr
![Page 5: Welcome and Setting a Context - Genome.govWelcome and Opening Remarks Author: Eric Green Subject: Genomics of model organisms and human biology: Insights from the modENCODE Project](https://reader033.vdocuments.net/reader033/viewer/2022060900/609dc8d04ffa33002c17af32/html5/thumbnails/5.jpg)
Nature 387:1-105, 1997
First Eukaryotic Genome Sequence
![Page 6: Welcome and Setting a Context - Genome.govWelcome and Opening Remarks Author: Eric Green Subject: Genomics of model organisms and human biology: Insights from the modENCODE Project](https://reader033.vdocuments.net/reader033/viewer/2022060900/609dc8d04ffa33002c17af32/html5/thumbnails/6.jpg)
Science 282:1012-2018, 1998
First Animal Genome Sequence
![Page 7: Welcome and Setting a Context - Genome.govWelcome and Opening Remarks Author: Eric Green Subject: Genomics of model organisms and human biology: Insights from the modENCODE Project](https://reader033.vdocuments.net/reader033/viewer/2022060900/609dc8d04ffa33002c17af32/html5/thumbnails/7.jpg)
Science 287:2185-2195, 2000
Second Animal Genome Sequence
![Page 8: Welcome and Setting a Context - Genome.govWelcome and Opening Remarks Author: Eric Green Subject: Genomics of model organisms and human biology: Insights from the modENCODE Project](https://reader033.vdocuments.net/reader033/viewer/2022060900/609dc8d04ffa33002c17af32/html5/thumbnails/8.jpg)
Draft Human Genome Sequence Published
First Mammalian Genome Sequence
![Page 9: Welcome and Setting a Context - Genome.govWelcome and Opening Remarks Author: Eric Green Subject: Genomics of model organisms and human biology: Insights from the modENCODE Project](https://reader033.vdocuments.net/reader033/viewer/2022060900/609dc8d04ffa33002c17af32/html5/thumbnails/9.jpg)
Nature 420:520-562, 2002
Second Mammalian Genome Sequence
![Page 10: Welcome and Setting a Context - Genome.govWelcome and Opening Remarks Author: Eric Green Subject: Genomics of model organisms and human biology: Insights from the modENCODE Project](https://reader033.vdocuments.net/reader033/viewer/2022060900/609dc8d04ffa33002c17af32/html5/thumbnails/10.jpg)
Human Genome Project Ends
April, 2003
![Page 11: Welcome and Setting a Context - Genome.govWelcome and Opening Remarks Author: Eric Green Subject: Genomics of model organisms and human biology: Insights from the modENCODE Project](https://reader033.vdocuments.net/reader033/viewer/2022060900/609dc8d04ffa33002c17af32/html5/thumbnails/11.jpg)
Myriad Applications of Genomics
Health, Disease, & Medicine
![Page 12: Welcome and Setting a Context - Genome.govWelcome and Opening Remarks Author: Eric Green Subject: Genomics of model organisms and human biology: Insights from the modENCODE Project](https://reader033.vdocuments.net/reader033/viewer/2022060900/609dc8d04ffa33002c17af32/html5/thumbnails/12.jpg)
Genomic Medicine
Healthcare tailored to the individual based on genomic information
![Page 13: Welcome and Setting a Context - Genome.govWelcome and Opening Remarks Author: Eric Green Subject: Genomics of model organisms and human biology: Insights from the modENCODE Project](https://reader033.vdocuments.net/reader033/viewer/2022060900/609dc8d04ffa33002c17af32/html5/thumbnails/13.jpg)
Base Pairs to Bedside
Helix to Health
Nature
2003
![Page 14: Welcome and Setting a Context - Genome.govWelcome and Opening Remarks Author: Eric Green Subject: Genomics of model organisms and human biology: Insights from the modENCODE Project](https://reader033.vdocuments.net/reader033/viewer/2022060900/609dc8d04ffa33002c17af32/html5/thumbnails/14.jpg)
Function of the Human Genome Sequence
![Page 15: Welcome and Setting a Context - Genome.govWelcome and Opening Remarks Author: Eric Green Subject: Genomics of model organisms and human biology: Insights from the modENCODE Project](https://reader033.vdocuments.net/reader033/viewer/2022060900/609dc8d04ffa33002c17af32/html5/thumbnails/15.jpg)
The ENCODE Portfolio: Elucidating Genome Function
![Page 16: Welcome and Setting a Context - Genome.govWelcome and Opening Remarks Author: Eric Green Subject: Genomics of model organisms and human biology: Insights from the modENCODE Project](https://reader033.vdocuments.net/reader033/viewer/2022060900/609dc8d04ffa33002c17af32/html5/thumbnails/16.jpg)
![Page 17: Welcome and Setting a Context - Genome.govWelcome and Opening Remarks Author: Eric Green Subject: Genomics of model organisms and human biology: Insights from the modENCODE Project](https://reader033.vdocuments.net/reader033/viewer/2022060900/609dc8d04ffa33002c17af32/html5/thumbnails/17.jpg)
TGCCGCGGAACTTTTCGGCTCTCTAAGGCTGTATTTTGATATACGAAAGGCACATTTTCCTTCCCTTTTCAAAATGCACCTTGCAAACGTAACAGGAACCCGACTAGGATCATCGGGAAAAGGAGGAGGAGGAGGAAGGCAGGCTCCGGGGAAGCTGGTGGCAGCGGGTCCTGGGTCTGGCGGACCCTGACGCGAAGGAGGGTCTAGGAAGCTCTCCGGGGAGCCGGTTCTCCCGCCGGTGGCTTCTTCTGTCCTCCAGCGTTGCCAACTGGACCTAAAGAGAGGCCGCGACTGTCGCCCACCTGCGGGATGGGCCTGGTGCTGGGCGGTAAGGACACGGACCTGGAAGGAGCGCGCGCGAGGGAGGGAGGCTGGGAGTCAGAATCGGGAAAGGGAGGTGCGGGGCGGCGAGGGAGCGAAGGAGGAGAGGAGGAAGGAGCGGGAGGGGTGCTGGCGGGGGTGCGTAGTGGGTGGAGAAAGCCGCTAGAGCAAATTTGGGGCCGGACCAGGCAGCACTCGGCTTTTAACCTGGGCAGTGAAGGCGGGGGAAAGAGCAAAAGGAAGGGGTGGTGTGCGGAGTAGGGGTGGGTGGGGGGAATTGGAAGCAAATGACATCACAGCAGGTCAGAGAAAAAGGGTTGAGCGGCAGGCACCCAGAGTAGTAGGTCTTTGGCATTAGGAGCTTGAGCCCAGACGGCCCTAGCAGGGACCCCAGCGCCCGAGAGACCATGCAGAGGTCGCCTCTGGAAAAGGCCAGCGTTGTCTCCAAACTTTTTTTCAGGTGAGAAGGTGGCCAACCGAGCTTCGGAAAGACACGTGCCCACGAAAGAGGAGGGCGTGTGTATGGGTTGGGTTTGGGGTAAAGGAATAAGCAGTTTTTAAAAAGATGCGCTATCATTCATTGTTTTGAAAGAAAATGTGGGTATTGTAGAATAAAACAGAAAGCATTAAGAAGAGATGGAAGAATGAACTGAAGCTGATTGAATAGAGAGCCACATCTACTTGCAACTGAAAAGTTAGAATCTCAAGACTCAAGTACGCTACTATGCACTTGTTTTATTTCATTTTTCTAAGAAACTAAAAATACTTGTTAATAAGTACCTAAGTATGGTTTATTGGTTTTCCCCCTTCATGCCTTGGACACTTGATTGTCTTCTTGGCACATACAGGTGCCATGCCTGCATATAGTAAGTGCTCAGAAAACATTTCTTGACTGAATTCAGCCAACAAAAATTTTGGGGTAGGTAGAAAATATATGCTTAAAGTATTTATTGTTATGAGACTGGATATATCTAGTATTTGTCACAGGTAAATGATTCTTCAAAAATTGAAAGCAAATTTGTTGAAATATTTATTTTGAAAAAAGTTACTTCACAAGCTATAAATTTTAAAAGCCATAGGAATAGATACCGAAGTTATATCCAACTGACATTTA
The Human Genome Sequence
![Page 18: Welcome and Setting a Context - Genome.govWelcome and Opening Remarks Author: Eric Green Subject: Genomics of model organisms and human biology: Insights from the modENCODE Project](https://reader033.vdocuments.net/reader033/viewer/2022060900/609dc8d04ffa33002c17af32/html5/thumbnails/18.jpg)
Nature Nature
2003 2011
![Page 19: Welcome and Setting a Context - Genome.govWelcome and Opening Remarks Author: Eric Green Subject: Genomics of model organisms and human biology: Insights from the modENCODE Project](https://reader033.vdocuments.net/reader033/viewer/2022060900/609dc8d04ffa33002c17af32/html5/thumbnails/19.jpg)
New NHGRI Vision for Genomics Published
genome.gov/sp2011
February, 2011
![Page 20: Welcome and Setting a Context - Genome.govWelcome and Opening Remarks Author: Eric Green Subject: Genomics of model organisms and human biology: Insights from the modENCODE Project](https://reader033.vdocuments.net/reader033/viewer/2022060900/609dc8d04ffa33002c17af32/html5/thumbnails/20.jpg)
Five Domains of Genomics Research
![Page 21: Welcome and Setting a Context - Genome.govWelcome and Opening Remarks Author: Eric Green Subject: Genomics of model organisms and human biology: Insights from the modENCODE Project](https://reader033.vdocuments.net/reader033/viewer/2022060900/609dc8d04ffa33002c17af32/html5/thumbnails/21.jpg)
Alternate Routes Among Domains
![Page 22: Welcome and Setting a Context - Genome.govWelcome and Opening Remarks Author: Eric Green Subject: Genomics of model organisms and human biology: Insights from the modENCODE Project](https://reader033.vdocuments.net/reader033/viewer/2022060900/609dc8d04ffa33002c17af32/html5/thumbnails/22.jpg)
Understanding the Structure of
Genomes
Understanding the Biology of
Genomes
Understanding the Biology of
Disease
Advancing the Science of
Medicine
Improving the Effectiveness of Healthcare
1990-2003 Human Genome Project
2004-2010
2011-2020
Beyond 2020
Genomic Accomplishments Across Domains
![Page 23: Welcome and Setting a Context - Genome.govWelcome and Opening Remarks Author: Eric Green Subject: Genomics of model organisms and human biology: Insights from the modENCODE Project](https://reader033.vdocuments.net/reader033/viewer/2022060900/609dc8d04ffa33002c17af32/html5/thumbnails/23.jpg)
Sequencing a Human Genome
HGP (1st Sequence) Today
~6-8 years ~2-3 days
~$1B ~$4-8K
Immediate Post-HGP
~3-4 months
~$10-50M
![Page 24: Welcome and Setting a Context - Genome.govWelcome and Opening Remarks Author: Eric Green Subject: Genomics of model organisms and human biology: Insights from the modENCODE Project](https://reader033.vdocuments.net/reader033/viewer/2022060900/609dc8d04ffa33002c17af32/html5/thumbnails/24.jpg)
![Page 25: Welcome and Setting a Context - Genome.govWelcome and Opening Remarks Author: Eric Green Subject: Genomics of model organisms and human biology: Insights from the modENCODE Project](https://reader033.vdocuments.net/reader033/viewer/2022060900/609dc8d04ffa33002c17af32/html5/thumbnails/25.jpg)
Continued Key Role of Model Systems
![Page 26: Welcome and Setting a Context - Genome.govWelcome and Opening Remarks Author: Eric Green Subject: Genomics of model organisms and human biology: Insights from the modENCODE Project](https://reader033.vdocuments.net/reader033/viewer/2022060900/609dc8d04ffa33002c17af32/html5/thumbnails/26.jpg)
Caroline Kelly Mike Pazin Leslie Adams Elise Feingold Kurd Ali Jory Barone
Special Thanks!
![Page 27: Welcome and Setting a Context - Genome.govWelcome and Opening Remarks Author: Eric Green Subject: Genomics of model organisms and human biology: Insights from the modENCODE Project](https://reader033.vdocuments.net/reader033/viewer/2022060900/609dc8d04ffa33002c17af32/html5/thumbnails/27.jpg)
Improving human health through genomics research