welcome to pakistan research repository:...

Study of Multifactorial Eye Disorders in

Pakistan

By

Humaira Ayub

CIIT/SP09-PBS-002/ISB

PhD Thesis

In

Biosciences

COMSATS Institute of Information Technology

Islamabad, Pakistan Spring, 2015

ii

COMSATS Institute of Information Technology

Study of Multifactorial Eye Disorders in Pakistan

A Thesis Presented to

COMSATS Institute of Information Technology, Islamabad

In partial fulfillment

Of the requirement for the degree of

PhD

(Biosciences)

By

Humaira Ayub


Spring, 2015

iii


A Doctoral Thesis submitted to the Department of Biosciences as partial

fulfillment of the requirement for the award of Degree of PhD (Biosciences).

Name Registration Number

Humaira Ayub CIIT/SP09-PBS-002/ISB

Supervisor

Prof. Dr. Raheel Qamar (T.I.)

Tenured Professor of Biochemistry & Molecular Biology

Dean of Research, Innovation & Commercialization

COMSATS Institute of Information Technology,

Islamabad, Pakistan

Co-Supervisor

Prof. Dr. Anneke I den Hollander

Professor in Molecular Ophthalmology

Departments of Ophthalmology and Human Genetics, Radboud

University Medical Center,

Nijmegen, The Netherlands

COMSATS Institute of Information Technology,

June, 2015

iv

Final Approval

This PhD thesis titled


By

Humaira Ayub


Has been approved

For COMSATS Institute of Information Technology, Islamabad

External Examiner: __________________________________________

Dr. Bushra Mirza

Professor & Chairperson

Department of Biochemistry

Quaid-e-Azam University Islamabad

External Examiner: __________________________________________

Dr. Atika Mansoor

Chief Scientific Officer

Institute of Biomedical & Genetic Engineering

KRL Hospital, Islamabad

Supervisor: ________________________________________________



Dean of Research, Innovation & Commercialization, Islamabad

HoD: __________________________________________________



Department of Biosciences, CIIT, Islamabad

Chairman:_________________________________________________

Prof. Dr. Mahmood A Kayani

Department of Biosciences, CIIT, Islamabad

Dean, Faculty of Science: __________________________________________

Prof. Dr. Arshad Saleem Bhatti (T.I.)

CIIT, Islamabad

v

Declaration

I, Humaira Ayub, CIIT/SP09-PBS-002/ISB hereby declare that I have produced the

work presented in this thesis, during the scheduled period of study. I also declare that I

have not taken any material from any source except referred to wherever due, that

amount of similarity with other sources is within the acceptable range. If a violation of

Higher Education Commission of Pakistan (HEC) rules of research has occurred in this

thesis, I shall be liable to punishable action under the plagiarism rules of the HEC.

Date:__________________

______________________

Humaira Ayub

(CIIT/SP09-PBS-002/ISB)

vi

Certificate

It is certified that Ms. Humaira Ayub, CIIT/SP09-PBS-002 has carried out all the

work related to this thesis under my supervision at the Department of Biosciences, CIIT,

Islamabad and the work fulfills the requirement for the award of PhD Degree.

Date:_______________

Supervisor:

_______________________

Prof. Dr. Raheel Qamar, T.I.


Dean of Research, Innovation & Commercialization, Islamabad

Head of Department:

________________________


Head

Department of Biosciences

CIIT, Islamabad.

vii

DEDICATION

My Parents – who mean the world to me!

viii

ACKNOWLEDGEMENTS

Acknowledgements may not be of substance to any research work but it’s a unique

opportunity for a writer to express gratitude to all people who have made valuable

contributions in the completion of the task. First of all, the Higher Education

Commission (HEC), Pakistan, made this endeavor possible, without whose financial

support none of the work could have been conducted.

Special thanks to my supervisor Prof. Dr. Raheel Qamar for his patience, who endured

and refined my raw work and groomed me gradually as a researcher. He is a thorough

gentleman. My co-supervisor Prof. Dr. Anneke I den Hollander helped, encouraged

and made Radboud University a wonderful learning experience, thanks to her. I am

also grateful to Mrs. Frederieke Schoenmaker-Koller, Dr. Eiko de Jong and Bjorn

Bakker in The Netherlands, who provided invaluable assistance in my work.

Dr. Maleeha Azam, Dr. Muhammad Ajmal, Dr. Syeda Hafiza Benish Ali, Dr.

Muhammad Imran, Mr. Moeen Riaz, Mr. Raja Khurram, Mr. Shakeel Ahmad, Mr.

Muhammad Shakil Khan, Mr. Liaqat Ali, Ms. Maleeha Maria, Ms. Saba Saleem and

my dear friends Sobia Shafique and Zehra Agha shared their valuable experiences

with me. Moreover their active participation and interest in my research work has

always been healthy. They were the sole outlet that I had for sharing light moments of

my time spent at CIIT. I have no enough words to thank my hostel mates and beloved

friends Ruqia, Rabia, Zarqa and Javeria who were always there to enlighten my days

far from family. I am grateful to the clinicians Dr. Farah Akhtar and Dr. Muhammad

Asim Khan and my sister-in-law Mrs. Zahida Adil for their invaluable clinical input

and help in sampling the patients.

My PhD studies also provided me an opportunity to admire the cultural diversity in

different European countries including Spain, Italy, Belgium, Germany, The

Netherlands & Portugal, which was a lifetime experience.

I would especially like to thank my family for their encouragement and support, without

which I would not have been able to achieve my goals in life and I am also grateful for

ix

their love and their constant source of admiration and for always being there whenever

I needed them. My most special thanks to my dear father Dr. Muhammad Ayub and

mother Mrs. Asma Ayub (late) who have been an inspiration and motivation

throughout my life.

In the end my sincere gratitude to all the families who donated their blood samples for

this study.

Humaira Ayub


x

ABSTRACT

Study of Multifactorial Eye Disorders in Pakistan The aim of the current study was to investigate the underlying genetic cause in the

Pakistani population of common multifactorial eye disorders including glaucoma and

age-related macular degeneration. For this purpose linkage analysis of the families

suffering from these diseases as well as case-control association analysis of sporadic

cases of reported single nucleotide polymorphisms (SNPs) was performed. The

genotyping was done by Sanger sequencing, SNP microarray analysis, exome

sequencing and Taqman/KASPar SNP genotyping assays. The preliminary analysis of

glaucoma families was carried out by sequencing candidate genes MYOC, OPTN,

WDR36 and CYP1B1, which resulted in the identification of a disease-causing mutation

(c.868dup; p.Arg290Profs*37) in CYP1B1 in a large family with primary congenital

glaucoma (PCG). 250K microarray analysis of families with PCG and juvenile-onset

open angle glaucoma (JOAG) resulted in the identification of a possible novel locus on

chromosome 7 in one family. Exome sequencing revealed possible trigenic inheritance

(variants in three genes MYO18A; c.2071G>A; p.Arg691Cys, ENOX1; c.171C>T;

p.Met57Ile and COL9A2; c.1061C>T; p.Pro354Leu) in a family with JOAG, and

another variant (c.724C>T; p.Val242Met) in NCOA7 segregating with the disease in

the same family among individuals with late onset of the disease. Moreover in another

family a possible disease-causing variant was found in the PHKG1 gene (c.125 C>T;

p.Thr42Met). In the AMD families, sequencing of the complement factor H (CFH) gene

revealed no mutations.

Association analysis was performed of polymorphisms previously reported to be

associated with glaucoma and AMD, in 1000 samples with glaucoma comprising of

500 samples of primary open angle glaucoma (POAG), 200 samples of primary angle

closure glaucoma (PACG) and 300 pseudoexfoliation glaucoma (PEXG) samples, as

well as 300 unaffected controls. In addition, 300 samples of AMD patients and 250

unaffected age and gender-matched controls were screened. Of the 11 polymorphisms

screened in the glaucoma cohort, significant association of HSP70 (rs1043618) and

NOS3 (27bp VNTR in intron 4) polymorphisms with all three types of glaucoma were

found, whereas association of BIRC6 (rs2754511) and P450 (c.-2805T>C)

polymorphisms were found only for PEXG. 16 polymorphisms in genes of the

apoptotic, oxidative stress, complement and inflammatory pathways were screened in

xi

the AMD cohort. Significant association was found for polymorphisms in MMP2

(rs243866) and CX3CR1 (rs3732378 and rs3732379) with dry AMD, for NOS3 (27bp

VNTR in intron 4), and ARMS2 (rs10490924) with wet AMD and for ILβ (rs16944)

both with wet and dry AMD.

In conclusion, in the present study possible novel genetic causes of familial glaucoma

were identified, which included a possible novel locus in a PCG family, a possible

trigenic pattern of inheritance in a JOAG family involving three genes (MYO18A,

ENOX1, COL9A2), and in the same family a variant in the NCOA7 gene possibly

responsible for late-onset glaucoma in a separate loop. Furthermore, in another family

with JOAG, a variant in the PHKG1 gene was found to segregate with the disease.

Moreover, SNPs in oxidative stress and apoptosis components were found to be to be

associated with sporadic glaucoma. In addition, AMD-associated genes were for the

first time screened in the Pakistani population, which resulted in the identification of

variants in the complement and inflammatory pathway to be associated with AMD in

the Pakistani population.

xii

TABLE OF CONTENTS

1 Introduction………………………………………………………………

1

1.1 Multifactorial Diseases…………………………………………………. 2

1.2 Anatomy of Eye with Reference to Glaucoma and AMD……………… 2

1.2.1 Outer Segment…………………………………………………... 2

1.2.2 Interior Segment………………………………………………… 2

1.2.3 Posterior Segment………………………………………………. 4

1.2.4 Optic Nerve Head………………………………………………. 8

1.3 Glaucoma……………………………………………………………….. 8

1.3.1 Types of Glaucoma……………………………...……...………. 8

1.3.1.1 Primary Open Angle Glaucoma………………………. 9

1.3.1.2 Primary Angle Closure Glaucoma……………………. 9

1.3.1.3 Pseudoexfoliative Glaucoma……………………...….. 10

1.3.1.4 Syndromic Forms of Glaucoma…….………………… 11

1.3.2 Prevalence………………………………………………………. 11

1.3.3 Pathophysiology of Glaucoma…………………….……………. 11

1.3.4 Signs, Symptoms and Diagnosis………………………………... 13

1.3.5 Risk Factors of Glaucoma………………………………………. 14

1.3.5.1 Raised Intraocular Pressure…………………………… 14

1.3.5.2 Age……………………………………………………. 14

1.3.5.3 Ethnicity………………………………………………. 14

1.3.5.4 Miscellaneous Factors……………………………..…. 14

1.3.6 Treatment of Glaucoma…………………………………………. 14

1.4 Age-Related Macular Degeneration……………………………………. 15

1.4.1 Prevalence of AMD……………………………………………... 16

1.4.2 Clinical Classification of AMD………………………………… 16

1.4.2.1 Dry AMD……………………………………………... 16

1.4.2.2 Wet AMD……………………………………………... 17

1.4.3 Pathophysiology of AMD…………..…………………………... 17

1.4.2.1 Formation of Drusen………………………………….. 17

1.4.2.2 Formation of Lipofuscin……………………………… 20

1.4.2.3 Choroidal Neovascularization and Inflammation…….. 20

1.4.4 Risk Factors……………………………………………………... 21

1.4.4.1 Age……………………………………………………. 21

1.4.4.2 Smoking………………………………………………. 21

1.4.4.3 Diet……………………………………………………. 21

1.4.4.4 Exposure to Sunlight………………………………….. 21

1.4.5 Treatment of AMD……………………………………………… 22

1.5 Molecular Pathology of Glaucoma and AMD…….……………………. 23

1.5.1 Role of Oxidative Stress in Glaucoma and AMD………………. 23

1.5.2 Role of Immune system in Glaucoma and AMD……………….. 27

1.6 Genetic Etiology of Glaucoma and AMD……...………………………. 28

1.6.1 Molecular Genetics of Glaucoma……………………………… 29

1.6.2 Molecular Genetics of AMD…………………………………... 33

1.7 Study Overview………………………………………………………… 34

xiii

2 Materials & Methods………………………………………………………….. 36

2.1 Ethics Statement…………………………………………………………. 37

2.2 Participants of the Study…………………………………………………. 37

2.2.1 Families with Glaucoma and AMD……………………………… 37

2.2.2 Sporadic Cases and Controls…………………………………….. 37

2.3 Clinical Diagnostic Criteria……………………………………………… 39

2.3.1 Diagnosis of Sporadic Cases…………………………………….. 39

2.3.2 Diagnosis of Families……………………………………………. 39

2.4 Collection of Blood Samples and Genomic DNA Extraction……………. 40

2.4.1 DNA Extraction and Dilution……………………………………. 40

2.5 Screening Glaucoma and AMD Families………………………………... 41

2.5.1 Exclusion of Known Genes…..………………………………….. 41

2.5.1.1 Primer Design and Polymerase Chain Reaction……….. 41

2.5.1.2 Sanger Sequencing and InSilico Analysis of Variants... 41

2.5.1.3 Segregation Analysis of Variants in OPTN, MYOC and

WDR36…………………………………………………

42

2.5.1.4 Mutation and Segregation Analysis of Variants in

CYP1B1………………………………………………...

42

2.5.2 Homozygosity Mapping Using Microarray Analysis……………. 43

2.5.2.1 Brief 250K Microarray Protocol………………………. 43

2.5.3 In Silico Analysis of 250K Microarray Data…………………….. 43

2.5.4 CA-repeat Marker Analysis……………………………………… 43

2.5.5 Plausible Candidate Gene Analysis and Mutation Screening…… 44

2.6 Exome Sequencing……………………………………………………….. 45

2.6.1 Exome Variant Filtering….……………………………………… 49

2.6.1.1 Variant Filtering in Recessive Families……………….. 49

2.6.1.2 Variant Filtering in Dominant Families……………….. 49

2.6.2 Variant Screening and Validation………………………………... 50

2.7 Screening of Sporadic Cases……………………………………………... 50

2.7.1 SNPs Genotyped by Taqman® / KASPar Assay…….................. 51

2.7. 2 PCR Restriction Fragment Length Polymorphism Analysis…… 51

2.7.3 Variable Number of Tandem Repeat (VNTR) Genotyping….…. 59

2.7.4 Variation Analysis by Sanger Sequencing…………….………... 59

2.8 Statistical Analysis……………………………………………………….. 61

3 Results………………………………………………………………………….. 62

3.1 Results of Glaucoma Families………………………………………….. 63

3.2 Exclusion of Known Genes…………………………………………….. 63

3.2.1 MYOC, OPTN, WDR36 and CYP1B1 Screening……………….. 63

3.2.1.1 MYOC, OPTN and WDR36 Analysis………………… 63

3.2.1.2 Identification of a Homozygous CYP1B1 Mutation in

PCG Family GLC 16………………………………….

65

3.3 SNP Microarray Analysis Results…………………………..………….. 69

3.3.1 Identification of a Possible Novel Locus of Primary Congenital

Glaucoma……...

69

3.3.2 Identification of Homozygous Region in JOAG Family

GLC4……...……………………………………………………

73

xiv

3.3.3 Identification of Homozygous Region in Juvenile Open Angle

Glaucoma Family GLC 8…………………...………………….

76

3.4 Next Generation Sequencing Analysis ………………………………… 79

3.4.1 Identification of Three Variants MYO18A, ENOX1 and

COL9A2 in JOAG Family GLC 1……………………………..

79

3.4.2 Identification of a Variant in PHKG1 in JOAG Family GLC 5.. 82

3.5 Case-Control Association Studies ……………………………………... 85

3.5.1 Case-Control Studies of Glaucoma……………………………. 85

3.5.1.1 Screening BIRC6 and PDIA5 Polymorphisms in

Glaucoma Cohort …………………………………….

85

3.5.1.2 Screening OPTN and MYOC Polymorphisms in

Glaucoma Cohort……………………………………..

88

3.5.1.3 Screening Oxidative Stress and Apoptotic Pathway

Gene Polymorphisms in Glaucoma Cohort…………..

88

3.5.1.4 Screening PLEKHA7, COL11A1, PCMTD1

Polymorphisms in PACG Cohort…………………….

94

3.6 Results of AMD Families...…………………………………………….. 94

3.7 Case-Control Studies of AMD………………………………………….. 97

3.7.1 Screening Polymorphisms Known AMD Genes…………..…... 98

3.7.1.1 CFH and ARMS2…………………………………….. 98

3.7.1.2 C2/CFB……………………………………………..... 98

3.7.1.3 C3…………………………………………………….. 101

3.7.2 Screening Polymorphisms in Lipid pMetabolism Associated

Gene…………………………………………………………….

101

3.7.2.1 APOE………………………………………………… 101

3.7.3 Screening Polymorphisms in Immune System Pathway Gene.. 104

3.7.3.1 CX3CR1……………………………………………… 104

3.7.4 Screening Vascular System Related Gene Polymorphisms…… 106

3.7.4.1 VEGF………………………………………………… 106

3.7.4.2 Intron 4, 27bp VNTR in NOS3………………………. 108

3.7.5 Screening Polymorphisms in Genes Implicated in Oxidative

Stress……………………………………………………………

108

3.7.5.1 MMPs………………………………………………… 108

3.7.5.2 TIMP3………………………………………………... 111

3.7.5.3 TNF and ILβ………………………………………….. 111

3.8 Summary……………………………………………………………….. 114

4 Discussion……………………………………………………………………… 121

4.1 Glaucoma Families…………………………………………………….. 122

4.2 Case-Control Association Analysis: Glaucoma………………………... 128

4.3 Familial Screening and Case-Control Association Analysis: Age-

Related Macular Degeneration………………………………………….

138

4.4 Conclusion……………………………………………………………… 145

4.5 Future Perspective……………………………………………………… 145

5 References……………………………………………………………………… 147

xv

Fig 1.1

Cross sectional view of the eye……………………………………………..

3

Fig 1.2 A schematic diagram of the retina…………………………………………. 7

Fig 1.3 Differences between an RPE cell of a 3-year old child and an 80-year old

person……………………………………………………………………….

18

Fig 1.4 Pathological mechanisms involved in glaucoma…………………………... 24

Fig 1.5 Pathological mechanisms involved in AMD……………………………….. 25

Fig 3.1 Segregation analysis and sequencing chromatogram of identified variants

in OPTN in POAG families………………………………………………...

66

Fig 3.2 Sequence chromatogram of rs11258194; c.293T>C; p.Met98Lys in OPTN. 67

Fig 3.3 Pedigree of a large consanguineous Pakistani family with PCG (GLC 16).. 68

Fig 3.4 Clinical analyses of the two affected members in the PCG family GLC 2.... 70

Fig 3.5 Homozygosity mapper plot of the PCG family (GLC 2)............................... 71

Fig 3.6 Homozygous region linked to PCG in two affected individuals II: 3 and II:

4 of family GLC 2..........................................................................................

72

Fig 3.7 Homozygosity mapper plot of homozygous regions in a juvenile open

angle glaucoma family GLC 8.......................................................................

74

Fig 3.8 Pedigree of a recessive consanguineous Pakistani family with juvenile

open angle glaucoma (GLC 4)................…………………………………...

75

Fig 3.9 Pedigree of a consanguineous Pakistani family with juvenile open angle

glaucoma (GLC 8)…………………………………………………………..

77

Fig 3.10 Homozygosity Mapper plot of homozygous regions in juvenile open angle

glaucoma family GLC 8………………………………...…………………..

78

Fig 3.11 Pedigree of a consanguineous Pakistani family with JOAG (GLC 1a & 1b) 80

Fig 3.12 Retinal Nerve Fiber Layer thickness for patient IV:10 of JOAG family 1a 81

Fig 3.13 Pedigree of a consanguineous Pakistani family with late-onset glaucoma

(GLC 1b)……………………………………………………………………

83

Fig 3.14 Pedigree of a consanguineous Pakistani family with JOAG GLC 5……….. 84

Fig 3.15 Pedigree of non-consanguineous Pakistani families with AMD…………… 96

Fig 3.16 Forest plot of the SNPs screened for POAG……………………………….. 115

Fig 3.17 Forest plot of the SNPs screened for PACG……………………………….. 116

Fig 3.18 Forest plot of the SNPs screened for PEXG……………………………….. 117

Fig 3.19 Forest plot of the SNPs screened for wet AMD……………………………. 118

Fig 3.20 Forest plot of the SNPs screened for dry AMD……………………………. 119

Fig 4.1 Summary of the SNPs genotyped in glaucoma…………………………...... 129

Fig 4.2 Summary of the SNPs genotyped in AMD.................................................... 140

LIST OF FIGURES

xvi

Table 1.1 Loci associated with glaucoma…………………………………………. 30

Table 1.2 Genes and polymorphisms associated with POAG and PACG……….... 32

Table 2.1 Overview of collected glaucoma and AMD families ….………………. 38

Table 2.2 Primer sequences of CA repeat markers used for the chromosome 3

locus in PCG family GLC 2………………………..……………………

46


locus in PCG family GLC 2…………………………

47


locus in PCG family GLC 2……………………………………………..

48

Table 2.5 Exome variants and their primer sequences screened in JOAG family

GLC 5…………………………………………………………………...

52

Table 2.6 Variants detected by exome sequencing and analysed for segregation in

JOAG family GLC 1………………….………………………..………..

55

Table 2.7 Homozygous variants detected by exome sequencing and analysed for

segregation analysis in PCG family GLC 2……………………………

58

Table 2.8 Primer sequences and restriction enzymes used for RFLP analysis…..... 60

Table 3.1 Recurrent SNPs and de novo variations in glaucoma and AMD

associated genes identified by sequencing........…………………………

64

Table 3.2 Demographic and clinical features of the control, POAG, PACG and

PEXG cohorts…………………………………………………………...

86

Table 3.3 Results of logistic regression analysis for genotype and allele

frequencies of SNPs rs11720822 in PDIA5 and rs2754511 in BIRC6 in

POAG, PCAG and PEXG patients and control individuals…………….

87

Table 3.4 Logistic regression analysis for rs11258194, rs10906308 in OPTN and

rs2234926 in MYOC in Pakistani glaucoma cohorts and controls………

89

Table 3.5 Haplotype analysis of OPTN polymorphisms rs11258194 and

rs10906308 in Pakistani POAG cohorts………………………………...

90

Table 3.6 Logistic regression analysis of allele frequency distribution of P21

(rs1801270), P450 (rs2567206), P53 (rs1042522), HSP70 (rs1043618)

and NOS3 (27bp intron 4) polymorphisms in Pakistani glaucoma

cohorts and controls……………………………………………………..

92

Table 3.7 Allele frequency distribution of P21 (rs1801270), P450 (rs2567206),

P53 (rs1042522), HSP70 (rs1043618), and NOS3 (27bp intron 4)

polymorphisms in Pakistani glaucoma cohorts and controls…………...

93

Table 3.8 Logistic regression analysis of genotype and allele frequency

distribution of COL11A1 (rs3753841), PCMTD1 (rs1015213), and

PLEKHA7 (rs11024102) polymorphisms in Pakistani PACG cohorts

and controls……………………………………………………………...

95


distribution of polymorphisms rs1061170 in CFH and rs10490924 in

ARMS2 in AMD patients and controls…………………………………..

99


distribution of rs429608 polymorphism near C2/CFB in AMD patients

and controls……………………………………………………………...

100


distribution of rs2230199 polymorphism near C3 in AMD patients and

controls…………………………………………………………………..

102

LIST OF TABLES

xvii


distribution of rs4420638 polymorphism near APOE in AMD patients

and controls……………………………………………………………...

103


distribution of rs3732378 and rs3732379 polymorphism in CX3CR1 in

AMD patients and controls……………………………………………...

105


distribution of VEGF polymorphisms in AMD patients and controls…..

107


distribution of 27bp VNTR polymorphism in NOS3 in AMD patients

and controls……………………………………………………………...

109


distribution of MMP9 (rs17576) and MMP2 (rs243866) polymorphism

in AMD patients and controls…………………………………………...

110


distribution of rs5749482 polymorphism near TIMP3 in AMD patients

and controls……………………………………………………………...

112


distribution of polymorphisms rs1800629 in TNF and rs16944 in ILβ in

AMD patients and controls……………………………………………...

113

xviii

Annexure 1 Product size and primer sequences used to amplify the exons

and intron-exon junctions of MYOC and OPTN ………………

187

Annexure 2 Product size and primer sequences used to amplify exons and

intron-exon junctions of WRD36 and CYP1B1…………………

189

Annexure 3 Standard PCR reagent concentrations…………………………. 191

Annexure 4 Product size and primer sequence and PCR products for

candidate genes in the homozygous regions of families GLC 2,

GLC 4 and GLC 8………………………………………………

192

Annexure 5 Product size and primer sequences for the gene SH3PXD2B…. 194

Annexure 6 Homozygous regions obtained in the affected members of

families GLC 2, GLC 4 and GLC 8.............................................

195

Annexure 7 Unsolved glaucoma families........................................................ 196

Annexures

xix

LIST OF ABBREVIATIONS

Alpha

Beta

g Microgram

l Microliter

m Micrometer

A2E N-retinylidene-N-retinylethanolamine

AMD Age-Related Macular Degeneration

Apo-B Apolipoprotein B

ARM Age-Related Maculopathy

ARMS2 Age-Related Maculopathy Susceptibility 2

BAM Binary Sequence Alignment/Map format

BM Bruch’s Membrane

C3 Complement Component 3

CDR Cup-to-Disc Ratio

CETP Cholesteryl Ester Transfer Protein

CFH Complement Factor H

CNV Choroidal Neovascularization

CYP1B1 Cytochrome P450

ECM Extracellular Matrix

ET-1 Endothelin 1

GAGs Glycosaminoglycans

GWAS Genome-Wide Association Study

HDL High Density Lipoprotein

HSPs Heat Shock Proteins

HTG High Tension Glaucoma

HTRA1 High temperature requirement A1

IL Interleukin Beta

IOP Intraocular Pressure

LIPC Hepatic Lipase

LPL Lipoprotein Lipase

MYOC Myocillin

NO Nitric Oxide

NTG Normal Tension Glaucoma

ONH Optic Nerve Head

OPTN Optineurin

PACG Primary Angle Closure Glaucoma

PCG Primary Congenital Glaucoma

PEDF Pigment Epithelium Derived Factor

PEXG Pseudoexfoliative Glaucoma

POAG Primary Open Angle Glaucoma

PUFAs Poly Unsaturated Fatty Acids

RFLP Restriction Fragment Length Polymorphism

RNFL Retinal Nerve Fiber Layer

ROS Reactive Oxygen Species

RPE Retinal Pigment Epithelium

SCRs Short Consensus Repeats

SIG Steroid Induced Glaucoma

TM Trabecular Meshwork

TNF Tumor Necrosis Factor Alpha

xx

VEGF Vascular Endothelial Growth Factor

WDR36 WD repeat domain 36

NOS3 Endothelial Nitric Oxide Synthase

HSP70 Heat Shock Protein 70

Chapter 1

Introduction

2

1 Introduction

1.1 Multifactorial Diseases

Diseases involving multiple causative factors are known as multifactorial diseases. These

factors can be environmental, metabolic, functional or genetic, with strong interactions

between them. Several organs of the human body might be affected because of the complex

interactions of these factors.

There are many diseases of the eye that are multifactorial in nature e.g. myopia, diabetic

retinopathy, dry eye disease, age-related macular degeneration (AMD), glaucoma, etc.

According to the global data on visual impairment, 16 million people around the globe are

visually impaired, while 37 million are blind due to the presence of different eye diseases,

and, in addition, 137 million people have low vision. Of the visually impaired, glaucoma

and age-related macular degeneration are the major cause after cataract (Resnikoff et al.,

2004). The main focus of the current study was to explore the genetics of the multifactorial

eye diseases glaucoma and AMD.

1.2 Anatomy of the Eye with Reference to Glaucoma and AMD

Vision is one of the five most widely used senses that enable human beings to see their

surroundings. The eye is the organ that is involved in the vision process, which can be

divided into three segments namely outer, interior and posterior segments and it also

consists of the optic nerve head (ONH).

1.2.1 Outer Segment

The outer segment of the eye includes the eye lid, orbit and sclera; these parts protect the

eye from external hazards.

1.2.2 Interior Segment

The interior segment consists of the cornea, iris, aqueous humor, lens, ciliary body, stroma

and pupil, which are mostly involved in focusing the light coming from an object and

maintaining the pressure in the eye (Fig.1.1). The cornea is the transparent portion of the

3

Figure 1.1 Cross sectional view of Eye (Patel and Lundy 2002)

4

eye with no blood supply and allows the light rays to enter the eye through it. Corneal

transparency is lost at the ends where it merges into the sclera; this point of merging is

called the limbus. There is a fluid filled chamber between the lens and the cornea, which

is known as the aqueous chamber. The fluid in the aqueous chamber is secreted by the

ciliary body and is known as aqueous humor (Riordan-Eva and Whitcher 2007). This fluid

provides nutrients to the cornea and the lens, and provides the path to the light rays entering

the eye. Aqueous humor is also involved in maintaining the pressure inside the eye

(Agarwal et al., 2003; Morrison and Pollack 2011). Once the nutrients from the fluid are

extracted, it is secreted from the chamber via the drainage system i.e the trabecular

meshwork (TM) that lies behind the limbus. The fluid passes through the angle between

the cornea and anterior iris which is known as angle of the anterior chamber or iridocorneal

angle. Almost 80% of the fluid is secreted through this passage and empties into the

episcleral venous pathway; the remaining 20% of the fluid is secreted via the Schlemm’s

canal through the uveoscleral pathway (Distelhorst and Hughes 2003). The fluid outflow

is hindered to maintain the intraocular pressure (IOP) between 15-21 mmHg, which thus

maintains the proper shape of the eye and keeps all tissues in their proper position

(Morrison et al., 2005). The iris is the colored portion of the eye and can be viewed from

the cornea. This structure controls the amount of light entering the eye via a small opening;

the pupil (Michael 2005).

1.2.3 Posterior Segment

The posterior segment of the eye consists of the vitreous and retina. The vitreous is a clear

gel like fluid, which fills the posterior segment of the eye and also provides protection to

it. At the anterior side, the vitreous is in contact with the ciliary body and the lens, whereas

on the posterior side it comes in contact with the retina (Corina 1999).

The retina is a thin, almost transparent tissue, which is specialized in capturing the light

photons and initiates the process of image formation by the brain. It is composed of ten

layers of neurons interconnected by synapses and supporting cells. The deepest layer of the

retina is composed of the retinal pigment epithelium (RPE). The RPE is a single layer of

pigmented cells and is crucial for normal metabolic and supportive functions of the retina

(De Jong 2006). It serves as an obstruction in flow of ions, nutrients, metabolic products,

5

and water between the retina and the choriocapillaries. It is also responsible for the

restoration of the visual cycle (conversion of excited trans-retinal to 11-cis retinal and

recycling it back to the photoreceptors). The photoreceptors shed their tips, which are

degraded by the lysosomes through the phagocytic activity of the RPE. The regeneration

of the rod cells occurs at the base by the addition of the membrane of the outer segment,

whereas in the case of the cone cells replacement of lipids, proteins and membranes occurs

all over the individual cell rather than just at the base. This regeneration function of the

RPE is performed by the secretion of growth factors that maintain the photoreceptors,

endothelium and the choriocapillaries (Ehrlich et al., 2008). Moreover,

immunosuppressive factors are also secreted by the RPE that help to maintain the immune

functions of the eye (Strauss 2005).

The rest of the nine layers of the retina are involved in the conversion of light into

electrochemical signals and subsequently transmission of these signals to the brain via the

optic nerve for image formation. The macula lutea is the central yellow portion of the retina

with a diameter of about 6mm and is responsible for central vision. Central to the macula

is a depression known as the fovea, which has the highest concentration of cone

photoreceptor cells and thus is responsible for sharp image formation and color vision. The

yellowish appearance of the macula is caused by the presence of different pigments

consisting of antioxidants (xynthophill, carotenoids, lutein, zeaxanthin). Although only

0.5% of the retina is occupied by the fovea, 50% of the nerve fibers carry the information

from the fovea due to its dense concentration of the photoreceptor cells.

The rod and cone photoreceptors convert light into an electrical impulse. Their distribution

throughout the retina varies. The concentration of cones is highest in the fovea (199,000

cones/mm2) and decreases towards the periphery, whereas the concentration of the rods is

highest in the area at 20o from the fovea (160,000 rods/mm2). The photoreceptor density

also decreases towards the periphery. The cones contain a visual pigment known as opsin,

which is sensitive to a wide range of wavelengths, depending on the structure of the opsin

molecule. ‘L’ cones are sensitive to light with long wavelengths (red light, 564 nm), ‘M’

cones are sensitive to light with medium wavelengths (green light, 533 nm) and ‘S’ cones

to light with short wavelengths (blue light, 437 nm). The rods contain visual pigment called

6

rhodopsin, and are sensitive to blue-green light (500 nm). Rods enable vision in dim light,

are sensitive enough to even detect a single photon of light and are able to detect contrast,

motion and brightness (Provencio et al., 2000).

The Bruch’s membrane (BM) is a three-layer connective tissue sandwiched between two

basement membranes: the RPE basement membrane and choriocapillary basement

membrane (Figure 1.2). The three layers of BM are the inner collagenous layer adjacent to

the RPE known as the RPE basement membrane, an elastic central layer, and the outer

collagenous layer adjacent to the choriocapillaries basal lamina (Sivaprasad et al., 2005;

De Jong 2006). BM plays two important functions in the eye; structural support and

transport facilitation. It covers more than half of the eye and whenever extra pressure is

exerted due to raised IOP or increasing blood volume in the choroid, BM adjusts with it,

stretching along with the corneoscleral envelope, and when the pressure is lowered the

membrane reverts back to its original position (Beers and Heijde 1994; Charman 2008).

The choriocapillaries lie just behind the BM and provide the choroidal vasculature for the

transport of nutrients and waste products to and from the photoreceptors via the RPE and

BM (Nowak 2006). The transport of nutrients takes place from the choriocapillaries to the

RPE, and waste product removal occurs in the opposite direction via the BM. Certain

factors necessary for the proper functioning of the photoreceptors such as signalling

molecules and vitamins are carried to the RPE in the form of lipoproteins passing through

the BM. The fluid in the eye is moved from the RPE to the BM, which then passes to the

capillary bed and is subsequently taken away to the main blood stream. With advancing

age, significant changes occur in the BM that hinder its transport function, resulting in

accumulation of the waste material in the BM (Curcio and Johnson 2013). The retina

requires more oxygen as compared to any other tissue (Nowak 2006). In dark conditions

the photoreceptors are anoxic and thus are dependent upon the choriocapillaries for the

provision of oxygen, which provides 90% of it. Any harm to the capillaries can prove to

be fatal to the photoreceptors (Jong 2006). To fulfill the energy requirements of the retina,

it is enriched by two systems of the vasculature, the retinal vessels and the choriocapillary

bed. The retinal vessels provide nutrients to the inner retina, whereas the choroid provides

7

Figure 1.2 A schematic diagram of the retina is shown in the figure. The inset shows the choroid and layers of the retina, including the

retinal pigment epithelium (RPE) Bruch’s membrane (BM) choroid, rod cells & cone cells and basement membranes [modified; Zhang

et al., 2012]

8

nutrients to the outer retina, which is completely devoid of vessels (Campochiaro 2004;

Das and Mcguire 2003).

1.2.4 Optic Nerve Head

The optic nerve head (ONH) is a central convergence point for all retinal ganglion cells,

comprised of 1.2 million ganglion cell axons (Morrison and Pollack 2011). The nerve fibers

of these ganglion cells leave the eye at the optic disc where it forms a depression called the

cup, whereas the outer rim of this region is known as the disc (Quigley 2011). The optic

disc is 1.5 mm in diameter and the cup is 0.3 mm, with the ratio between the two in a

normal eye around 1:3 (Morrison and Pollack 2011; Karen 2006). The optic disc consists

of nerve fiber layers only and thus is not involved in any excitatory visual process; therefore

it is also referred to as the blind spot of the eye. Some ganglion cells have a pigment known

as melanopsin, which is not involved in image formation but is involved in the rapid

adjustment of the pupil size (Provencio et al., 2000).

Damage to the ONH or macula due to the interplay of multiple factors results in glaucoma

and AMD, respectively.

1.3 Glaucoma

Glaucoma is a group of nurodegenerative eye disorders, generally characterized by optic

nerve damage in one or both eyes, subsequently resulting in gradual narrowing of the visual

field. The damage is a result of the death of the retinal ganglion cells and axons in the optic

nerve (Quigley 2011). It is the second major cause of blindness worldwide (Resnikoff et

al., 2004), affecting mostly Asians (Stein et al., 2011) and Africans (Ntim-Amponsah et

al., 2004). More than 67 million people are estimated to suffer from glaucoma at present

(Quigley 1996), and the number is expected to rise to 80 million by the year 2020 (Varma

et al., 2011).

1.3.1 Types of Glaucoma

Glaucoma can be divided into primary glaucoma and secondary glaucoma. In primary

glaucoma the etiology of the disease is unknown. This form of glaucoma can be divided

into three subclasses: primary open angle glaucoma (POAG), primary angle closure

9

glaucoma (PACG) and primary congenital glaucoma (PCG). In secondary glaucoma the

etiology is usually known, and most often this category is named after the causative factor.

Secondary glaucoma consists of pseudoexfoliative glaucoma (PEXG), steroid induced

glaucoma (SIG), neovascular glaucoma, and pigmentary glaucoma.

1.3.1.1 Primary Open Angle Glaucoma

The most common type of glaucoma is POAG; a progressive chronic neuropathy of the

eye, in which many factors play a role in initiation, progression and damage to the optic

nerve with irreversible vision loss (Center 2007). POAG is a complex disease and its

classification is based on the age of onset (0-3 years primary congenital glaucoma; 10-35

years, juvenile-onset glaucoma, JOAG; 36 years and above adult glaucoma) (Gemenetzi et

al., 2012). POAG is not always associated with raised IOP and hence can also be classified

into NTG and high tension glaucoma (HTG), which classification is based upon the

pressure in the eye. In NTG the pressure remains in the normal range (less than 21mmHg),

but lowering the pressure further protects the ONH from further damage (Valk et al., 2005).

The patient becomes aware of the problem only when considerable damage has occurred

(Hewitt et al., 2006; Mukesh et al., 2002). Although the IOP is not raised in NTG, the loss

to the ONH and loss of vision is at the same level as in HTG. The reason for the occurrence

of POAG even at low pressure is still unclear, but genetic and environmental factors are

postulated to play a combined role in POAG (Fan et al., 2006).

The risk factors associated with POAG other than raised IOP (Tielsch et al., 1994), are

family history of the disease, hypertension and cigarette smoking (Wilson et al., 1987).

1.3.1.2 Primary Angle Closure Glaucoma

PACG anatomically is characterized by closure of the angle of drainage between the

trabecular meshwork (TM) and the iris (Tarongoy et al., 2009; Kim and Jung 1997). The

American Academy of Ophthalmology classifies the primary group of angle closure into

primary angle closure suspect, primary angle closure without damage and the final stage

of PACG (Tarongoy et al., 2009). PACG is more aggressive as compared to POAG, and

patients suffer from an acute and sudden attack resulting in loss of vision, but this condition

is preventable. The blockage in PACG occurs via two mechanisms; papillary block

10

mechanism and angle crowding, both of which result in abrupt elevation of IOP leading to

glaucomatic changes in the eye. The aqueous humor flows from its site of production into

the posterior chamber and then to the anterior chamber, flowing from underneath the iris,

above the lens, passing through the pupil and finally flows out from the TM. There is a

pressure difference of 0.23 mmHg in the posterior chamber and the anterior chamber (Heys

et al., 2001). In pupillary blockage, this pressure increases to 10-15 mmHg, which results

in the increased convexity of the iris, resulting in iris bombe´ that blocks the TM and thus

the drainage route of the aqueous humor. The eye anatomy is the strongest risk factor for

the development of PACG. The shape and the size of iris, placement of the lens and

anatomy of the ciliary body are the usual factors for the pupillary block. The other mode

of development of PACG is the mechanism of angle crowding, in which the iris is

sandwiched between the TM and the ciliary body forming a raised iris arrangement called

plateau iris, which then blocks the drainage of the aqueous humor and results in the raised

IOP (Wand et al., 1977; Tarongoy et al., 2009). Patients suffering from PACG also

experience pain in the eyes, vision blurring, headache, eye redness, vomiting, nausea and

circles of rainbow color around a light source. The pain radiates to the head and sinuses

and might cause corneal edema as well (Morrison and Pollack 2011). Family history, age,

and female gender are risk factors of PACG (Coleman 1999; Karen 2006)

1.3.1.3 Pseudoexfoliative Glaucoma

PEXG is a secondary form of glaucoma, occurring in the eye(s) mostly with an age-related

systemic disorder known as exfoliation syndrome (Viso et al., 2010). The syndrome is

present in almost 25% patients of open angle glaucoma (OAG) worldwide (Ritch and

Schlotzer-Schrehardt 2001). PEXG is characterized by the deposition of fibrillar

exfoliative material on the aqueous bathed surfaces of the eye including the lens, the non-

pigmented iris epithelium and trabecular and corneal endothelium (Naumann et al., 1998;

Ritch and Schlotzer-Schrehardt 2001). The disease usually manifests when the normal

passage of aqueous humor is blocked in the TM due to the accumulation of fibrillar

material, which leads to raised IOP causing OAG (Johnson et al., 2008), which is

considered to be the primary cause of the development of glaucoma in PEX syndrome.

11

1.3.1.4 Syndromic Forms of Glaucoma

There are various systemic disorders that involve ocular abnormalities. Several with

abnormalities of the anterior segment result in glaucomatic changes in the ONH and are

known as glaucoma syndromes (Wiggs 2007). These syndromes include for example Nail

patella syndrome, Alfred Reiger’s syndrome, aniridia pigment dispersion syndrome, an

Marfan’s syndrome.

1.3.2 Prevalence

Being the second most prevalent disease responsible for causing bilateral blindness,

glaucoma affects 16 million people worldwide, ¾ of whom suffer from POAG. Females

are mostly affected, comprising 55% of POAG patients, 70 % of PACG and 59% of other

types of glaucoma. Among various ethnic groups of the world, Asians are more prone to

develop glaucoma after Africans, who have the highest chance of developing glaucoma.

Among Asians, Chinese have a higher incidence of PACG patients, whereas the Japanese

have higher number of normal tension glaucoma (NTG) patients. The prevalence of POAG

is similar among various populations of the world, with the exception of Africans, where

it is the highest (Cook and Foster 2012).

1.3.3 Pathophysiology of Glaucoma

The pathophysiological features of glaucoma revolve around the TM, outflow of the

aqueous humor, the retinal ganglion cells and the optic nerve.

The TM is the vital drainage pathway for the normal outflow of the aqueous humor (Tamm

2009). Pressure is built up inside the anterior chamber of the eye in response to any

resistance in the outflow of aqueous humor from the TM (Gabelt and Kaufman 2005). A

normal pressure is necessary to maintain the normal shape of the eye and keep various

tissues in their respective positions. At stable IOP, the production rate of aqueous humor

in the ciliary body and its outflow is balanced due to a basal resistance, which helps

maintain the pressure around 20-21 mmHg. With advancing age, various physiological

changes occur in the TM. As a result, the resistance increases hindering the normal outflow

of the aqueous humor and raising the IOP (Gabelt and Kaufman 2005). The TM outflow is

12

responsible for 80% of the aqueous humor drainage, while the rest of it is done by the

uveoscleral pathway (Alm and Nilsson 2009)

A raised IOP results in disturbances in the microcirculation of nutrients to the ganglion

cells. In addition, a raised IOP can also directly damage these cells by triggering apoptosis

(Osborne et al., 2001). Moreover the TM cells have the capability of producing

extracellular matrix (ECM) components and when these components attach to the ECM, it

starts generating various cellular signals thus acting as a signaling molecule (Zhou et al.,

2000). These cells also act as phagocytes and thus have the ability to detach from the site

of formation and move around. With advancement in age these cells become committed to

phagocytosis more than any other function; once they detach from their place of origin they

may be lost via Schlemm’s canal. The TM cells are lost at a rate of 12,000 cells/ year as a

result of their movement (Gabelt et al., 2003). This decrease in the TM cells resultantly

hinders the catabolic organization of the cellular matrix (Grierson et al., 1982). Besides,

accumulation of debris in the TM blocks the drainage of the TM, and thus the nutrients

present in the aqueous humor do not reach the TM cells. In addition this also blocks the

toxic metabolites that are needed to be removed (Kaufman., 1995). Another mechanism

for the loss of retinal nerve fibers in glaucoma is accumulation of plaques that covers the

fine fibrils, which connect the ciliary epithelium and matrix of the TM thus thickening it

(Gottanka et al., 1997). The exact relationship of loss of the retinal nerve fibers with the

accumulation of the sheath particles is not known but it is postulated that the factors that

affect the formation of the sheath are the same that result in the death of the retinal fibers,

moreover, they may act in combination with IOP or by themselves may be enough to cause

the damage (Gabelt and Kaufman 2005). This accumulation results in disruption of the

cellular arrangement and death of astrocytes (neurosupportive cells; a type of glial cells

present in abundance in retina) leading to optic cupping. The death of the cells in the ONH

results in its progressive thinning till the ratio between optic rim (disc) and optic cup

decreases to 1 (Hernandez 2000). The primary damage to the optic nerve is also thought to

be due to compliance, a phenomenon in which the ONH is pushed back due to the raised

IOP, reverting to its original position when the pressure is reduced (Burgoyne et al., 1995),

this phenomenon results in disorganization of the ONH structure. If the pressure remains

high for a longer period of time, it results in reduced compliance, which then causes the

13

initial insult to the axons, besides resulting in the accumulation of the ECM material

(Johnson et al., 2000). The raised IOP also interferes with the transfer of nutrients

(neurotrophins) to the axons of the ganglion cells, and results in neuronal cell death

(Quigley 1999). Moreover, cellular apoptosis of the retinal ganglion cells is also one of the

mechanisms that can lead to pathophysiological changes of glaucoma (Quigley et al.,

1995).

1.3.4 Signs, Symptoms and Diagnosis

Raised IOP is considered to be the most important sign of glaucoma but this is not always

the case. Lower elevation in IOP indicates suspicion of glaucoma and higher eye pressure

clearly indicates the development of the disease (Coleman 1999). Rapid elevation to

extreme levels (which is mostly the case in PACG) results in sudden and chronic insult to

the ONH and rapid loss of vision. In the case of POAG, the IOP remains between 20-30

mmHg, thus causing progressive damage over a number of years (Karen 2006). A

tonometer is used to measure the IOP, to assess the individuals at risk of developing

glaucoma.

Cupping of the ONH is another symptom of glaucoma, which refers to the disturbance of

the cup-to-disc ratio. With the maximum number of axons dying, the ratio falls to 1:1,

resulting is maximum damage of the ONH (Coleman 1999; Adatia and Damji 2005).

Vision tunneling is an obvious sign of glaucoma and occurs due to the loss of ganglion

cells in the ONH (Arthur and Jan 2005). The progressive loss of the peripheral vision leads

to tunneling of the vision, and the patient remains unaware of the damage until only the

central vision is left (Buckingham et al., 2008). The visual field damage starts appearing

when 50 percent of the axons of the ganglion cells are dead (Cook 2009). Visual field

testing is done to measure the entire field of vision in both eyes individually in order to

estimate the damage to the field of vision as a result of glaucoma.

In addition, ophthalmic tests are conducted to differentiate between open angle and angle

closure glaucoma. A gonioscope is used to measure the angle of the anterior chamber of

the eye (Fraser and Manvikar 2005). Gonioscopy also helps to differentiate between

primary and secondary glaucoma (Morrison and Pollack 2011).

14

1.3.5 Risk Factors for Glaucoma

1.3.5.1 Raised Intraocular Pressure

Elevated IOP is the most important risk factor for glaucoma, and damage caused as a result

of elevated IOP is associated with disease progression. However, the role of IOP in

glaucoma is controversial in the case of NTG, as the pressure is normal. The disease

remains unnoticed until substantial damage has occurred (Rao 2014).

1.3.5.2 Age

Age is also a potential risk factor for glaucoma, although the disease can affect all age

groups (Drance 2008; Fraser and Manvikar 2005). The usual age range is from 10 years to

70 years for POAG, with the majority being affected after the age of 40 years (Alward et

al., 1998).

1.3.5.3 Ethnicity

The risk of development of glaucoma is higher among the Afro-Caribbean’s as compared

to white people. Africans are the most POAG susceptible ethnic group followed by Asians

(Quigley and Broman 2006)

1.3.5.4 Miscellaneous Factors

Gender is also a risk factor; females have been found to be more susceptible than males

(Quigley and Broman 2006). Vascular abnormalities, vasospasm, migraine, and diabetes

are also associated with glaucoma (Leske 2007; Fraser and Manvikar 2005). Family history

of glaucoma increases the risk many fold (Adatia and Damji 2005; Taylor and Keeffe

2001).

1.3.6 Treatment of Glaucoma

Glaucoma treatment involves only the management of IOP as it is the only treatable factor

known till date (Wilensky 1999). Once glaucoma is confirmed, controlling IOP can help

stop/slow down the progression of the disease (Lichter 2002). In the past, leeching

15

procedures were used to lower the IOP, but now medications are used to lower it. These

medications can be administered orally or in the form of ophthalmic drops.

These drops given to the patient are of different types. Miotics facilitate the flow of aqueous

humor out of the drainage system by opening it wider. Beta-blockers decrease the rate of

flow of the aqueous humor into the anterior chamber (Zimmerman and Kaufman 1977).

Lantoprost increases the flow of the aqueous humor out of the eye (Alm 2014).

Apraclonidine is used during surgeries and otherwise, to stop the sudden increase in IOP.

Sometimes when the IOP cannot be controlled with eye drops alone, a combination with

oral medication is prescribed, which targets the production of the aqueous humor.

Surgery for the treatment of glaucoma involves trabeculectomy, a procedure in which a

portion of the TM is removed surgically to facilitate the outflow of aqueous humor.

Although this procedure relieves the patient from pain and glaucoma medication, cataract

develops as an after effect of surgery mostly within 5 years. Laser surgery is becoming

more and more popular because of its fewer post-operative complications and also as it is

a painless procedure. In this procedure a laser beam is used to shrink the TM muscles,

resulting in widening of the path for the aqueous humor outflow.

1.4 Age-Related Macular Degeneration

Initial cases of age-related macular degeneration (AMD) were seen in 1875 by two

clinicians, Hutchinson and Tay, who explained the condition in aged patients due to

different changes in the fundus. Ten years later, in 1885, this condition was clinically

recognized and was known as “senile macular degeneration” by Otto Haab. Today it is

alternatively called AMD or age-related maculopathy (ARM) (Mcconnell and Silvestri

2005).

It is mainly a disease of the RPE layer of the retina that leads to various age-related changes,

causing deterioration of the photoreceptors primarily in the macular region resulting in loss

of central vision (Chen et al., 2010b). This loss of central vision adversely affects normal

daily chores of a person, such as reading, driving and facial recognition (Ehrlich et al.,

2008).

16

1.4.1 Prevalence of AMD

The usual age of onset of AMD is 50 years. Above the age of 65 years the disease

occurrence increases to 35%, and being prevalent mostly in people of 80 years of age.

Therefore, for AMD-based epidemiological studies, 50 years is chosen as the minimum

patient inclusion criterion (Bird et al., 1995). AMD is more prevalent in Caucasians as

compared to other populations (Chen et al., 2010b). AMD is common in the female gender

above the age of 75 years, and the prevalence of wet AMD is twice as high in females as

compared to males (Smith et al., 1997). Epidemiological studies in the U.S. have shown

that there are 8 million people suffering from intermediate AMD, whereas 2 million have

the advanced stages of the disease (Owen et al., 2003).

1.4.2 Clinical Classification of AMD

Changes in the macula are used to clinically diagnose AMD (Jong 2006), which can be

grouped into two classes: dry and wet AMD.

1.4.2.1 Dry AMD

Dry AMD can be classified as early, intermediate and late dry AMD. Characteristic

features of early AMD are the accumulation of small drusen without any significant loss

of vision. In intermediate AMD, accumulation of drusen occurs (both basal laminar and

basal linear deposits). Moreover, lipofuscin accumulation, thickening and disturbance in

the architecture of the BM and hyper- or hypo-pigmentation in the macular region also

takes place. The first sign of late dry AMD is the appearance of the geographic atrophy of

the RPE cells, and thus it is also known as geographic AMD or non-exudative AMD. This

results in the degeneration of the photoreceptor cells and thinning of the retinal layer, and

consequently, deterioration of vision. The retinal atrophy also moves to the other layers of

the retina, thus worsening the condition. Hyperpigmentation of the peripheral regions of

the patchy areas occurs in response to apoptosis of the RPE cells (Ding et al., 2009). Dry

AMD is responsible for loss of vision in 20% of the AMD patients (Ferris et al., 1984).

17

1.4.2.2 Wet AMD

A characteristic feature of wet AMD is the formation of new vessels in the sub-retinal

space, and therefore it is also known as neovascular AMD or exudative AMD. The classical

pattern of growth of these vessels is across the BM and into the sub-retinal space (Ding et

al., 2009). Vision is severely compromised, primarily due to hemorrhage and exudate

formation, and secondly due to the cellular apoptosis. The CNV can cause detachment of

the RPE or the retina. As the CNV progresses to the macular region, the elastic layer of the

BM becomes thin in the foveal region. This results in reduction of the foveal region to

55nm, also increasing the porosity of the foveal region to up to 35% (Ambati et al., 2003).

The end stage of wet AMD is disciform scar formation, vascularised by the choroid and

sometimes by the retinal blood supply as well. The bigger the scar is, the greater the loss

of the RPE and photoreceptors (Green and Enger 2005). People with wet AMD may also

develop blind spots.

1.4.3 Pathophysiology of AMD

The outer surface of the retina, which is a combination of RPE, photoreceptor cells (rods

and cones) and Bruch’s membrane (BM), faces the choroid and hence is dependent on the

choriocapillaries for nutrition, while the internal surface faces the vitreous chamber. All

these parts together are called Ruysch’s complex and are responsible for retinal function

(Jong 2006). With advancing age, degenerative changes in RPE, BM and choriocapillaries

(in the case of wet AMD) are the characteristic features of AMD (Coleman et al., 2008).

The pathological features of AMD involve changes in the RPE cells, Bruch's membrane

and photoreceptor cells (Fig. 1.3) and the mechanisms leading to AMD are formation of

the drusen, formation of lipofuscin, choroidal neovascularisation and inflammation.

1.4.3.1 Formation of Drusen

The clinical hallmark of AMD is the formation of deposits or drusen, which can vary in

color (white to yellow) and size (De Jong 2006; Nowak 2006). The particles of drusen

lump together as a result of the aging process, which in turn is due to many factors including

physiological changes, oxidative stress, inflammation and the activity of the immune

system, which all play a central role in the formation of drusen (Anderson et al., 2010).

18

Figure 1.3 Differences between an RPE cell of a 3-year old child and an 80-year old person.

The outer segments of the rods and cones are embedded in the interphotoreceptor matrix

(blue-gray areas) and partially surrounded by apical pseudopodial RPE processes). The

figure shows the shed disks (right-hand panel); digested by the RPE. The right-hand panel

shows enlarged lipofuscin granules, the thickened Bruch's membrane, and attenuation of

the choriocapillaries. The central elastic lamina in Bruch's membrane becomes more

porous in old age (De Jong 2006)

19

Drusen are generally composed of glycoproteins (central part), surrounded by

apolipoproteins (A & E), chaperone proteins, inflammatory proteins, fibronectin,

vitronectin and RPE debris (Jong 2006). The major components of drusen are lipids, which

originate from the membrane debris of the shed photoreceptor discs (Malek et al., 2003).

The RPE transports the membrane bound particles (secretary proteins, lipids, and

cytoplasm), and malfunctioning of the RPE is thus thought to be involved in the formation

of drusen in the BM. Moreover, ECM remodelling is also suggestive of drusen formation

due to its presence in different regions in the BM (Hageman and Mullins 1999; Luibl et

al., 2006). Moreover, drusen formation is probably an active and discriminatory process

rather than just a slow build-up of lipid and protein debris in the BM, and thus not only age

but also genetic components and environmental stress factors coalesce to cause the disease,

which explains why not all elderly people have AMD (Ehrlich et al., 2008; Sivaprasad et

al., 2005; Jong 2006).

Drusen, on the basis of their aggregation site in the BM and composition are classified into

two categories: basal laminar drusen and basal linear drusen. Basal laminar drusen are

located between the RPE and basement membrane of RPE (Russell et al., 2000), whereas

basal linear drusen are located between the RPE basement membrane and the inner

collagenous layer of BM (Curcio and Millican 1999). Basal laminar drusen are considered

as a histological finding of AMD, consisting mostly of collagen, fibronectin, laminin, and

lipids, which are formed during advanced stages of the disease (Yamada et al., 2006; Reale

et al., 2009). Basal linear drusen consist of lipoprotein particles and lipid aggregates that

stack together forming a lipid wall (Curcio and Millican 1999).

Based on the appearance of the boundary of drusen, they can be classified into ‘soft’ or

‘hard’, drusen. Soft drusen are known to accumulate in the macular region, increasing the

risk of AMD many-fold (Davis et al., 2005; Klein et al., 2007). Soft and basal linear drusen

are fragile, oily and not easily isolatable particles, and the lipids present in the soft drusen

are membranous debris (Rudolf et al., 2008). Hard drusen mostly accumulate in the

peripheral region and are easily isolated. The major components of hard drusen are

apolipoproteins and lipoproteins (Ryan et al., 2012)

20

1.4.3.2 Formation of Lipofuscin

Yellowish brown cellular debris, known as age pigment or lipofuscin, accumulates over

time in the RPE (Terman and Brunk 1998). It is composed of bisretinoids, lipids (~50%)

and proteins (~44%) (Julien and Schraermeyer 2012) and shed membranes of the outer

segments of photoreceptor cells (Saprunova et al., 2010). The accumulation of lipofuscin

causes the death of RPE cells and result in dark patchy areas (geographic atrophy) that

gives rise to dry AMD (Holz et al., 2007). Lipofuscin amassing in the RPE results in

adverse effects on the RPE. Its component N-retinylidene-N-retinylethanolamine (A2E)

seems to eliminate the acidic environment of the lysosome and thus hinders the degradation

activity of the lysosome, in turn hindering the phagocytic property of the RPE cells (Godley

et al., 2005). Moreover, A2E activates the complement system, which then results in

activation of the immune system (Radu et al., 2011). It also has the ability to stimulate the

production of reactive oxygen species (ROS) in response to light (Saprunova et al., 2010).

1.4.3.3 Choroidal Neovascularization (CNV) and Inflammation

Normally, endothelial cells control angiogenic signals, and thus a balance is maintained

between the pro-angiogenic factors (VEGF) and anti-angiogenic factors (pigment

epithelium derived factor, PEDF) (Das and Mcguire 2003). If this balance is disturbed as

a result of ischemia or hypoxia, it results in upregulation of angiogenic growth factors

(Campochiaro 2004). In the choriodal vasculature, besides ischemia and insult, also local

inflammation and activation of the immune system are thought to play a significant role in

the initiation and progression of CNV (Das and Mcguire 2003; Anderson et al., 2002). The

immune cells, like mast cells and neutrophils, have the ability to disrupt the balance of pro-

and anti-growth factors by releasing pro-angiogenic factors (Kijlstra et al., 2005). VEGF

and PEDF have been postulated to play a very important role in the formation of CNV, and

thus therapeutic strategies have been and are being developed to maintain the balance

between VEGF and PEDF (Nowak 2006). The new vessels (neovascularisation) thus

formed either remains under the RPE or they may break through the RPE cells and enter

the sub-retinal tissue. The blood from these vessels may also seep out into the sub-retinal

area giving it a grayish color (Ambati et al., 2003).

21

1.4.4 Risk Factors

1.4.4.1 Age

Age is a major risk factor for AMD. In the age group of 65-74 years, it is prevalent among

approximately 20% of people, and in the 75-84 year age group it occurs in almost 35% of

people (Bonnel et al., 2003). Major changes occurring with age are the accumulation of

lipids and lipofuscin formation in the BM, which when exposed to daylight generate ROS

that are potent in damaging the membranes (protein and lipid). A2E creates phototoxic

environment (via blue light), disrupting the membrane integrity, and apoptotic death of the

RPE cells. Similarly, lumping of drusen associated with AMD occurs with increasing age

(Sparrow et al., 2000; Schutt et al., 2000).

1.4.4.2 Smoking

Smoking is a single, strong, modifiable risk factor of AMD that increases the risk of

development of disease 2 to 4 times, and persists as a risk factor for even 20 years after

cessation of smoking (Morris et al., 2007). There is a linear relationship in the number of

cigarettes smoked and the progression of AMD (Coleman et al., 2008). Depletion of

antioxidants and the resultant oxidative stress might be the result of smoking, but the exact

mode of action of involvement of smoking in causing AMD is not known (Dhubhghaill et

al., 2010; Cano et al., 2010).

1.4.4.3 Diet

A diet rich in fats and cholesterol has been associated with increased risk of developing

AMD. A mineral- and antioxidant-rich diet decreases the risk of disease progression by

25% (2001). Carotenoids are also found to have a protective role in AMD (Seddon et al.,

1994).

1.4.4.4 Exposure to Sunlight

Exposure to sunlight has been shown to be associated with increased risk of development

of AMD but not its progression. Use of sunglasses or a hat have been seen to be protective

against the development of AMD (Tomany et al., 2004a). The possible mechanism of

22

sunlight-induced damage is the creation of oxidative stress in the macular region (Taylor

et al., 1992).

1.4.5 Treatment of AMD

There is no standard treatment of AMD that can revert the loss of vision. Therefore,

prevention is the best mode of defense against the disease. Taking care of modifiable risk

factors, such as smoking and diet, can help reduce the chances of developing the disease

(Tomany et al., 2004b).

Currently, there is no medication available for the cure of dry AMD or its prevention from

advancing to the late stage. Usually, dietary supplements are used to reduce the chances of

the disease entering into advanced stages. The Age Related Eye Disease Study (AREDS)

found that a combination of antioxidant minerals and vitamins act as preventive agents, but

this study could not establish a regimen for the cure of the disease, since the combination

supplement could not prevent the disease from entering the advanced stages (Age-Related

Eye Disease Study Research Group., 2001). In the next study trial, lutein and zeaxanthin

were added to the supplementation, which further decreased the chances of development

of advanced stages of the disease. It was found to be 20% more beneficial as compared to

the previous supplement (Age-Related Eye Disease Study 2 Research Group., 2013). Beta-

carotene has been reported to be associated with lung cancer in smokers, and hence was

removed from the final formulation of the supplement. The current supplement that is given

to patients with dry AMD comprises of vitamin C (500 mg), vitamin E (400 IU), zinc (as

zinc oxide 80 mg), copper (as cupric oxide 2mg), lutein (10mg)/zeaxanthin (2 mg), omega-

3 long-chain polyunsaturated fatty acids, docosahexaenoic acid (DHA-350 mg) and its

precursor, eicosapentaenoic acid (EPA-650 mg) (Ratnapriya and Chew 2013).

The most effective therapy for wet AMD is anti-VEGF therapy, which involves intravitreal

injections of humanized monoclonal antibodies, Avastin (bevacizumab) and Lucentis

(ranibizumab). The mode of action of this drug is neutralization of all active forms of

VEGF and thus its angiogenic capacity. A new therapic compound, Aflibercept, is also

given to the patients via intravitreal injections, and it acts as a soluble receptor that traps

the VEGF family of proteins (Ratnapriya and Chew 2013).

23

1.5 Molecular Pathology of Glaucoma and AMD

Many aspects of glaucoma and AMD are not fully understood, and the treatment options

are thus very limited. Therefore, there is a need to study the molecular mechanism of the

disease to gain a better understanding of the disease processes, and thus create the

possibility of developing better treatments. Interactions of various molecular mechanisms

involved in glaucoma and AMD are depicted in the flowchart in Figures 1.4 & 1.5.

1.5.1 Role of Oxidative Stress in Glaucoma and AMD

Oxidative stress can be described as the physiological production of ROS, and failure of

scavenging enzymes to eliminate them thus creates an environment of stress. With

advancement in age, the concentration of free radicals increases and results in oxidative

stress and damage to various tissues of the body, especially post-mitotic tissues such as

brain, heart, liver, and the retina. (Shigenaga et al., 1994). ROS include radical OH-,

peroxyl radical ROO-, super anion of oxygen O2-, hydrogen per oxide H2O2, hydroxyl and

singlet oxygen 1O2 (Ferreira et al., 2004). Free radicals are involved in lipid per-oxidation

of cell membrane components thus disrupting it, increasing the vulnerability of DNA,

proteins and mitochondrial DNA. This mechanism is believed to play a general role in most

degenerative diseases (Sacca et al., 2007). Under the influence of age, smoking, pollution,

and inflammation, free radicals keep on leaking from the active sites of the enzymes

(Borish et al., 1987). Oxidative stress has been reported in different ocular complications

including glaucoma (Ferreira et al., 2004) and macular degeneration (Yildirim et al., 2004).

Its role in glaucoma was postulated thirty years ago (Alvarado et al., 1981; Alvarado et al.,

1984). Subsequently, in vivo and in vitro experiments were conducted to determine the role

of oxidative stress in glaucoma (Izzotti et al., 2006). In the in vitro studies, TM cells were

treated with H2O2, which demonstrated that these cells lose their integrity and cell-to-cell

adhesion capacity decreases in the presence of H2O2 (Zhou et al., 1999). In vivo studies on

calf showed that perfusion with H2O2 resulted in a change in the drainage of aqueous humor

from the interior chamber to the posterior chamber (Kahn et al., 1983). Moreover,

treatment with anti-oxidants has been shown to provide protection to retinal ganglion cells

in rats (Ko et al., 2000). Superoxide dismutase, glutathione oxidase and catalase act as

antioxidant enzymes in eye tissues, in particular in the TM and aqueous humor, and provide

24

Figure: 1.4 Pathological mechanisms involved in glaucoma [modified (Vohra et al., 2013), (Sacca et al., 2007)]. IOP; Intra Ocular

Pressure, NO; Nitric Oxide, ET1; Endothelin1, TBM; Trabecular Meshwork, RGC; Retinal Ganglion Cells.

25

Figure: 1.5 Pathological mechanisms involved in AMD [modified (Anderson et al., 2010; Nowak 2006; Kopitz et al., 2004)].

RPE; Retinal Pigment Epithelium, NO; Nitric Oxide, CFH; Complement factor H, C3; complement 3, C2; Complement 2.

26

a defense mechanism against free radicals by scavenging them (Behndig et al., 1998).

Carotenoids such as lutein and zeaxanthin are present in the macular region (macular

pigments), where they provide the first line of defense to neurons, particularly from singlet

oxygen (Frank 1996). It has been found that the level of glutathione is lower in glaucomatic

eyes, suggesting that its protective role is compromised. Moreover, polymorphisms in

Glutathione S Transferase Mu 1 (GSTM1; that catalyse reaction of glutathione with variety

of organic compounds and is involved in detoxification process) have been associated with

glaucoma (Izzotti et al., 2003). Although the enzyme is not directly involved in IOP

management, it may protect aqueous-bathed surfaces from the possible damaging effects

of H2O2 (Kahn et al., 1983). Most damaging changes due to H2O2 occur in the inner layers

of the TM due to oxidative stress, which together with other factors can induce TM cell

loss, the thickening of the fibrils in TM, which result in compromising the integrity of the

TM (Sacca et al., 2007). The structural units of TM, glycosaminoglycans (GAGs) and

hyaluronic acid, play an important role in the outflow of aqueous humor, and their integrity

is disturbed in the presence of reduced quantities of ascorbate (Sacca et al., 2007).

Moreover, due to elevated free radicals, nitric oxide (NO) has the capacity to generate toxic

substances that can damage the TM and alter its properties (Lipton 1999). Endothelin levels

have been seen to be elevated in glaucomatous eyes, which reduce the blood flow in the

ONH and/or hinder the axonal transport and cause glaucomatic damage (Yorio et al.,

2002).

The retina has the highest consumption of oxygen compared to all other tissues, and

therefore accumulatess a high concentration of free radicals. The RPE contains many

photosensitizers, such as in the outer segments of the photoreceptor cells that contain

polyunsaturated fatty acids (PUFAs), which are continuously being shed and phagocytosed

by the RPE cells (Beatty et al., 2000). The burden of phagocytosis by the RPE increases as

a consequence of the above mentioned changes, which results in peroxidation of lipids that

damages the RPE itself thus triggering apoptosis of the RPE. As a consequence, the

apoptotic RPE cells and the undigested phagocytosed material pile up in BM and trigger

drusen formation (Ishibashi et al., 1986; Cai et al., 2000). Lipofuscin present in the RPE

cells acts as a photosensitizer, generating ROS and damaging the RPE. Moreover, the A2E

compound of lipofuscin hinders the function of the RPE, reducing its capacity of

27

phagocytosis (Gaillard et al., 1995; Holz et al., 1999). Lipofuscin can also induce

generation of ROS under the influence of light (Beatty et al., 2000).

1.5.2 Role of Immune System in Glaucoma and AMD

An inflammatory response is elicited in the eye in response to ischemia, vascular

dysregulation, oxidative stress, hypoxia, and raised IOP (Ergorul et al., 2010). The immune

system maintains the tissue architecture by helping the cells to overcome these stresses and

thus maintain the tissue architecture, which otherwise would result into neurodegenerative

changes (Schwartz and Ziv 2008). With advancing age and chronic increase in stress

factors, the potential of the immune system to overcome the stress decreases. Initially

providing a protective mechanism, the immune system overactivates the immune

regulatory protection of the tissues and thus results in an autoimmune-triggered

neurodegenerative process (Tezel 2009).

The complement cascade, auto-antibodies and T-cell cytotoxicity have been found to be

involved in the degeneration of RGC and axons in glaucoma (Wax et al., 2008). Heat shock

proteins (HSPs) have an antigenic character, and their upregulation is taken as a signal for

the removal of harmful and stressed cells thereby activating the immune response (Tezel

et al., 2000). The vascular dysregulation, as a result of raised IOP and other stressors is

also seen to play a role in activation of the immune response and ischemic injury to the

ONH (Vohra et al., 2013). In response to these changes (raised IOP, ischemia, stressors),

nitric oxide (NO) and endothelin 1 (ET-1) levels rise in the vasculature, resulting in

lowering of the IOP. However ET-1 also lowers the blood flow to the ONH, with potential

damaging consequences (Sugiyama et al., 1995). Ubiquitin-dependent proteosomal

degradation system is also disrupted by the ET-1, which decreases the ubiquitination in the

ONH and activates caspase-3, resulting in apoptosis (Dibas et al., 2008). As a result of

this disruption in the ocular blood flow, other inflammatory compounds are also

upregulated, which include tumor necrosis factor (TNF), C reactive protein (CRP),

vascular endothelial growth factor (VEGF), and interleukins (ILs) (Vohra et al., 2013). The

overexpression of VEGF activates the major histocompatability complex (MHC-I and

MHC-II), thus eliciting an immune response (Chintala et al., 2002). VEGF interaction with

28

ET-1 and involvement in VEGF has been previously reported in POAG and NTG (Iwabe

et al., 2010).

The most significant pathogenic mechanism of the immune system involved in AMD is

the complement pathway (Parmeggiani et al., 2012). Macrophages and lymphocytes have

also been reported to be present in the Ruysch's complex (Penfold et al., 1985; Dunaief et

al., 2002), moreover the oxidative stress produced in the photoreceptors also influences the

activation of the complement system, resulting in apoptosis of retinal cells in the Ruysch's

complex and accumulation of drusen (Hollyfield et al., 2010). It has been reported that the

retina and RPE can manufacture as well as transport lipoproteins, besides extracting them

from the blood (Zheng et al., 2012). Apolipoprotein B (Apo-B) mediated transport of

cholesterol has been observed to be the most important mechanism involved in the

pathogenesis of AMD (Curcio et al., 2010). The particles (Apo-B) pile up in the BM,

resulting in activation of drusenogenesis with advancing age (Curcio et al., 2009). Various

genes in these pathways have been identified as pathogenic factors for AMD in genome-

wide association studies (GWAS), which include high density lipoprotein (HDL) related

genes such as ATP binding cassette transporter 1 (ABCA1), hepatic lipase (LIPC),

cholesteryl ester transfer protein (CETP), and lipoprotein lipase (LPL) (Neale et al., 2010).

The accumulation of drusen in the BM and RPE is capable of triggering inflammation by

triggering the complement system and cytotoxicity (Pauleikhoff et al., 1990).

1.6 Genetic Etiology of Glaucoma and AMD

Various DNA sequence variations with pathogenic consequences have been reported to be

associated with the development of genetic disorders (Lai 2001). Advancement in

statistical and bioinformatics tools as well as evolution of techniques such as GWAS,

microarrays and advancement in sequencing techniques has enabled researchers in better

understanding complex diseases such as glaucoma and AMD (Feero et al., 2008). These

advancements have made the genetic analysis of these diseases somewhat easier (Fuse

2010). As glaucoma and AMD are both mutlifactorial complex disorders, multiple genes

can be involved in the pathogenicity of these diseases (Donoso et al., 2006). The current

etiology of these disease mechanisms is not clearly understood due to the complex nature

and involvement of a combination of factors in their manifestation. The interactions of

29

these multiple factors result in deviation from the Mendelian mode of inheritance of

multifactorial diseases such as glaucoma and AMD (Fan et al., 2004; Libby et al., 2005).

In addition, in the case of multifactorial diseases, more than one gene might interact with

each other in disease manifestation (Faucher et al., 2002; Baird et al., 2003). Monogenic

forms of glaucoma and AMD also exist such as PCG (Lopez-Garrido et al., 2013) and

juvenile macular degeneration (Stargardt disease) (Tuo et al., 2004).

1.6.1 Molecular Genetics of Glaucoma

To date 20 loci (Table 1.1) (GLC1A to GLC1N, GLC3A to GLC3D) have been reported

to be associated with familial glaucoma and three genes, myocillin (MYOC), optineurin

(OPTN), and WD repeat domain 36 (WDR36), have been reported to be the causative

factor in these loci (Fuse 2010). Cytochrome P450 (CYP1B1) has been found to be

associated with PCG. These loci have been found by candidate gene analysis in which a

plausible gene is screened in the family on the basis of its function (Fuse 2010). In total

more than 20 genes (Table 1.2) have been reported to be associated with POAG (Fuse

2010) and 9 genes associated with PACG were identified by GWAS (Vithana et al., 2012)

and case-control association studies in different cohorts (Shastry 2013).

Worldwide more than 70 point mutations in MYOC have been found to be associated with

POAG (predominantly with JOAG), with a 3-5% overall association with POAG (Challa

2011). MYOC encodes a 570 kDa protein, spans a 17 kb genome region and has 3 exons.

The MYOC protein has a C-terminal alfactomedin-like domain and an N-terminal myosin-

like domain (Suzuki et al., 1997). In the eye it has been reported to be present in the TM,

aqueous humor (Suzuki et al., 1997) and in the sheath of the optic nerve fibers (Tamm et

al., 1999). Different mutations in MYOC have been reported to interfere with aqueous

humor outflow and thus increase the IOP. However, the mechanism of the rise in IOP has

not been clearly defined yet (Mackey et al., 2003; Wilkinson et al., 2003).

In vivo studies of MYOC have shown that it does not seem to play a role in the pathogenesis

of glaucoma, which could be a coincidental finding, or the gene might be acting in tandem

with another gene. For examples, the. Gly399Val mutation in the the MYOC gene has been

reported to cause late-onset POAG (mean age of 51 years), however, when it occurs in

30

Table: 1.1 Loci associated with glaucoma

Locus name Gene Name Chromosomal

location

Characteristic

Features

Mode of inheritance Population

studied

References

GLC1A Myocilin 1q23 JOAG; high IOP Autosomal dominant Sheffield et al., 1993

GLC1B - 2cen-q13 Late onset, moderate IOP Stoilova et al., 1996

GLC1C - 3q21-24 Late onset Autosomal dominant Wirtz et al., 1997

GLC1D - 8q23 Adult onset Medium IOP Autosomal dominant Trifan et al., 1998

GLC1E Optineurin 10p13 Adult onset NTG Variable pattern British Sarfarazi et al., 1998

GLC1F ASB10 7q36 Late onset, low and high

IOP

Autosomal dominant U.S Wirtz et al., 1999

GLC1G WDR36 5q22.1 POAG, NTG Monemi et al., 2005

GLC1H - 2p16-p15 Late onset, moderate to

high IOP

Variable segregation

pattern

British Suriyapperuma et al.,

2007

GLC1I - 15q11-q13 Adult onset Complex segregation Caucasian Allingham et al., 2005

GLC1J - 9q22 JOAG Autosomal dominant Wiggs et al., 2004

GLC1K - 20p12 JOAG Wiggs et al., 2004

GLC1L - 3p22-p21? Late onset, autosomal dominant British Baird et al., 2005

GLC1M - 5q22.1-q32 JOAG Autosomal dominant Filipino Pang et al., 2006

GLC1N - 15q22-q24 JOAG Autosomal Dominant Chinese Wang et al., 2006a

GLC1O NTF4 19q13.3 POAG, NTG European Pasutto et al., 2009

GLC1P TBK1* 12q14 NTG, early onset Autosomal dominant African-

American

Fingert et al., 2011

GLC3A CYP1B1 2p21 PCG, very high IOP Autosomal recessive Sarfarazi et al., 1995

GLC3B 1p36.2-p36.1 PCG, very high IOP Autosomal recessive Akarsu et al., 1996

GLC3C 14q24.3-31.1 PCG, very high IOP Autosomal recessive Stoilov and Sarfarazi.,

2002

GLC3D LTBP2 14q24 PCG, very high IOP Autosomal recessive Pakistani Firasat et al., 2008

*300kb duplication in TBK1 gene

31

combination with the Arg368His mutation in CYP1B1, the age of onset of the disease

decreases to a mean age of 27 years (Challa 2011). In vivo analysis of MYOC mutations in

double mutant mice revealed that the gene is not associated with IOP maintenance, since

no TM abnormalities were seen in transgenic mice after the introduction of these mutations

(Liu and Neufeld 2003).

The optineurin gene has been reported to be associated with a late age of disease onset, but

it has been found to account for only about 1% of glaucoma mutations. Polymorphisms in

the gene are associated with NTG, and the Glu50Lys variant has been reported in POAG

cases (Leung et al., 2003). The Met98Lys variant is also associated with NTG (Craig et

al., 2006). The gene encodes a 577-kDa protein expressed in the TM, ciliary muscle, and

retina, and has been shown to have a protective role in the eye, being expressed in response

to stress (Vittotow and Borras 2002).

Mutations in WDR36 account for pathogenicity in less than 1% of glaucoma cases.

Although initially associated with glaucoma, later studies have shown no involvement of

the gene in glaucoma (Gemenetzi et al., 2012).

PCG is a developmental disorder of infants, usually occurring in sporadic cases, but

familial cases of the disease have also been reported. The disease is inherited as an

autosomal recessive trait (Sarfarazi et al., 2003; Bejjani et al., 2000). Although to date four

loci have been linked to the condition, GLC3A, GLC3B, GLC3C and GLC3D, only two

genes have been found in these loci to be causative of the disease i.e. GLC3A (CYP1B1)

and GLC3D (Latent transforming growth factor beta binding protein; LTBP2)

(Mozaffarieh et al., 2008; Coleman 1999). Around 60 different mutations in CYP1B1 have

been reported to be associated with PCG (Ressiniotis et al., 2005). To date, a single

mutation in LTBP2 has been identified to cause PCG in a Pakistani family (Ali et al., 1999),

which was also found homozygously later as a founder mutation in 12 Gypsy PCG

probands (Azmanov et al., 2011). Besides the mutations, there is just one report of a single

basepair deletion in the gene resulting in PCG (Narooie-Nejad et al., 2009).

32

Table: 1.2 Genes and polymorphisms associated with POAG and PACG

Gene Disease type Population Original study

AGTR2 POAG Japanese Hashizume et al., 2005

ANP POAG Australian Tunny et al., 1996

APOE POAG -- Copin et al., 2002

CDH-1 POAG Chinese Lin et al., 2006

EDNRA POAG Japanese Ishikawa et al., 2005

GPDS1 POAG Japanese Nakamura et al., 2009

GST POAG Estonian Juronen et al., 2000

HSPA1A POAG Japanese Tosaka et al., 2007

IGF2 POAG Chinese Tsai et al., 2003

Ilβ POAG Chinese Lin et al., 2003b

MFN1 POAG German Wolf et al., 2009

MFN2 POAG Dutch Wolfs et al., 1998

MTHFR POAG -- Junemann et al., 2005

NCK2 POAG Japanese Akiyama et al., 2008

NOS3 POAG Australian Tunny et al., 1998

NTF4 POAG German Pasutto et al., 2009

OCLM POAG -- Fujiwara et al., 2003

OLFM2 POAG Japanese Funayama et al., 2006

OPA1 POAG European Aung et al., 2002

PARL POAG German Wolf et al., 2009

PON1 POAG Japanese Inagaki et al., 2006

TAP1 POAG -- Lin et al., 2004

TLR4 POAG Japanese Shibuya et al., 2008

TNF POAG Chinese Lin et al., 2003a

TP53 POAG Chinese Lin et al., 2002

PLEKHA7 PACG Asian Vithana et al., 2012

COL11A1 PACG Asian Vithana et al., 2012

PCMTD1 PACG Asian Vithana et al., 2012

MMP9 PACG Chinese

Taiwanese

Caucasian

Qui 1990

Wang et al., 2006b

Awadalla et al., 2011a

MFRP PACG Chinese Aung et al., 2008

MTHFR PACG Pakistani Michael et al., 2008

NOS3 PACG Pakistani Ayub et al., 2010

HSP70 PACG Pakistani Ayub et al., 2010

HGF PACG Nepalese Awadalla et al., 2011b

33

1.6.2 Molecular Genetics of AMD

The role of genetics in the pathogenesis of AMD has lately been reported in a number of

genetic studies, which have been conducted to explore the underlying cause of the disease

and its mechanisms (Edwards et al., 2005). Twin studies, combined linkage analysis and

GWAS have contributed considerably in the understanding of the genetics of AMD

(Spencer et al., 2011). Studies on smaller families has resulted in the identification of

susceptible loci at 1q25-31, 9p13, 9p24, 10q26, 15q21 and 17q25 (Mancebo 1992; Klein

et al., 1998; Weeks et al., 2004; Abecasis et al., 2004) and GWAS identified loci in the

vicinity of genes such as COL8A1/FILIP1L, IER3/DDR1, SLC16A8, TGFBR1, RAD51B,

ADAMTS9, and B3GALTL (Fritsche et al., 2013). GWAS and candidate gene studies have

highlighted the role of genes including complement factor H (CFH) (Zareparsi et al.,

2005), complement component 3 (C3) (Maller et al., 2007), complement component 2,

complement factor B (C2-CFB) (Gold et al., 2006), complement factor I (CFI) (Fagerness

et al., 2009), HTRA1/LOC387715/ARMS2 (Rivera et al., 2005; Kanda et al., 2007), CETP,

TIMP3 (Chen et al., 2010a), hepatic lipase gene (LIPC) (Neale et al., 2010), VEGF-A,

COL10A1 (Yu et al., 2011), TNFRSF10A (Arakawa et al., 2011) and APOE (Mckay et al.,

2011).

Rare variant studies and GWAS have shown upregulation of the alternative pathway of the

complement system in AMD (Fritsche et al., 2013). Variants at two loci have been

recurrently shown to be associated with AMD in several studies in the world. These two

loci contain the genes complement factor H (CFH) and age-related maculopathy

susceptibility 2/High temperature requirement A1 (ARMS2/HTRA1) (Sobrin et al., 2011).

The C3 convertase enzyme and other components of the immune system are activated as a

result of complement system activation, which can occur through any of the three pathways

i.e. classical, lectin or alternative pathway, all of which act as a component of the

membrane attack complex and cell lyses. CFH has been shown to be involved in controlling

the alternative pathway of complement activation by inhibiting the activation of C3 to C3a

and C3b (Klein et al., 2005). CFH is composed of 20 repeating units of 60 amino acids

called short consensus repeats (SCRs) (Edwards et al., 2005). In SCR7 a change in the

amino acid tyrosine to histidine at position 402 has mostly been found to be associated with

34

AMD (Klein et al., 2005). This polymorphism lies in the region of the protein critical for

binding of CFH to heparin and C-reactive protein (CRP) ( Cordoba et al., 2004).

Involvement of CFH in the incidence as well as progression to the end stages of AMD has

been well established (Cao et al., 2013).

Polymorphisms in ARMS2/HTRA-1 have also been reported to be associated with increased

risk of AMD (Sundaresan et al., 2012). ARMS2 lies in the mitochondrial membrane and

is hypothesized to cause AMD by interfering with energy metabolism of the photoreceptors

as well as by activating apoptosis and reactive oxygen species (Kanda et al., 2007). The

HTRA1 protein is located in the vascular endothelium and the polymorphisms in the gene

are postulated to cause AMD by degrading the ECM by increasing the expression of the

matrix metalloproteinases (Ding et al., 2009). The variant rs10490924 in HTRA1 is

reported to be significantly associated with AMD (Sobrin et al., 2011).

1.7 Study Overview

The current study was based on investigating the underlying genetic causes of

multifactorial eye diseases, glaucoma and AMD. Both diseases are complex inherited

disorders and determination of their genetic basis is very difficult. Therefore, in order to

better understand the genetic etiology in Pakistani glaucoma and AMD patients, we

conducted genetic linkage analysis and case-control association studies. AMD familial

cases are rare, therefore mostly sporadic cases were included for genetic investigation. The

genetic analyses were conducted using high-throughput techniques, such as microarray

analysis that led to the identification of a possible novel locus for PCG, and next generation

sequencing analysis that revealed possible genetic causes in two glaucoma families with

juvenile onset of the disease.

In addition, polymorphisms in different genes were screened in sporadic cases of glaucoma

and AMD, which had been previously reported to be significantly associated with the

respective diseases in various populations. Restriction fragment length polymorphism

(RFLP), Taqman® allelic discrimination assay, KASPar assays and Sanger sequencing

were employed to explore the genetic causes of glaucoma and AMD, which led to the

identification of a number of genes involved in the pathogenesis of glaucoma and AMD in

35

the Pakistani population. However, there were also contradictory results for some of the

previously reported associated variants.

Chapter 2

Materials and Methods

37

2 Materials and Methods

2.1 Ethics Statement

The current study was approved by COMSATS Institute of Information Technology,

Islamabad, Department of Biosciences, Ethics Review Board and conforms to all of the

norms of the Helsinki Declaration. Informed written consent was obtained from all the

participants recruited for the analysis prior to sampling.

2.2 Participants of the Study

In the current study, families with glaucoma and AMD, as well as sporadic cases of

glaucoma and AMD were included.

2.2.1 Families with Glaucoma and AMD

Twenty families diagnosed with glaucoma and two families diagnosed with AMD,

collected mainly from the Punjab province and the Khyber Pakhtunkhwa (KPK) province

of Pakistan and were included in the current study. The probands were identified by

clinicians of different hospitals and were approached for a brief interview about their

family history, age of onset, and severity of their disease. After drawing the pedigree,

venous blood was drawn from all family members, and information on their medication,

diet, occupation, smoking status, and any other disease was documented.

After a detailed clinical examination the families were classified into different subtypes of

glaucoma, including POAG, PACG and PCG (Table 2.1). Complete interview and

ophthalmic examination of the POAG families allowed further classification into JOAG

and late-onset glaucoma. The potential mode of inheritance was also noted (Table 2.1).

2.2.2 Sporadic Cases and Controls

Approximately 500 POAG patients, 200 PACG patients, 300 PEXG patients and 300 AMD

cases were recruited from different ophthalmological centers in Pakistan, including the Al-

Shifa Eye Trust Hospital in Rawalpindi, the Myo Hospital in Lahore and the Ayub

Teaching Hospital in Abbottabad. In addition, 300 age- and gender-matched controls with

no signs of glaucoma or AMD were also sampled from the same centers, as well as from

38

Table 2.1 Overview of collected glaucoma and AMD families

Family Potential mode

of inheritance

Age of

onset

Number of sampled individuals

(Affected/Unaffected)

Disease

GLC 1 Dominant Juvenile 10/9 JOAG

GLC 2 Recessive Congenital 2/5 PCG

GLC 3 Recessive Juvenile 4/5 JOAG



GLC 6 Dominant Late 9/6 POAG




GLC 10 Recessive Late 2/3 PACG



GLC 13 Dominant Juvenile 8/9 PACG

GLC 14 Dominant Juvenile 4/4 PACG


GLC 16 Dominant Congenital 8/16 PCG

GLC 17 Recessive Congenital 8/12 PCG




AMD 1 Recessive NA 3/2 AMD

AMD 2 Recessive NA 2/6 AMD

NA; Not applicable

39

the general population.

2.3 Clinical Diagnostic Criteria

2.3.1 Diagnosis of Sporadic Cases

The sporadic cases of POAG, PACG and PEXG were selected on the basis of their clinical

history, cup–to-disc ratio (CDR), evaluation of the optic disc, visual field determination

and elevated IOP. They were categorized into open angle (POAG) and closed angle

(PACG) groups based on gonioscopic findings. In order to determine the presence of

exfoliative deposits on the pupillary border and the iris of the patients with PEXG, slit lamp

biomicroscopy was initially performed without dilation of the pupil. Subsequently, after

pupil dilation, patients were re-examined to detect the presence of white deposits on the

anterior lens surface. Angles were measured with a gonioscope to differentiate between

narrow and open angles among PEXG patients. Age-matched controls were recruited in

the study after complete clinical examination of the fundus. In addition, to rule out any

ocular anomalies, the controls also underwent applanation tonometery, slit lamp

examination to exclude exfoliative deposits, CDR measurement and visual field

assessment. All controls had normal visual fields, IOPs (≤ 20 mmHg) and CDRs (≤0.2).

AMD patients were recruited on the basis of a diagnosis of severe macular degeneration.

They were aged ≥ 50 years and recruited on the basis of presence of at least 15 intermediate

(64-125μm) or at least one large drusen (>125μm). Fundus photography was done as a

confirmatory test for the presence of drusen and progression of the geographic atrophy (dry

AMD), whereas fundus fluorescein angiography (FFA) and optical coherence tomography

(OCT) were performed to distinguish between patients with dry AMD and choroidal

neovascularisation (wet AMD). Control subjects were aged ≥60 years of age and did not

have AMD. Fundus examination of the eye was done for all controls before sampling to

rule out the presence of drusen.

2.3.2 Diagnosis of Families

All glaucoma family members underwent complete ophthalmic examination. Tests

included fundoscopy to observe the optic discs, tonometery to measure the IOP and

40

gonioscopy to distinguish the angle (closed or open). Moreover, FFA was done for all the

individuals of the family for examination of the retinal nerve fiber layer (RNFL) and to

determine the thickness of the nerve fiber layer. The diagnosis of PCG was made on the

basis of an age of onset of less than 3 years; megalocornea or buphthalmos (horizontal

corneal diameter >13 mm); corneal haze; breaks in Descemet membrane; raised intraocular

pressure (>21 mmHg); CDR >0.6; and the presence of additional symptoms such as

blepharospasm and photophobia.

JOAG was diagnosed on the basis of juvenile appearance of glaucoma symptoms in the

second decade of life in affected family members. On the other hand, individuals of

families with a disease onset in the fourth decade of life were diagnosed as late onset

glaucoma.

The AMD families went through similar ophthalmic examination as the sporadic cases

described in 2.3.1.

2.4 Collection of Blood Samples and Genomic DNA Extraction

Venous blood was drawn from affected and unaffected family members, sporadic cases

and controls, and stored at 4oC in acid citrate dextrose (ACD)-containing vacutainers till

further processing.

2.4.1 DNA Extraction and Dilution

The blood samples were first treated with erythrocyte lysis buffer (ELB) to lyse the red

blood cells and further treatment overnight with reagents (Pronase E, Sodium Dodecyl

Sulphate, Tris Sodium/Nitrium Chloride EDTA) to digest the proteins, remove cellular

debris and expose the nucleus. The DNA was then precipitated by the salting-out method

using 6M NaCl and 99% ethanol. The DNA was then washed in 70% ethanol. The isolated

and dried DNA was resuspended in 1X TE buffer (pH 8.0) and stored at -20˚C. The

extracted DNA was separated on 1% agarose gels containing ethidium bromide along with

a λ-HinD-III DNA ladder for quantification. After electrophoresis, DNA was visualized

using the Gel Documentation System and Bio Cap MW software V11.01 (Vilber Lourmat,

Marne-La-Vallee, Cedex1, France).

41

2.5 Screening Glaucoma and AMD Families

Twenty families with glaucoma were pre-screened for mutations in known glaucoma

genes. Two families with AMD were analysed for mutations in known AMD genes.

2.5.1 Exclusion of Known Genes

The probands of the 20 glaucoma families were first screened for mutations in MYOC,

OPTN and WDR36 followed by pathogenicity assessment of the variants and segregation

analysis in the family. Similarly, two families with AMD were screened for mutations in

CFH.

2.5.1.1 Primer Design and Polymerase Chain Reaction

Screening of the genes was done by designing primers for all coding exons and exon-intron

boundaries (enlisted in Annex 1 and 2) using the Exon Primer tool of the UCSC Genome

browser (http://genome.ucsc.edu/). Specificity of the primers as well as the primer

conditions were confirmed by using the online tool Primer 3 version 0.4.0

(http://frodo.wi.mit.edu/primer3/). The coding regions of all genes were amplified in a 25µl

reaction volume using a thermal cycler (GeneAMP, PCR System 9700, Applied

Biosystems) using 1X PCR buffer (100 mM Tris-HCl, (pH 8.3), 500 mM KCl), 0.25mM

dNTPs, 2.5mM Mg+2, 0.5μM of each primer, 2.5U Taq polymerase (Fermentas Life

Sciences, Ontario, Canada) and 50ng gDNA. The thermal cycling consisted of initial

denaturation at 95˚C for 5 min followed by 30 cycles of amplification at 95˚C for 1 min,

58˚C for 30 sec and 72˚C for 45 sec. A final extension was carried out at 72˚C for 5 min.

After amplification the samples were separated on 2% agarose gels, visualized under UV

transillumination and documented using the Gel Documentation System (Vilber Lourmat,

Marne-La-Vallee, Cedex1, France).

2.5.1.2 Sanger Sequencing and in Silico Analysis of Variants

The amplified PCR products of candidate genes were purified using the GeneJET TM PCR

purification kit (Fermentas, Life Sciences, Ontario, Canada) and sequenced bidirectionally

with forward and reverse primers using dye-termination chemistry (BigDye Terminator,

version 3 on a 3730 or 2100 DNA analyzer; Applied Biosystems) at the sequencing facility

http://genome.ucsc.edu/

42

of the Department of Human Genetics, Radboud University Medical Centre, Nijmegen,

The Netherlands. Sequence data were analyzed using Vector NTI Advance 11 software

(Invitrogen, Life Technologies, Carlsbad, CA). Identified variants were analyzed for their

pathogenicity by in silico analysis using online Alamut Biointeractive software

(http://www.interactive-biosoftware.com). Conservation scores of the variants

(http://genetics.bwh.harvard.edu/pph2), defined by the phyloP score and the Grantham

score (http://www.interactive-biosoftware.com), were calculated for each identified

variant. Moreover, the damaging effect of the variants was determined online by SIFT

(sorting intolerant from tolerant) (http://sift.jcvi.org) and Polyphen (polymorphism

phenotyping v2) (http://genetics.bwh.harvard.edu/pph2/). The Exome Variant Server

(EVS) (http://evs.gs.washington.edu/EVS/) was used to investigate the population

frequency of identified variants.

2.5.1.3 Segregation Analysis of Variants in OPTN, MYOC, WDR36

Variants in OPTN, MYOC and WDR36 with high pathogenicity scores were analysed in

the respective families for segregation using Sanger sequencing.

2.5.1.4 Mutation and Segregation Analysis of Variants in CYP1B1

Three PCG families were screened for mutations in CYP1B1. Primer designing for the two

coding exons of CYP1B1 was done as explained in section 2.5.1.1. DNA samples of the

probands of the three families were first screened for mutations. Segregation analysis was

performed in all members of PCG family GLC16 by Sanger sequencing.

2.5.2 Homozygosity Mapping Using Microarray Analysis

Three families (GLC 2, GLC 4 and GLC 8) with juvenile-onset disease were selected for

genotyping using 250K SNP arrays (Affymetrix, Santa Clara, CA) to determine

homozygous regions shared among the affected individuals of the family.

2.5.2.1 Brief 250K Microarray Protocol

Briefly, the array analysis consisted of digestion of 250 ng of genomic DNA with

restriction enzyme NspI. The digested fragments were incubated for 3 hours at 16oC to

http://genetics.bwh.harvard.edu/pph2

http://www.interactive-biosoftware.com/

http://genetics.bwh.harvard.edu/pph2/

http://evs.gs.washington.edu/EVS/

43

ligate adaptors, followed by incubation at 70oC for 20 minutes. The ligated DNA fragments

were then amplified using PCR master mix containing Titanium Taq PCR Buffer, 2.5 mM

dNTPs, GC-Melt 5M (1µl), 100µM PCR primers and Titanium Taq DNA polymerase. The

initial denaturation of the thermal cycle was at 94ºC for 3 minutes (1 cycle) followed by

30 cycles of denaturation at 94 ºC for 30 sec and annealing at 60ºC for 45 sec followed

by extension at 68 ºC for 15 sec. Final extension was done at 78 ºC for 7 min. The amplified

product was then treated with DNase I and the 3' ends were labeled at 37 ºC for 4 hours.

The fragmented samples were then hybridized with the probes on the Affymetrix 250K

array platform, after which the array was scanned using a GeneChip scanner 3000 7G

(Affymetrix).

2.5.3 In Silico Analysis of 250K Microarray Data

The 250K SNP microarray data were initially analyzed using Homozygosity Mapper, an

online tool (http://www.homozygositymapper.org/), which provides common homozygous

regions shared between the affected individuals. Homozygous regions larger than 1 Mb

were further analyzed by CA-repeat marker analysis, and exons of candidate genes in the

selected regions were sequenced to determine the presence of mutations. All data were

analysed using the Human Genome Build (hg19) release Feb. 2009.

2.5.4 CA-repeat Marker Analysis

Homozygosity mapping with 250K SNP arrays identified three homozygous regions in

family GLC 2 on chromosomes 3, 7 and 15, three homozygous regions in family GLC 4

on chromosomes 1, 2 and 10, and four homozygous regions in family GLC 8 on

chromosomes 3, 4, 6, and 11. CA-repeat marker analysis was performed for family GLC 2

to determine which of the regions segregated with the disease in the family. CA markers

were chosen on chromosomes 3, 7 and 15, with heterozygosity greater than 70%. Primer

sequences to amplify the polymorphic markers, as well as their cytogenetic locations, were

obtained from the UCSC genome browser (STS marker; https://genome.ucsc.edu), the

Marshfield Medical Center database (www.marshmed.org.gov/genetics/) and the Human

Genome Database (www.gdb.org). M13-tailed primers were designed by addition to the

forward and reverse CA markers the forward M13 sequence 5'-

http://www.homozygositymapper.org/

https://genome.ucsc.edu/

44

TGTAAAACGACGGCCAGT-3' and a reverse M13 sequence (M13 tail) 5'-

CAGGAAACAGCTATGACC- 3' respectively. A list of the CA markers used is provided

in Tables 2.2 to 2.4.

A two-step PCR was used, in which the first PCR was a standard PCR amplifying the CA

markers under standard PCR conditions (Annex 3). In a second PCR, 1 ul of the first PCR

product was amplified using M13 forward primers fluorescently labeled with FAM (blue),

NED (yellow) or VIC (green) and an M13 reverse primer. For the second PCR, 2 mM

MgCl2, 10 mM dNTPs, 20 µM fluorescently labeled M13 forward primer (FAM, VIC or

NED), 20 µM unlabelled M13 reverse primer, and 1 U Taq polymerase were used in a

reaction volume of 10µl. The thermal cycling for the second PCR consisted of an initial

denaturation step of 3 min at 94oC, then 10 cycles of denaturation at 94oC for 30 sec,

annealing at 55oC for 30 sec and elongation at 72oC for 30 sec, followed by a final extension

step of 6 min at 72 oC. The products were then visualized on 2% agarose gels to confirm

amplification. Subsequently, 2µl of the PCR products were mixed with 0.5µl LIZ (internal

lane standard) and 7.5µl formamide in a final reaction volume of 10µl. The samples were

then submitted to the Genescan facility of the Department of Human Genetics, Radboud

University Medical Centre, Nijmegen, The Netherlands, where the fragments were size-

separated using capillary electrophoresis on 3730(XL) DNA analyzer. The results obtained

were analyzed using Applied Biosystem software Gene Mapper v4.0. The difference in the

allele sizes of the selected polymorphic markers enabled the construction of haplotypes in

affected and unaffected family members. The ultimate goal was to use this information to

determine whether the haplotypes segregated with the disease in the family, and to

determine the critical linkage interval of the disease locus.

2.5.5 Plausible Candidate Gene Analysis and Mutation Screening

Several potential candidate genes resided in the homozygous regions of two families

(TMCO1 for GLC 4; TMEM74, PITX2, FOXC1 for GLC 8) and were thus screened for

mutations in the probands of the respective families by Sanger sequencing (sequencing

primers and product sizes are provided in Annexure 4), followed by segregation analysis

in all affected and unaffected family members.

45

2.6 Exome Sequencing

Two unsolved families with JOAG (GLC 1 and GLC 5) and one unsolved family with PCG

(GLC 2) were sequenced for all exons in the genome by exome sequencing. This technique

enables the identification of novel disease genes. In exome sequencing, enrichment of all

genes of the human genome is performed followed by next-generation sequencing. Three

affected members of GLC 1, two affected members of GLC 2, and four affected members

of GLC 5 were selected for exome sequencing.

The procedure was performed on a 5500xl Genetic Analyzer platform from Life

Technologies (Carlsbad, CA). The Sure Select XT Human All Exon v.2 Kit (50Mb) from

Agilent Technologies, Inc. (Santa Clara, CA) was used to capture all coding regions of

~21,000 genes in the selected family members. This procedure is known as target

enrichment. Genomic DNA is digested into smaller fragments of 150-200 bps, blunt ends

were created followed by phosphorylation of the 5’ end and adenine overhangs were

produced via Klenow fragments, followed by ligation to the indexing-specific adaptors and

subsequent PCR amplification. The PCR products were hybridized to the enrichment probe

library containing biotinylated ribonucleic acid (RNA) probes. Streptavidin-coated

magnetic beads were used to extract the hybridized fragments and the RNA probes were

digested, yielding enriched DNA for further use.

A SOLiD TM sequencer (Life Technologies) was used for next-generation sequencing,

which uses five universal sequencing primers and a ligation-mediated di-base detection

system. Initially, the universal primers were annealed to the adapter sequences, followed

by annealing and ligation of 8 nucleotide probes that was composed of two color-coded

bases and a fluorescent label at the 3’end. The 3 bases at the 3’ end of the 8 nucleotide

probes along with the fluorescent label were then cleaved off. All five universal primers

were then offset by a base followed by probe annealing, ligation, fluorescence detection

and finally by cleavage of the fluorescent label for the detection of the inserted bases. The

template DNA sequence was retrieved by decoding the sequences of the colors. The hg19

reference genome assembly was used to align the variants, using Life Scope software v2.1

(Life Technologies). Small insertion-deletion changes in the sequences were detected using

the Small Indel Tool, and variations in single nucleotides were detected using the DiBayes

46

Table 2.2 Primer sequences of CA repeat markers used for the chromosome 3 locus in PCG

family GLC 2. The Marshfield location (cM), the primer sequence and with product length

are provided.

Marker Location

(cM)

Primer Sequence 5’ to 3’ Product

size (bp)

D3S3678 67.73 F-ACCTGTAGAGTCCAGGGATGC

R-GGGCTCATTCTCATGCAAAG

219-265

D3S3647 67.73 F-GGCTCAGAGCAGGCATAC

R-CCTAACTAATAAAATGTGTTCCCAG

190-228

D3S3597 68.38 F-CACACCCATTAGGATGGAA

R-GCAAATAGTAGGTGCTCAATAAACA

261-269

D3S3624 68.77 F-GGCTCAGAGCAGGCATAC

R-CCTAACTAATAAAATGTGTTCCCAG

190-228

D3S2409 70.61 F-GGTGACAGAGACTCTTGTCTCA

R-CATTCTGGTTGGGGAACATA

115-127

D3S3629 70.81 F-CAAGCAGATGTTGCTGCC

R-GGAATTACCTGGATTGCCC

236-25

D3S3667 70.89 F-TTTAAGAAGCCTTTGTCAGAA

R-CTATTGATGTTTCATGGTGC

167-183

D3S1568 70.89 F-CCATGAACAGAACCTCCCTA

R-CCGCTGTCCTGCTGTAAG

276-296

D3S1621 70.89 F-TTTGAGAAATGCCCCC

R-GAGCCAAGCCCTGGTT

97-139

D3S1573 70.89 F-TTCATTTTTGCTTATTAAGATATGC

R-CCAGTAAATNACAGGGCTAT

136-154

D3S3561 71.22 F-TCCTGGGGACTGTGATG

R-TCCTGGGGACTGTGATG

185-229

D3S1581 71.41 F-CAGAACTGCCAAACCA

R-GGGTAACAGGAGCGAG

78-102

D3S1578 70.61 F-GCCAACACACATTAATCACATA

R-GGGGCCAAAATCTGCT

140-166

D3S1582 72.21 F-CAGCAGGTACTATGAAAGCCTGT

R-GGAACAGCCCTATGGTTCAC

154-178

D3S3660 74.65 F-GCATTTTAAGACTCACAGAATGTT

R-TGGCAGGAAGTTCTTCATT

192-202

D3S1613 75.18 F-TGTGATAAGGACCAAGGC

R-GAGCAAATTGCAGAATGAG

225-253

D3S3721 77.26 F-GAAACCTCCTGACCATCC

R-CCAGTCTTGCTCTGTCAATC

203-219

F, Forward; R, reverse

47

Table 2.3 Primer sequences of CA repeat markers used for the chromosome 7 locus in PCG

family GLC 2. The Marshfield location (cM), the primer sequence and with product length

are provided.

Marker Location

(cM)


size (bp)

D7S509 142.55 F-ACTGAACCTGGGGTGG

R-GTTGCTGGCCCTGTAGTA

203-225

D7S495 145.33 F-TGGCATTCATTTACAATAGCC

R-AGCACCTGGTCCAATTTTCT

150-168

D7S2560 145.34

F-AATGACTATTGCAGACTCAAAC

R-TAATTTCTTAGGATTCTTCAGAGG

149-195

D7S684 147.22

F-GCTTGCAGTGAGCCGAC

R-GATGTTGATGTAAGACTTTCCAGCC

169-187

D7S2202 148.73 F-TCTCTTACCCTTTGGGACCT

R-CTTGCAGATGGCCTAATTGT

149-169

D7S2513 150.22 F-GCAGCATTATCCTCAACAGC

R-CACAAATGGCAGCCTTTC

157-181

D7S661 151.16 F-TTGGCTGGCCCAGAAC

R-TGGAGCATGACCTTGGAA

252-282

D7S676 152.14 F-TGANTCTAAGCAGCCACCT

R-GCAACATGATCCAGAAAACA

148-166

D7S2511 154.43 F-CAGAGCAATACCATCAAAAC

R-GTACCATAAACTGGGTGGC

225-265

D7S794 155.1 F-GCCAATTCTCCTAACAAATCC

R-TATGCCCATGTGTTAGGGTT

168-208

D7S2442 159.53

F-TGAGCCAAGATCACAGCACT

R-TGAGCCAAGATCACAGCACT

226-236

D7S688 159.53

F-TGCAGAAATGCCTCCCTAAATATAA

R-ACAGGAAACGATTGCCATCCTT

147-161

D7S2426 160.09

F-GGTGGCTTGCCCAGAG

R-CCAGTGCATCTGTTTCCC

105-127


48

Table 2.4 Primer sequences of CA repeat markers used for the chromosome 15 locus in

PCG family GLC 2. The Marshfield location (cM), the primer sequence and with product

length are provided.

Marker Location

(cM)


size (bp)

D15S155 52.33 F-TGGAGTTTCCTGCACCTATC

R-TGCACCCAGCCTGCTAT

229-249

D15S117 56.46 F-GCACCAACAACTTATCCCAA

R-CCCTAAGGGGTCTCTGAAGA

132-150

D15S1026 72.37

F-TGAATTGAACACCTGCCC

R-AGTCAAGTTGGTTTCCCTGG

181-215

D15S1005 75.27

F-GGCTAGAAACAGGATGTCCTC

R-GCCCAGCCTTAACTGCTT

102-122

D15S114 80.3 F-AGAATGAGCAGCACTGTTTG

R-TTGTCACTGCTTTTCTCTGC

177-187


49

algorithm, with high-stringency calling. The data generated were then filtered to identify

the potential disease-causing mutation.

2.6.1 Exome Variant Filtering

Filtering of the genetic variants in the exome data was performed, as initially thousands of

variants were obtained in each individual. For each family, variants were selected that were

present in all affected individuals that were analyzed by exome sequencing. The variants

that were detected in less than 10 reads were removed. Exclusion of synonymous and non-

coding variants resulted in a few hundred remaining variants. Different filtering protocols

were used for recessive and dominant families.

2.6.1.1 Variant Filtering in Recessive Families

In recessive families variants with a population frequency of less than or equal to 0.5% in

the dbSNP database were retained. Moreover, filtering for homozygous variants was

conducted by retaining variants that were present in more than 80% of variant calls. For

filtering of the compound heterozygous variants, 20-80% variant calls were also taken into

account and only considered 2 (or more) variants that were present in the same gene. To

confirm the number of the variant calls, validation was done by checking the Binary

Sequence Alignment/Map format (BAM file) to minimize the chances of automatic

generation of the number of reads in the output file. Moreover, the variants with a

Grantham score higher than 80 or a phyloP score of more than 2.0 were retained. All these

filtering steps enabled to narrow the number of variants from hundreds to just a few

variants.

2.6.1.2 Variant Filtering in Dominant Families

In dominant families, all filtering steps were the same as for recessive families, except that

variants that were present on 20% - 80% of variant calls were retained, which potentially

represent heterozygous changes. Moreover, sequences with more than 2 reads were also

considered.

50

2.6.2 Variant Screening and Validation

Variant filtering in PCG family GLC 2 resulted in the identification of a single

heterozygous 18-bp deletion in SH3PXD2B (previously implicated in Frank-Ter Haar

syndrome, an autosomal recessive disorder involving glaucoma (Iqbal et al., 2010)) and 9

homozygous variants. These variants were screened for segregation in all family members

by Sanger sequencing. To determine whether a second heterozygous variant in SH3PXD2B

was missed by exome sequencing, all coding exons of SH3PXD2B were screened in family

GLC 2 by Sanger sequencing (primer sequences are given in Appendix 5). The exome

data for the dominant families GLC 1 and 5 were filtered using the above mentioned

criteria. First, variants in genes in the known glaucoma loci were filtered, and sequenced

to evaluate their segregation in the families (Table 2.5). Next, heterozygous variants and

compound heterozygous variants with high phyloP or Grantham scores were then analysed

for segregation (Table 2.5). Finally, variants in genes related to pathways of known

glaucoma genes were screened for segregation in family GLC 5 (Table 2.5).

After variant filtering, less than 40 potentially pathogenic variants remained for families

GLC 1 and GLC 5, which were all validated and analysed for segregation in the families

by Sanger sequencing. The sequencing primers for the variants were designed by the online

software Primer3 (http://frodo.wi.mit.edu/). The primer sequences and product sizes that

were used to amplify all analysed variants in GLC 1, GLC 2 and GLC 5 are provided in

Tables 2.5-2.7. The amplified PCR products were sequenced as described above in section

2.5.1.2.

2.7 Screening of Sporadic Cases

Approximately 500 cases with POAG, 200 cases with PACG, 300 cases with PEXG

patients, 300 AMD patients and 300 age- and gender-matched controls were genotyped for

various glaucoma and AMD associated SNPs. The SNPs were selected on the basis of their

previously reported associations with the disease. In addition, for the glaucoma cohorts two

variants (p.Thr377Arg in MYOC and p.Met98Lys in OPTN) were selected that were

recurrently detected in affected individuals of glaucoma families by exome sequencing and

were predicted to be potentially pathogenic by different pathogenicity predicting softwares.

http://frodo.wi.mit.edu/

51

Moreover, the Exome Variant Server (EVS) (http://evs.gs.washington.edu/EVS/) and 1000

Genomes were used to determine the frequency of the variants. Selected SNPs were

genotyped in the respective cohorts using various techniques as described in the following

sections (2.7.1 to 2.7.4).

2.7.1 SNPs Genotyped by Taqman® / Kaspar’s (KASP) Assay

Three intronic SNPs, rs11720822 in PDIA5, rs2754511 in BIRC6, rs10906308 in OPTN,

and the exonic variant rs2234926 in MYOC were screened in sporadic glaucoma cases and

matched controls, whereas rs1061170 in CFH, rs10490924 in ARMS2, rs429608 near CFB,

rs2230199 near C3, rs5749482 near TIMP3 and rs442063 near APOE were genotyped in

AMD samples and matched controls using the Taqman®/KASP allelic discrimination

assays performed by Real-time PCR (Applied Biosystems 7900HT Fast System and

Sequence Detection Systems Software v2.3, Foster City, CA). PCR amplification was

performed according to the protocol of the manufacturer using 10ng of DNA in a reaction

mixture of 4l, using fluorescently labeled primers containing VIC and FAM. After an

initial denaturation step of 12 min at 95oC, 50 cycles of amplification were performed for

15 sec at 92oC and termination for 90 sec at 60oC. The results of the Taqman® and KASPar

allelic discrimination assays were then analyzed with the software SDS1.4/SDS2.0.6 on

the 7500 Fast Real-time PCR system or SDS2.3/SDS2.4 on the 7900HT Fast Real-time

PCR system.

2.7. 2 PCR-Restriction Fragment Length Polymorphism (RFLP) Analysis

Glaucoma and matched control samples were genotyped by PCR-RFLP, for the following

SNPs: exonic SNPs rs11258194 in OPTN, rs1801270 in p21, rs2567206 in CYP1B1,

rs1042522 in p53, rs1043618 in HSP70, rs11024102 in PLEKHA7, rs3753841 in

COL11A1, and rs1015213 in PCMTD1. The AMD samples and matched controls were

genotyped by PCR-RFLP for the following SNPs: rs3732379 and rs3732378 in CCRX1,

rs243866 in MMP2, rs17576 in MMP9, rs1800629 in TNF and rs16944 in IL1B. PCR

primers used for amplifying the genomic intervals containing these SNPs, the product

length of the PCR product, and the annealing temperature for the PCR are provided in

http://evs.gs.washington.edu/EVS/

52

Table 2.5 Exome variants and their primer sequences screened in JOAG family GLC 5


Gene

name

Variant PhyloP Grantham SNP/ Novel

variant


size bp)

SH3RF2 1105G>C; p.Ala369Pro

3.22 0.00 rs145544864

F-CCACAAACCACAGAGAGGAC 356

R-TGTCTCTGGATGGGATGTTT

ERAP1 1939C>T;

p.Val647Ile

5.71 29 rs111363347 F-ATGATCGGGCGAGTCTCATT 246

R-TCCTTCCTTCAAGTGCCTTAGT

GPR151 694G>A;

p.Arg232*

0.05 1000 Novel F-GAGACAGTGCCAAATGTTCC 376

R-TGGTTTAACATGGCCAGAAT

TSSK1B 28G>A; p.Arg10*

1.01 1000 Novel F-CAGCCAGCAACACTTCCTTG 230

R-GGAGATGAGCATGTGGAGGA

ITGA8 405C>G;

p.Trp135Cys

6.089 215 Novel F-TTTGGAGGAGTTTGACAAGG 288

R-GCTTGAAAACATTCCAGTGC

ICMT 211A>T;

p.Cys71Arg

2.82 112 Novel F-TCAGCAAATCGGCTCTATCT 292

R-GATGAGACAGGGATGAGGAA

CASD 1046G>A;

p.Ser349Asn

2.48 81 Novel F-TGAGCTAAGACCCCCACAG 388

R-CCACAGAGAGACCGAGAGAA

MYCBP2 7295A>C;

p.Ile2432Thr

142 99 Novel F-TAGGATTGCCAGGAGGTATG 447

R-AGTCATGAGGGCTACAGTGC

SLC7A7 1103A>G;

p.Met368Thr

3.5 81 Novel F-AAACCAGAAGAGGACCAGGA 326

R-ACAACTCCAGCTGTTTCAGG

HEATR5A 911T>C; p.Glu304Gly

4.92 94 rs191067821 F-CGCAGAGTATCTTTGGAGGA 290

R-AATGTTTTGGCCTTACCATTTA

DLGAP4 733G>A;

p.Ala245Thr

5.30 58 rs146757517 F-AGTCCAGCGGCTTTTCTT 439

R-AATGTTTTGGCCTTACCATTTA

DNAH17 11588G>T;

p.Ser3863Phe

5.75 144 Novel F-GCTGAAGAAAGTCCACCAAA 364

R-TGAAGTGGTGTCTCATGTGC

53

Table 2.5 cont.


Gene

name


variant


size bp)

UQCRB 200A>T; p.Leu67Pro 4.65 113 rs139283183 F-AGGGTTAATGCGAGATGATACA 204

R-TGAGCAACACTGTCAGGTAGA

OPLAH 1750C>A; p.Gly584Ser 2.31 159 rs10107332 F-AGAAGCAGAACAGGTGTCCT 246

R-AGTCAGGAAGCCACGTACC

RMI1 980del;

p.Gln327_Thr333delinsPro

4.11 1000 rs146219782 F-CAGAACGATGTTTCACCACA 389

R-AACAGATGGACAACCAAATGA

GPR148 266C>T; p.Pro89Leu 1.48 98 Novel F-CAGCCAGCAACACTTCCTTG 230


GPR148 205C>G; p.Leu69Leu 2.39 32 Novel F-CAGCCAGCAACACTTCCTTG 230


MASTL 928A>G; p.Ile310Val 1.69 29 Novel F-GGAATGCCTGTGAAGTGTCT 157

R-TCCCTCAAACCTGGCAATCT

MASTL 2128C>T; p.Thr710Ala 5.33 74 Novel F-ACGCCTAGTAGCCTATGAGC 228

R-TCAGGTGCAAGGTAGTCTGG

NUP210 4063C>A; p.Ala1355Thr 1.78 99 Novel F-TTTTGTTTTCCAAAGGGATG 292

R-CGTTCACCTTCCAGCTAAGA

EBLN1 644T>C; p.Glu215Gly 0.46 98 Novel F-CGATATGCACCAACAGCCTC 247

R-ATCATCTGTGCTTTGCTGGC

MMP14 1016G>A; p.Arg339His 2.91 29 rs140740223 F-GACAACAGTGTGAGACTCCATC 351

R-GAGTGCCTGGTTACCTTTGA

IFT80 1229G>A; p.Pro410Leu 2.8 98 rs148396265 F-TTTTCCCAAGGATAAACTATTCTG 397

R-TTTGAAAACAAAATAGAAAGCTCA

GBA2 587C>T; p.Arg196Gln 4.53 43 Novel F-TGATGGTGCAGTGGTAACAG 322

R-AAGATGGGTGTGATCTGACG

54

Table 2.5 cont.

Gene

name


variant


size bp)

APLO3 104C>A 0.84 109 rs148885226 F-CTGGGAAGCATCCTGTTTT 176

R-AACAGCTGGATCTTGCTCAC

SKIV2L2 1A>T; p.Met1? 3.11 11 Novel F-ATCGTGGGTAGGAGGGAGAT 182

R-TCCTTACCCTGCCTTGTCTG

EYS 6982C>T;

p.Gly2328Arg

0.30 125 Novel F-GCCATATTCCTGCAAATGTT 300

R-GACTTGTCATTTTCGTCTCTCA

SPHK1 957G>C;

p.Pro319Pro

2.23 22 Novel F-TGAGAAGTATCGGCGTCTGG 236

R-CTAGCACAAAGTCCTCGTCG

MYCBP2 7295A>C;

p.Ile2432Thr

3.30 142 Novel F-CCAGTGAGAATATGCTGATCCG 210

R-GTCTAGTGCAAGTTAATGGGCA

BDKRB1 844C>G;

p.Arg282*

0.17 125 rs145322761 F- CGCAAGGATAGCAAGACCAC 194

R- AGGGAGCTGTTAGTGAAGGC

ATM 2932T>C;

p.Ser978Pro

3.98 74 rs139552233 F-GAAGAGTACCCCTTGCCAAT 374

R-CTTGCATTCGTATCCACAGA

DCBLD1 568G>A;

p.Val190Ile

2.36 29 Novel F- CCCCTTGCCAATGGAAGATG 249

R- GTCCATATTGCTTTGACCTAGGT

COL22A1 3754C>T;

p.Gly1252Ser

2.73 56 Novel F-TGAAACTGCCTTCGTCTTTC 288

R-TGGGGACAGCAGTGTTTACT


55

Table 2.6 Variants detected by exome sequencing and analysed for segregation analysis in JOAG family GLC 1

Gene

name


Variant

Primer Sequence 5’ to 3’ Product size

(bp)

VPS13D

3272G>A;

p.Cys1091Tyr

6

194 Novel F-TTTGATATTCCAACGGGAAG 380

R-CCTTGTTCTCTGAAGCTTCTTT

AASS

2152G>A;

p.His718Tyr

5.86

83 Novel F-GTGTGCCTTCTCAATGTTCC 399

R-CTGTCCCCAACTCCTAATGA

KIF19

664G>A; p.Ala222Thr

5.82

58 rs34016821 F-TTTCCCAACTGCTCAGACAT 469

R-TCCAACTCCTACGAAGCTGA

GCDH

886G>A;

p.Gly296Ser

5.57

56 Novel F-TGTGATGTGAACCACAACCT 299

R-AGAGAGTGAAACCCAAGCTG

ENOX1

171C>T;

p.Met57Ile

5.41

10 Novel F-AACAAACACCCTTGCCTATG 294

R-AAAGACTGTGTCCAACACTCG

PLIN2

269A>G; p.Ile90Thr

4.58

89 Novel F-AGCCCATTATTGCCATTTTT 224

R-CCAGGTTGGGAAAACAAGTA

COL9A2

1061G>A;

p.Pro354Leu

4.48

98 Novel F-AATCAGGAGCCAAGAGGATT 146

R-AGGAGAAAGAGCTTCCCTGA

MYO18A

2071G>A; p.Arg691Cys

4.42

180 Novel F-TCCTTTAGGACCTGCTCATTC 491

R-CAGAGCATCTGTTCACTCCA

NFIB

274G>A; p.Phe92Leu

4.34

74 rs140030018 F-CATTCATCGAGGCACTTCTT 285

R-CGGGATTGGATAAGACACAG

TMPRSS7

311T>G; p.Leu104Ser

3.79

61 Novel F-ATTGGCCTTACCTTGAATCC 382

R-TCCCACATTGTAATGCTTCA

R3HDM1

2492T>C;

p.Val831Ala

3.76

64 Novel F-GGCTTCAACCTGGTTTTCTT 369

R-CGGGATTTCAAATTCAAGC

CNTRL

1136A>G;

p.Asp379Gly

3.49

94 Novel F-TCCAAACTTTCACTCTTCTGTG 388

R-GTTGTTCATCTGGCTCCATC


56

Table 2.6 continued

Gene name Variant PhyloP Grantham SNP/ Novel

variant


(bp)

SUSD4

190C>T;

p.Glu64Lys

3.11

56 Novel F-TAAAATGTCCTTGGCTTTGG 362

R-TTCCGTGGAGAAGTAAGCAC

ADPRH

977C>A;

p.Ser326Phe

3.07

144 Novel F-TCTTTCGGTGTGAAGGAGAG 397

R-AATCCATCAGAAGTGAACATCA

C4orf21

163C>T 2.62

21 rs148197910 F-CGCCTAGCTCTAATATGTGTTGT 273

R-TCGGCCAGAGGATATAAATG

CNGB3

1208C>T;

p.Arg403Gln

2.39

43 rs147876778 F-CCTCCTTGGGCTTGTTTCAT 390

R-GTTTGTGGTTCTGGAAGGCC

ARHGAP44

2371C>T;

p.Arg791Cys

2.21

180 Novel F-ATCGACTGTGCAACACAATG 298

R-AGAACACTTGGCAAGCTCAT

C9orf128

133A>C 0.89

99 rs151344607 F-TGAAGCCTGTACCCTGTTCT 370

R-ATAGGTAGGGGTCTCTGAAGGA

WBSCR28

373G>A;

p.Ala125Thr

0.71

58 Novel F-TGCTCCTCAAGATCAACCTC 146

R-AAGCAGTGGGACTTCTGACA

BDKRB1

721G>A; p.Gly241Arg

0.62

125 rs45528332 F-TCCCAGATCTGAACATCACC 497

R-GCTTGCACCTGGAATAAGAA

DKK3

1018C>A;

p.Ala340Thr

0.53

99 Novel F-GATGTTGACGGGAAGTGAAG 491

R-GGGGAAACTTACTGGGAAGA

WBSCR28

550C>T;

p.Arg184Cys

0.009

180 Novel F-TGTCAGAAGTCCCACTGCTT 295

R-TCTGGGAGTTTCTTGCTCTG

CGN

725A>G;

p.Asp242Gly

0.79

94 Novel F-TCACTCATCAACAAGTTTGACAG 270

R-CAAAACTCTGAAGGACCCAGT

NCOA7

724C>T;

p.Val242Met

0.26

83 Novel F-ACCTGGCTTCAGAAAAGGAT 298

R-CAAATGCAGAAGAAGTGTCG


57

Table 2.6 continued

Gene name Variant PhyloP Grantham SNP/ Novel

variant


(bp)

ZP4

1226G>A;

p.Pro409Leu

0.62

98 Novel F-CCATCCTGGTAAAGGGGTAA 390

R-TTGTAAGTTGGGGAGGTTCA

ASB10

545G>A;

p.Lys182Arg

2.39

64 rs151344607 F-CTGTGTTCATGTGCTGCTGG 154

R-GCCTCTTTGCTTCCCTTCAG

NEBL

1108G>T;

p.Gln370*

3.16

53 rs146198369 F-ATATGCTTTTCTTTTTCCAATGA 296

R-TAGACAAGATCCCAGGCAGT


58

Table 2.7 Homozygous variants detected by exome sequencing and analysed for segregation analysis in PCG family GLC 2

Gene name


Variant Primer Sequence 5’ to 3’

Product

size(bp)

SH3PXD2B

2629del;

p.Phe876Lysfs*16

4.35

1000

Novel

F-CTCTTTGTATGTGGCCGTGG

202 R-TCTAGGCAGAAAGGGAGTCG

CACNA1D

2474T>C;

p.Ile825Thr

4.27

89

rs147933585

F-TTCAGCCTTCTTCTCACCTG

452 R-GTGACACATTCTGCCTGTGA

CILP

217G>A;

p.Arg73Trp

3.80

101

Novel

F-AGGGAAAGGAGAACTGGAGC

162 R-ACGGTCCCCATAGTAGAAGC

ANKDD1A

1096C>T;

p.Arg366Cys

2.5

180

rs144426862

F-ACCTTTCTGCTCTCAGCGTA

349 R-ATCACCTGCTTGGAGACTGA

LRRC8E

580G>C;

p.Gly194Arg

2.33

125

Novel

F-TCGTGGTCATTCACACACTC

492 R-CCACCAGGAAACTGATCTTC

CSPG4

4813G>A;

p.Leu1605Phe

2.22

24

Novel

F-GTGCTGATCATGGGCATT

505 R-TTCTGGGAACATGAACTTGC

CLRN3

532C>T;

p.Gly178Arg

1.89

125

Novel

F-CATGCCATGCATGAAACTC

300 R-ATAAAATTCCGTCCCTTGGA

ALS2CL

2843T>G;

p.His948Arg

0.46

77

Novel

F-CTATTGAGCCCTAGATCCTGTG

299 R-AGCATCTTCCTGTGCAAAAC

TRAIP

898C>T;

p.Glu300Lys

2.83

56

rs143310707

F-AGGTCATCTCTGCCTTCAGC

112 R-GGGGGAGTATCCACATCAAA

F, Forward; R, reverse; del, deletion

59

Table 2.8. After PCR amplification, PCR products were subjected to RFLP analysis for all

above mentioned SNPs. The amplified products were digested overnight at 37°C with

respective restriction enzymes (Fermentas, Waltham, MA) (Table 2.8). The digested

products were then electrophoretically separated on agarose gels ranging from 2-4%,

resulting in the separation of the homozygous ancestral allele from heterozygous and

homozygous variant alleles.

2.7.3 Variable Number of Tandem Repeat (VNTR) Genotyping

A 27-bp insertional VNTR in intron 4 of NOS3 was genotyped by PCR amplification in

the glaucoma and AMD cohorts, and matched controls. The VNTR region was amplified

using the Gene amp® PCR system 2700 (ABI, Foster City, CA). Briefly, the protocol

consisted of 35 cycles of DNA denaturation at 95°C for 1 min, primer annealing at 60°C

for 45 sec and extension at 72°C for 1 min, followed by a final extension step at 72°C for

5 min. The constituents of the reaction consisted of: 1.2 pM of each primer, 10 mM dNTPs,

2 mM MgCl2, 1 U Taq polymerase and 1× PCR buffer, along with 40–50 ng of DNA. The

PCR products were electrophoretically separated on 4% agarose gels and visualized under

ultraviolet light. Two alleles were obtained when this region was amplified: “NOS34a,”

which was 393 bp long and consisted of four 27-bp repeat units, and “NOS34b,” which

was 420 bp long and consisted of five 27-bp repeat units.

2.7.4 Variant Analysis by Sanger Sequencing

150 AMD samples and 150 matched controls were sequenced for eight SNPs in the

promoter region of VEGF using a single primer set with forward primer 5’-

GCAGCGTCTTCGAGAGTGAG-3’ and reverse primer 5’-

CCGCTACCAGCCGACTTT-3’. The promoter region variants were selected because

these variants may be important for regulating the gene expression. The SNPs that were

analyzed in this 0.5kb region were rs833061 (-460C>T); rs833062 (-417T>C); rs13207351

(-152G>A); rs59260042 (-1210C>A); rs79469752 (-1203C>T); (-160C>T); rs28357093 (-

141A>C); and rs1570360 (-116G>A). The sequences were analyzed using Vector NTI

Advance 11 software (Invitrogen Life Technologies, Carlsbad, CA).

60

Table 2.8 Primers sequences and restriction enzymes used for RFLP analysis

Gene Variant Primer Sequence 5’ to 3’ Annealing

Temp.

Enzyme

OPTN rs11258194 F-TCCACTTTCCTGGTGTGTGA

R-TTTTCCAAGCTCTTCCTTCAA

58oC Stu1

P21 rs1801270 F-GTCAGAACCGGCTGGGGATG

R-CTCCTCCCAACTCATCCCGG

57oC Esp1

CYP1B1 rs2567206 F-GGTTGTGAGCGTGGTTC

R-TCTCACAACTGGAGTCGCAG

55oC Taq1

P53 rs1042522 F-TTGCCGTCCCAAGCAATGGATGA

R-TCTGGGAAGGGACAGAAGATGAC

60oC Bsh12361

HSP70 rs1043618 F- CGCCATGGAGACCAACACCC

R- GCGGTTCCCTGCTCTCTGTC

60oC Brsb1

PLEKHA7 rs11024102 F-GTAGCACCTACTATATGATCT

R-TTCGCCTAGCTGGCTTCT

58 oC AseI

COL11A1 rs3753841 F-TCATTCTAGGGTCCTGTTGGT

R-TCCTGCATTTGCAATTACTTT

58oC NlaIV

PCMTD1 rs1015213 F-CTGATGCTGAGGCTGTACCTC

R-GAGGCTGACCTACCTCTGGTG

58oC HpyCH4III

TNF rs1800629 F-AGGCAATAGGTTTTGAGGGCCAT

R- GTAGTGGGCCCTGCACCTTCT

60oC NcoI

IL1B rs16944 F- TGGCATTGATCTGGTTCATC

R- GTTTAGGAATCTTCCCACTT

60oC Ava1

CX3CR1 rs3732379 F-CTCCCCAGCAAATGCATAG

R- GAATGCCTTGGTGACTACCC

60 oC AcI1

CX3CR1 rs3732378 F-GCAATGCATCTCCATCACTC

R-AACCACAAGAAAGCCAAAGC

60 oC HpyCH4III

MMP2 rs243866 F-ACTGACTCTGGAAAGTCAGAGCA

R-GGCACAGGGTGAGGGATGG

63oC Tsp45I

MMP9 rs17576 F-GAGAGATGGGATGAACTG

R-GTGGTGGAAATGTGGTGT

63oC MspI

F, Forward; R, reverse; Temp, temperature

61

2.8 Statistical Analysis

Allele frequencies between the unaffected controls and the patient groups were compared

with the Pearson χ2 test using online software (http://statpages.org/ctab2x2.html). The

genotype frequencies were calculated by logistic regression analysis keeping age and

gender as covariates. The data were statistically analyzed using R software (R Core Team

(2012). (R Foundation for Statistical Computing, Vienna, Austria. ISBN 3-900051-07-0,

URL http://www.R-project.org/). In addition, Bonferoni correction was applied to the

individual p-values generated from logistic regression analysis.

http://statpages.org/ctab2x2.html

http://www.r-project.org/

Chapter 3

Results

63

3 Results

In the current study, twenty families with glaucoma and 2 families with AMD were

analysed. In addition, in the glaucoma association studies 350 healthy controls, 500 POAG,

200 PACG and 300 PEXG patients were analyzed for different SNPs, while for the AMD

association studies 300 healthy controls and 300 AMD patients were analysed for different

SNPs.

3.1 Results of Glaucoma Families

Initial screening of glaucoma families for mutations in known glaucoma associated genes,

resulted in linking one family with PCG to CYP1B1. In the rest of the families, two affected

members of the GLC 2 family (PCG), one member of GLC 4 (JOAG) and four affected

members of GLC 8 (JOAG) were selected for 250K SNP array analysis.

Of the unsolved glaucoma families, two affected members of GLC 1 with early onset of

symptoms of the disease, two affected members of GLC 2, and four affected members of

GLC 5 were selected for exome sequencing.

3.2 Exclusion of known genes

3.2.1 MYOC, OPTN, WDR36 and CYP1B1 Screening

Probands of the 20 families with glaucoma were screened for mutations in known

glaucoma-associated genes: MYOC, OPTN, WDR36 and CYP1B1.

3.2.1.1 MYOC, OPTN and WDR36 analysis

Several known and novel variants in MYOC, OPTN and WDR36 were found in the

probands of the 20 families, but these variants did not segregate with the disease in these

families (Table 3.1). However, a non-synonymous SNP in MYOC (rs2234926 c.227G>A,

p.(Arg76Lys)) was found in 50% of the probands, and an intronic SNP (rs2032555,

c.730+35G>A) was found in 13 % of the probands. In OPTN three variants were identified

in the families. Of these, the synonymous SNP rs2234968 (c.102G>A, p.(=)), c.293T>A,

64

Table 3.1 Recurrent SNPs and de novo variations in glaucoma and AMD associated genes identified by sequencing

NC; Not checked because the SNPS were not pathogenic

Gene Families

Screened

Coding

Exons

Recurrent

Variants (SNPs)

Segregation of

SNPs in Family Novel

Variants

Segregation of Novel

Variants in Family

MYOC 20 Glaucoma

families 3

rs2234926 NC c.648G>A Not Segregating

rs2032555 NC c.1438A>C

OPTN 20 Glaucoma

families 16

rs2234968 NC p.Glu95Gln Not segregating

rs11258194 Not Segregating

WDR36 20 Glaucoma

families 23 -- -- c.1628G>A Not Segregating

CYP1B1

20 Glaucoma

families 1 -- -- c.1169G>A Segregating

PXDN GLC 2 23 rs17841813 NC p.Thr237Asn Not segregating

rs1863135 NC p.Val1284Leu Heterozygous

TMEM74 GLC 8 2 -- --

CFH 2 AMD

families 23

rs800292 NC

p.Glu850Lys Not Segregating rs1061147 Not Segregating

rs368670743 NC

65

p.(Met98Lys) Fig. 3.1) was identified in 6.3% probands. In addition a novel variant (M2:

c.283G>C, p.(Glu95Gln)) in exon 5 of OPTN was found in one proband, however, none of

these variants segregated with the disease in the families (segregation is shown in Fig. 3.1

A,B,C & D, chromatograms are shown in Fig. 3.2 A & B).

Analysis of the variants Arg76Lys in MYOC and Met98Lys in OPTN were further extended

by screening the association of these variants with unrelated sporadic cases of POAG,

PACG and PEXG and compared with unaffected controls. The MYOC variant was not

associated with any subtype of glaucoma, but the OPTN variant was associated with

increased risk of POAG (section 3.5.1.2).

In WDR36 a novel variant, c.1628G>A (p.Arg543Lys), was identified in exon 14 of a

single proband, but further segregation analysis in the family revealed that the variant did

not segregate with the disease in the family.

3.2.1.2 Identification of a Homozygous CYP1B1 Mutation in a PCG family

Affected individuals of a family (GLC 16) were diagnosed with PCG, with the symptoms

appearing in the first decade of life. The affected individuals shared the same phenotype

and had raised IOP (>40 mmHg) and visual field damage. They had large bulging eyes

(buphthalmus) with varying opacity in the affected individuals. Due to the corneal

opacification, the optic nerve could not be examined. The elder affected members of the

family in their third and fourth decade, were completely blind. All symptoms were absent

in normal individuals of the family. The proband V:1 had bilateral juvenile open angle

glaucoma, 360o iris processors and increased CDR (right eye=0.6, left eye=0.9).

Pachymetry revealed thin corneas (right=0.44, left=0.43). Bilateral trabeculectomy had

been done and in the left eye, and a glaucoma Ahmed valve was inserted to control the

IOP.

Sequence analysis of the coding exons of CYP1B1 revealed a homozygous missense

mutation (c.868dup; p.Arg290Profs*37) segregating with the disease in PCG family

GLC16 (Fig.3.3). The variant was not found in 140 unaffected control individuals.

66

Figure 3.1 Segregation analysis and sequencing chromatogram of identified variants in

OPTN in POAG families A, B & C. Pedigrees with segregation analysis of rs11258194

(M1: c.293T>A, p.[Met98Lys]) and of a novel variant (M2: c.283G>C p.[Glu95Gln] D).

Generation numbers in the pedigrees are indicated by roman numerals. Filled squares and

circles are affected males and females, respectively, while the unfilled symbols are

unaffected individuals. Probands are indicated by an arrow, and all individuals that

underwent molecular genetic analysis are indicated by their mutation pattern, ‘+’ indicatest

the ancestral allele, ‘M’ indicates the derived allele. Individuals indicated with +|+ carry

the homozygous ancestral genotype, those indicated by +|M are heterozygotes carrying one

ancestral and the derived allele, and individuals with M|M carry the derived allele

homozygously.

67

Figure 3.2 A) Sequence chromatogram of rs11258194 c.293T>A p.Met98Lys in OPTN

showing the homozygous ancestral genotype (upper panel), the heterozygous genotype

(middle panel), and the derived homozygous genotype (lower panel). B) Sequence

chromatogram of c.283G>C showing the ancestral homozygous genotype (upper panel),

the heterozygous genotype (middle panel), and the derived homozygous genotype (lower

panel).

A B

68

Figure 3.3 Pedigree of a large consanguineous Pakistani family with PCG (GLC 16). The c.868dup; p.Arg290Profs*37 mutation in

CYP1B1 is indicated with an M, and the ancestral allele with a +. All affected individuals carry the mutation homozygously, while the

unaffected individuals are heterozygous or do not carry the mutation. The mutation segregates with the disease in the family through a

recessive mode of inheritance.

GLC16 (c.868dup; p.Arg290Profs*37)

69

3.3 SNP Microarray Analysis Results

3.3.1 Identification of a Possible Novel Locus of Primary Congenital Glaucoma

A recessive PCG family (GLC 2) was sampled from a village in Multan located in southern

Punjab, consisting of two affected and five unaffected individuals. Both affected

individuals suffered from raised IOP and nystagmus bilaterally. They had completely

opaque and bulging avascularised corneas, which were highly sensitive to touch and hence

normal ophthalmic tests were not possible for the affected individuals (Fig. 3.4). The IOP

measurement was conducted carefully with air puff tonometery and the IOP was found to

be >40 mmHg in both individuals. The patients’ fundus and the optic nerve could not be

visualized due to the opacity of the cornea. The patients also had Haab’s striae, which are

horizontal breaks in the Descemet's membrane. The signs of the disease started appearing

in the first year of their life, which was progressive and resulted in complete blindness.

Trabeculectomy had also been done for one individual to lower the IOP and pain in the

eyes. All the other unaffected siblings had no signs of glaucoma.

Affymetrix 250K SNP microarray analysis was conducted for both affected members of

the family, followed by analysis of the data by Homozygosity Mapper. This revealed five

homozygous regions: one on chromosome 3, one on chromosome 7 and three regions on

chromosome 15 (Fig. 3.5). Microsatellite marker analysis confirmed the homozygous

region on chromosome 7 and excluded the regions on chromosome 3 and 15 (Fig. 3.6). The

region was further refined by using microsatellite markers and a 2 Mb region was marked

as a common homozygous region in the affected individuals, while it was not homozygous

among any of the unaffected individuals, thus suggesting a possible novel locus for PCG.

No plausible candidate gene was present in the locus, and therefore the family was further

analyzed by exome sequencing. No potentially pathogenic variants were found within this

homozygous region on chromosome 7. In addition, all filtered homozygous variants with

high pathogenicity scores observed in the exome data were screened in the family (Table

2.7), but none of the variants segregated with the disease.

70

Figure 3.4 Clinical analyses of the two affected members in the PCG family GLC 2. i)

Shows an opaque cornea and bulging of the eyes due to an elevated IOP in individual II:3.

ii) Shows an opaque cornea of individual II:4, which also bulges out. Both individuals were

completely blind, iii) showing the B-scans done for II:4. The B-scan of the right eye shows

an integral haze with a total freely mobile fibrotic posterior vitreous detachment. The optic

nerve head shows a markedly deep excavated cup indicated with an arrow. The B-scan of

the left eye also shows a deep excavated cup (indicated with an arrow), but the patient had

normal tomographs.

71

Figure 3.5 Homozygosity Mapper plot of the congenital glaucoma family (GLC 2) (details of regions are given in Appendix 6)

72

Figure 3.6 Homozygous region linked to PCG in two affected individuals (II: 3 and II: 4) of family GLC 2. Both SNP array and

Exome sequencing were performed for both affected individuals.

GLC 2 (Chr.7:139,681,371-141,507,822)

73

3.3.2 Identification of a Homozygous Region in Juvenile Open Angle Glaucoma

Family (GLC 4)

A family with JOAG (GLC 4) with a dominant pattern of inheritance was sampled from

the suburbs of southern Punjab, Pakistan. Six affected individuals and seven unaffected

individuals were sampled from this family for analysis. Among the six affected individuals

four (indicated by * in Fig. 3.8) were not aware of having developed the disease and were

clinically suspected to be suffering from glaucoma based on persistent headaches and

blurred of vision. All family members (affected, glaucoma suspects and unaffected)

underwent diagnostic tests. Gonioscopic findings revealed a CDR> 0.5 in the affected and

individuals suspected of having glaucoma and all of them had visual field defects and a

raised IOP (>30 mmHg). Fundus fluorescein angiography (FFA) was conducted for the 7

normal individuals and 2 affected and 4 glaucoma suspects. The affected individuals as

well as glaucoma suspects had thinning of the nerve fibre layer. All normal individuals also

underwent diagnostic tests such as visual field analysis, IOP measurement, CDR analysis

and RNFL thickness estimation, which were within normal limits in all cases. Individual

V:2 was seven years of age and was most severely affected in the family. The diagnostic

tests helped in confirmation of the affected status of the glaucoma suspects as they all had

damaged optic disc, impaired visual field and thinned nerve fiber layer, all of these

symptoms were similar as in the established affected members of the family (III:3 and V:2).

Known glaucoma genes were excluded in the family and one individual (V:2) was selected

from the family for 250K SNP microarray analysis. The data were analysed by

Homozygosity Mapper, which revealed three homozygous regions in the family located on

chromosomes 1, 3 and 10 (Fig. 3.7, Annexure 6). OPTN, TMCO1, and COL11A1 were

positional candidate genes in these regions and were screened for the presence of

mutations. OPTN screening revealed no novel variant in the family, but SNP rs11258194

(Met98Lys) was found, which had previously been shown to be associated with glaucoma.

However, the Met98Lys variant did not segregate with the disease in the family (Fig. 3.8).

Analysis of the other two genes, TMCO1 and COL11A1, did not reveal any mutation in

this family. Therefore, the family was included in the panel of unsolved families (A;

Annexure 7).

74

Figure 3.7 Homozygosity Mapper plot of homozygous regions in a juvenile open angle glaucoma family GLC 8 (details of regions are

given in Annexure 6)

75

Figure 3.8 Pedigree of a recessive consanguineous Pakistani family with juvenile open angle glaucoma (GLC 4). The polymorphism

Met98Lys in OPTN is indicated with an M, and the ancestral allele with a ‘+’. All affected individuals carry the mutation homozygously

or heterozygously, while some of the unaffected individuals were also heterozygous, demonstrating that the variation did not segregate

with the disease in the family.

GLC 4 (c.293T>A; p.Met98Lys)

76

3.3.3 Identification of Homozygous Region in Juvenile Open Angle Glaucoma

Family GLC 8

A JOAG family with a recessive pattern of inheritance was sampled from KPK province

of Pakistan. Six affected and eight normal individuals were sampled for further analysis

(Fig. 3.9). The proband of the family (V:5) suffered from a raised IOP and blurred vision.

Due to the raised IOP, the individual was suspected to have glaucoma and underwent

additional diagnostic tests. Visual field analysis revealed arcuate defects in vision,

tonometery revealed a raised IOP (>30 mmHg), and gonioscopic findings also supported

the other two tests revealing an increased cup-to-disc ratio (CDR=0.7). The individual had

a family history of the disease and hence all the approachable family members were

screened clinically for glaucoma. There were six individuals in the family who had an

increased CDR (>0.6), an elevated IOP (>30 mmHg) and visual field defects. The normal

individuals had no visual field defects or alterations in the CDR and their IOP was in the

normal range. The symptoms of the disease started appearing at the end of the second

decade of life in all affected individuals. In addition, individual IV:3 (the father of proband)

suffered from diabetic retinopathy. Four affected individuals from the fifth generation (V:1,

V:3, V:5 and V:7) were selected for 250K SNP microarray analysis. Homozygosity

Mapper was used to analyse the data obtained from the array, which revealed 4

homozygous regions on chromosomes 3, 4, 6 and 11 (Fig. 3.10 Annexure 6). The family

(GLC 8, Fig. 3.9) was screened for mutations in known glaucoma genes (MYOC, OPTN,

WDR36 and CYP1B1), and no causative mutation was found in any of these genes. Using

the online UCSC genome browser, two genes known to be involved in anterior segment

defects (PITX2 and FOXC1) and four candidate genes (IFT80, COL25A1, ATXN1,

PLEKHA7) were selected from the homozygous regions, and were screened in the family

for disease-causing variants. No mutation was found in any of these genes. Therefore, this

family was also added to the panel of unsolved families (Annexure 7).

77

Figure 3.9 Pedigree of a consanguineous Pakistani family with juvenile open angle glaucoma (GLC 8), exhibiting an autosomal

recessive inheritance pattern. The sampled family members are indicated by *, and the proband by an arrow.

GLC 8 (Juvenile Open Angle Glaucoma Family)

78

Figure 3.10 Homozygosity Mapper plot of homozygous regions in juvenile open angle glaucoma family GLC 8 (details of regions are

given in Annexure 6)

79

3.4 Next Generation Sequencing Analysis

3.4.1 Identification of Three Variants MYO18A, ENOX1 and COL9A2 in JOAG

Family GLC 1

A large glaucoma family (GLC1) with a dominant mode of inheritance was sampled, but

due to a difference in the age of disease onset in the two loops of the family they were

analysed separately as independent families. GLC 1a had a juvenile onset (mean age 25

years). While GLC 1b had a late onset (mean age 50 years, Fig. 3.11). GLC 1a consisted

of ten sampled members (seven affected and three unaffected). There were two non-

consanguineous loops in GLC 1a, one of which had an early onset of the disease with a girl

(V: 5) being affected in the first decade of life. In the other affected individuals of loop

GLC1a the onset of signs and symptoms was in the mid to late half of the second decade

of life or at the beginning of the third decade. The patients suffered from a raised IOP and

pain in the eyes and forehead region. Ophthalmic examination revealed a raised CDR (0.7-

0.9), and visual field analysis showed loss in the field of vision. In addition, FFA was

conducted, which revealed RNFL thinning in the affected (individual IV:10, Fig. 3.12) and

also in two members of the family (IV:2, IV:4) who were unaware of the onset of

glaucomatic changes and were subsequently categorized as affected members (Fig. 3.11).

Two members of the family from the GLC1a branch (IV:10 and V:5) were selected for

exome sequencing. After filtering of the exome data, only 38 overlapping variants were

left among the two affected individuals. All variants were checked for segregation among

the GLC 1a and GLC 1b loops, and three heterozygous variants 2071G>A; Arg691Cys in

MYO18A, 171C>T; Met57Ile in ENOX1 and 1061C>T; Pro354Leu (rs201772619) in

COL9A2 segregated with the disease in the affected family members of loop GLC 1a.

Hence, all the affected members carry three variants in three genes, which were not present

in any of the normal members in any of the two branches. These three variants were not

present in 200 normal healthy unrelated control individuals. Two of the variants (in

MYO18A and ENOX1) were also present in a normal individual in loop GLC 1b (IV:1) but

of the third variant in COL9A2 was absent in this individual.

80

Figure 3.11 Pedigree of a consanguineous Pakistani family with JOAG (GLC 1a) as well as late onset POAG (GLC 1b) inherited

dominantly. Exome sequencing was performed for individuals IV:10 and V:5. Variants in three genes, MYO18A c. 2071G>A (black),

ENOX1 c.171C>T (blue), and COL9A2 c.1061C>T (red), were found to segregate with the disease in loop GLC1a. The variant allele is

indicated with an M, and the ancestral allele with a ‘+’. All affected individuals in loop GLC 1a carry the mutations heterozygously (IV:

10 carries MYO18A variant homozygously). The proband is indicated by arrow.

GLC 1 (MYO18A c. 2071G>A; p.Arg691Cys, ENOX1 c.171C>T; p.Met57Ile, COL9A2 c.1061C>T; p.Pro354Leu)

81

Figure 3.12 RNFL thickness for the patient IV:10 of JOAG family GLC1a. The figure

shows RNFL thinning in all four quadrants (nasal, temporal, superior and inferior), which

along with measurement of IOP, CDR clearly indicates that the individual is glaucomatic.

82

Exome sequencing revealed only one variant (724C>T; p.Val242Met) in the NCOA7 gene

segregated with the disease in the GLC 1b loop of the family (Fig. 3.13). The variant was

present in heterozygous form among the two affected members (IV:2 and IV:4) of the

family in the fourth generation; all unaffected individuals in this generation had the

homozygous ancestral allele. Of the three sampled individuals in the fifth generation, two

unaffected individuals (V:2 and V:3) carried the variant allele in a heterozygous state.

These two individuals at the time of sampling were in their first decade of life. As the

disease has a late onset in this branch of the family, the symptoms of the disease might not

have surfaced yet in these unaffected individuals. In loop GLC 1a, the variant in NCOA7

was present heterozygously in all affected members, except for one affected individual

(IV:12), while all normal individuals carried the ancestral allele (segregation not shown in

the pedigree). The variant was not identified in 200 unrelated normal unaffected controls.

3.4.2 Identification of a Variant in PHKG1 in JOAG Family GLC 5

Family GLC 5 (Fig. 3.14) was a consanguineous family with a dominantly inherited form

of glaucoma, sampled from the suburbs of southern Multan. This family had early onset of

the disease in two individuals (V:2, V:6) with appearance of symptoms in the middle of

the second decade of life, whereas among all other individuals the symptoms appeared in

the later half of the third decade. Individual V: 6 presented with a raised IOP (>30 mmHg)

as well as increased CDR, which was higher for the vertical diameter than the horizontal

diameter, creating a notch in the neuroretinal rim superiorly. Treatment of the patient with

beta-blockers helped in lowering the IOP to the normal range (18-20 mmHg). The other

affected members of the family (III:1, IV:4, IV:6, IV:7, IV:8) had a late onset of the disease

with the symptoms appearing in the later half of the third decade. Six affected members

and two normal individuals of the family were sampled. All sampled individuals underwent

ophthalmic examination. The visual field test confirmed abnormalities among the affected

members of the family only. They also had a raised IOP (>30 mmHg) and increased CDR

(0.8). All normal individuals of the family had an IOP in the normal range (<20 mmHg)

and normal CDR (0.1-0.3).

83

Figure 3.13 Pedigree of a consanguineous Pakistani family with late onset glaucoma (GLC 1b) inherited dominantly. Segregation of

variant c.724C>T; p.Val242Met in NCOA7 is shown in the figure. The derived allele is indicated with an M, and the ancestral allele

with a ‘+’. All elderly affected individuals in the third generation of loop GLC 1b carry the variant heterozygously, while in the fourth

generation, V: 2 and V:3 carry the varaint heterozygously.

GLC 1b (NCOA7: c.724C>T; p. p.Val242Met)

84

Figure 3.14 Pedigree of a consanguineous Pakistani family with juvenile onset open angle glaucoma inherited dominantly. Exome

sequencing was performed for individuals IV:4, IV:6, IV:7 and V:6. Segregation of a variant (c.125C>T) in the PHKG1 gene is shown

in the figure. The derived allele is indicated with an M, and the ancestral allele with a ‘+’. All affected members of the family are

heterozygous for the variant, and V: 6 was homozygous for the variant. The proband is indicated by an arrow.

GLC 5 (PHKG1: c.125 C>T; p.Thr42Met)

85

No novel or recurrent variants were found in the known glaucoma genes in this family, and

thus the family was further analysed by exome sequencing. Exome data filtering resulted

in forty variants, which were subsequently screened in the family for segregation. Out of

all variants, only one variant, 125C>T (p.Thr42Met) in PHKG1, segregated with the

disease in the family (Fig. 3.14). The variant was present in a heterozygous state in affected

individuals who had an onset of disease in the fourth decade of life, as well as in one normal

individual (V:7) of age below 10 years, and in homozygous form in one affected individual

(V: 6) who had juvenile onset of the disease and a severe phenotype with much raised IOP

and CDR as compared to other affected members of the family as well as severely reduced

visual fields.

3.5 Case-Control Association Studies

3.5.1 Case-Control Association Studies for Glaucoma

Patients and controls included in the case-control association studies for glaucoma were

age- and gender-matched (Table 3.2). The mean age (± standard deviation) of the controls

was 48.1±13.2 years, of patients with POAG 48.3±16.5 years, of patient with PACG

45.5±16.5 years and of patients with PEXG 50.09±14.1 years (Table 3.2). In total 350

healthy subjects (52% males and 48% females), 500 patients with POAG (51% males and

49% females), 200 patients with PACG (49.5% males and 50.5% females) and 300 patients

with PEXG (48% males and 52% females) were enrolled in the study. The majority of the

patients were under treatment by β-blockers, or had undergone surgery (trabeculectomy)

to lower their IOP.

3.5.1.1 Screening BIRC6 and PDIA5 Polymorphisms in Glaucoma Cohort

The allele and genotype frequencies of rs11720822 in PDIA5 were not significantly

different between POAG, PACG and PEXG as compared to the control individuals (Table

3.3). The T allele of rs2754511 in BIRC6 was found in 35% of control alleles, while it was

found in 32% of POAG alleles, 35% of PACG alleles, and 28% of PEXG alleles. The

frequency of the T allele was found to be significantly lower in PEXG

86

Table 3.2 Demographic and clinical features of the control, POAG, PACG and PEXG cohorts

Controls POAG p-

value PACG

p-

value PEXG

p-

value

Age 48.1±13.2 48.3±16.5 >0.05 45.5.±16.5 >0.05 50.09±14.1 >0.05

Gender

>0.05

>0.05

>0.05 Males 52% 51% 49.5% 48%

Females 48% 49% 50.5% 52%

IOP 16.4±2.3 30.5±11.6 <0.05 26.4±10.2 <0.05 28.4±10.5 <0.05

CDR 0.39±0.18 0.85±.63 <0.05 0.67±.27 <0.05 0.76±.23 <0.05

87

Table 3.3 Results of logistic regression analysis for genotype and allele frequencies of SNPs rs11720822 in PDIA5 and rs2754511 in BIRC6 in POAG, PACG and PEXG patients and control individuals

PDIA5

rs11720822

POAG

Est.

Z

value OR (95%CI) P-value/pb

PACG

Est.

Z

value OR (95%CI) p-value/pb

PEXG

Est.

Z

value OR (95%CI) p-value/pb

CC 0.07

17.90

0.16

0.02

0.9 (0.37-2.26) a

5.95(0.00-Inf) a

0.86/1.00b

0.98/1.00b

0.22

12.89

-0.45

0.01

0.79 (0.29-2.13)a

3.69 (0.00-Inf)a

0.64/1.00b

0.98/1.00b

0.60

15.55

1.30

0.01

1.82(0.74-4.48)a

5.68(0.00-Inf)a

0.18/1.00b

0.98/1.00b CT

TT

Allele Frequency

C - - 0.74 (0.41-1.34)c 0.28/1.00b

- - 1.00 (0.51-1.96)c 0.99/1.00b

- - 1.15 (0.60-2.19)c 0.66/1.00b

T - - - - - -

BIRC6

rs2754511

AA 0.39

0.18

-2.53

0.81

0.67 (0.49-0.91)a

0.83 (0.52-1.30)a

0.01/0.06b

0.41/1.00b

0.05

0.18

-0.28

0.59

0.94 (0.62-1.41)a

1.20 (0.65-2.22)a

0.77/1.00

0.54/1.00b

0.35

0.84

-1.87

2.58

0.70 (0.48-1.01)a

0.42 (0.22-0.81)a

0.06/0.36b

0.009/0.05b AT

TT

Allele Frequency

A - - 0.85 (0.68-1.06)c 0.15/0.90b

- - 0.95(0.72-1.26)c 0.28/1.00b

- - 0.72 (0.55-0.94)c 0.01/0.06b

T - - - - - -

a Age- and gender-adjusted OR and (95%CI) from multivariate logistic regression analysis; pb Bonferroni-corrected p values; c OR and (95%CI)

from univariate logistic regression analysis; Est., estimates

88

patients as compared to the controls (p=0.01; OR 0.72 [95% CI 0.55-0.94]) (Table 3.3),

however this association did not remain significant when Bonferroni correction was

applied to the data (p=0.06). Logistic regression analysis was conducted adjusting for age

and gender, which showed that the homozygous TT genotype of the studied BIRC6

polymorphism is protective in the case of PEXG (p=0.009), which remained significant

even after Bonferroni correction was applied (p=0.05).

3.5.1.2 Screening OPTN and MYOC Polymorphisms in Glaucoma Cohort

The genotype and allele frequencies of the SNP rs11258194 in OPTN were not

significantly associated with increased risk of POAG after correction of p values for

multiple testing, (p=0.07, OR=2.85 [95% CI=1.15-7.06]; p=0.06, OR=2.68 [95% CI=1.07-

7.12]; Table3.4). The AA genotype was present in low percentage (0% in controls, and 1%

in cases; data not shown) therefore it was merged into the TA genotype for logistic

regression analysis. Similarly, no significant associations were observed for PACG or

PEXG (PACG; p=0.25, OR=2.05 [95% CI=0.05-7.14]; p=0.22, OR=1.96 [95% CI=0.58-

6.68], PEXG; p=0.33, OR=1.76 [95% CI=0.56-5.51]; p=0.17, OR=1.96 [95% CI=0.67-

6.11]; Table3.4). In addition, rs10906308 in OPTN and rs2234926 in MYOC were not

found to be significantly associated with POAG, PACG, or PEXG (Table 3.4). Moreover,

the mean IOP of POAG patients carrying the variant allele rs11258194 (23.6±9.2 mmHg)

was not significantly different from the mean IOP in POAG patients who had the ancestral

allele (25.2±10.1 mmHg; p>0.05). Haplotype analysis of the two SNPs in OPTN was also

conducted, which showed that the haplotype A-G (rs11258194-rs10906308) was

significantly associated with increased risk of POAG (p=0.019, OR=2.96 [95% CI=1.20-

7.31]; Table 3.5).

3.5.1.3 Screening Oxidative Stress and Apoptotic Pathway Gene Polymorphisms in

Glaucoma Cohort

Polymorphisms in three genes (P21, P53, P450) of the apoptotic pathway were selected

for screening in the glaucoma cohorts. In addition, polymorphisms in the oxidative stress

genes NOS3 and HSP70 were screened in these cohorts. Logistic regression analysis

revealed that the P21 polymorphism rs1801270 is not associated with any type of

89

Table 3.4 Logistic regression analysis for rs11258194 and rs10906308 in OPTN and rs2234926 in MYOC in Pakistani glaucoma

cohorts and controls

Genotype

rs11258194

Estimate

POAG

Z

value OR (95%CI)

p value/

*p-value

Estimate

PACG

Z

value OR (95%CI)

p value/

*p-value

Estimate

PEXG

Z

value OR (95%CI)

p value/

*p-value

TT -- -- 2.85 (1.15-7.06)a 0.02/0.07

-- -- 2.05(0.05-7.14)a 0.25/0.60

-- -- 1.76 (0.56-

5.51)a 0.33/0.72

TA+AA 1.05 2.27 0.71 1.13 0.56 0.97

Allele Frequency

T -- -- 2.68(1.07-7.12)b 0.02/0.06

-- -- 1.96(0.58-6.68)b 0.22/0.66

-- -- 1.96(0.67-

6.11)b 0.17/0.51

A -- -- -- -- -- --

Genotype rs10906308

GG -- --

0.96(0.35-2.62)a

1.16(0.68-1.98)a

0.45/0.92

0.92/0.99

-- --

0.99(0.58-1.68)a

1.04(0.41-2.66)a

0.98/1.00

0.91/0.99

-- --

0.87(0.25-2.99)a

0.99(0.51-1.93)a

0.98/1.00

0.78/0.99

GA 0.15 0.73 -0.003 -0.01 -0.006 -0.02

AA -0.03 -0.08 0.04 0.10 -0.13 -0.27

Allele Frequency

G -- -- 1.10(0.86-1.63)b 0.54/1.00

-- -- 1.10(0.75-1.61)b 0.92/1.00

-- -- 1.00(0.68-

1.47)b 0.71/1.00

A -- -- -- -- -- --

Genotype rs2234926

GG -- --

0.91(0.60-1.38)a

0.75(0.36-1.55)a

0.69/0.99

0.44/0.91

-- --

0.74(0.43-1.26)a

0.88(0.37-2.12)a

0.27/0.72

0.79/0.99

-- --

0.71(0.35-1.43)a

1.23(0.42-3.54)a

0.22/0.64

0.61/0.98

GA -0.08 -0.39 -0.29 -1.09 -0.33 -1.21

AA -0.28 -0.76 -0.11 -0.26 0.20 0.49

Allele Frequency

G -- -- 0.87(0.60-1.26)b 0.49/1.00

-- -- 0.87(0.60-1.26)b 0.47/1.00

-- -- 1.00(0.69-

1.45)b 1.00/1.00

C -- -- -- -- -- --

aAge- and gender-adjusted OR and (95% CI) from multivariate logistic regression analysis, bOR and (95%CI) from univariate logistic regression

analysis, *p Bonferroni corrected p-values,

90

Table 3.5 Haplotype analysis of OPTN SNPs rs11258194 and rs10906308 in Pakistani

POAG cohorts

rs11258194 rs10906308 Freq OR (95%CI) P-value

1 T G 0.6733 1.00 ---

2 T A 0.2789 1.10 (0.80-1.51) 0.55

3 A G 0.0398 2.96 (1.20-7.31) 0.019

Global haplotype association p-value:0.0082

91

glaucoma. The P450 polymorphism c.-2805T>C was found to possibly have a protective role

in patients with PEXG (estimate=-0.81, z value=-3.68, OR=0.44, [95% CI=0.25-0.77], p=8.8e-

04) in the presence of the heterozygous genotype. However, the P450 c.-2805T>C

polymorphism was not found to be associated with POAG or PACG (Table 3.6).

The P53 polymorphism rs1042522 was also not found to be associated with any type of

glaucoma (Table 3.6). When univariate logistic regression analysis was applied to the allele

frequencies (Table 3.7), it was seen that the minor allele ‘C’ of this polymorphism was not

associated with either POAG, PACG or PEXG (POAG: OR=1.01, [95% CI=0.83-1.23],

p=1.00), (PACG: OR=1.25 [95% CI=1.00-1.58], p=0.2), (PEXG: OR=1.26 [95% CI=1.02-

1.57], p=0.15) (Table 3.7).

The HSP70 rs1043618 polymorphism was found to be significantly associated with POAG,

both for the heterozygous genotype (GC) (estimate=0.98, z value= 6.19, OR=2.68 [95%

CI=1.79-4.01], p=2.22e-09) as well as for the homozygous variant genotype (CC)

(estimate=0.60, z value= 3.06, OR=1.83 [95% CI=1.11-3.04], p=0.009) (Table 3.6). It was also

found to be significantly associated with PACG, both in heterozygous (GC) form

(estimate=0.65, z value= 2.87, OR=1.91 [95% CI=1.08-3.39], p=0.01) as well as in

homozygous (CC) form (estimate=0.65, z value= 3.41, OR=1.91 [95% CI=1.18-3.10],

p=0.002). In PEXG only the homozygous variant genotype (CC) of the polymorphism was

significantly associated with the disease (estimate=1.05, z value= 0.19, OR=2.87 [95%

CI=1.75-4.71], p=2.5e-07). Univariate logistic regression analysis showed that the risk allele C

of the HSP70 rs1043618 polymorphism is significantly associated with all three types of

glaucoma; POAG (OR=1.69 [95% CI=1.37-2.09], p=<0.001), PACG (OR=1.60 [95%

CI=1.25-2.05], p=<0.001), and PEXG (OR=2.02 [95% CI=1.61-2.54], p=<0.001) (Table 3.7).

The heterozygous genotype of in 27bp intron 4 VNTR polymorphism in NOS3 was found to

be significantly associated with POAG and PEXG (estimate=0.55, z value= 3.06, OR=1.74,

[95% CI=1.10-2.75], p=0.01) and (estimate=0.51, z value= 2.38, OR=1.68, [95% CI=1.01-

2.74], p=0.04), respectively. However, PACG was found to be significantly associated with

both heterozygous (estimate=0.73, z value= 3.5, OR=2.09, [95% CI=1.23-3.55], p=0.001) as

well as homozygous genotypes (estimate=0.87, z value= 2.46, OR=2.38, [95% CI=1.00-

92

Table 3.6 Logistic regression analysis of genotype frequency distribution of P21 (rs1801270), P450 (c.-2805T>C), P53 (rs1042522),

HSP70 (rs1043618) and NOS3 (27bp intron 4) polymorphisms in Pakistani glaucoma cohorts and controls

Categories POAG

Estimate

Z

value

OR (95%CI) p value/

*p-value

PACG

Estimat

e

Z

Value

OR (95%CI) p value/

*p-value

PEXG

Estimat

e

Z

value

OR (95%CI) p value/

*p-value

P21 (rs1801270) polymorphism

CC -- -- --

0.76 (0.26-2.23)/0.02/0.95

1.55 (0.93-2.57)/0.53/0.12

-- -- --

1.10 (0.58-2.06)/0.68/0.99

0.11 (0.007-1.59)0.03/0.15

-- -- --

0.98 (0.62-1.566)/0.95

1.08 (0.47-2.50)/0.84

CA -0.26 -0.62 0.09 0.40 -0.01 -0.05

AA 0.44 2.18 -2.1 -2.07 0.08 0.19


CC -- -- --

0.61(0.36-1.03)/0.01/0.07

0.80 (0.47-1.36)/0.031/0.74

-- -- --

0.73 (0.39-1.37)/0.21/0.59

1.03 (0.54-1.94)/0.89/0.99

-- -- --

0.44 (0.25-0.77)/0.0002/8.8 e-

04

0.63 (0.36-1.11)/0.04/0.15

CT -0.49 -2.35 -0.31 -1.25 -0.81 -3.68

TT -0.21 -1.03 0.03 0.12 -0.45 -2.04


GG -- -- --

1.29 (0.83-1.99)/0.13/0.43

1.05 (0.64-1.70)/0.78/0.99

-- -- --

1.2 (0.74-2.15)/0.26/0.69

1.4 (0.85-2.63)/0.07/0.25

-- -- --

1.23 (0.75-2.01)/0.27/0.71

1.51 (0.89-2.55)/0.04/0.17

GC 0.25 1.50 0.23 1.11 0.21 1.09

CC 0.05 0.26 0.40 1.80 0.41 1.99

HSP70 (rs1043618) polymorphism

GG -- -- --

2.68 (1.79-4.01)/0.000/2.22 e-09

1.83 (1.11-3.04)/0.002/0.009

-- -- --

1.91 (1.08-3.39)/0.0006/0.01

1.91 (1.18-3.10)/0.004/0.002

-- -- --

1.04 (0.64-1.68)/0.81/0.99

2.87 (1.75-4.71)0.000/2.5 e-07

GC 0.98 6.19 0.65 2.87 0.04 0.23

CC 0.60 3.06 0.65 3.41 1.05 0.19

NOS3 (27 bp intron 4 VNTR polymorphism)

Bb -- -- --

1.74 (1.10-2.75)/0.002/0.01

1.34 (0.57-3.13)/0.37/0.86

-- -- --

2.09 (1.23-3.55)/0.0004/0.001

2.38 (1.00-5.82)/0.01/0.05

-- -- --

1.68 (1.01-2.7)/0.009/0.04

1.56 (0.64-3.78)/0.20/0.61

Ba 0.55 3.06 0.73 3.5 0.51 2.38

Aa 0.29 0.88 0.87 2.46 0.44 1.27

*p p-values corrected by simultaneous inference.

93

Table 3.7 Allele frequency distribution of P21 (rs1801270), P450 (c.-2805T>C), P53 (rs1042522), HSP70 (+190G>C), and NOS3

(27bp intron 4) polymorphisms in Pakistani glaucoma cohorts and controls

P21

(rs1801270)

Controls

N=350

POAG

N=518

OR (95%CI) p value/

*p-value

PACG

N=274

OR (95%CI) p value/

*p-value

PEXG

N=348

OR (95%CI) p value/

*p-value

C 636 (91%) 922 (89%) 1.23 (0.88-1.72)

0.20/1.00 510 (93%)

0.74 (0.48-1.15)

0.15/0.75 631 (91%)

1.02 (0.70-1.49)

0.89/1.00

A 64 (9%) 114 (11%) 38 (7%) 65 (9%)

P450 (rs2567206)

C 440 (63%) 643 (62%) 1.03 (0.84-1.27)

0.73/1.00

351 (64%) 0.95 (0.75-1.21)

0.66/1.00

414 (60%) 1.15 (0.92-1.44)

0.19/0.95 T 260 (37%) 393 (38%) 197 (36%) 282 (40%)

P53 (rs1042522 )

G 342 (49%) 503 (49%) 1.01 (0.83-1.23)

0.90/1.00

236 (43%) 1.25 (1.00-1.58)

0.04/0.2

300 (43%) 1.26 (1.02-1.57)

0.03/0.15 C 358 (51%) 533 (51%) 312 (57%) 396 (57%)

HSP70 (rs1043618)

G 500 (71%) 618 (60%) 1.69 (1.37-2.09)

<0.001/<0.001

334 (61%) 1.60 (1.25-2.05)

<0.001/<0.001

385 (55%) 2.02 (1.61-2.54)

<0.001/<0.001 C 200 (29%) 418 (40%) 214 (39%) 311 (45%)

NOS3 (27bp intron 4)

B 616 (88%) 861 (83%) 1.49 (1.12-1.99)

0.005/0.02

432 (79%) 1.97 (1.43-2.71)

<0.001/<0.001

575 (83%) 1.54 (1.13-2.11)

0.004/0.02 A 84 (12%) 175 (17%) 116 (21%) 121 (17%)

*p Bonferroni corrected p-values.

94

5.82], p=0.05). The risk allele of the NOS3 gene polymorphism was also significantly

associated with POAG (OR=1.49, [95% CI=1.12-1.99], p=0.005), PACG cohort

(OR=1.97, [95% CI=1.43-2.71], p=<0.001), as well as the PEXG cohort (OR=1.54, [95%

CI=1.13-2.11], p=0.004) (Table 3.7).

3.5.1.4 Screening PLEKHA7, COL11A1, and PCMTD1 polymorphisms in the

PACG Cohort

PACG-associated SNPs rs11024102 in PLEKHA7, rs3753841 in COL11A1 and rs1015213

in PCMTD1 were screened in 200 PACG patients and 200 age- and gender-matched

unaffected controls. The genotype and allele frequencies of the SNP rs3753841 in

COL11A1 were significantly associated with PACG (homozygous derived genotype;

p=0.05, OR=0.44 [95% CI=0.19-1.00]; derived allele; p<0.001, OR=0.56 [95% CI=0.41-

0.75]; Table3.8), respectively, suggesting a protective role. As opposed to this, no

significant association was observed in the PACG cohort with SNP rs1015213 in

PCMTD1, where the minor genotype (TT) was present at a low percentage, and therefore

it was merged with the CT genotype for logistic regression analysis [genotype; (p=0.15,

OR=0.59 [95% CI=0.31-1.1]; allele frequency; p=1.00, OR=1.00 [95% CI=0.7-1.45];

Table3.8). Moreover, genotype and allele frequencies of the rs11024102 polymorphism in

PLEKHA7 were not found to be significantly associated with PACG (CT: p=0.89,

OR=0.79 [95% CI=0.36-1.7]; CC: p=0.89, OR=0.74 [95% CI=0.33-1.6]; allele frequency;

p=0.19, OR=0.82 [95% CI=0.61-1.1], Table 3.8).

3.6 Results of AMD Families

Two families with AMD were recruited in the current study. Family AMD 1 was sampled

from the federal capital of Pakistan with three affected individuals, but at the time of

sampling only two affected members were alive and hence sampled (Fig. 3.15 A). Family

AMD 2 (Fig. 3.15 B) was a small family consisting of two affected members belonging to

DG Khan in Pakistan. The probands of both families had wet AMD and were treated with

Avastin injections to control neovascularisation. As there were only two affected

individuals from each family available, only analysis of known genes was conducted for

the families. All exons of the CFH gene were screened in the probands of both families,

95

Table 3.8 Logistic regression analysis of genotype and allele frequency distribution of COL11A1 (rs3753841), PCMTD1 (rs1015213),

and PLEKHA7 (rs11024102) polymorphisms in Pakistani PACG cohort and controls

Genotype

COL11A1 (rs3753841) OR (95% CI)

p value/

*p-value

PCMTD 1

(rs1015213) OR (95%

CI)

p value/

*p-value

PLEKHA7

(rs11024102) OR (95% CI) p value/

*p-value Est. Z value Est. Z value Est. Z value

Ancestral allele

genotype -- --

0.65 (0.30- 1.4)

0.44 (0.19-1.0)

0.16/0.49

0.01/0.05

-- --

0.59 (0.31- 1.1)

0.03/0.15

-- --

0.79 (0.36- 1.7)

0.74 (0.33- 1.6)

0.44/ 0.89

0.36/0.82

Heterozygous -0.42 -1.38 0.51** -2.07** -0.23 -0.75

Derived allele

Genotype -0.80 -2.48 -0.29 -0.90

Allele

Frequency Con. PACG Con.

Patient

s Con. Patients

Ancestral allele 126 (32%) 180 (45%)

0.56 (0.41-0.75) <0.001

<0.001

318

(80%)

317

(79%) 1.0 (0.7-

1.45) 1.00/1.00

152

(38%)

171

(43%) 0.82 (0.61-1.1) 0.19/0.57

Derived allele 274 (69%) 220 (55%) 82

(20%)

83

(21%)

248

(62%)

229

(57%)

*p values of genotype frequency corrected by simultaneous inference and p values of allele frequency corrected by Bonferroni method

** Multivariate logistic regression done by merging Heterozygous CT and Homozygous TT genotypes together, Est.; Estimate.

96

Figure 3.15 Pedigrees of non-consanguineous Pakistani families with AMD. A) Segregation of variant c.1204C>T; p.His402Tyr in CFH

is shown in family AMD 1. Derived allele is indicated with an M and the ancestral allele with a ‘+’. B) Segregation of variant

c.2548G>A; p.Glu850Lys in CFH is shown in family AMD 2. The variant allele is indicated with an M2, and the ancestral allele with

a ‘+’.

AMD 2 (CFH: c.2548G>A) AMD 1 (CFH: c.1204C>T)

97

which identified non-synonymous SNPs rs800292 in exon 2, rs1061170 in exon 9 and

rs368670743 in exon 14. Among these SNPs rs1061170 was previously shown to be

associated with AMD and thus its segregation was checked in the respective family

(Fig.3.15). Another variant, c.2548G>A (p.Glu850Lys), was found in the proband of

family AMD 2, which upon segregation analysis showed no linkage with the disease (Fig.3.

15 B).

3.7 Case-Control Studies in AMD

Patients and controls included in the current study were age- and gender-matched. The

mean age (± standard deviation) of the controls was 64.6±10.92 years and of AMD cases

65.9±10.92 years. 300 healthy subjects (52% males and 48% females) and 300 patients

with AMD (51% males and 49% females) were enrolled in the case-control association

studies. The AMD patients were further bifurcated into two categories i.e. wet AMD and

dry AMD. Moreover, the individuals who had stopped smoking at least 3 years ago were

categorised as former smokers and those individuals who had been smoking for the past 5

years were categorized as current smokers. Multivariate logistic regression analysis was

applied to the data keeping age and gender as covariates. The p-values were corrected by

simultaneous inference (test of hypothesis) for multiple testing. Univariate logistic

regression analysis was applied to the allele frequencies to determine the effect of the

variant allele on the disease. The data analysis showed that the current smokers were at a

higher risk of developing AMD as compared to the non-smokers [OR=2.42(95%CI=2.42-

5.01) p=0.004]. Moreover, the former smokers were at higher risk of development of the

disease as compared to the non-smokers [OR=5.34 (95%CI=2.55-11.17) p<0.0001]. The

former smokers with dry and wet AMD were more at risk of development of advanced

stages of AMD [OR=5.42 (95%CI=1.95-15.01) p<0.0001] as compared to the current

smokers with dry or wet AMD [OR=2.76 (95%CI=1.16-6.57) p=0.008].

98

3.7.1 Screening Polymorphisms in Known AMD Gene

3.7.1.1 CFH and ARMS2

Multivariate logistic regression analysis showed that rs1061170 in CFH was not associated

with AMD overall or with wet AMD. The ‘CC’ as well as the ‘TC’ genotype of the

polymorphism rs1061170 was not associated with the risk of having AMD or any subtype

of AMD (Table 3.9) (AMD overall; TC: p=0.77, OR=0.94 [95% CI=0.64-1.38], CC:

p=0.02, OR=2.14 [95% CI=1.08-4.25]; Wet AMD (TC: p=0.53, OR=0.85 [95% CI=0.52-

1.39], CC: p=0.03, OR=2.37 [95% CI=1.06-5.32]; Dry AMD (TC: p=0.80, OR=1.05 [95%

CI=0.68-1.62], CC: p=0.06, OR=2.05 [95% CI=0.96-4.37; Table 3.9]).

Univariate logistic regression analysis showed that the risk allele C was also not associated

with the disease in the combined data (p=0.13, OR=1.24 [95% CI=0.93-1.64]) nor with the

subtypes of the disease (Wet AMD; p=0.22, OR=1.23 [95% CI=0.87-1.76], Dry AMD;

p=0.15, OR=1.24 [95% CI=0.90-1.71]; Table 3.9).

Multivariate logistic regression analysis showed that the derived genotype ‘TT’ of

rs10490924 in ARMS2 was significantly associated with AMD in the overall data as well

as with wet AMD. The ‘GT’ genotype of the polymorphism rs10490924 was not associated

with the risk of developing AMD (AMD overall; GT: p=0.92, OR=1.15 [95% CI=0.69-

1.91], TT: p=0.003, OR=2.61 [95% CI=1.28-5.32] nor with wet AMD (GT: p=0.94,

OR=1.19 [95% CI=0.61-2.32], TT: p=0.0006, OR=3.57 [95% CI=1.52-8.37]). None of the

genotypes were associated with dry AMD (GT: p=0.97, OR=1.12 [95% CI=0.63-1.99],

TT: p=0.06, OR=2.14 [95% CI=0.97-4.37]). Univariate logistic regression analysis showed

that the risk allele T was significantly associated with the disease in the overall data

(p<0.001, OR=1.61 [95% CI=1.22-2.11]) as well as with the subtypes of the disease (wet

AMD; p<0.001, OR=1.89 [95% CI=1.34-2.65], dry AMD; p=0.04, OR=1.43 [95%

CI=1.05-1.95]; Table 3.9).

3.7.1.2 C2/CFB

An AMD-associated SNP (rs429608) near C2 and CFB genes on chromosome 6p21.3 was

screened in AMD cases and controls (Table 3.10). Multivariate logistic regression analysis

adjusted for age, gender and smoking status showed that the genotype and allele frequency

99

Table 3.9 Logistic regression analysis of genotype and allele frequency distribution of polymorphisms rs1061170 in CFH and

rs10490924 in ARMS2 in AMD patients and controls

Genotype

CFH

(rs1061170)

Overall OR (95%CI) p/*p

value Wet AMD OR (95%CI)

p/*p

value

Dry AMD OR (95%CI) p/*p

value

Est. Z value Est. Z

value Est. Z value

TT -- -- -

0.94 (0.64-1.38)

2.14 (1.08-4.25)

-

0.77/0.99

0.02/0.11

- - -

0.85 (0.52-1.39)

2.37 (1.06-5.32)

-

0.53/0.95

0.03/0.13

- - -

1.05 (0.68-1.62)

2.05 (0.96-4.37)

-

**0.80

**0.06

TC -0.05 -0.28 -0.15 -0.62 0.05 0.24

CC 0.76 2.18 0.86 2.10 0.71 1.85

Allele

Frequency Controls Overall

Allele

Frequency

Allele

Frequency

T 281 (70%) 393 (66%) 1.24 (0.93-1.64) 0.13/0.26

164 (66%) 1.23 (0.87-1.76) 0.22/0.4

229 (65%) 1.24 (0.90-1.71)

**0.15/0.3 C 119 (30%) 207 (34%) 86 (34%) 121 (35%)

ARMS2 (rs10490924)

GG - -

-

1.15 (0.69-1.91)

2.61 (1.28-5.32)

-

0.47/0.92

0.0006/

0.003

- -

-

1.19 (0.61-2.32)

3.57 (1.52-8.37)

-

0.50/0.94

0.0001/

0.0006

- -

-

1.12 (0.63-1.99)

2.14 (0.97-4.37)

-

0.60/0.97

0.01/0.06

GT 0.14 0.71 0.17 0.66 0.11 0.51

TT 0.96 3.39 1.27 3.76 0.76 2.42

Allele


Allele

Frequency

Allele

Frequency

G 273 (68%) 343 (57%) 1.61 (1.22-2.11)

<0.001/<

0.001

133 (53%) 1.89 (1.34-2.65)

<0.001/<0

.001

210 (60%) 1.43 (1.05-1.95)

0.02/0.0

4 T 127 (32%) 257 (43%) 117 (47%) 140 (40%)

*p values corrected by simultaneous inference, **p value not corrected

100

Table 3.10 Logistic regression analysis of genotype and allele frequency distribution of rs429608 polymorphism near C2/CFB in AMD

patients and controls

Genotype

C2/CFB

(rs429608)

Overall

OR (95% CI) P

value

Wet AMD

OR (95% CI) P

value

Dry AMD

OR (95% CI) P

value Est. Z value Est. Z

value Est.

Z

value

GG

GA -0.03* -0.15* 0.96 (0.63- 1.47) 0.8*

-0.44 -1.50 0.63 (0.35- 1.14) 0.13 0.23 0.93 1.26 (0.77- 2.06) 0.35

AA -0.22 -0.37 0.79 (0.23- 2.65) 0.70 -0.40 -0.61 0.66 (0.18- 2.43) 0.54

Allele

Frequency Controls AMD

Allele

Frequency

Allele

Frequency

A 310 (79%) 400 (79%) 0.97 (0.69-1.36) 0.89

167 (81%) 0.86 (0.55-1.34) 0.52

233 (78%) 0.98 (0.66-1.44) 1.00

G 84 (21%) 106 (21%) 39 (19%) 62 (22%)

Est.; Estimate,

101

of rs4420638 was not associated with AMD. The homozygous genotype AA was present

in a small number of cases. Therefore, the heterozygous and homozygous genotype groups

were merged together in the combined AMD data to conduct multivariate logistic

regression analysis (AMD overall; p=0.8, OR=0.96 [95% CI=0.63-1.47], wet AMD; GA:

p=0.13, OR=0.63 [95% CI=0.35-1.14], AA: p=0.70, OR=0.79 [95% CI=0.23-2.65]; Table

3.10, dry AMD; GA: p=0.35, OR=1.26 [95% CI=0.77-2.06], AA: p=0.54, OR=0.66 [95%

CI=0.18-2.43]; Table 3.10). Univariate logistic regression analysis showed that the risk

allele A was also not associated with the disease in the combined data (p=0.89, OR=0.97

[95% CI=0.69-1.36]) nor with the subtypes of the disease (wet AMD; p=0.52, OR=0.86

[95% CI=0.55-1.34], dry AMD; p=1.00, OR=0.98 [95% CI=0.66-1.44]; Table 3.10).

3.7.1.3 C3

An AMD-associated SNP (rs2230199) in C3 was screened in AMD cases and controls.

Multivariate logistic regression analysis adjusted for age, gender and smoking status

showed that the genotype and allele frequencies of the polymorphism rs2230199 were not

associated with AMD (AMD overall; GC: p=0.17, OR=0.31 [95% CI=0.05-1.70], CC:

p=0.31, OR=0.42 [95% CI=0.08-2.24], wet AMD; GC p=0.32, OR=0.35 [95% CI=0.04-

2.78], CC: p=0.28, OR=0.33 [95% CI=0.04-2.52], dry AMD; GA: p=0.13, OR=0.24 [95%

CI=0.03-1.53], AA: p=0.36, OR=0.44 [95% CI=0.07-2.61]; Table 3.11). Univariate

logistic regression analysis showed that the risk allele C was also not associated with the

disease in the overall data (p=0.62, OR=1.10 [95% CI=0.7-1.64]) nor with the subtypes of

the disease (wet AMD; p=0.5, OR=0.86 [95% CI=0.53-1.3], dry AMD; p=0.18, OR=1.36

[95% CI=0.84-2.19]; Table 3.11).

3.7.2 Screening Polymorphisms in Lipid Metabolism Associated Gene

3.7.2.1 APOE

A previously reported AMD-associated SNP (rs4420638) 14 kb upstream of the APOE

gene was screened in AMD cases and controls. Multivariate logistic regression analysis

adjusted for age-, gender and smoking status showed that the genotype and allele

frequencies of polymorphism rs4420638 were not associated with AMD (Table 3.12). The

102

Table 3.11 Logistic regression analysis of genotype and allele frequencies of the rs2230199 polymorphism near C3 in AMD patients

and controls

Genotype

C3

(rs2230199)

Overall

OR (95% CI) P

value

Wet AMD

OR (95% CI) P

value

Dry AMD

OR (95% CI) P

value Estimate Z value Est. Z

value Est.

Z

value

GG

GC -1.16 -1.34 0.31 (0.05- 1.70) 0.17 -1.04 -0.99 0.35 (0.04- 2.78) 0.32 -1.41 -1.50 0.24 (0.03- 1.53) 0.13

CC -0.84 -1.0 0.42 (0.08- 2.24) 0.31 -1.10 -1.06 0.33 (0.04- 2.52) 0.28 -0.81 -0.90 0.44 (0.07- 2.61) 0.36

Allele


Allele

Frequency

Allele

Frequency

G 56 (14%) 69 (13%) 1.10 (0.7-1.64) 0.62

35 (16%) 0.86 (0.53-1.3) 0.5

34 (11%) 1.36 (0.84-2.19) 0.18

C 344 (%) 469 (87%) 185 (84%) 284 (89%)

Est.; Estimate, Con.; Controls

103

Table 3.12 Logistic regression analysis of genotype and allele frequencies of the rs4420638 polymorphism near APOE in AMD


Genotype

APOE

(rs4420638)

Overall

OR (95% CI) p

value

Wet AMD

OR (95% CI) p

value

Dry AMD

OR (95% CI) p value Est. Z value Est.

Z

value Est.

Z

value

GG 1.34 (0.79- 2.28)

0.27

0.99 (0.50- 1.99) 0.99

1.55 (0.86- 2.80) 0.14 GA+AA 0.29 1.08 -0.001 -0.003 0.44 1.46

Allele


Allele

Frequency

Allele

Frequency

G 373 (91%) 454 (90%) 1.15 (0.72-

1.84) 0.57

185 (92%) 0.92 (0.48-1.75) 0.88

269 (88%) 1.31 (0.78-2.19) 0.31

A 37 (9%) 52 (10%) 17 (8%) 35 (12%)

, Est.; Estimate,

104

homozygous genotype AA was not present in the patients and only one control individual

was homozygous for the risk allele. Therefore, the heterozygous and homozygous genotype

groups were merged together to conduct the multivariate logistic regression analysis (AMD

overall; p=0.27, OR=1.34 [95% CI=0.79- 2.28], wet AMD; p=0.99, OR=0.99 [95%

CI=0.50-1.99], dry AMD; p=0.14, OR=1.55 [95% CI=0.86-2.80]; Table 3.12). Univariate

logistic regression analysis showed that the risk allele A was also not associated with the

disease in the combined data (p=0.57, OR=1.15 [95% CI=0.72-1.84]) nor with the subtypes

of the disease (wet AMD; p=0.88, OR=0.92 [95% CI=0.48-1.75], dry AMD; p=0.31,

OR=1.31 [95% CI=0.78-2.19]; Table 3.12).

3.7.3 Screening Polymorphisms in Immune System Pathway Genes

3.7.3.1 CX3CR1

Two SNPs, rs3732378 (c.839C>T) and rs3732379 (c.745G>A), in CX3CR1 were

genotyped in the AMD cohort and controls. Multivariate logistic regression analysis

showed that the genotype distribution of rs3732378 was not associated with AMD (AG;

p=0.5, OR=2.04 [95% CI=0.57-7.31]; GG; p=0.6, OR=1.77 [95% CI=0.55-5.69]; Table

3.13), nor with any of the sub-types of AMD (Table 3.13). Univariate logistic regression

analysis showed that the risk allele ‘G’ was also not associated with AMD (p=0.28,

OR=0.76 [95% CI=0.52-1.10]; Table3.13), nor with wet AMD (p=0.60, OR=0.76 [95%

CI=0.46-1.24]; Table 3.13), but was significantly associated with dry AMD (p=0.00,

OR=0.30 [95% CI=0.16-0.55]; Table 3.13) suggesting a protective role in dry AMD.

Multivariate logistic regression analysis showed that the heterozygous genotype ‘CT’ of

rs3732379 in CX3CR1 was significantly associated with AMD (CT; p=0.005, OR=0.26

[95% CI=0.08-0.77], TT; p=0.9, OR=1.59 [95% CI=0.37-6.69]; Table 3.13), and also with

dry AMD (CT; p=0.0008, OR=0.19 [95% CI=0.06-0.60], TT; p=0.9,OR=1.41 [95%

CI=0.30-6.48]; Table 3.13) but not with wet AMD (CT; p=0.5, OR=0.41 [95% CI=0.09-

1.85], TT; p=0.7, OR=2.25 [95% CI=0.35-14.1]; Table 3.13). Univariate logistic

regression analysis showed that the risk allele ‘T’ was not associated with AMD overall

(p=0.64, OR=1.12 [95% CI=0.88-1.44]; Table 3.13), nor with wet AMD (p=0.36, OR=1.23

105

Table 3.13 Logistic regression analysis of genotype and allele frequencies of rs3732378 and rs3732379 polymorphisms in CX3CR1 in

AMD patients and controls

CX3CR1

(rs3732378)

Overall

OR (95%CI) p value/

*p-value

Wet AMD

OR (95%CI) p value/

*p-value

Dry AMD

OR (95%CI) p value/

*p-value Est. Z value Est. Z

value Est.

Z

valu

e

AA -- -- -- -- -- --

AG 0.71 1.47 2.04 (0.57- 7.31) 0.13/0.5 0.30 0.50 1.35 (0.27- 6.57) 0.61/0.9 1.08 1.71 2.95 (0.56- 15.6) 0.08/0.3

GG 0.57 1.30 1.77 (0.55- 5.69) 0.19/0.6 0.28 0.53 1.33 (0.32- 5.54) 0.59/0.9 0.79 1.33 2.21 (0.46- 10.4) 0.18/0.6

Allele

Frequency Con. AMD

Allele

Frequency Allele Frequency

A 429 (86%) 533 (89%) 0.76 (0.52-1.10) 0.14/0.28

222 (89%) 0.76 (0.46-1.24) 0.30/0.60

314 (95%) 0.30 (0.16-0.55)

<0.0001

<0.001 G 71 (14%) 67 (11%) 28 (11%) 16 (5%)

CX3CR1 (rs3732379)

CC -- -- -- --

CT -1.34 -3.28 0.26 (0.08- 0.77) 0.001/

0.005 -0.89 -1.56 0.41 (0.09- 1.85) 0.11/0.5 -1.64

-3.80

0.19 (0.06- 0.60) 0.0001/

0.0008

TT 0.46 0.85 1.59 (0.37- 6.69) 0.39/0.9 0.81 1.17 2.25 (0.35- 14.1) 0.24/0.7 0.34 0.60 1.41 (0.30- 6.48) 0.54/0.9

Allele

Frequency Con. AMD

Allele

Frequency Allele Frequency

C 250 (50%) 282 (47%) 1.12 (0.88-1.44) 0.32/0.64

112 (45%) 1.23 (0.89-1.69) 0.18/0.36

170 (48%) 1.05 (0.79-1.40) 0.72/1.00

T 250 (50%) 318 (53%) 138 (55) 180 (52%)

*p values corrected by simultaneous inference,

106

[95% CI=0.89-1.69], and neither with dry AMD (p=1.00, OR=1.05 [95% CI=0.79-1.40];

Table 3.13).

3.7.4 Screening Vascular System Related Gene Polymorphisms

3.7.4.1 VEGF

Three promoter region polymorphisms of VEGF were screened in 150 AMD samples (50%

wet AMD and 50% dry AMD) and 150 age-matched controls. Multivariate logistic

regression analysis was conducted and the results showed that rs8333061 was not

associated with AMD overall, nor with wet AMD or dry AMD (AMD overall; CT: p=0.80,

OR=1.05 [95% CI=0.68-1.62], TT: p=0.44, OR=2.05 [95% CI=0.96-4.37], wet AMD; CT:

p=0.44, OR=1.34 [95% CI=0.62-2.86], TT: p=0.10, OR=1.89 [95% CI=0.86-4.15), Dry

AMD; CT: p=0.68, OR=0.86 [95% CI=0.43-1.72], TT: p=0.65, OR=0.84 [95% CI=0.39-

1.79]; Table 3.14).

In addition, rs13207351 was also not associated with AMD or any subtype of AMD in the

current cohort (AMD overall; AG: p=0.93, OR=0.97 [95% CI=0.53-1.76], GG: p=0.72,

OR=1.12 [95% CI=0.58-2.17], Wet AMD; AG: p=0.28, OR=1.55 [95% CI=0.69-3.48],

GG: p=0.12, OR=1.96 [95% CI=0.82-4.66), Dry AMD; AG: p=0.28, OR=0.68 [95%

CI=0.34-1.36], GG: p=0.32, OR=0.67 [95% CI=0.30-1.48]; Table 3.14).

Also rs1570360 was not associated with AMD or any subtype of AMD in the current cohort

(AMD overall; GA: p=0.20, OR=1.37 [95% CI=0.87-2.25], AA: p=0.45, OR=1.31 [95%

CI= 0.65-2.64], wet AMD; GA: p=0.30, OR=1.35 [95% CI=0.75-2.45], AA: p=0.46,

OR=0.68 [95% CI=0.25-1.86], dry AMD; GA: p=0.23, OR=1.45 [95% CI=0.78-2.70],

AA: p=0.07, OR=2.08 [95% CI=0.93-4.65]; Table 3.14). Univariate logistic regression

analysis showed that the risk allele C of rs8333061, the risk allele G of rs13207351 as well

as risk allele A of rs1570360 were not associated with AMD [(rs8333061; AMD overall;

T: p=0.41, OR=1.59 [95% CI=0.83-1.62], wet AMD: p=0.08, OR=1.42 [95% CI=0.93-

2.16], dry AMD; p=0.84, OR=0.94 [95% CI=0.62-1.43], rs13207351; AMD overall;

p=1.00, OR=1.01 [95% CI=0.72-1.41], wet AMD: p=0.23, OR=1.27 [95% CI=0.84-1.93],

dry AMD; p=0.31, OR=0.80 [95% CI=0.53-1.21]), (rs1570360; AMD overall; p=0.25,

OR=1.23 [95% CI=0.86-1.76], wet AMD: p=1.00, OR=0.98 [95% CI=0.62-1.54]) but the

107

Table 3.14 Logistic regression analysis of genotype and allele frequencies of VEGF polymorphisms in AMD patients and controls

Genotype

VEGF

rs8333061

Overall OR (95%CI) p

value Wet AMD OR (95%CI)

*p

value Dry AMD OR (95%CI)

*P

value

Est. Z value Est. Z

value Est.

Z

value

CC - -

1.05 (0.68- 1.62)

2.05 (0.96- 4.37)

-

0.86

0.44

- - -

1.34 (0.62- 2.86)

1.89 (0.86-4.15)

-

0.44

0.10

- - -

0.86(0.43- 1.72)

0.84(0.39-1.79)

-

0.68

0.65

CT 0.05 0.24 0.29 0.75 -0.14 -0.40

TT 0.71 1.85 0.64 1.60 -0.17 -0.44

Allele


Allele

frequency

Allele

frequency

C 142 (47%) 131 (44%) 1.59 (0.83-1.62) 0.41

58 (39%) 1.42 (0.93-2.16) 0.08

73 (49%) 0.94 (0.62-1.43) 0.84

T 158 (53%) 169 (56%) 92 (61%) 77 (51%)

rs13207351

AA - -

0.97 (0.53- 1.76)

1.12 (0.58-2.17)

-

0.93

0.72

- - -

1.55 (0.69-3.48)

1.96 (0.82- 4.66)

-

0.28

0.12

- - -

0.68(0.34- 1.36)

0.67(0.30- 1.48)

-

0.28

0.32

AG -0.02 -0.08 0.43 1.06 -0.38 -1.07

GG 0.11 0.34 0.67 1.52 -0.39 -0.97

Allele


Allele

frequency

Allele

frequency

A 140 (47%) 135 (45%) 1.01 (0.72-1.41) 1.00

59 (39%) 1.27 (0.84-1.93) 0.23

76 (51%) 0.80 (0.53-1.21) 0.31

G 169 (53%) 165 (55%) 91 (61%) 74 (49%)

rs1570360

GG - -

1.37 (0.84- 2.25)

1.31 (0.649- 2.64)

-

0.20

0.45

- - -

1.35 (0.75-2.45)

0.68 (0.25- 1.86)

-

0.30

0.46

- - -

1.45(0.78-2.70)

2.08(0.93- 4.65)

-

0.23

0.07

GA 0.32 1.27 0.30 1.01 0.37 1.19

AA 0.27 0.75 -0.37 -0.73 0.73 1.79

Allele


Allele

frequency

Allele

frequency

G 209 (70%) 195 (65%) 1.23 (0.86-1.76) 0.25

105 (70%) 0.98 (0.62-1.54) 1.00

90 (60%) 1.53 (0.99-2.35)

0.04/0

.12 A 91 (30%) 105 (35%) 45 (30%) 60 (40%)

*p values corrected by simultaneous inference, Est.; Estimate

108

risk allele ‘A’ of the SNP rs1570360 was found to be associated with dry AMD; p=0.04,

OR=1.53 [95% CI=0.99-2.35]; Table 3.14) but the association did not remain significant

after the p-values were corrected.

3.7.4.2 Intron 4, 27bp VNTR in NOS3

Multivariate logistic regression analysis of the intron 4, 27 bp VNTR in NOS3 showed that

the genotype frequencies were not associated with AMD (ba; p=0.22, OR=1.59 [95%

CI=0.87-2.90], aa; p=0.07, OR=1.91 [95% CI=0.47-7.66]; Table 3.15), nor with wet AMD

(ba; p=0.1, OR=1.80 [95% CI=0.86-3.73], aa; p=0.8, OR=1.88 [95% CI=0.36-9.56]; Table

3.15) or with dry AMD (ba; p=0.7, OR=1.41 [95% CI=0.69-2.87], aa; p=0.9, OR=1.55

[95% CI=0.31-7.66]; Table 3.15). Univariate logistic regression analysis showed that the

risk allele ‘a’ was associated with AMD in the overall cohort (p=0.01, OR=1.57 [95%

CI=1.00-2.28]; Table 3.15), as well as with wet AMD (p=0.008, OR=1.81 [95% CI=1.15-

2.84], but not with dry AMD (p=0.11, OR=1.40 [95% CI=0.91-2.16]; Table 3.15).

3.7.5 Screening Polymorphisms in Genes Implicated in Oxidative Stress

3.7.5.1 MMPs

Two SNPs, rs17576 and rs243866, in MMP9 and MMP2, respectively, were genotyped in

the AMD cohort and controls. Multivariate logistic regression analysis showed that

rs17576 in MMP9 was significantly associated with AMD (AG; p=0.005, OR=8.47 [95%

CI=1.57-45.5]; GG; p=0.05, OR=5.34 [95% CI=0.97-29.25]; Table 3.16)), but not with

any of the sub-types of AMD (Table 3.16). Univariate logistic analysis showed that the risk

allele ‘G’ was not associated with AMD (p=1.00, OR=1.06 [95% CI=0.8 2-1.38]; Table

3.16), nor any subtype of AMD (Wet AMD; p=1.00, OR=0.97 [95% CI=0.68-1.33]; Dry

AMD; p=0.60, OR=1.15 [95% CI=0.85-1.56]; Table3.16).

For the rs243866 SNP in MMP2, multivariate logistic regression analysis showed that the

homozygous risk genotype ‘AA’ was significantly associated with AMD (AA; p=0.01,

OR=4.98 [95% CI=1.25-19.88]; Table 3.16), and also with dry AMD (AA; p=0.01,

OR=5.55 [95% CI=1.22-25.1]; Table 3.16), but not with wet AMD (AA; p=0.06, OR=4.76

109

Table 3.15 Logistic regression analysis of genotype and allele frequencies of the 27-bp VNTR polymorphism in NOS3 in AMD


Genotype

NOS3

Overall

OR (95% CI) *P

value

Wet AMD

OR (95% CI) *P

value

Dry AMD

OR (95% CI) *P

value Est. Z value Est. Z

value Est.

Z

value

Bb -- -- -- -- -- --

Ba 0.46 2.04 1.59 (0.87- 2.90) 0.04/0.

22 0.58 2.13 1.80 (0.86- 3.73)

0.03/

0.1 0.34 0.26 1.41 (0.69- 2.87)

0.19/0

.7

Aa 0.64 1.23 1.91 (0.47- 7.66) 0.21/0.

76 0.63 1.02 1.88 (0.36- 9.56)

0.30/

0.8 0.44 0.73 1.55 (0.31- 7.66)

0.46/0

.9

Allele

Frequency Con AMD

Allele

Frequency

Allele

Frequency

B 446 (89%) 504 (84%) 1.57 (1.0-2.28) 0.01

205(85%) 1.81 (1.15-2.84) 0.008

299 (85%) 1.40 (0.91-2.16) 0.11

A 54 (11%) 96 (16%) 45 (18%) 51 (15%)

*p values corrected by simultaneous inference, Est.; Estimate, Con.; controls

110

Table 3.16 Logistic regression analysis of genotype and allele frequencies of MMP9 (rs17576) and MMP2 (rs243866) polymorphisms

in AMD patients and controls

Genotype

MMP9

(rs17576)

Overall

OR (95%CI) p value/

*p-value

Wet AMD

OR (95%CI) p value/

*p-value

Dry AMD

OR (95%CI) p value/

*p-value Est. Z value Est. Z value Est. Z

value

AA -- -- -- --

AG 2.13 3.33 8.47 (1.57- 45.5) 00008/

0.005 2.55 2.45 12.92 (0.85- 19.6)

0.01/

0.07 1.90 2.46 6.7 (0.88- 50.4)

0.01/

0.07

GG 1.67 2.58 5.34 (0.97-29.25) 0.009/

0.05 1.78 1.69 5.93 (0.37- 92.5)

0.09/

0.3 1.56 2.00 4.78 (0.62- 36.7)

0.04/

0.22

Allele

Frequency Con. AMD Allele Frequency Allele Frequency

A 175 (35%) 201 (66.5%) 1.06 (0.82-1.38) 0.61/1.00

90(36%) 0.97 (0.68-1.33) 0.8/1.00

111(32%) 1.15 (0.85-1.56) 0.33/0.60

G 325 (65%) 399 (33.5%) 160(64%) 239(68%)

MMP2(rs243866)

GG -- -- -- -- -- --

GA -0.01 -0.05 0.98 (0.57-1.69) 0.95/

1.00 -0.22 -0.85 0.79 (0.39-1.61)

0.39/

0.9 0.09 0.39 1.09 (0.58- 2.04) 0.69/0.9

AA 1.60 3.07 4.98 (1.25-19.88) 0.002/

0.01 1.56 2.54 4.76 (0.94-24.1)

0.01/

0.06 1.71 3.00 5.55 (1.22- 25.1) 0.002/0.01

Allele

Frequency Con. AMD Allele Frequency Allele Frequency

G 421 (84%) 469 (78%) 1.48 (1.08-2.05) 0.01/0.02

202 (81%) 1.26 (0.83-1.91) 0.25/0.5

267 (76%) 1.60 (1.12-2.29) 0.008/0.01

A 79 (16%) 131 (22%) 48 (19%) 83 (24%)

*p values of genotype frequency corrected by simultaneous inference and p values of allele frequency corrected by Bonferroni method,

Est.; Estimate, Con,; Controls,

111

[95% CI=0.94-24.1]; Table 3.16). Similarly, univariate logistic regression analysis showed

that the risk allele ‘G’ was associated with AMD (p=0.02, OR=1.48 [95% CI=1.08-2.05];

Table3.9), as well as with dry AMD (p=0.01, OR=1.65 [95% CI=1.15-2.37]), but not with

wet AMD (p=0.5, OR=1.26 [95% CI=0.83-1.91]; Table 3.16).

3.7.5.2 TIMP3

A previously reported AMD-associated SNP (rs5749482) 100 kb upstream of TIMP3 was

screened in AMD cases and controls. The multivariate logistic regression analysis adjusted

for age, gender and smoking status showed that the genotype and allele frequencies of the

polymorphism rs4420638 were not associated with AMD. As the homozygous genotype

AA was present in in only a few cases, the heterozygous and homozygous genotype groups

were added together in the combined AMD multivariate logistic regression analysis (AMD

overall; p=0.60, OR=1.13 [95% CI=0.70-1.81], wet AMD; p=0.73, OR=1.10 [95%

CI=0.60-2.02], dry AMD; p=0.48, OR=1.21 [95% CI=0.70-2.06]; Table 3.17). Univariate

logistic regression analysis showed that the risk allele C was also not associated with the

disease in the overall data (p=0.69, OR=1.08 [95% CI=0.72-1.63]) nor with the subtypes

of the disease (wet AMD; p=0.80, OR=1.06 [95% CI=0.63-1.78], dry AMD; p=0.65,

OR=1.10 [95% CI=0.69-1.74]; Table 3.17).

3.7.5.3 TNF and ILβ

The SNP rs1800629 in TNF and SNP rs16944 in ILβ were genotyped in the AMD cohort

and controls. Multivariate logistic regression analysis showed that there was no genotype

association between the TNF rs1800629 SNP and the AMD cohort nor with any subtype of

AMD (Table 3.18). For rs16944 in ILβ, multivariate logistic regression analysis showed

that the heterozygous genotype ‘CT’ as well as homozygous risk allele ‘TT’ were

significantly associated with AMD (CT; p=0.01, OR=1.87 [95% CI=1.10-3.18]) TT;

p=0.02, OR=2.38 [95% CI=1.06-5.38]; Table 3.18), and also with wet AMD (CT; p=0.05,

OR=2.01 [95% CI=1.0-4.12], TT; p=0.009, OR=3.23 [95% CI=1.21-8.62]; Table 3.18) as

well as with dry AMD but only with the CT genotype (CT; p=0.006, OR=2.17 [95%

CI=1.16-4.06], TT; p=0.15, OR=2.29 [95% CI=0.85-6.21]; Table 3.18). Univariate logistic

112

Table 3.17 Logistic regression analysis of genotype and allele frequencies of the rs5749482 polymorphism near TIMP3 in AMD patients

and controls

Genotype

TIMP3

(rs5749482)

Overall

OR (95% CI) P

value

Wet AMD

OR (95% CI) P

value

Dry AMD

OR (95% CI) P

value Estimate Z value Est. Z

value Est.

Z

value

GG - - 1.13 (0.70- 1.81) 0.60

- - 1.10 (0.60- 2.02) 0.73

- - 1.21 (0.70- 2.06) 0.48

GC+CC 0.124 0.51 0.10 0.33 0.19 0.69

Allele


Allele

Frequency

Allele

Frequency

G 340 (87%) 450 (86%) 1.08 (0.72-1.63) 0.69

185 (86%) 1.06 (0.63-1.78) 0.80

265 (86%) 1.10 (0.69-1.74) 0.65

C 50 (13%) 72 (14%) 29 (14%) 43 (14%)

Est.; Estimate, Con.; Controls

113

Table 3.18 Logistic regression analysis of genotype and allele frequencies of rs1800629 in TNF and rs16944 in ILβ in AMD patients

and controls

Genotype

TNF

rs1800629

Overall

OR (95%CI) *p

value

Wet AMD

OR (95%CI) *p

value

Dry AMD

OR (95%CI) *P

value Estimate Z value Est. Z Est. Z

value

GG -- -- -- -- -- --

GA 0.15 0.62 1.16 (0.60- 2.27) 0.5/0.9 0.33 1.08 1.40 (0.61- 3.18) 0.27/0.8 0.08 0.27 1.08 (0.49- 2.38) 0.78/0.9

AA 0.19 0.20 1.21 (0.09- 15.38) 0.8/0.9 1.21 1.13 3.37 (0.19- 57.9) 0.25/0.8 -0.53 -0.41 0.58 (0.01- 17.4) 0.67/0.9

Allele


Allele

Frequency

Allele

Frequency

G 461 (92%) 545 (91%) 1.19 (0.76-1.87)

0.44/0.

88

224 (90%) 1.37 (0.78-2.38)

0.27/0.5

4

321 (92%) 1.06 (0.62-1.81) 0.79/1.00

A 39 (8%) 55 (9%) 26 (10%) 29 (8%)

ILβ rs16944

TT -- -- -- -- -- --

TC 0.62 3.14 1.87 (1.10- 3.18) 0.001/0

.01 0.70 2.5 2.01 (1.00- 4.12)

0.009/0.

05 0.77 3.27 2.17 (1.16- 4.06)

0.001/0.00

6

CC 0.87 2.83 2.38 (1.06- 5.38) 0.004/0

.02 1.17 3.16 3.23 (1.21- 8.62)

0.001/0.

009 0.83 2.21 2.29 (0.85- 6.21) 0.02/0.15

Allele


Allele

Frequency

Allele

Frequency

T 348 (70%) 371 (62%) 1.41 (1.09-1.83)

0.008/0

.01

148 (59%) 1.57 (1.13-2.19)

0.005/0.

01

223(64%) 1.30 (0.96-1.76) 0.07/0.14

C 152 (30%) 229 (38%) 102 (40%) 127 (36%)

*p values corrected by simultaneous inference,

114

regression analysis showed that the risk allele ‘T’ was associated with [95% CI=1.09-1.83];

Table3.18), and with wet AMD [p=0.01, OR=1.57 [95% CI=1.13-2.19], but not with dry

AMD (p=0.14, OR=1.30 [95% CI=0.96-1.76]; Table 3.18).

3.8 Summary

The Summarised results of the multivariate logistic regression (OR and 95% CI) are

presented in the forest plots (Fig. 3.16; POAG, Fig. 3.17; PACG and Fig. 3.18;

PEXG, Fig. 3.19; wet AMD and Fig. 3.20; dry AMD).

115

Fig 3.16 Forest plot of the SNPs screened for POAG. Diamond shape represents OR, horizontal lines represent 95% CI, HG;

heterozygous genotype, VG; variant allele genotype, AF; Allele frequency, * the p values were significant before correction for

multiple testing. The vertical line at unit 1 represents the central value of OR. All the horizontal lines that cross this line represent non-

significant association of the SNPs. Those left of this central line are protective (OR<1), and those right of the line are risk-conferring

SNPs (OR>1).

116


heterozygous genotype, VG; variant allele genotype, AF; Allele frequency. The vertical line at unit 1 represents the central value of

OR. All the horizontal lines that cross this line represent non-significant association of the SNPs. Those left of this central line are

protective (OR<1), and those right of the line are risk-conferring SNPs (OR>1).

117





SNPs (OR>1).

118





SNPs (OR>1).

119


heterozygous genotype, VG; variant allele genotype, AF; Allele frequency. The vertical line at unit 1 represents the central value of

OR. All the horizontal lines that cross this line represent non-significant association of the SNPs. Those left of this central line are

protective (OR<1), and those right of the line are risk-conferring SNPs (OR>1).

Chapter 4

Discussion

121

4 Discussion

Glaucoma and AMD are multifactorial diseases, caused by a combination of genetic and

environmental factors. Some of the features reflecting the complex nature of the diseases

are their heterogeneous nature (different genes causing the same phenotype) and polygenic

involvement (more than one gene interacts to cause the disease). In addition, environmental

factors also influence disease progression (phenocopies), and sometimes the mutation

carriers do not have disease symptoms due to the presence of modifier elements. In

addition, such diseases may also not necessarily follow Mendelian rules of inheritance

(Faucher et al., 2002; Baird et al., 2003; Pang et al., 2002; Lander and Schork 1994). For

such complex diseases, although it is difficult but is very important to ascertain the

pathogenic nature of the variant, penetrance of the disease and age of disease onset.

Moreover another indicator of the pathogenicity of a certain variant is indicated by its

higher presence in affected individuals as compared to an unaffected control population

(Alward et al., 1998).

In an attempt to identify the underlying genetic factors in Pakistani patients implicated in

multifactorial disorders including glaucoma and AMD, genetic screening was carried out

for 20 families with glaucoma and 2 families with AMD. In the glaucoma families, possible

novel disease genes were identified, including a possible novel locus for PCG. The

previously associated glaucoma genes MYOC, OPTN and WDR36 were found not to be

involved in the pathogenesis of glaucoma in the studied Pakistani families. However, a

mutation in CYP1B1 was found to be involved in the pathogenicity of PCG in a Pakistani

family. Of the 20 families studied, in 4 (20%) families of glaucoma a possible genetic cause

was identified in the current study. Along with the screening of the familial cases, case-

control association analysis for both glaucoma and AMD was carried out where 12 SNPs

in 1000 cases with glaucoma (500 POAG, 200 PACG and 300 PEXG) and 300 controls,

and 16 SNPs in 300 cases with AMD and ~300 controls were studied. In the Pakistani

population a few SNPs were found to have a protective role while others had a pathogenic

role and yet others had no role in the pathogenicity of the diseases. The difference in the

association of the SNPs in Pakistani populations as compared to the populations in which

the SNPs are associated with the respective diseases (glaucoma and AMD) might be due

122

to variations in the distribution of the alleles of a particular SNP in various populations of

the world.

4.1 Glaucoma Families

All the glaucoma families were pre-screened for candidate glaucoma genes MYOC OPTN,

WDR36 and CYP1B1. Though MYOC is known to be involved in disease progression in

2.6% to 4.4% of POAG cases (Fingert et al., 1999), no pathogenic variant in the gene was

found in the current cohort with the exception of a non-synonymous SNP (rs2234926).

This variant was identified in 16 probands, and was therefore screened in a panel of

unrelated POAG, PACG and PEXG patients. However, no significant association was

found for rs2234926 with the different types of glaucoma. This polymorphism is a

recurrent SNP among MYOC variations and being the most common SNP it is reported to

be disease-associated in various populations (Lam et al., 2000; Pang et al., 2002). In

addition, mutations in MYOC occur in various populations of the world with varying

frequency; 8% of Italian glaucoma patients carry MYOC variants, whereas in the Finnish

population no MYOC variants were identified (Lam et al., 2000; Pang et al., 2002; Fingert

et al., 1999). In the Indian population, mutations in the gene are reported to be responsible

for 2% of POAG cases (Sripriya et al., 2004). Although no disease-causing mutation was

found in the current cohort, recently the c.1130C>T, p.(Thr377Arg) variant in MYOC has

been reported to be a disease-causing mutation in a Pakistani family (Waryah et al., 2013).

This indicates the possibility that the gene might be involved in the pathogenesis of

glaucoma in the Pakistani population, but is probably a rare cause of the disease. Similarly,

in the current cohort only a known pathogenic SNP, Met98Lys, was found in OPTN in

three probands. The result is not surprising as the association of the SNPs and mutations in

OPTN varies among various populations of the world (Leung et al., 2003; Ayala-Lugo et

al., 2007). The original study that highlighted OPTN as a candidate gene for glaucoma

described the Met98Lys, was found in OPTN in three probands. The result is not surprising

as the variant to be associated with NTG (Rezaie et al., 2002). Although subsequent studies

showed conflicting results about the involvement of the variant in glaucoma, meta-analysis

did indicate association of the Met98Lys, was found in OPTN in three probands. The result

is not surprising as the variant with glaucoma but only a weak association was found in

123

various Asian populations (Ayala-Lugo et al., 2007; Alward et al., 2003; Fuse et al., 2004;

Sripriya et al., 2006). Keeping in view the diversity of the association of this SNP with

different populations, Ayala-Luogo et al (2007) proposed that the involvement of

rs11258194 might be evaluated in glaucoma families as well as in sporadic cases. Thus in

the current study the segregation of rs11258194 was checked in the families of the 3

probands (in whom it was initially identified), as well as its association with sporadic

POAG, PACG and PEXG cohorts. Although the SNP did not segregate in the 3 POAG

families, an interesting pattern of segregation was seen when the overall frequency

distribution of the alleles was calculated in the affected as well as unaffected family

members. In this analysis it was observed that of the total individuals 2 (11%) had the

ancestral TT genotype, 14 (78%) were heterozygous (TA) and 2 (11%) had the

homozygous variant allele (AA). This pattern was not seen in unaffected controls

(TT=96.4%, TA=3.6%, AA=0%), or sporadic cases of POAG (TT=90.8%, TA=9%,

AA=0.2%). Although this variant did not segregate in the families, the preponderance of

the TA genotype in the families suggests a possible role in the progression of the disease.

This genotype may interact with some other unknown gene and thus increase the risk of

glaucoma in the families carrying this variant. In order to preclude the possibility that the

high prevalence in the affected families was by chance, we also analyzed two other POAG

families in which this variant was not found in the probands, but none of the members of

these families were found to carry the variant A allele. This further strengthens our

conjecture that when present, this variant might play a role in the initiation or progression

of the disease in the affected families. In addition, this SNP has previously been reported

to be associated with low IOP, and thus has a modifying effect on the glaucoma phenotype.

OPTN increases the sensitivity of glial neuronal cells to risk factors of glaucoma, even at

normal IOP (Melki et al., 2003). In the current study no difference was detected between

the IOP in patients with and without this variant, which is in agreement with the previous

work of Ayala-Luogo et al. (2007) who also did not find an IOP lowering effect of the

variant allele of this SNP. However, its role in an increased risk due to sensitivity of glial

cells at normal IOP cannot be ruled out, thus studies of NTG patients are required to further

validate this.

124

When WDR36 was screened in the familial cases no mutation was found in any of the cases.

Previously Monemi et al (2005) have shown that WDR36 was associated with Glaucoma,

where they found 4 mutations in this gene present in 11 patients. However, in subsequent

studies of the same gene no association of WDR36 was observed with glaucoma (Fingert

et al., 2007; Footz et al., 2009) thus making it one of the rare genes causing glaucoma in a

select ethnic group.

In the current cohort, there were three families of PCG, and in one family (GLC 2) among

thethem a possible novel locus on chromosome 7 was found to be linked with the disease,

and in another family (GLC 16) a mutation (Arg290Profs*37) in CYP1B1 segregated with

the disease. One family however, remained unsolved. The incidence of PCG worldwide is

1:10,000, which is much higher among populations where the rate of consanguineous

marriages is higher (Papadopoulos et al., 2007). To date the highest incidence of PCG has

been found in Gypsies (1:1,250) (Gencik 1989) and Saudis (1:2500) (Gencik et al., 1982)

whereas in India 1:3300 children suffer from PCG (Dandona et al., 1998). In the Pakistani

population the ratio of consanguineous marriages is much higher (Afzal et al., 1994;

Hussain and Bittles 1998), hence the rate of PCG is expected to be high but due to a lack

of epidemiological studies the exact rate is not known. To date 4 loci (GLC3A to GLC3D)

have been reported to be associated with PCG (Sarfarazi et al., 1995; Akarsu et al., 1996).

Two genes in two of these loci have been found to be involved in the pathogenicity of PCG,

one of which is well established; CYP1B1 in GLC3A (Stoilov et al., 1997) and LTBP2 in

GLC3D. The later still needs to be functionally validated for its involvement in PCG

(Moren et al., 1994). It has been more than a decade that CYP1B1 has been shown to be

causative in PCG patients (Sarfarazi et al., 1995), and screening of POAG and PCG for

CYP1B1 in different populations of the world has revealed various mutations involved in

the pathogenesis of the disease. Mostly these mutations have been identified in

homozygous form in PCG patients owing to the recessive pattern of inheritance of the

disease (Stoilov et al., 1998). Nearly 150 mutations are known in CYP1B1, causing PCG

in various populations while a few of them have been identified to be disease-associated in

the Pakistani population, which include p.Leu177Pro, p.Ile87Val, p.Asp374Asn (Beier and

Fahimi 1985), p.Ala288Pro, p.Asp242Ala (Micheal et al., 2014). This higher prevalence

of mutations in a particular gene resulting in the same phenotype in a population is

125

indicative of its pathogenicity and screening of this gene could be effectively used as a

diagnostic tool for pre-screening of PCG patients before whole genome analysis.

Another interesting result of the current work was the identification of possible trigenic

inheritance in a JOAG family (GLC 1). Novel variants in MYO18A, ENOX1 and COL9A2

segregated with the disease in one loop (GLC1a) of the family, while in the other loop

(GLC1b) a variant in NCOA7 segregated with the disease in the family. The difference in

both loops was the age at which the symptoms of the disease started to appear. In the loop

where the three variants were present the mean age of onset was 25 years, whereas in the

loop where this possible trigenic pattern was absent, the mean age of onset of the disease

was 50 years. The interaction of different genes resulting in variation in the age at which

the symptoms of a particular phenotype appear within the same family has also been

reported previously in glaucoma, where a single mutation in MYOC (Gly399Val) resulted

in disease development among the affected individuals at a mean age of 57 years, and when

this mutation was present in tandem with a mutation in another gene, CYP1B1

(Arg368His), it resulted in a lower mean age of disease onset to 27 years (Vincent et al.,

2002).

Among the three variants, the variant in MYO18A (c.2071C>T; p.Arg691Cys) lies in a

highly conserved region in 12 species (phyloP 4.40) where it is present in the motor head

domain of the protein, resulting in the change of a basic amino acid (Arg) to a hydrophobic

amino acid (Cys), which gave a higher physicochemical difference among the two amino

acids (Grantham distance=180). SIFT analysis revealed the variant as deleterious and

Mutation Taster categorises the variant as disease-causing. The gene MYO18A encodes a

P21 activated kinase (PAK) involved in Golgi localization, cytoskeleton maintenance and

acts as an immunological cell surface protein (Hsu et al., 2010). Moreover, it also plays an

important role in the migration ability of epithelial cells (Taft et al., 2013). The motor

domain of MYO18A has a binding site for ATP and F-actin, and it is localized near the

cell periphery in the lamellar actomyosin bundles (Taft et al., 2013). There is no previous

report of the involvement of the gene in pathogenicity of glaucoma, but in a study

conducted by Thomas et al (2011) on the differential expression of protein phosphorylating

genes in response to increased pressure on the glial cells (astrocytes), the authors found

126

that MYO18A was one of the few genes highly expressed in the region as a result of

increased hydrostatic pressure. Inhibition of the protein kinases can result in the disruption

of the actin filaments, present in the eyes, which can change the TM and as a consequence

alter the ECM matrix composition and aqueous humor outflow (Thomas et al., 2011),

which can result in raising the IOP. High expression of the gene is seen in the mouse eye

(genome.ucsc.edu). All members of the family in the current study carrying the variant had

elevated IOP, which was reduced to the normal range by the use of medicine.

The second variant (c.171G>A, p.Met57Ile) in the family (GLC1) was found in the Ecto

NADH Oxidase (ENOX1) disulphide exchanger 1 gene. This variant also lies in a highly

conserved region of the gene in 12 species (phyloP 5.37), resulting in the change of

methionine (Met) to isoleucine (Ile). As both amino acids are hydrophobic, the

physicochemical difference is low (Grantham distance=10) and the pathogenicity

predicting programme SIFT grades the variant as tolerated, whereas Mutation Taster

identifies it as a disease-causing variant. The ENOX1 exhibits oxidoreductase activity as

well as N disulphide thiol interchange activity (Jiang et al., 2008). It also plays an essential

role in the plasma membrane electron transport pathway, which in turn is involved in

cellular defence, intracellular redox homeostasis and control of cell growth and survival

(Venkateswaran et al., 2014). It has been observed that there are strong interactions

between the plasma membrane and cytosolic redox homeostasis imbalance and oxidative

stress. Once the ratio is imbalanced the induction of Bcl-2 occurs resulting in apoptotic cell

death (Morré and Morré, 2012).

The third variant (c.1061C>T, p.Pro345Leu) segregating with the disease in the family was

located in the collagen, type IX, alpha 2 (COL9A2) gene, present in a highly conserved

region in 11 species (PhyloP 4.48). This change results in incorporation of the amino acid

leucine instead of the normally translated amino acid proline. As both amino acids are

hydrophobic, there is very little physciochemical difference between them (Grantham score

21). The pathogenicity predictor SIFT predicts the variant to be deleterious and the

Mutation Taster grades it as disease-causing. This is a rare variant and has been assigned a

reference SNP number rs201772619. The collagens play an important role in strengthening

and structurally supporting connective tissues (Bruce et al., 2007) such as tendons and

127

ligments. The type 9 collagens are the most flexible collagens among all. Mutations in the

genes coding the protein are known to cause dominant multiple epiphyseal dysplasia

(Villemain et al., 1990), intervertebral disc disease (Higashino et al., 2007) and Stickler’s

syndrome (Baker et al., 2011). The features of Stickler syndrome are distinctive facial

appearance, eye abnormalities, hearing loss and joint problems. The eye abnormalities can

be severe myopia (mostly), increased IOP and glaucoma, retinal detachment as well as

cataract (Nikopoulos et al., 2011; Pagon et al., 2012). Mutations in the gene have

previously been reported to cause severe myopia in Han Chinese (Chen et al., 2014a).

Glaucoma in the above mentioned family may possibly be due to a result of the combined

effect of all the three variants. The combination of these variants may also result in

lowering the age of onset of the disease, as in the patients (GLC1b) where the variant was

not present the age of onset of the disease was much higher. Moreover it was observed that

an individual who had both variants in MYO18A and ENOX1 had no symptoms of the

disease. Therefore, it is hypothesized that the presence of the third variant in COL9A2

interacts with the other two variants and results in the appearance of the phenotype at an

early age. Another possibility is that only one variant among the three is responsible for

the disease pathogenicity and COL9A2 variant is deemed to be the most likely disease

causative variant in this family. However, there is still a need of conducting functional

studies to validate the involvement as well as the interaction of these variants with each

other in the manifestation of disease. As opposed to this, the variant (c.724G>A,

p.Val242Met) in exon 11 of NCOA7 (nuclear receptor coactivator 7) segregated with the

disease in the loop with higher age of onset of the disease. The variant lies in a highly

conserved region (PhyloP 6.18) resulting in a change of valine to methionine in the

peptidoglycan-binding lysin domain. As both amino acids are hydrophobic, there is a small

physiochemical difference between them (Grantham distance=21). The pathogenicity

predicting software SIFT scores the variation deleterious, Mutation Taster categorises it as

disease-causing, and PolyPhen considers the variant as probably damaging. NCOA7

encodes a protein involved in nuclear hormone receptor binding and ligand-dependent

nuclear receptor transcription coactivator activity. It is involved in the enhancement of the

transcriptional activities of several nuclear receptors and coactivation of different nuclear

receptors, such as estrogen receptor 1, thyroid hormone receptor, beta, peroxisome

128

proliferator-activated receptor gamma and retinoic acid receptor, alpha. The gene has been

implicated in reducing oxidative stress, thus lowering its damaging effects (Durand et al.,

2007), in diseases such as neurological diseases. These are regulated by interferons,

moreover the exons 11, 12 and 15 are expressed excessively as compared to other exons in

the neurological disorders (Yu et al., 2014). The variant c.724G>A also lies in the Exon 11

of the gene and thus functional studies are required for the elucidation of disruption in the

function of the gene as a consequence of this change.

Another family with dominant glaucoma (GLC 5) was screened by exome sequencing; the

family had two individuals with early appearance of glaucoma symptoms. Only one variant

(c.125C>T, p.Thr42Met) in PHKG1 segregated with the phenotype in the family in a

heterozygous form, with the exception of the individuals with early appearance of

symptoms in which it was present homozygously. The variant lies in four overlapping

domains; the protein kinase catalytic domain, serine-threonine/tyrosine-protein kinase

catalytic domain, serine/threonine/dual specificity protein kinase catalytic domain and

tyrosine-protein kinase catalytic domain. This variant lies in a highly conserved region in

ten different species (phyloP 5.94), and results in an amino acid change from threonine to

methionine, thus changing a polar uncharged amino acid to a hydrophobic amino acid

(Grantham score= 81). SIFT scores the variation deleterious, Mutation Taster categorises

it as disease-causing, and PolyPhen considers the variant to be probably damaging.

4.2 Case Control Association Analysis: Glaucoma

Previously reported SNPs associated with POAG in various studies including GWAS, were

screened in the current glaucoma cohort. Since recent studies have suggested that common

genetic factors might contribute to various forms of glaucoma, the current study was

extended to PACG and PEXG. A summary of the SNPs genotyped for glaucoma in the

Pakistani cohort and their pathways is given in Figure 4.1. Results indicated association of

SNPs in HSP70 and NOS3 with all three types of glaucoma, whereas an association of

BIRC6 and P450 polymorphisms was observed only with PEXG. No association was

observed for SNPs in PDIA5, P21 and P53 with any type of glaucoma in the current cohort.

Besides these SNPs, three SNPs in genes PLEKHA7, COL11A1 and PCMTD1 were

recently reported to be associated with PACG in the Asian population, therefore the SNPs

129

Figure 4.1 Summary of the SNPs genotyped for glaucoma. ‘*’ represents the SNPs that were genotyped for PACG only, ER;

Endoplasmic Reticulum, TM; Trabecular Meshwork.

130

were studied in the current cohort which identified only the COL11A1 SNP to be associated

with PACG.

Stress and apoptosis induced RGC degeneration is accentuated by the involvement of

multiple factors such as raised intraocular pressure (IOP), vascular abnormalities and

oxidative stress. These genes play an important role in oxidative stress and apoptosis and

one of the mechanisms via which the modification of cells as a result of oxidative stress

are dealt with, is controlled expression and regulation of various genes. NOS3 and HSP70

are two such genes, which are expressed in the cells in response to stress-inducing factors

such as heat, toxic metabolites, high intensity light and free radicals (Fletcher et al., 2008).

These genes have been shown to elicit enhanced transcription levels of the respective

mRNA when the body is under stress (Ishii et al., 2003; Liu and Neufeld 2003). NOS3 is

involved in different processes, such as neurotransmission, the regulation of vascular tone,

vasodilatation and apoptosis. In addition, it also regulates blood flow to the ocular tissues

and has been implicated in the pathogenesis of different neurodegenerative disorders, such

as diabetic retinopathy (Awata et al., 2004), glaucoma (Toda and Nakanishi-Toda 2007)

and migraines (Gruber et al., 2010). Plasma NO levels are regulated by NOS3, thus any

environmental or genetic risk factor that enhances NOS3 expression would contribute to

NO mediated toxicity. It has been previously reported that the VNTR in intron 4

of NOS3 significantly influences the plasma NO levels. Functional studies have shown that

the variant ‘a’ allele (with four 27-bp repeats) in homozygous form is strongly correlated

with increased plasma NO levels, which were found to be twice as high as the level found

in the ‘b/b’ genotype (with five 27-bp repeats), indicating the NOS3 underlying potential

for NO-related pathogenicity (Malek et al., 1999).

The NOS3 expression is regulated at the transcriptional level by microRNAs (Balligand et

al., 2009) that repress NOS3 expression by interfering with the gene transcription

efficiency. Moreover the microRNAs act as an endogenous sequence-specific feedback

regulatory molecule that reversibly inhibited this process and thus enabled the rapid

turnover of NOS3 molecules to minimize the damage associated with stress and hypoxia.

Zang et al. (2005) postulated that the amount of microRNA would vary from individual to

individual. In contrast to the ‘b’ allele with five 27-bp repeats, the variant ‘a’ allele with 4

131

repeats produced fewer microRNAs and hence, reduced transcriptional repression would

occur, correlating with the increased plasma NO.

The current results are in line with the above observations, as in the current study

significant association of the NOS34 a/b genotype was found with all forms of glaucoma

in the Pakistani cohort, which is probably a result of high plasma NO levels that are toxic

to the optic nerve and ultimately cause its degeneration, which is a classic hallmark of

glaucoma. Earlier studies conducted to establish a possible association between glaucoma

and altered NOS expression focused mainly on POAG patients (Galassi et al., 2004;

Karantzoulis-Fegaras et al., 1999) and were able to show a positive correlation between

this polymorphism and the disease, which is in agreement with the current results.

In the current work, the involvement of the intron 4 VNTR polymorphism of NOS3 was

also studied in PACG, as impairment in the NO production might lead to closure of the

angle (Awadalla et al., 2013), which can be partially associated with

altered NOS3 expression and the resultant NO-mediated neurotoxicity. The current results

indicate that there is indeed a correlation between PACG and the polymorphism in NOS3,

as a significantly higher frequency of the variant NOS3 a allele was found in PACG patients

as compared to the unaffected controls. Previously also the 27bp variant allele of the NOS3

intron 4 VNTR polymorphism has been shown to be significantly associated with PACG

in Australians (Awadalla et al., 2013). In the current cohort an association of ‘ba’ and ‘aa’

genotypes of the NOS3 gene polymorphism was also found with PACG. As opposed to this

in the POAG and PEXG cohorts, the heterozygous ‘ba’ genotype was found to be

associated with the disease. The mechanism behind the PACG pathogenicity might be that

NO production in the anterior chamber results in the relaxation of the ciliary muscle and

thus increases the depth of the anterior chamber of the eye (Shi et al., 2014). The site for

the formation of NOS3 lies in excess in the ciliary muscle, and the outflow passageway of

the aqueous humor and thus has been proposed to be involved in the regulation of IOP

(Nathanson and Mckee 1995). The anatomical change induced by NO in PACG is

postulated to be due to its effect on the activity of MMP9, which when down regulated,

might result in the narrowing of the anterior chamber and refractive errors by affecting the

ECM remodelling (Shi et al., 2014). In the presence of the ‘ba’ or ‘aa’ genotype the

132

narrowing of the chamber occurs, which is a characteristic feature of PACG (Shi et al.,

2014). In POAG and PEXG there are other mechanisms such as the accumulation of debris

in the TM for disease pathogenicity as opposed to the narrowing/closing of the angle, which

in the later case remains open.

In glaucoma patients, raised IOP causes stress mediated neuron injury and to overcome

this stress heat shock proteins (HSPs) are recruited. Besides its protective effects one of

the side effects of the HSPs is the stimulation of the immune system and engagement of

the antigen presenting cells. Thus the HSPs not only act as neuroprotective molecules in

the cell but they can also contribute to the progression of the disease by over-activating the

auto-stimulatory immune responses leading to optic nerve neuropathy (Tezel et al., 2004;

Ishii et al., 2003). In glaucoma patients, it has been observed that as a result of activation

of the immune system, there are increased titers of anti-HSP antibodies, which aid in the

progression of the disease by minimising the protective abilities of the native HSPs (Tezel

et al., 2000).

The regulation of HSPs’ expression pattern determines the fate of the cell, the

underexpression leads to an inefficient stress response and overexpression drives

immunodestruction, with the outcome in both cases being damage driven by the oxidative

free radicals in one case and by cytokines in the other. This is supported by the data of

Tezel et al. (2000), who have previously shown HSPs to be significant enhancers of both

the cytoprotective and neurodegenerative functions of the immune system in RGCs and

glial cells, and clearly demonstrated that these proteins were critical in facilitating the

glaucomatous changes resulting in optic nerve damage and neurodegeneration.

The rs1043618 polymorphism in HSP70 screened in the current cohort has previously been

shown to be associated with reduced HSP70 expression, which could result in an inability

of the cell to cope with stress and to perform cytoprotective functions. Functional analyses

of the rs1043618 polymorphism, which maps to the 5′ UTR region of HSP70, has revealed

that compared with the G allele, the variant C allele causes reduced promoter activity and

lower HSP70 protein levels (He et al., 2009). Tosaka et al. (2007) had previously reported

a significant association between the -110A>C polymorphism in HSP70 and POAG

(p=0.026) in the Japanese population. This polymorphism is known to increase HSP70

133

expression, thus supporting the hypothesis that neuropathy is associated with

autoimmunity as a result of the elevated HSP70 levels. However, Tosaka et al. (2007) did

not find any association between glaucoma and the rs1043618 polymorphism. The same

mechanism might be involved in the onset of PEXG seen in the current study, as the raised

IOP-induced stress on the RGCs might recruit the HSPs to overcome the stress. Moreover,

Fung et al. (2005) have reported that lower levels of HSP70 are not able to provide

protection against neurodegeneration in Alzheimer’s disease. On the basis of a higher

frequency of the risk allele “C” in PEXG, POAG and PACG patients it is hypothesized that

this polymorphism might be associated with pathogenesis of all three types of glaucoma.

In both the primary forms of glaucoma the association of the heterozygous ‘GC’ as well as

homozygous ‘CC’ genotype was observed with the disease but in the secondary form i.e.

PEXG, only the homozygous ‘CC’ genotype was found to be associated with the disease.

In different studies different risk factors of POAG and PACG have been established

whereas, there is still limited understanding of the factors responsible for PEXG

predisposition. Raised IOP is the major contributor of OAG in patients with PEXG, but the

contribution of the risk factors such as the dandruff-like flakes that accumulate in all the

aqueous bathed surfaces of the eye in PEXG cannot be ignored (Eagle 2012). Differential

expression of the stress response genes is seen in eyes with PEXG, as seen in the case of

clustrin gene, an efficient extracellular chaperone, which is down regulated in the case of

PEXG, resulting in the aggregate formation and accumulation of PEX material in the TM,

hence clogging it and elevating the IOP (Zenkel et al., 2006). This mechanism might

indicate that the changes in the PEXG patients carrying the ‘CC’ genotype of the HSP70

polymorphism is more severe as compared to those carrying the ‘GC’ genotype.

The current study identified a moderate protective association of the BIRC6 rs2754511

polymorphism with PEXG in the Pakistani population (p=0.05). In agreement with the

previous findings in the Salt Lake City and San Diego populations, which demonstrated a

protective effect of the T allele of rs2754511 on the development of POAG (Carbone et

al., 2011), this allele in the homozygous form (TT) was also found to be protective in

PEXG in the current study. BIRC6 is ubiquitin carrier protein involved in the protection of

the cell against apoptosis and also reduces cellular stress (Carbone et al., 2011; Lamers et

134

al., 2012). Increased intraocular pressure, ROS and free radicals create a stressful

environment in the eye (Sacca et al., 2007; Izzotti et al., 2011). In the ER, stress can be

accompanied by the aggregation of misfolded proteins, which can activate a cytoprotective

signal response known as unfolded protein response (UPR) that triggers the activator

functions such as adaptation, alarm and apoptosis (Xu et al., 2005). When stress is

prolonged and adaptation and alarm fail to pull the cell back towards normal conditions,

the UPR results in activation of apoptosis (Kim et al., 2008) and also elicits an

inflammatory response in order to restore the normal environment of the cell. This

mechanism has been found to be involved in the pathogenesis of many neurodegenerative

disorders such as Alzheimer’s, Parkinson’s and cerebral ischemic insults (Wang and

Kaufman 2012). Apoptosis might be one of the various mechanisms that is involved in the

degeneration of RGCs in PEXG. BIRC6 is an anti-apoptotic protein, which promotes cell

survival by inhibiting caspases (Ren et al., 2005). Association of downregulation of BIRC6

with various polymorphisms and mutations leads to upregulation of P53, resulting in

mitochondrial-mediated apoptotic cell death (Ren et al., 2005).

Another polymorphism in CYP1B1, rs2567206, iwas also screened, which indicated a

strong association of the polymorphism with PEXG only and not with POAG or PACG.

CYP1B1 belongs to the family of cytochrome P450 (Zhao et al., 2013) and is involved in

regulating the metabolic pathways by acting as an intermediate catalyst. This protein also

plays an important role in the proper development and functioning of the iridocorneal angle

of the eye (Sarfarazi 1997). Vasiliou and Gonzalez (2008) observed that CYP1B1 deficient

mice had an abnormal drainage structure, including abnormalities in the trabecular

meshwork; the same phenomenon has been observed in human PACG patients. Mutations

in this gene associated with PACG have been reported in Pakistani (Firasat et al., 2008),

Indian (Kumar et al., 2007) and European families (Reddy et al., 2003; Kakiuchi-

Matsumoto et al., 2001). Polymorphisms in different region of the gene have been reported

to be associated with modified activity of the CYP1B1 enzyme, which has been shown to

cause certain types of cancers and POAG in different populations. The SNP rs2567206 has

previously been found to be associated with PCG but not with primary open angle or angle

closure glaucoma. It has been hypothesized that the variant results in lowering the activity

of the promoter in the TM cells, and regulates the gene in vivo (Chakrabarti et al., 2010).

135

It has also been observed that the polymorphism rs2567206 covers the site of the promoter

region, which contains the binding site of transcription factors and could thus interfere with

this process (Kim et al., 2002; Price et al., 1992).

The association of both BIRC6 and CYP1B1 SNP only with PEXG might be due to the

more aggressive nature of PEXG i.e severe degenerative changes occurring in PEXG as

compared to POAG or PACG. Moreover, in patients with PEXG the damage to the ONH

is more severe than in POAG or PEXG in the current cohort as depicted by the CDRs,

(mean CDR values; PEXG=0.79±0.26, POAG=0.62±0.23, & PACG=0.61±0.27). The

extracellular matrix of the trabecular meshwork is disrupted as a consequence of damage

to the mitochondria, a characteristic mechanism involved in the pathogenicity of POAG

and PEXG (Izzotti et al., 2011). Konstas et al. (1997) have observed excessive

mitochondrial alterations in PEXG. The highest level of mitochondrial damage and

mitochondrial loss per cell was seen in PEXG as compared to POAG, which indicates its

more aggressive nature. Zenkel et al (2005) have reported differential expression of ECM

proteins and stress response genes in the eyes of PEXG patients compared to eyes of normal

healthy controls. The expression of ECM genes is upregulated, resulting in aggregation of

ECM proteins. Glutathione S-transferase 1, which is involved in protection from oxidative

stress, has been reported to be downregulated in these patients. In addition, clusterin, an

efficient extracellular chaperone, is downregulated in PEXG eyes, resulting in aggregation

of pathologic ECM proteins. Consequently, abnormal proteins accumulate, resulting in the

formation of pseudoexfoliative material (Zenkel et al., 2006). In the anterior chamber this

hinders the outflow of aqueous humor by clogging the trabecular meshwork, which results

in elevation of the IOP (Streeten et al., 1992; Streeten et al., 1990). All these stresses result

in severe degenerative changes in PEXG.

The SNP rs1801270 was also screened in the current glaucoma cohort but no association

was found. The SNP is located in a highly conserved region, which encodes the DNA-

binding zinc-finger domain of the protein and results in incorporation of Arg at position 31

instead of Ser (Ressiniotis et al., 2005). Incorporation of Arg results in failure to protect

the RGCs from degeneration in glaucomatous neuropathy. RGC death via apoptosis has

been extensively explored (Nickells 1999) and the major transcription factor in this

136

apoptotic cascade is P53, which is also known as guardian of the genome (Rosenbaum et

al., 1998) and is involved in the transcription of the kinase inhibitor P21 (Ressiniotis et al.,

2005). Damage to the DNA causes the activation of the P21 enzyme, which then causes

cell cycle arrest by inhibiting the cyclin dependent kinases, thus blocking the entry of the

cell cycle from the G1 to S phase and from the S to G2 phase, finally leading the cell

towards apoptosis. In normal ocular tissue a higher expression of P53 is usually observed

(Acharya et al., 2002), therefore it has been speculated that any alteration in its expression

might stimulate P53-induced apoptosis. Tsai et al (2004) concluded that the post-

transcriptional product of rs1801270 was important in the development of POAG.

However, studies conducted on Caucasian (Ressiniotis et al., 2005) and Turkish (Saglar et

al., 2009) populations showed non-significant association of rs1801270 with glaucoma.

The current results are in agreement with the above mentioned studies as there was no

association between the P21 SNP and all the three different types of glaucoma in the

Pakistani population. The distribution of the minor allele of the SNP is highly variable

among populations; according to NCBI, it is 0.02 among Europeans and reaches 0.41

among Asians, while Africans and Hispanics had a frequency distribution in between these

values (Gravina et al., 2009).

Different studies of Chinese (Lin et al., 2002) and Caucasians (Daugherty et al., 2009)

have demonstrated significant association of P53 polymorphism (rs1042522) with POAG.

However, Acharya et al (2002), Saglar et al (2009) and Mabuchi et al (2009) studied P53

polymorphism in Indians, Turks and Japanese, respectively, and found no association

between the P53 alleles and POAG. Another interesting aspect of the polymorphism is that

the presence of Arg is associated with POAG in the Chinese population (Lin et al., 2002)

whereas the presence of the variant amino acid Pro is associated with POAG in Caucasians

(Daugherty et al., 2009). The aim of the current work was to study the role of this SNP in

the Pakistani population and the results of the current study were found to be in agreement

with Dimasi et al (2005) who also did not find any association of this SNP with POAG.

One possible explanation of not finding association in the current cohort could be that P53

might be contributing towards the development of glaucoma as a non-IOP genetic factor

(Mabuchi et al., 2009; Nickells 1999), increasing the susceptibility of NTG patients toward

glaucoma as compared to the patients with high tension glaucoma. Since in the current

137

cohort patients were studied with predominantly higher IOP, no association was observed,

while taking the NTG association under consideration, Dimasi et al (2005) screened their

patients with NTG for the polymorphism but found no association of the SNP with the

disease, which might be due to a smaller cohort of patients (62) of NTG in their study.

In addition a previously associated SNP, rs11720822 in the protein disulphide isomerase

family A member 5 (PDIA5) gene was also screened, but no association was found with

the disease in the Pakistani population. The gene is upregulated in response to endoplasmic

reticulum stress (Hayano and Kikuchi 1995), and the SNP has been shown to be associated

with POAG in San Diego in a GWAS study (Carbone et al., 2011). According to the dbSNP

database, occurrence of the T allele of rs11720822 in PDIA5 is very rare in various

populations of the world including the Asian and African populations

(http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=rs11720822), which supports

the current finding, as in the current study high occurrence of the allele was not observed.

Among the three genes found to be implicated in the pathogenicity of PACG (Vithana et

al., 2012), the polymorphism rs3753841 in COL11A1 was the only one found to be

associated with PACG in the Pakistani population. This polymorphism results in a change

from proline at position 1323 to leucine. The collagen type 11 has two α chains and the

gene COL11A1 transcribes one of them. Mutations in the gene have already been known

to cause Marshall syndrome and Stickler syndrome, both of which have glaucoma as one

of the features, in addition to features such as face flattening, auditory and skeletal

dysfunctioning. Due to aberrations in this gene, abnormality in the fibrillar collagen matrix

in the sclera occurs causing ocular deformities. The gene is also expressed in TM cells and

might be associated with the regulation of aqueous humor drainage, which when aberrant

might predispose the person to ocular anomaly. Vithana et al (2012) propose that common

variants in the gene affect the normal ocular architecture and might result in PACG. The

other two polymorphisms, one in PLEKHA7 (rs11024102) and the other in PCMTD1

(rs1015213), were not found to be associated with PACG in the current Pakistani cohort.

PLEKHA7 is involved in stabilizing the cellular junctions (adherens junctions), which are

essential in the iris, cillary body and aqueous humor outflow and the choroid. The SNP

rs1015213 resides 120 kb upstream of the gene and is in linkage disequilibrium (LD) with

138

PCMTD1, which has lately been found to play an intertermediate role in apoptosis and

inflammation. The differences in the association might be attributed to the smaller sample

size of the current study (200 PACG samples, 200 controls) as compared to the original

study (3771 PACG samples and 18,551 controls) (Vithana et al., 2012). All three SNPs

have also been screened in the Indian PACG cohort, which identified an association of

rs1015213 in PCMTD1 with PACG but not the other two polymorphisms (Duvesh et al.,

2013). The SNPs in COL11A1 and PLEKHA7 have also been reported to be associated

with higher risk of PACG in the Chinese, where the incidence of PACG is twice as high as

compared to other Asian populations (Chen et al., 2014b).

4.3 Familial Screening and Case Control Association Analysis: Age

Related Macular Degeneration

Two families with AMD were screened for the candidate gene CFH, in which no

involvement of the gene variants was found in the current families. Although linkage

studies for AMD using large families and twin studies has helped to identify the AMD

susceptibility genes, it has always been difficult to map the plausible genes mainly due to

the late onset of the disease (Swaroop et al., 2009). The familial studies have helped in the

discovery of disease causing genetic variants in two major AMD causing genetic loci which

harbour CFH and ARMS2/HTRA1. Besides the familial studies, case-control association

studies have contributed tremendously in defining the genetic component of the disease. A

summary of the SNPs genotyped for AMD in the Pakistani cohort and their pathways; is

given in Figure 4.2.

Drusen are the hallmark of AMD in whose formation and accumulation, the components

of the inflammatory pathway and complement system have been shown to be involved

(Seddon et al., 2005; Yucel et al., 2012). Polymorphisms in CFH, C3, C2, CFB and few

other genes have also been reported to be associated with AMD in various populations

around the world (Deangelis et al., 2011). Besides CFH, variants in ARMS2/HTRA1 have

also been found to be associated with AMD (Rivera et al., 2005; Klein et al., 2005b). In

the current AMD cohort no association was found with the CFH polymorphism rs1061170,

which is a well-established AMD causative variation in various populations, especially in

139

Europeans and also Indians (Kaur et al., 2006). These results are suggestive of differences

in the genotype and allele frequency distribution of this polymorphism among and within

various populations (Rodriguez De Cordoba et al., 2004; Chen et al., 2006). The

association of the CFH polymorphism appears to be varied specially among the Asian and

white populations (Tsai et al., 2008). The risk allele of the SNP was found to be lower in

Asians (Chen et al., 2012; Tsai et al., 2008), whereas it is higher in Europeans (Sofat et al.,

2012). It has recently been reported by the AMD Gene Consortium (Fritsche et al., 2013)

that there were great differences in effect sizes of the CFH polymorphism when the data

were stratified on the basis of ethnic background, and the strongest association was found

in Europeans. Other genes of the complement pathway have also been found to be

associated with AMD, including C2/CFB and C3 (Fuse et al., 2006; Yates et al., 2007;

Gold et al., 2006). SNPs that had been previously reported to be significantly associated

with AMD and are located 100kb upstream of the C2/CFB and C3 genes (Fritsche et al.,

2013) were screened in the current study, but these SNPs were not found to be associated

with AMD in the current Pakistani cohort, although the variants in these genes have been

reported to significantly contribute to AMD susceptibility (Swaroop et al., 2009).

A gene other than the complement pathway genes that has been shown to have a major

contribution in AMD is ARMS2 (Swaroop et al., 2009). In the current population, the case-

control association analysis identified that the risk allele (T) of the ARMS2/HTRA1

rs10490924 SNP confers higher risk of developing wet AMD as compared to dry AMD,

which is in agreement with the study of Sobrin et al (2011). In another study conducted by

Schwartz et al (2012), it was observed that the variant allele T conferred higher risk towards

advance bilateral wet AMD. The effect size of the rs10490924 SNP was much higher in

the current wet AMD cohort (OR=3.57) as compared to the multicentre study conducted

by Sobrin et al. (2011) although they obtained similar results the effect size was between

1.34-1.56. ARMS2 is located in the outer mitochondrial membrane and encodes protein

(age-related maculopathy susceptibility protein 2) of mitochondria (Kanda et al., 2007).

An indel polymorphism (372_815del443ins54) in the gene has been reported to remove

the polyadenylation signal, resulting in a higher turnover of the mRNA (Fritsche et al.,

2008). With advancing age, loss in the functional efficiency of the mitochondria occurs,

resulting in the formation and accumulation of ROS, mutations in the mitochondrial DNA

140

Figure 4.2 Summary of the SNPs genotyped for Age Related Macular Degeneration. ECM; Extracellular Matrix

141

and onset of apoptosis (Lin and Beal 2006). It has been observed that in the aging retina

and particularly in the macular region, cytochrome C deficient cones accumulate as well

as a higher rate of mitochondrial deletions are detected (Mcbride et al., 2006). The SNP

rs10490924 has been implicated in mitochondrial dysfunction, which consequently

increases the susceptibility of the photoreceptors to age associated degenerative changes

that might be due to the change in the coding sequence (A69S) of ARMS2, affecting its

conformation and thus interaction of the protein (Kanda et al., 2007).

A SNP, rs4420638, 14 kb upstream of the gene APOC1 and co-inherited with APOE is

previously shown to be significantly associated with AMD in the studied population

(Fritsche et al., 2013) was also screened in the current study, but the SNP was not found to

be associated with AMD in the current cohort. APOE was initially considered as a plausible

gene for AMD for two main reasons. First, it was found to be present in drusen associated

with AMD (Wang et al., 2010) and secondly, due to its involvement in Alzheimer’s (Baird

et al., 2006), which has many common features with AMD such as the presence of β

amyloid in the plaques of patients with Alzheimer’s as well as in drusen of patients with

AMD. In addition, both are diseases that occur at higher age (Ohno-Matsui 2011). The

gene is involved in the transport of lipids and cholesterol metabolism (Schmidt et al.,

2002), which are essential components of drusen (Wang et al., 2010) and hence the

involvement of APOE in AMD cannot be ignored, despite the non-association of

rs4420638 in the current cohort, which could be due to racial differences.

Microglial cells are present in the retina that respond to oxidative stress by the formation

of drusen (Combadiere et al., 2007) by the expression of APOE (Xu et al., 2006), proteins

of the complement system (Bellander et al., 2004), inflammatory components, CX3CR1and

β amyloid precursor protein (Haass et al., 1991). These cells are also found to play a

proangiogenic role in the retina (Checchin et al., 2006), and moreover, in the absence of

CX3CR1, they secrete VEGF which results in neovascularisation (Combadiere et al., 2007)

resulting in wet AMD. The risk allele (A) of the chemokine receptor CX3CR1 (Tuo et al.,

2004) SNP rs3732378, and the heterozygous genotype of SNP rs3732379 confer increased

risk of AMD in the Pakistani population, which is in agreement with previous studies

(Yang et al., 2010). It is postulated that the variation (rs3732378) in CX3CR1 affects the

142

migratory properties of the microglial cells in the retina, and accumulation in the

underlying layers of the retina result in drusenogenesis (Combadiere et al., 2007).

Moreover, lower levels of CX3CR1 have been detected in the macula of patients with

AMD and both variants, rs3732379 and rs3732378, might be responsible for decreased

ligand affinity and receptor binding. It is further postulated by Tuo et al (2004) that

decreased levels of CX3CR1 might be due to the interaction of SNPs present in the

promoter region that are in LD with the above mentioned SNPs and thus the presence of

the variant alleles of these SNPs might affect the transcription activity.

Under stressful conditions, VEGF plays a very important role in the maintenance of the

vasculature and has been found to be extensively expressed in the eyes of the AMD patients

where it induces the formation of new vessels in the retina (Shibuya 2008). Moreover, the

binding of VEGF with its receptor generates a signal cascade that affects NOS3 expression

(Gelinas et al., 2002; Hood et al., 1998). The expression of NOS3 results in the synthesis

of NO, which maintains the vascular tone, inhibits apoptosis (Kota et al., 2012) and is a

key regulator of ocular blood flow (Bhutto et al., 2010). In the promoter region of VEGF

there are eight SNPs (rs833061 [-460C>T], rs833062 [-417T>C], rs59260042 [-

1210C>A], rs79469752 [-1203C/T], C-160T, rs28357093 [-141A>C], rs1570360 [-

116G>A]) which have previously been reported to be associated with diabetic retinopathy

(Churchil et al., 2008), and recently found to be involved in neovascularisation in Pakistani

diabetic patients with retinopathy (unpublished data). Keeping in view the involvement in

the Pakistani diabetic retinopathy patients, the SNPs were also screened in the current

AMD cohort. However, none of the SNPs were found to be associated with AMD in this

cohort, although the risk allele of rs1570360 [-116G>A] showed a trend towards

association (after correction for multiple testing p=0.07) with AMD but did not reach the

level of significance. The 27bp intron 4 VNTR polymorphism of NOS3 was also screened

in the current AMD cohort, and it was observed that the risk allele ‘a’ was significantly

associated with wet AMD. The risk allele of the NOS3 polymorphism has previously been

reported to be associated with macular edema in the Japanese (Awata et al., 2004). The

NO produced results in the vasodilatation of the ocular vessels but free radicals produced

in oxidative stress deactivate the NO function, which further catalyses the lipid

peroxidation resulting in enhancement of stress in the ocular tissue (Beckman et al., 1990).

143

The minor allele ‘a’ has been shown to be associated with lower production of NO, which

under oxidative stress can increase the damage to the cells (Zhang et al., 2008). Previously

NO has been found in lower amounts in the plasma of AMD patients (Totan et al., 2001)

and reported to have an adverse effect on vascular functions (Bhutto et al., 2010).

In the current cohort the SNP rs243866 in MMP2 and SNP rs17576 in MMP9 were also

screened to determine their association with AMD. Both these SNPs were found to be

associated with AMD (wet and dry AMD combined) and with the dry AMD in the

subgroup analysis. However, the association remained significant only for rs243866 after

correction for multiple testing, although SNP rs17576 had a mild association with both wet

AMD and dry AMD, before the correction for multiple testing, which might be the reason

that overall the SNP is strongly associated with AMD. It is hypothesised that the risk allele

(A) and genotype (AA) of MMP2 rs243866 increases the predisposition towards dry AMD.

Both MMPs belong to the subgroup of gelatinases that cleaves the collagenases (Sethi et

al., 2000). The MMPs maintain the balance of extracellular matrix (Birkedal-Hansen et al.,

1993), which in the eyes includes the interphotoreceptor matrix (IPM) and the BM

(Plantner 1992). The MMP2 and MMP9 proteins are abundantly found in the IPM. It is

postulated that disproportion of these MMPs against their tissue inhibitors TIMPs in the

IPM can cause a pathological condition (AMD) in the retina. MMP2 and MMP9 proteins

have been found in higher levels in the RPE associated ECM in patients of AMD (Plantner

et al., 1998b; Plantner et al., 1998a). The SNP rs17579 has also been screened in Chinese

Han, but was not found to be associated with AMD (Zeng et al., 2014). The MMP activity

is controlled by expression of the tissue inhibitors of MMPs and posttranslational

modifications and thus by the control of expression level (Sternlicht and Werb 2001). The

SNP rs243866 is located in the promoter region of MMP2 (-1575 position) and has been

found to be associated with reduced transcriptional activity (Harendza et al., 2003).

Various studies found SNPs near the tissue inhibitor metalloproteinase 3 (TIMP3) gene to

be significantly associated with AMD. The protein remodels the extracellular matrix in the

retina (Francis and Klein 2011). The mutated gene causes Sorby’s fundus dystrophy, which

is an early onset degeneration of the macula (Weber et al., 1994). The previously associated

SNP rs5749482 in TIMP3 was studied in the current AMD cohort, but no association of

144

the SNP was found. Although the variation in the SNP has previously been reported as not

associated with AMD (Stone et al., 2001), Abecasis et al (2004) speculate that the

variations in the gene might be involved in interacting with some other variants in AMD

susceptible genes and also suggest environmental influences to cause the late effects of the

disease (neovascularisation).

Several Interleukins have been reported to play a key role in the pathogenesis of AMD

(Seddon et al., 2005; Klein et al., 2005a). IL-6 was previously shown to be involved in

increasing the risk of AMD independently (Seddon et al., 2005), moreover, IL-10 has been

postulated to suppress neovascularisation in wet AMD by regulating macrophages, which

are known to be anti-angiogenic factors (Apte et al., 2006). This interleukin is suggested

to suppress the influx of macrophages by having inhibitory effect on the cytokines that

attract macrophages (Ferguson et al., 1994). In the current cohort the risk allele ‘C’ and the

homozygous genotype ‘CC’ of the SNP rs16944 in ILβ was found to increase the risk of

wet AMD with an effect size of 1.57 and 3.23, respectively. However, the ‘CT’ genotype

of the SNP is associated with both wet and dry AMD, and the homozygous ‘CC’ genotype

was associated with dry AMD, but the association did not remain significant after the p

value was corrected for multiple testing. In a study conducted by Tsai et al. (2008), it was

postulated that the risk allele of the associated interleukin (IL-8) also increased the risk of

developing wet AMD in the Taiwanese. This SNP (rs16944) has previously been shown to

be associated with schizophrenia (Shirts et al., 2006) and bipolar disorder (Papiol et al.,

2008). The SNP is in the promoter region of the gene (-511) and has been shown to increase

the expression of the gene in combination with another variant in the promoter region of

the gene at -31 position (Hulkkonen et al., 2000; Hall et al., 2004).

SNP rs1800629 located in the promoter region of the ubiquitously expressed cytokine

tumor necrosis factor-alpha (TNF-α) was also screened in the current AMD cohort, but no

association of the polymorphism was found. The protein is involved in various processes

such as inflammation, immune-regulation and apoptosis (Vassalli 1992) and the

polymorphism has been associated with elevated TNF-α production (Wilson et al., 1997),

which has been associated with various complications in the eyes such as diabetic

retinopathy (Yoshioka et al., 2006; Limb et al., 1999) and glaucoma (Huang et al., 2009).

145

This polymorphism was also found to be associated with PEXG in the Pakistani population

(Khan et al., 2009) but the same polymorphism was not associated with PEXG in

Europeans of Caucasian descent (Mossbock et al., 2009). The difference in the associations

might be due to the difference in the distribution of the genotypes among various

populations of the world (Mossbock et al., 2009).

4.4 Conclusion

In the present study the genetic cause of familial and sporadic cases with glaucoma and

AMD were studied in the Pakistani population. This is the first time that a genetic screening

of AMD and whole genome screening of familial glaucoma in Pakistan has been

conducted, which has resulted in the identification of possible novel genes and a possible

novel locus linked to glaucoma. The association analysis of sporadic glaucoma and AMD

was also conducted for various polymorphisms, which were found to be significantly

associated with various populations in GWAS. Some of those polymorphisms were found

to be associated with the current population, either playing a pathogenic or a protective

role; whereas the rest of them were not associated with the disease, indicating genetic

heterogeneity. These differences among different association studies might be due to

geographical and ethnic variations in the studied populations.

4.5 Future Perspective

Glaucoma and AMD are both complex disorders and their complexity is attributed to the

contribution of numerous genes with varying degrees of effects. Although high throughput

techniques like GWAS have resulted in discovery of interesting genes but due to

restrictions such as differences in phenotyping and screening methods, replicating such

studies becomes difficult. Moreover, in the current study several genes could not be

functionally validated. Also genes implicated by functional studies could not be found to

be associated in genetic studies. Therefore the requirement is to characterize these diseases

at the molecular level using high throughput techniques. For such complex disorders,

whole genome sequencing is the method of choice for understanding their genetic etiology.

Functional studies would further be required for the validation of the genetic data, followed

by validation through proteomic approaches, animal models and replication studies in

146

different populations. Only then it would be possible to unravel the causative agents of

these complex disorders and their underlying molecular mechanisms that will further help

in developing better therapeutic interventions.

Chapter 5

References

147

5. References

Abecasis, G. R., Yashar, B. M., Zhao, Y., Ghiasvand, N. M., Zareparsi, S., Branham, K.

E., Reddick, A. C., Trager, E. H., Yoshida, S., Bahling, J., Filippova, E., Elner, S.,

Johnson, M. W., Vine, A. K., Sieving, P. A., Jacobson, S. G., Richards, J. E. &

Swaroop, A. (2004). Age-related macular degeneration: a high-resolution genome

scan for susceptibility loci in a population enriched for late-stage disease. Am J

Hum Genet. 74: 482-494.

Acharya, M., Mitra, S., Mukhopadhyay, A., Khan, M., Roychoudhury, S. & Ray, K.

(2002). Distribution of p53 codon 72 polymorphism in Indian primary open angle

glaucoma patients. Mol Vis. 8: 367-371.

Adatia, F. A. & Damji, K. F. (2005). Chronic open-angle glaucoma. Review for primary

care physicians. Can Fam Physician. 51: 1229-1237.

Afzal, M., Ali, S. M. & Siyal, H. B. (1994). Consanguineous marriages in Pakistan. Pak

Dev Rev. 33: 663-674.

Agarwal, S., Agarwal, A., Buratto, L., Apple, D. J. & Alió, J. L. (2002). Textbook of

Ophthalmology, Lippincott Williams & Wilkins.

Age-Related Eye Disease Study Research Group. (2001). A randomized, placebo-

controlled, clinical trial of high-dose supplementation with vitamins C and E, beta

carotene, and zinc for age-related macular degeneration and vision loss: AREDS

report no. 8. Arch Ophthalmol. 119: 1417-1436.

Age-Related Eye Disease Study 2 Research Group. (2013). Lutein + zeaxanthin and

omega-3 fatty acids for age-related macular degeneration: the Age-Related Eye

Disease Study 2 (AREDS2) randomized clinical trial. JAMA. 309: 2005-2015.

Akarsu, A. N., Turacli, M. E., Aktan, S. G., Barsoum-Homsy, M., Chevrette, L., Sayli, B.

S. & Sarfarazi, M. (1996). A second locus (GLC3B) for primary congenital

glaucoma (Buphthalmos) maps to the 1p36 region. Hum Mol Genet. 5: 1199-1203.

Akiyama, M., Yatsu, K., Ota, M., Katsuyama, Y., Kashiwagi, K., Mabuchi, F., Iijima, H.,

Kawase, K., Yamamoto, T., Nakamura, M., Negi, A., Sagara, T., Kumagai, N.,

Nishida, T., Inatani, M., Tanihara, H., Ohno, S., Inoko, H. & Mizuki, N. (2008).

Microsatellite analysis of the GLC1B locus on chromosome 2 points to NCK2 as a

new candidate gene for normal tension glaucoma. Br J Ophthalmol. 92: 1293-1296.

Ali, M., Mckibbin, M., Booth, A., Parry, D. A., Jain, P., Riazuddin, S. A., Hejtmancik, J.

F., Khan, S. N., Firasat, S., Shires, M., Gilmour, D. F., Towns, K., Murphy, A. L.,

Azmanov, D., Tournev, I., Cherninkova, S., Jafri, H., Raashid, Y., Toomes, C.,

148

Craig, J., Mackey, D. A., Kalaydjieva, L., Riazuddin, S. & Inglehearn, C. F. (2009).

Null mutations in LTBP2 cause primary congenital glaucoma. Am J Hum Genet.

84: 664-671.

Allingham, R. R., Wiggs, J. L., Hauser, E. R., Larocque-Abramson, K. R., Santiago-Turla,

C., Broomer, B., Del Bono, E. A., Graham, F. L., Haines, J. L., Pericak-Vance, M.

A. & Hauser, M. A. (2005). Early adult-onset POAG linked to 15q11-13 using

ordered subset analysis. Invest Ophthalmol Vis Sci. 46: 2002-2005.

Alm, A. & Nilsson, S. F. (2009). Uveoscleral outflow-a review. Exp Eye Res. 88: 760-768.

Alm, A. (2014). Latanoprost in the treatment of glaucoma. Clin Ophthalmol. 8: 1967-1985.

Alvarado, J., Murphy, C. & Juster, R. (1984). Trabecular meshwork cellularity in primary

open-angle glaucoma and nonglaucomatous normals. Ophthalmology. 91: 564-579.

Alvarado, J., Murphy, C., Polansky, J. & Juster, R. (1981). Age-related changes in

trabecular meshwork cellularity. Invest Ophthalmol Vis Sci. 21: 714-727.

Alward, W. L., Fingert, J. H., Coote, M. A., Johnson, A. T., Lerner, S. F., Junqua, D.,

Durcan, F. J., Mccartney, P. J., Mackey, D. A., Sheffield, V. C. & Stone, E. M.

(1998). Clinical features associated with mutations in the chromosome 1 open-

angle glaucoma gene (GLC1A). N Engl J Med. 338: 1022-1027.

Alward, W. L., Kwon, Y. H., Kawase, K., Craig, J. E., Hayreh, S. S., Johnson, A. T.,

Khanna, C. L., Yamamoto, T., Mackey, D. A., Roos, B. R., Affatigato, L. M.,

Sheffield, V. C. & Stone, E. M. (2003). Evaluation of optineurin sequence

variations in 1,048 patients with open-angle glaucoma. Am J Ophthalmol. 136: 904-

910.

Ambati, J., Ambati, B. K., Yoo, S. H., Ianchulev, S. & Adamis, A. P. (2003). Age-related

macular degeneration: etiology, pathogenesis, and therapeutic strategies. Surv

Ophthalmol. 48: 257-293.

Anderson, D. H., Mullins, R. F., Hageman, G. S. & Johnson, L. V. (2002). A role for local

inflammation in the formation of drusen in the aging eye. Am J Ophthalmol. 134:

411-431.

Anderson, D. H., Radeke, M. J., Gallo, N. B., Chapin, E. A., Johnson, P. T., Curletti, C.

R., Hancox, L. S., Hu, J., Ebright, J. N., Malek, G., Hauser, M. A., Rickman, C. B.,

Bok, D., Hageman, G. S. & Johnson, L. V. (2010). The pivotal role of the

complement system in aging and age-related macular degeneration: hypothesis re-

visited. Prog Retin Eye Res. 29: 95-112.

149

Apte, R. S., Richter, J., Herndon, J. & Ferguson, T. A. (2006). Macrophages inhibit

neovascularization in a murine model of age-related macular degeneration. PLoS

Med. 3: e310.

Arakawa, S., Takahashi, A., Ashikawa, K., Hosono, N., Aoi, T., Yasuda, M., Oshima, Y.,

Yoshida, S., Enaida, H., Tsuchihashi, T., Mori, K., Honda, S., Negi, A., Arakawa,

A., Kadonosono, K., Kiyohara, Y., Kamatani, N., Nakamura, Y., Ishibashi, T. &

Kubo, M. (2011). Genome-wide association study identifies two susceptibility loci

for exudative age-related macular degeneration in the Japanese population. Nat

Genet. 43: 1001-1004.

Arthur, L. & Jan, J. (2005). Atlas of Ophthalmology, London, World Scientific Publishers.

Aung, T., Lim, M. C., Wong, T. T., Thalamuthu, A., Yong, V. H., Venkataraman, D.,

Venkatraman, A., Chew, P. T. & Vithana, E. N. (2008). Molecular analysis of

CHX10 and MFRP in Chinese subjects with primary angle closure glaucoma and

short axial length eyes. Mol Vis. 14: 1313-1318.

Aung, T., Ocaka, L., Ebenezer, N. D., Morris, A. G., Krawczak, M., Thiselton, D. L.,

Alexander, C., Votruba, M., Brice, G., Child, A. H., Francis, P. J., Hitchings, R. A.,

Lehmann, O. J. & Bhattacharya, S. S. (2002). A major marker for normal tension

glaucoma: association with polymorphisms in the OPA1 gene. Hum Genet. 110:

52-56.

Awadalla, M. S., Burdon, K. P., Kuot, A., Hewitt, A. W. & Craig, J. E. (2011a). Matrix

metalloproteinase-9 genetic variation and primary angle closure glaucoma in a

Caucasian population. Mol Vis. 17: 1420-1424.

Awadalla, M. S., Thapa, S. S., Burdon, K. P., Hewitt, A. W. & Craig, J. E. (2011b). The

association of hepatocyte growth factor (HGF) gene with primary angle closure

glaucoma in the Nepalese population. Mol Vis. 17: 2248-2254.

Awadalla, M. S., Thapa, S. S., Hewitt, A. W., Craig, J. E. & Burdon, K. P. (2013).

Association of eNOS polymorphisms with primary angle-closure glaucoma. Invest

Ophthalmol Vis Sci. 54: 2108-2114.

Awata, T., Neda, T., Iizuka, H., Kurihara, S., Ohkubo, T., Takata, N., Osaki, M., Watanabe,

M., Nakashima, Y., Sawa, T., Inukai, K., Inoue, I., Shibuya, M., Mori, K., Yoneya,

S. & Katayama, S. (2004). Endothelial nitric oxide synthase gene is associated with

diabetic macular edema in type 2 diabetes. Diabetes Care. 27: 2184-2190.

Ayala-Lugo, R. M., Pawar, H., Reed, D. M., Lichter, P. R., Moroi, S. E., Page, M., Eadie,

J., Azocar, V., Maul, E., Ntim-Amponsah, C., Bromley, W., Obeng-Nyarkoh, E.,

Johnson, A. T., Kijek, T. G., Downs, C. A., Johnson, J. M., Perez-Grossmann, R.

A., Guevara-Fujita, M. L., Fujita, R., Wallace, M. R. & Richards, J. E. (2007).

150

Variation in optineurin (OPTN) allele frequencies between and within populations.

Mol Vis. 13: 151-163.

Ayub, H., Khan, M. I., Micheal, S., Akhtar, F., Ajmal, M., Shafique, S., Ali, S. H., Den

Hollander, A. I., Ahmed, A. & Qamar, R. (2010). Association of eNOS and HSP70

gene polymorphisms with glaucoma in Pakistani cohorts. Mol Vis. 16: 18-25.

Azmanov, D. N., Dimitrova, S., Florez, L., Cherninkova, S., Draganov, D., Morar, B., Saat,

R., Juan, M., Arostegui, J. I., Ganguly, S., Soodyall, H., Chakrabarti, S., Padh, H.,

Lopez-Nevot, M. A., Chernodrinska, V., Anguelov, B., Majumder, P., Angelova,

L., Kaneva, R., Mackey, D. A., Tournev, I. & Kalaydjieva, L. (2011). LTBP2 and

CYP1B1 mutations and associated ocular phenotypes in the Roma/Gypsy founder

population. Eur J Hum Genet. 19: 326-333.

Baird, P. N., Craig, J. E., Richardson, A. J., Ring, M. A., Sim, P., Stanwix, S., Foote, S. J.

& Mackey, D. A. (2003). Analysis of 15 primary open-angle glaucoma families

from Australia identifies a founder effect for the Q368STOP mutation of myocilin.

Hum Genet. 112: 110-116.

Baird, P. N., Foote, S. J., Mackey, D. A., Craig, J., Speed, T. P. & Bureau, A. (2005).

Evidence for a novel glaucoma locus at chromosome 3p21-22. Hum Genet. 117:

249-257.

Baird, P. N., Richardson, A. J., Robman, L. D., Dimitrov, P. N., Tikellis, G., Mccarty, C.

A. & Guymer, R. H. (2006). Apolipoprotein (APOE) gene is associated with

progression of age-related macular degeneration (AMD). Hum Mutat. 27: 337-342.

Baker, S., Booth, C., Fillman, C., Shapiro, M., Blair, M. P., Hyland, J. C. & Ala-Kokko,

L. (2011). A loss of function mutation in the COL9A2 gene causes autosomal

recessive Stickler syndrome. Am J Med Genet A. 155A: 1668-1672.

Balligand, J. L., Feron, O. & Dessy, C. (2009). eNOS activation by physical forces: from

short-term regulation of contraction to chronic remodeling of cardiovascular

tissues. Physiol Rev. 89: 481-534.

Beatty, S., Koh, H., Phil, M., Henson, D. & Boulton, M. (2000). The role of oxidative stress

in the pathogenesis of age-related macular degeneration. Surv Ophthalmol. 45: 115-

134.

Beckman, J. S., Beckman, T. W., Chen, J., Marshall, P. A. & Freeman, B. A. (1990).

Apparent hydroxyl radical production by peroxynitrite: implications for endothelial

injury from nitric oxide and superoxide. Proc Natl Acad Sci U S A. 87: 1620-1624.

Beers, A. P. & Van Der Heijde, G. L. (1994). In vivo determination of the biomechanical

properties of the component elements of the accommodation mechanism. Vision

Res. 34: 2897-2905.

151

Behndig, A., Svensson, B., Marklund, S. L. & Karlsson, K. (1998). Superoxide dismutase

isoenzymes in the human eye. Invest Ophthalmol Vis Sci. 39: 471-475.

Beier, K. & Fahimi, H. D. (1985). Automatic determination of labeling density in protein

A-gold immunocytochemical preparations using an image analyzer. Application to

peroxisomal enzymes. Histochemistry. 82: 99-100.

Bejjani, B. A., Stockton, D. W., Lewis, R. A., Tomey, K. F., Dueker, D. K., Jabak, M.,

Astle, W. F. & Lupski, J. R. (2000). Multiple CYP1B1 mutations and incomplete

penetrance in an inbred population segregating primary congenital glaucoma

suggest frequent de novo events and a dominant modifier locus. Hum Mol Genet.

9: 367-374.

Bellander, B. M., Bendel, O., Von Euler, G., Ohlsson, M. & Svensson, M. (2004).

Activation of microglial cells and complement following traumatic injury in rat

entorhinal-hippocampal slice cultures. J Neurotrauma. 21: 605-615.

Bhutto, I. A., Baba, T., Merges, C., Mcleod, D. S. & Lutty, G. A. (2010). Low nitric oxide

synthases (NOSs) in eyes with age-related macular degeneration (AMD). Exp Eye

Res. 90: 155-167.

Bird, A. C., Bressler, N. M., Bressler, S. B., Chisholm, I. H., Coscas, G., Davis, M. D., De

Jong, P. T., Klaver, C. C., Klein, B. E., Klein, R. & Et Al. (1995). An international

classification and grading system for age-related maculopathy and age-related

macular degeneration. The International ARM Epidemiological Study Group. Surv


Birkedal-Hansen, H., Moore, W. G., Bodden, M. K., Windsor, L. J., Birkedal-Hansen, B.,

Decarlo, A. & Engler, J. A. (1993). Matrix metalloproteinases: a review. Crit Rev

Oral Biol Med. 4: 197-250.

Bonnel, S., Mohand-Said, S. & Sahel, J. A. (2003). The aging of the retina. Exp Gerontol.

38: 825-831.

Borish, E. T., Pryor, W. A., Venugopal, S. & Deutsch, W. A. (1987). DNA synthesis is

blocked by cigarette tar-induced DNA single-strand breaks. Carcinogenesis. 8:

1517-1520.

Bruce, A., Alexander, J., Julian, L., Martin, R., Keith, R. & Peter, W. (2007). Molecular

Biology of the Cell, New York, Garland Science.

Buckingham, B. P., Inman, D. M., Lambert, W., Oglesby, E., Calkins, D. J., Steele, M. R.,

Vetter, M. L., Marsh-Armstrong, N. & Horner, P. J. (2008). Progressive ganglion

cell degeneration precedes neuronal loss in a mouse model of glaucoma. J

Neurosci. 28: 2735-2744.

152

Burgoyne, C. F., Quigley, H. A., Thompson, H. W., Vitale, S. & Varma, R. (1995). Early

changes in optic disc compliance and surface position in experimental glaucoma.

Ophthalmology. 102: 1800-1809.

Cai, J., Nelson, K. C., Wu, M., Sternberg, P., Jr. & Jones, D. P. (2000). Oxidative damage

and protection of the RPE. Prog Retin Eye Res. 19: 205-221.

Campochiaro, P. A. (2004). Ocular neovascularisation and excessive vascular

permeability. Expert Opin Biol Ther. 4: 1395-1402.

Cano, M., Thimmalappula, R., Fujihara, M., Nagai, N., Sporn, M., Wang, A. L., Neufeld,

A. H., Biswal, S. & Handa, J. T. (2010). Cigarette smoking, oxidative stress, the

anti-oxidant response through Nrf2 signaling, and Age-related Macular

Degeneration. Vision Res. 50: 652-664.

Cao, S., Ko, A., Partanen, M., Pakzad-Vaezi, K., Merkur, A. B., Albiani, D. A., Kirker, A.

W., Wang, A., Cui, J. Z., Forooghian, F. & Matsubara, J. A. (2013). Relationship

between systemic cytokines and complement factor H Y402H polymorphism in

patients with dry age-related macular degeneration. Am J Ophthalmol. 156: 1176-

1183.

Carbone, M. A., Chen, Y., Hughes, G. A., Weinreb, R. N., Zabriskie, N. A., Zhang, K. &

Anholt, R. R. (2011). Genes of the unfolded protein response pathway harbor risk

alleles for primary open angle glaucoma. PLoS One. 6: e20649.

Center, P. (2007). Glaucoma Medical Therapy : Principles and Management, New York,

Oxford University Press.

Chakrabarti, S., Ghanekar, Y., Kaur, K., Kaur, I., Mandal, A. K., Rao, K. N., Parikh, R. S.,

Thomas, R. & Majumder, P. P. (2010). A polymorphism in the CYP1B1 promoter

is functionally associated with primary congenital glaucoma. Hum Mol Genet. 19:

4083-4090.

Challa, P. (2011). Genetics of adult glaucoma. Int Ophthalmol Clin. 51: 37-51.

Charman, W. N. (2008). The eye in focus: accommodation and presbyopia. Clin Exp

Optom. 91: 207-225.

Checchin, D., Sennlaub, F., Levavasseur, E., Leduc, M. & Chemtob, S. (2006). Potential

role of microglia in retinal blood vessel formation. Invest Ophthalmol Vis Sci. 47:

3595-3602.

Chen, H., Yu, K. D. & Xu, G. Z. (2012). Association between variant Y402H in age-related

macular degeneration (AMD) susceptibility gene CFH and treatment response of

AMD: a meta-analysis. PLoS One. 7: e42464.

153

Chen, L. J., Liu, D. T., Tam, P. O., Chan, W. M., Liu, K., Chong, K. K., Lam, D. S. &

Pang, C. P. (2006). Association of complement factor H polymorphisms with

exudative age-related macular degeneration. Mol Vis. 12: 1536-1542.

Chen, R., Gong, B., Li, Q., Zeng, G., Hao, F., Li, N., Shi, Y. & Zhang, D. (2014a).

[Analysis of COL9A2 gene mutations in a Chinese Han population with

pathological myopia]. Zhonghua Yi Xue Yi Chuan Xue Za Zhi. 31: 129-133.

Chen, W., Stambolian, D., Edwards, A. O., Branham, K. E., Othman, M., Jakobsdottir, J.,

Tosakulwong, N., Pericak-Vance, M. A., Campochiaro, P. A., Klein, M. L., Tan,

P. L., Conley, Y. P., Kanda, A., Kopplin, L., Li, Y., Augustaitis, K. J., Karoukis,

A. J., Scott, W. K., Agarwal, A., Kovach, J. L., Schwartz, S. G., Postel, E. A.,

Brooks, M., Baratz, K. H., Brown, W. L., Brucker, A. J., Orlin, A., Brown, G., Ho,

A., Regillo, C., Donoso, L., Tian, L., Kaderli, B., Hadley, D., Hagstrom, S. A.,

Peachey, N. S., Klein, R., Klein, B. E., Gotoh, N., Yamashiro, K., Ferris Iii, F.,

Fagerness, J. A., Reynolds, R., Farrer, L. A., Kim, I. K., Miller, J. W., Corton, M.,

Carracedo, A., Sanchez-Salorio, M., Pugh, E. W., Doheny, K. F., Brion, M.,

Deangelis, M. M., Weeks, D. E., Zack, D. J., Chew, E. Y., Heckenlively, J. R.,

Yoshimura, N., Iyengar, S. K., Francis, P. J., Katsanis, N., Seddon, J. M., Haines,

J. L., Gorin, M. B., Abecasis, G. R. & Swaroop, A. (2010a). Genetic variants near

TIMP3 and high-density lipoprotein-associated loci influence susceptibility to age-

related macular degeneration. Proc Natl Acad Sci U S A. 107: 7401-7406.

Chen, Y., Bedell, M. & Zhang, K. (2010b). Age-related macular degeneration: genetic and

environmental factors of disease. Mol Interv. 10: 271-281.

Chen, Y., Chen, X., Wang, L., Hughes, G., Qian, S. & Sun, X. (2014b). Extended

association study of PLEKHA7 and COL11A1 with primary angle closure

glaucoma in a Han Chinese population. Invest Ophthalmol Vis Sci. 55: 3797-3802.

Chintala, S. K., Zhang, X., Austin, J. S. & Fini, M. E. (2002). Deficiency in matrix

metalloproteinase gelatinase B (MMP-9) protects against retinal ganglion cell death

after optic nerve ligation. J Biol Chem. 277: 47461-47468.

Churchill, A.J., Carter, J.G., Ramsden, C., Turner, S.J., Yeung, A., Brenchley, P.E., Ray,

D.W. (2008). “VEGF polymorphisms are associated with severity of diabetic

retinopathy”. Invest Ophthal Vis Sci. 49:3611-3616.

Coleman, A. L. (1999). Glaucoma. Lancet. 354: 1803-1810.

Coleman, H. R., Chan, C. C., Ferris, F. L., 3rd & Chew, E. Y. (2008). Age-related macular

degeneration. Lancet. 372: 1835-1845.

Combadiere, C., Feumi, C., Raoul, W., Keller, N., Rodero, M., Pezard, A., Lavalette, S.,

Houssier, M., Jonet, L., Picard, E., Debre, P., Sirinyan, M., Deterre, P., Ferroukhi,

T., Cohen, S. Y., Chauvaud, D., Jeanny, J. C., Chemtob, S., Behar-Cohen, F. &

154

Sennlaub, F. (2007). CX3CR1-dependent subretinal microglia cell accumulation is

associated with cardinal features of age-related macular degeneration. J Clin Invest.

117: 2920-2928.

Cook, C. & Foster, P. (2012). Epidemiology of glaucoma: what's new? Can J Ophthalmol.

47: 223-226.

Cook, C. (2009). Glaucoma in Africa: size of the problem and possible solutions. J

Glaucoma. 18: 124-128.

Copin, B., Brezin, A. P., Valtot, F., Dascotte, J. C., Bechetoille, A. & Garchon, H. J. (2002).

Apolipoprotein E-promoter single-nucleotide polymorphisms affect the phenotype

of primary open-angle glaucoma and demonstrate interaction with the myocilin

gene. Am J Hum Genet. 70: 1575-1581.

Craig, J. E., Hewitt, A. W., Dimasi, D. P., Howell, N., Toomes, C., Cohn, A. C. & Mackey,

D. A. (2006). The role of the Met98Lys optineurin variant in inherited optic nerve

diseases. Br J Ophthalmol. 90: 1420-1424.

Curcio, C. A. & Millican, C. L. (1999). Basal linear deposit and large drusen are specific

for early age-related maculopathy. Arch Ophthalmol. 117: 329-339.

Curcio, C. A., Johnson, M., Huang, J. D. & Rudolf, M. (2009). Aging, age-related macular

degeneration, and the response-to-retention of apolipoprotein B-containing

lipoproteins. Prog Retin Eye Res. 28: 393-422.

Curcio, C. A., Johnson, M., Huang, J. D. & Rudolf, M. (2010). Apolipoprotein B-

containing lipoproteins in retinal aging and age-related macular degeneration. J

Lipid Res. 51: 451-467.

Dandona, L., Williams, J. D., Williams, B. C. & Rao, G. N. (1998). Population-based

assessment of childhood blindness in southern India. Arch Ophthalmol. 116: 545-

546.

Das, A. & Mcguire, P. G. (2003). Retinal and choroidal angiogenesis: pathophysiology and

strategies for inhibition. Prog Retin Eye Res. 22: 721-748.

Daugherty, C. L., Curtis, H., Realini, T., Charlton, J. F. & Zareparsi, S. (2009). Primary

open angle glaucoma in a Caucasian population is associated with the p53 codon

72 polymorphism. Mol Vis. 15: 1939-1944.

Davis, M. D., Gangnon, R. E., Lee, L. Y., Hubbard, L. D., Klein, B. E., Klein, R., Ferris,

F. L., Bressler, S. B. & Milton, R. C. (2005). The Age-Related Eye Disease Study

severity scale for age-related macular degeneration: AREDS Report No. 17. Arch

Ophthalmol. 123: 1484-1498.

155

De Jong, P. T. (2006). Age-related macular degeneration. N Engl J Med. 355: 1474-1485.

Deangelis, M. M., Silveira, A. C., Carr, E. A. & Kim, I. K. (2011). Genetics of age-related

macular degeneration: current concepts, future directions. Semin Ophthalmol. 26:

77-93.

Dibas, A., Yang, M. H., He, S., Bobich, J. & Yorio, T. (2008). Changes in ocular

aquaporin-4 (AQP4) expression following retinal injury. Mol Vis. 14: 1770-1783.

Dimasi, D. P., Hewitt, A. W., Green, C. M., Mackey, D. A. & Craig, J. E. (2005). Lack of

association of p53 polymorphisms and haplotypes in high and normal tension open

angle glaucoma. J Med Genet. 42: e55.

Ding, X., Patel, M. & Chan, C. C. (2009). Molecular pathology of age-related macular

degeneration. Prog Retin Eye Res. 28: 1-18.

Distelhorst, J. S. & Hughes, G. M. (2003). Open-angle glaucoma. Am Fam Physician. 67:

1937-1944.

Donoso, L. A., Kim, D., Frost, A., Callahan, A. & Hageman, G. (2006). The role of

inflammation in the pathogenesis of age-related macular degeneration. Surv


Drance, S. M. (2008). What can we learn from the disc appearance about the risk factors

in glaucoma? Can J Ophthalmol. 43: 322-327.

Dunaief, J. L., Dentchev, T., Ying, G. S. & Milam, A. H. (2002). The role of apoptosis in

age-related macular degeneration. Arch Ophthalmol. 120: 1435-1442.

Durand, M., Kolpak, A., Farrell, T., Elliott, N. A., Shao, W., Brown, M. & Volkert, M. R.

(2007). The OXR domain defines a conserved family of eukaryotic oxidation

resistance proteins. BMC Cell Biol. 8: 13.

Duvesh, R., Verma, A., Venkatesh, R., Kavitha, S., Ramulu, P. Y., Wojciechowski, R. &

Sundaresan, P. (2013). Association study in a South Indian population supports

rs1015213 as a risk factor for primary angle closure. Invest Ophthalmol Vis Sci. 54:

5624-5628.

Eagle, R. C. (2012). Eye Pathology: An Atlas and Text, Philadelphia Wolters Kluwer

Health.

Edwards, A. O., Ritter, R., 3rd, Abel, K. J., Manning, A., Panhuysen, C. & Farrer, L. A.

(2005). Complement factor H polymorphism and age-related macular degeneration.

Science. 308: 421-424.

156

Ehrlich, R., Harris, A., Kheradiya, N. S., Winston, D. M., Ciulla, T. A. & Wirostko, B.

(2008). Age-related macular degeneration and the aging eye. Clin Interv Aging. 3:

473-482.

Ergorul, C., Ray, A., Huang, W., Wang, D. Y., Ben, Y., Cantuti-Castelvetri, I. &

Grosskreutz, C. L. (2010). Hypoxia inducible factor-1alpha (HIF-1alpha) and some

HIF-1 target genes are elevated in experimental glaucoma. J Mol Neurosci. 42: 183-

191.

Fagerness, J. A., Maller, J. B., Neale, B. M., Reynolds, R. C., Daly, M. J. & Seddon, J. M.

(2009). Variation near complement factor I is associated with risk of advanced

AMD. Eur J Hum Genet. 17: 100-104.

Fan, B. J., Leung, Y. F., Wang, N., Lam, S. C., Liu, Y., Tam, O. S. & Pang, C. P. (2004).

Genetic and environmental risk factors for primary open-angle glaucoma. Chin

Med J (Engl). 117: 706-710.

Fan, B. J., Wang, D. Y., Lam, D. S. & Pang, C. P. (2006). Gene mapping for primary open

angle glaucoma. Clin Biochem. 39: 249-258.

Faucher, M., Anctil, J. L., Rodrigue, M. A., Duchesne, A., Bergeron, D., Blondeau, P.,

Cote, G., Dubois, S., Bergeron, J., Arseneault, R., Morissette, J. & Raymond, V.

(2002). Founder TIGR/myocilin mutations for glaucoma in the Quebec population.

Hum Mol Genet. 11: 2077-2090.

Faucher, M., Anctil, J. L., Rodrigue, M. A., Duchesne, A., Bergeron, D., Blondeau, P.,

Cote, G., Dubois, S., Bergeron, J., Arseneault, R., Morissette, J. & Raymond, V.

(2002). Founder TIGR/myocilin mutations for glaucoma in the Quebec population.

Hum Mol Genet. 11: 2077-2090.

Feero, W. G., Guttmacher, A. E. & Collins, F. S. (2008). The genome gets personal--

almost. JAMA. 299: 1351-1352.

Ferguson, T. A., Dube, P. & Griffith, T. S. (1994). Regulation of contact hypersensitivity

by interleukin 10. J Exp Med. 179: 1597-1604.

Ferreira, S. M., Lerner, S. F., Brunzini, R., Evelson, P. A. & Llesuy, S. F. (2004). Oxidative

stress markers in aqueous humor of glaucoma patients. Am J Ophthalmol. 137: 62-

69.

Ferris, F. L., 3rd, Fine, S. L. & Hyman, L. (1984). Age-related macular degeneration and

blindness due to neovascular maculopathy. Arch Ophthalmol. 102: 1640-1642.

157

Fingert, J. H., Heon, E., Liebmann, J. M., Yamamoto, T., Craig, J. E., Rait, J., Kawase, K.,

Hoh, S. T., Buys, Y. M., Dickinson, J., Hockey, R. R., Williams-Lyn, D., Trope,

G., Kitazawa, Y., Ritch, R., Mackey, D. A., Alward, W. L., Sheffield, V. C. &

Stone, E. M. (1999). Analysis of myocilin mutations in 1703 glaucoma patients

from five different populations. Hum Mol Genet. 8: 899-905.

Fingert, J. H., Robin, A. L., Stone, J. L., Roos, B. R., Davis, L. K., Scheetz, T. E., Bennett,

S. R., Wassink, T. H., Kwon, Y. H., Alward, W. L., Mullins, R. F., Sheffield, V. C.

& Stone, E. M. (2011). Copy number variations on chromosome 12q14 in patients

with normal tension glaucoma. Hum Mol Genet. 20: 2482-2494.

Fingert, J. H., Alward, W. L. M., Kwon, Y. H., Shankar, S. P., Andorf, J. L., Mackey, D.

A., Sheffield, V. C., Stone, E. M. (2007). No association between variations in the

WDR36 gene and primary open-angle glaucoma. Arch. Ophthal. 125: 434-436.

Firasat, S., Riazuddin, S. A., Hejtmancik, J. F. & Riazuddin, S. (2008). Primary congenital

glaucoma localizes to chromosome 14q24.2-24.3 in two consanguineous Pakistani

families. Mol Vis. 14: 1659-1665.

Firasat, S., Riazuddin, S. A., Khan, S. N. & Riazuddin, S. (2008). Novel CYP1B1

mutations in consanguineous Pakistani families with primary congenital glaucoma.

Mol Vis. 14: 2002-2009.

Fletcher, A. E., Bentham, G. C., Agnew, M., Young, I. S., Augood, C., Chakravarthy, U.,

De Jong, P. T., Rahu, M., Seland, J., Soubrane, G., Tomazzoli, L., Topouzis, F.,

Vingerling, J. R. & Vioque, J. (2008). Sunlight exposure, antioxidants, and age-

related macular degeneration. Arch Ophthalmol. 126: 1396-1403.

Footz, T. K., Johnson, J. L., Dubois, S., Boivin, N., Raymond, V., Walter, M. A. (2009).

Glaucoma-associated WDR36 variants encode functional defects in a yeast model

system. Hum. Molec. Genet. 18: 1276-1287.

Francis, P. J. & Klein, M. L. (2011). Update on the role of genetics in the onset of age-

related macular degeneration. Clin Ophthalmol. 5: 1127-1133.

Frank, H. A. (1996). Structural determinations and spectroscopic studies of carotenoids

reveal the factors important in controlling their function in biological systems. Eur

J Clin Nutr. 50 Suppl 3: S13-16.

Fraser, S. & Manvikar, S. (2005). Glaucoma- the pathophysiology and diagnosis.

Glaucoma- the pathophysiology and diagnosis. 12: 4.

Fritsche, L. G., Chen, W., Schu, M., Yaspan, B. L., Yu, Y., Thorleifsson, G., Zack, D. J.,

Arakawa, S., Cipriani, V., Ripke, S., Igo, R. P., Jr., Buitendijk, G. H., Sim, X.,

Weeks, D. E., Guymer, R. H., Merriam, J. E., Francis, P. J., Hannum, G., Agarwal,

A., Armbrecht, A. M., Audo, I., Aung, T., Barile, G. R., Benchaboune, M., Bird,

158

A. C., Bishop, P. N., Branham, K. E., Brooks, M., Brucker, A. J., Cade, W. H.,

Cain, M. S., Campochiaro, P. A., Chan, C. C., Cheng, C. Y., Chew, E. Y., Chin, K.

A., Chowers, I., Clayton, D. G., Cojocaru, R., Conley, Y. P., Cornes, B. K., Daly,

M. J., Dhillon, B., Edwards, A. O., Evangelou, E., Fagerness, J., Ferreyra, H. A.,

Friedman, J. S., Geirsdottir, A., George, R. J., Gieger, C., Gupta, N., Hagstrom, S.

A., Harding, S. P., Haritoglou, C., Heckenlively, J. R., Holz, F. G., Hughes, G.,

Ioannidis, J. P., Ishibashi, T., Joseph, P., Jun, G., Kamatani, Y., Katsanis, N., C, N.

K., Khan, J. C., Kim, I. K., Kiyohara, Y., Klein, B. E., Klein, R., Kovach, J. L.,

Kozak, I., Lee, C. J., Lee, K. E., Lichtner, P., Lotery, A. J., Meitinger, T., Mitchell,

P., Mohand-Said, S., Moore, A. T., Morgan, D. J., Morrison, M. A., Myers, C. E.,

Naj, A. C., Nakamura, Y., Okada, Y., Orlin, A., Ortube, M. C., Othman, M. I.,

Pappas, C., Park, K. H., Pauer, G. J., Peachey, N. S., Poch, O., Priya, R. R.,

Reynolds, R., Richardson, A. J., Ripp, R., Rudolph, G., Ryu, E., Sahel, J. A.,

Schaumberg, D. A., Scholl, H. P., Schwartz, S. G., Scott, W. K., Shahid, H.,

Sigurdsson, H., Silvestri, G., Sivakumaran, T. A., Smith, R. T., Sobrin, L., Souied,

E. H., Stambolian, D. E., Stefansson, H., Sturgill-Short, G. M., Takahashi, A.,

Tosakulwong, N., Truitt, B. J., Tsironi, E. E., Uitterlinden, A. G., Van Duijn, C.

M., Vijaya, L., Vingerling, J. R., Vithana, E. N., Webster, A. R., Wichmann, H. E.,

Winkler, T. W., Wong, T. Y., Wright, A. F., Zelenika, D., Zhang, M., Zhao, L.,

Zhang, K., Klein, M. L., Hageman, G. S., Lathrop, G. M., Stefansson, K.,

Allikmets, R., Baird, P. N., Gorin, M. B., Wang, J. J., Klaver, C. C., Seddon, J. M.,

Pericak-Vance, M. A., Iyengar, S. K., Yates, J. R., Swaroop, A., Weber, B. H.,

Kubo, M., Deangelis, M. M., Leveillard, T., Thorsteinsdottir, U., Haines, J. L.,

Farrer, L. A., Heid, I. M. & Abecasis, G. R. (2013). Seven new loci associated with

age-related macular degeneration. Nat Genet. 45: 433-439, 439e431-432.

Fritsche, L. G., Loenhardt, T., Janssen, A., Fisher, S. A., Rivera, A., Keilhauer, C. N. &

Weber, B. H. (2008). Age-related macular degeneration is associated with an

unstable ARMS2 (LOC387715) mRNA. Nat Genet. 40: 892-896.

Fujiwara, N., Matsuo, T. & Ohtsuki, H. (2003). Protein expression, genomic structure, and

polymorphisms of oculomedin. Ophthalmic Genet. 24: 141-151.

Funayama, T., Mashima, Y., Ohtake, Y., Ishikawa, K., Fuse, N., Yasuda, N., Fukuchi, T.,

Murakami, A., Hotta, Y. & Shimada, N. (2006). SNPs and interaction analyses of

noelin 2, myocilin, and optineurin genes in Japanese patients with open-angle

glaucoma. Invest Ophthalmol Vis Sci. 47: 5368-5375.

Fung, H. C., Chen, C. M., Wu, Y. R., Hsu, W. C., Ro, L. S., Lin, J. C., Chang, K. H., Wang,

H. K., Lin, S. J., Chan, H., Lin, Y. Y., Wei, S. L., Hsu, Y., Hwang, J. C., Tung, L.

C. & Lee-Chen, G. J. (2005). Heat shock protein 70 and tumor necrosis factor alpha

in Taiwanese patients with dementia. Dement Geriatr Cogn Disord. 20: 1-7.

Fuse, N. (2010). Genetic bases for glaucoma. Tohoku J Exp Med. 221: 1-10.

159

Fuse, N., Miyazawa, A., Mengkegale, M., Yoshida, M., Wakusawa, R., Abe, T. & Tamai,

M. (2006). Polymorphisms in Complement Factor H and Hemicentin-1 genes in a

Japanese population with dry-type age-related macular degeneration. Am J

Ophthalmol. 142: 1074-1076.

Fuse, N., Takahashi, K., Akiyama, H., Nakazawa, T., Seimiya, M., Kuwahara, S. & Tamai,

M. (2004). Molecular genetic analysis of optineurin gene for primary open-angle

and normal tension glaucoma in the Japanese population. J Glaucoma. 13: 299-

303.

Gabelt, B. T. & Kaufman, P. L. (2005). Changes in aqueous humor dynamics with age and

glaucoma. Prog Retin Eye Res. 24: 612-637.

Gabelt, B. T., Gottanka, J., Lutjen-Drecoll, E. & Kaufman, P. L. (2003). Aqueous humor

dynamics and trabecular meshwork and anterior ciliary muscle morphologic

changes with age in rhesus monkeys. Invest Ophthalmol Vis Sci. 44: 2118-2125.

Gaillard, E. R., Atherton, S. J., Eldred, G. & Dillon, J. (1995). Photophysical studies on

human retinal lipofuscin. Photochem Photobiol. 61: 448-453.

Galassi, F., Renieri, G., Sodi, A., Ucci, F., Vannozzi, L. & Masini, E. (2004). Nitric oxide

proxies and ocular perfusion pressure in primary open angle glaucoma. Br J


Gelinas, D. S., Bernatchez, P. N., Rollin, S., Bazan, N. G. & Sirois, M. G. (2002).

Immediate and delayed VEGF-mediated NO synthesis in endothelial cells: role of

PI3K, PKC and PLC pathways. Br J Pharmacol. 137: 1021-1030.

Gemenetzi, M., Yang, Y. & Lotery, A. J. (2012). Current concepts on primary open-angle

glaucoma genetics: a contribution to disease pathophysiology and future treatment.

Eye (Lond). 26: 355-369.

Gencik, A. (1989). Epidemiology and genetics of primary congenital glaucoma in

Slovakia. Description of a form of primary congenital glaucoma in gypsies with

autosomal-recessive inheritance and complete penetrance. Dev Ophthalmol. 16: 76-

115.

Gencik, A., Gencikova, A. & Ferak, V. (1982). Population genetical aspects of primary

congenital glaucoma. I. Incidence, prevalence, gene frequency, and age of onset.

Hum Genet. 61: 193-197.

Godley, B. F., Shamsi, F. A., Liang, F. Q., Jarrett, S. G., Davies, S. & Boulton, M. (2005).

Blue light induces mitochondrial DNA damage and free radical production in

epithelial cells. J Biol Chem. 280: 21061-21066.

Gold, B., Merriam, J. E., Zernant, J., Hancox, L. S., Taiber, A. J., Gehrs, K., Cramer, K.,

Neel, J., Bergeron, J., Barile, G. R., Smith, R. T., Hageman, G. S., Dean, M. &

160

Allikmets, R. (2006). Variation in factor B (BF) and complement component 2 (C2)

genes is associated with age-related macular degeneration. Nat Genet. 38: 458-462.

Gottanka, J., Johnson, D. H., Martus, P. & Lutjen-Drecoll, E. (1997). Severity of optic

nerve damage in eyes with POAG is correlated with changes in the trabecular

meshwork. J Glaucoma. 6: 123-132.

Gravina, S., Lescai, F., Hurteau, G., Brock, G. J., Saramaki, A., Salvioli, S., Franceschi, C.

& Roninson, I. B. (2009). Identification of single nucleotide polymorphisms in the

p21 (CDKN1A) gene and correlations with longevity in the Italian population.

Aging (Albany NY). 1: 470-480.

Green, W. R. & Enger, C. (2005). Age-related macular degeneration histopathologic

studies: the 1992 Lorenz E. Zimmerman Lecture. 1992. Retina. 25: 1519-1535.

Gruber, H. J., Bernecker, C., Lechner, A., Weiss, S., Wallner-Blazek, M., Meinitzer, A.,

Hobarth, G., Renner, W., Fauler, G., Horejsi, R., Fazekas, F. & Truschnig-Wilders,

M. (2010). Increased nitric oxide stress is associated with migraine. Cephalalgia.

30: 486-492.

Haass, C., Hung, A. Y. & Selkoe, D. J. (1991). Processing of beta-amyloid precursor

protein in microglia and astrocytes favors an internal localization over constitutive

secretion. J Neurosci. 11: 3783-3793.

Hageman, G. S. & Mullins, R. F. (1999). Molecular composition of drusen as related to

substructural phenotype. Mol Vis. 5: 28.

Hall, S. K., Perregaux, D. G., Gabel, C. A., Woodworth, T., Durham, L. K., Huizinga, T.

W., Breedveld, F. C. & Seymour, A. B. (2004). Correlation of polymorphic

variation in the promoter region of the interleukin-1 beta gene with secretion of

interleukin-1 beta protein. Arthritis Rheum. 50: 1976-1983.

Harendza, S., Lovett, D. H., Panzer, U., Lukacs, Z., Kuhnl, P. & Stahl, R. A. (2003). Linked

common polymorphisms in the gelatinase a promoter are associated with

diminished transcriptional response to estrogen and genetic fitness. J Biol Chem.

278: 20490-20499.

Hashizume, K., Mashima, Y., Fumayama, T., Ohtake, Y., Kimura, I., Yoshida, K.,

Ishikawa, K., Yasuda, N., Fujimaki, T., Asaoka, R., Koga, T., Kanamoto, T.,

Fukuchi, T. & Miyaki, K. (2005). Genetic polymorphisms in the angiotensin II

receptor gene and their association with open-angle glaucoma in a Japanese

population. Invest Ophthalmol Vis Sci. 46: 1993-2001.

Hayano, T. & Kikuchi, M. (1995). Molecular cloning of the cDNA encoding a novel

protein disulfide isomerase-related protein (PDIR). FEBS Lett. 372: 210-214.

161

He, M., Guo, H., Yang, X., Zhang, X., Zhou, L., Cheng, L., Zeng, H., Hu, F. B., Tanguay,

R. M. & Wu, T. (2009). Functional SNPs in HSPA1A gene predict risk of coronary

heart disease. PLoS One. 4: e4851.

Hernandez, M. R. (2000). The optic nerve head in glaucoma: role of astrocytes in tissue

remodeling. Prog Retin Eye Res. 19: 297-321.

Hewitt, A. W., Craig, J. E. & Mackey, D. A. (2006). Complex genetics of complex traits:

the case of primary open-angle glaucoma. Clin Experiment Ophthalmol. 34: 472-

484.

Heys, J. J., Barocas, V. H. & Taravella, M. J. (2001). Modeling passive mechanical

interaction between aqueous humor and iris. J Biomech Eng. 123: 540-547.

Higashino, K., Matsui, Y., Yagi, S., Takata, Y., Goto, T., Sakai, T., Katoh, S. & Yasui, N.

(2007). The alpha2 type IX collagen tryptophan polymorphism is associated with

the severity of disc degeneration in younger patients with herniated nucleus

pulposus of the lumbar spine. Int Orthop. 31: 107-111.

Hollyfield, J. G., Perez, V. L. & Salomon, R. G. (2010). A hapten generated from an

oxidation fragment of docosahexaenoic acid is sufficient to initiate age-related

macular degeneration. Mol Neurobiol. 41: 290-298.

Holz, F. G., Bindewald-Wittich, A., Fleckenstein, M., Dreyhaupt, J., Scholl, H. P. &

Schmitz-Valckenberg, S. (2007). Progression of geographic atrophy and impact of

fundus autofluorescence patterns in age-related macular degeneration. Am J


Holz, F. G., Schutt, F., Kopitz, J., Eldred, G. E., Kruse, F. E., Volcker, H. E. & Cantz, M.

(1999). Inhibition of lysosomal degradative functions in RPE cells by a retinoid

component of lipofuscin. Invest Ophthalmol Vis Sci. 40: 737-743.

Hood, J. D., Meininger, C. J., Ziche, M. & Granger, H. J. (1998). VEGF upregulates ecNOS

message, protein, and NO production in human endothelial cells. Am J Physiol.

274: H1054-1058.

Hsu, R. M., Tsai, M. H., Hsieh, Y. J., Lyu, P. C. & Yu, J. S. (2010). Identification of

MYO18A as a novel interacting partner of the PAK2/betaPIX/GIT1 complex and

its potential function in modulating epithelial cell migration. Mol Biol Cell. 21: 287-

301.

Huang, P., Zhang, S. S. & Zhang, C. (2009). The two sides of cytokine signaling and

glaucomatous optic neuropathy. J Ocul Biol Dis Infor. 2: 78-83.

162

Hulkkonen, J., Laippala, P. & Hurme, M. (2000). A rare allele combination of the

interleukin-1 gene complex is associated with high interleukin-1 beta plasma levels

in healthy individuals. Eur Cytokine Netw. 11: 251-255.

Hussain, R. & Bittles, A. H. (1998). The prevalence and demographic characteristics of

consanguineous marriages in Pakistan. J Biosoc Sci. 30: 261-275.

Inagaki, Y., Mashima, Y., Funayama, T., Ohtake, Y., Fuse, N., Yasuda, N., Fukuchi, T.,

Murakami, A. & Hotta, Y. (2006). Paraoxonase 1 gene polymorphisms influence

clinical features of open-angle glaucoma. Graefes Arch Clin Exp Ophthalmol. 244:

984-990.

Iqbal, Z., Cejudo-Martin, P., De Brouwer, A., Van Der Zwaag, B., Ruiz-Lozano, P.,

Scimia, M. C., Lindsey, J. D., Weinreb, R., Albrecht, B., Megarbane, A., Alanay,

Y., Ben-Neriah, Z., Amenduni, M., Artuso, R., Veltman, J. A., Van Beusekom, E.,

Oudakker, A., Millan, J. L., Hennekam, R., Hamel, B., Courtneidge, S. A. & Van

Bokhoven, H. (2010). Disruption of the podosome adaptor protein TKS4

(SH3PXD2B) causes the skeletal dysplasia, eye, and cardiac abnormalities of

Frank-Ter Haar Syndrome. Am J Hum Genet. 86: 254-261.

Ishii, Y., Kwong, J. M. & Caprioli, J. (2003). Retinal ganglion cell protection with

geranylgeranylacetone, a heat shock protein inducer, in a rat glaucoma model.

Invest Ophthalmol Vis Sci. 44: 1982-1992.

Ishikawa, K., Funayama, T., Ohtake, Y., Kimura, I., Ideta, H., Nakamoto, K., Yasuda, N.,

Fukuchi, T., Fujimaki, T., Murakami, A., Asaoka, R., Hotta, Y., Kanamoto, T.,

Tanihara, H., Miyaki, K. & Mashima, Y. (2005). Association between glaucoma

and gene polymorphism of endothelin type A receptor. Mol Vis. 11: 431-437.

Iwabe, S., Lamas, M., Vasquez Pelaez, C. G. & Carrasco, F. G. (2010). Aqueous humor

endothelin-1 (Et-1), vascular endothelial growth factor (VEGF) and

cyclooxygenase-2 (COX-2) levels in Mexican glaucomatous patients. Curr Eye

Res. 35: 287-294.

Iyengar, S. K., Song, D., Klein, B. E., Klein, R., Schick, J. H., Humphrey, J., Millard, C.,

Liptak, R., Russo, K., Jun, G., Lee, K. E., Fijal, B. & Elston, R. C. (2004).

Dissection of genomewide-scan data in extended families reveals a major locus and

oligogenic susceptibility for age-related macular degeneration. Am J Hum Genet.

74: 20-39.

Izzotti, A., Bagnis, A. & Sacca, S. C. (2006). The role of oxidative stress in glaucoma.

Mutat Res. 612: 105-114.

163

Izzotti, A., Longobardi, M., Cartiglia, C. & Sacca, S. C. (2011). Mitochondrial damage in

the trabecular meshwork occurs only in primary open-angle glaucoma and in

pseudoexfoliative glaucoma. PLoS One. 6: e14567.

Izzotti, A., Sacca, S. C., Cartiglia, C. & De Flora, S. (2003). Oxidative deoxyribonucleic

acid damage in the eyes of glaucoma patients. Am J Med. 114: 638-646.

Jiang, Z., Gorenstein, N. M., Morre, D. M. & Morre, D. J. (2008). Molecular cloning and

characterization of a candidate human growth-related and time-keeping constitutive

cell surface hydroquinone (NADH) oxidase. Biochemistry. 47: 14028-14038.

Johnson, E. C., Deppmeier, L. M., Wentzien, S. K., Hsu, I. & Morrison, J. C. (2000).

Chronology of optic nerve head and retinal responses to elevated intraocular

pressure. Invest Ophthalmol Vis Sci. 41: 431-442.

Johnson, T. V., Fan, S., Camras, C. B. & Toris, C. B. (2008). Aqueous humor dynamics in

exfoliation syndrome. Arch Ophthalmol. 126: 914-920.

Julien, S. & Schraermeyer, U. (2012). Lipofuscin can be eliminated from the retinal

pigment epithelium of monkeys. Neurobiol Aging. 33: 2390-2397.

Junemann, A. G., Von Ahsen, N., Reulbach, U., Roedl, J., Bonsch, D., Kornhuber, J.,

Kruse, F. E. & Bleich, S. (2005). C677T variant in the methylentetrahydrofolate

reductase gene is a genetic risk factor for primary open-angle glaucoma. Am J


Juronen, E., Tasa, G., Veromann, S., Parts, L., Tiidla, A., Pulges, R., Panov, A., Soovere,

L., Koka, K. & Mikelsaar, A. V. (2000). Polymorphic glutathione S-transferase M1

is a risk factor of primary open-angle glaucoma among Estonians. Exp Eye Res. 71:

447-452.

Kahn, M. G., Giblin, F. J. & Epstein, D. L. (1983). Glutathione in calf trabecular meshwork

and its relation to aqueous humor outflow facility. Invest Ophthalmol Vis Sci. 24:

1283-1287.

Kakiuchi-Matsumoto, T., Isashiki, Y., Ohba, N., Kimura, K., Sonoda, S. & Unoki, K.

(2001). Cytochrome P450 1B1 gene mutations in Japanese patients with primary

congenital glaucoma. Am J Ophthalmol. 131: 345-350.

Kanda, A., Chen, W., Othman, M., Branham, K. E., Brooks, M., Khanna, R., He, S., Lyons,

R., Abecasis, G. R. & Swaroop, A. (2007). A variant of mitochondrial protein

LOC387715/ARMS2, not HTRA1, is strongly associated with age-related macular

degeneration. Proc Natl Acad Sci U S A. 104: 16227-16232.

164

Kanda, A., Chen, W., Othman, M., Branham, K. E., Brooks, M., Khanna, R., He, S., Lyons,

R., Abecasis, G. R. & Swaroop, A. (2007). A variant of mitochondrial protein

LOC387715/ARMS2, not HTRA1, is strongly associated with age-related macular

degeneration. Proc Natl Acad Sci U S A. 104: 16227-16232.

Karantzoulis-Fegaras, F., Antoniou, H., Lai, S. L., Kulkarni, G., D'abreo, C., Wong, G. K.,

Miller, T. L., Chan, Y., Atkins, J., Wang, Y. & Marsden, P. A. (1999).

Characterization of the human endothelial nitric-oxide synthase promoter. J Biol

Chem. 274: 3076-3093.

Karen, L. (2006). Glaucoma, An insight into disease and therapy, Toronto, Ontario,

Canadian Pharmacists Association.

Kaur, I., Hussain, A., Hussain, N., Das, T., Pathangay, A., Mathai, A., Nutheti, R.,

Nirmalan, P. K. & Chakrabarti, S. (2006). Analysis of CFH, TLR4, and APOE

polymorphism in India suggests the Tyr402His variant of CFH to be a global

marker for age-related macular degeneration. Invest Ophthalmol Vis Sci. 47: 3729-

3735.

Khan, M. I., Micheal, S., Rana, N., Akhtar, F., Den Hollander, A. I., Ahmed, A. & Qamar,

R. (2009). Association of tumor necrosis factor alpha gene polymorphism G-308A

with pseudoexfoliative glaucoma in the Pakistani population. Mol Vis. 15: 2861-

2867.

Kijlstra, A., La Heij, E. & Hendrikse, F. (2005). Immunological factors in the pathogenesis

and treatment of age-related macular degeneration. Ocul Immunol Inflamm. 13: 3-

11.

Kim, I., Xu, W. & Reed, J. C. (2008). Cell death and endoplasmic reticulum stress: disease

relevance and therapeutic opportunities. Nat Rev Drug Discov. 7: 1013-1030.

Kim, S. K., Selleri, L., Lee, J. S., Zhang, A. Y., Gu, X., Jacobs, Y. & Cleary, M. L. (2002).

Pbx1 inactivation disrupts pancreas development and in Ipf1-deficient mice

promotes diabetes mellitus. Nat Genet. 30: 430-435.

Kim, Y. Y. & Jung, H. R. (1997). Clarifying the nomenclature for primary angle-closure

glaucoma. Surv Ophthalmol. 42: 125-136.

Klein, M. L., Schultz, D. W., Edwards, A., Matise, T. C., Rust, K., Berselli, C. B., Trzupek,

K., Weleber, R. G., Ott, J., Wirtz, M. K. & Acott, T. S. (1998). Age-related macular

degeneration. Clinical features in a large family and linkage to chromosome 1q.

Arch Ophthalmol. 116: 1082-1088.

Klein, R. J., Zeiss, C., Chew, E. Y., Tsai, J. Y., Sackler, R. S., Haynes, C., Henning, A. K.,

Sangiovanni, J. P., Mane, S. M., Mayne, S. T., Bracken, M. B., Ferris, F. L., Ott,

J., Barnstable, C. & Hoh, J. (2005). Complement factor H polymorphism in age-

related macular degeneration. Science. 308: 385-389.

165

Klein, R., Klein, B. E., Knudtson, M. D., Meuer, S. M., Swift, M. & Gangnon, R. E. (2007).

Fifteen-year cumulative incidence of age-related macular degeneration: the Beaver

Dam Eye Study. Ophthalmology. 114: 253-262.

Klein, R., Klein, B. E., Knudtson, M. D., Wong, T. Y., Shankar, A. & Tsai, M. Y. (2005a).

Systemic markers of inflammation, endothelial dysfunction, and age-related

maculopathy. Am J Ophthalmol. 140: 35-44.

Ko, M. L., Hu, D. N., Ritch, R. & Sharma, S. C. (2000). The combined effect of brain-

derived neurotrophic factor and a free radical scavenger in experimental glaucoma.


Konstas, A. G., Mantziris, D. A. & Stewart, W. C. (1997). Diurnal intraocular pressure in

untreated exfoliation and primary open-angle glaucoma. Arch Ophthalmol. 115:

182-185.

Kopitz, J., Holz, F. G., Kaemmerer, E. & Schutt, F. (2004). Lipids and lipid peroxidation

products in the pathogenesis of age-related macular degeneration. Biochimie. 86:

825-831.

Kota, S. K., Meher, L. K., Jammula, S., Krishna, S. V. & Modi, K. D. (2012). Aberrant

angiogenesis: The gateway to diabetic complications. Indian J Endocrinol Metab.

16: 918-930.

Kumar, A., Basavaraj, M. G., Gupta, S. K., Qamar, I., Ali, A. M., Bajaj, V., Ramesh, T.

K., Prakash, D. R., Shetty, J. S. & Dorairaj, S. K. (2007). Role of CYP1B1, MYOC,

OPTN, and OPTC genes in adult-onset primary open-angle glaucoma:

predominance of CYP1B1 mutations in Indian patients. Mol Vis. 13: 667-676.

Lai, E. (2001). Application of SNP technologies in medicine: lessons learned and future

challenges. Genome Res. 11: 927-929.

Lam, D. S., Leung, Y. F., Chua, J. K., Baum, L., Fan, D. S., Choy, K. W. & Pang, C. P.

(2000). Truncations in the TIGR gene in individuals with and without primary

open-angle glaucoma. Invest Ophthalmol Vis Sci. 41: 1386-1391.

Lamers, F., Schild, L., Koster, J., Speleman, F., Ora, I., Westerhout, E. M., Van Sluis, P.,

Versteeg, R., Caron, H. N. & Molenaar, J. J. (2012). Identification of BIRC6 as a

novel intervention target for neuroblastoma therapy. BMC Cancer. 12: 285.

Lander, E. S. & Schork, N. J. (1994). Genetic dissection of complex traits. Science. 265:

2037-2048.

Leske, M. C. (2007). Open-angle glaucoma -- an epidemiologic overview. Ophthalmic

Epidemiol. 14: 166-172.

166

Leung, Y. F., Fan, B. J., Lam, D. S., Lee, W. S., Tam, P. O., Chua, J. K., Tham, C. C., Lai,

J. S., Fan, D. S. & Pang, C. P. (2003). Different optineurin mutation pattern in

primary open-angle glaucoma. Invest Ophthalmol Vis Sci. 44: 3880-3884.

Libby, R. T., Gould, D. B., Anderson, M. G. & John, S. W. (2005). Complex genetics of

glaucoma susceptibility. Annu Rev Genomics Hum Genet. 6: 15-44.

Lichter, P. R. (2002). Impact of intraocular pressure reduction on glaucoma progression.

JAMA. 288: 2607-2608.

Limb, G. A., Webster, L., Soomro, H., Janikoun, S. & Shilling, J. (1999). Platelet

expression of tumour necrosis factor-alpha (TNF-alpha), TNF receptors and

intercellular adhesion molecule-1 (ICAM-1) in patients with proliferative diabetic

retinopathy. Clin Exp Immunol. 118: 213-218.

Lin, H. J., Chen, W. C., Tsai, F. J. & Tsai, S. W. (2002). Distributions of p53 codon 72

polymorphism in primary open angle glaucoma. Br J Ophthalmol. 86: 767-770.

Lin, H. J., Tsai, C. H., Tsai, F. J., Chen, W. C., Chen, H. Y. & Fan, S. S. (2004). Transporter

associated with antigen processing gene 1 codon 333 and codon 637

polymorphisms are associated with primary open-angle glaucoma. Mol Diagn. 8:

245-252.

Lin, H. J., Tsai, F. J., Chen, W. C., Shi, Y. R., Hsu, Y. & Tsai, S. W. (2003a). Association

of tumour necrosis factor alpha -308 gene polymorphism with primary open-angle

glaucoma in Chinese. Eye (Lond). 17: 31-34.

Lin, H. J., Tsai, F. J., Hung, P., Chen, W. C., Chen, H. Y., Fan, S. S. & Tsai, S. W. (2006).

Association of E-cadherin gene 3'-UTR C/T polymorphism with primary open

angle glaucoma. Ophthalmic Res. 38: 44-48.

Lin, H. J., Tsai, S. C., Tsai, F. J., Chen, W. C., Tsai, J. J. & Hsu, C. D. (2003b). Association

of interleukin 1beta and receptor antagonist gene polymorphisms with primary

open-angle glaucoma. Ophthalmologica. 217: 358-364.

Lin, M. T. & Beal, M. F. (2006). Mitochondrial dysfunction and oxidative stress in

neurodegenerative diseases. Nature. 443: 787-795.

Lipton, S. A. (1999). Neuronal protection and destruction by NO. Cell Death Differ. 6:

943-951.

Liu, B. & Neufeld, A. H. (2003). Activation of epidermal growth factor receptor signals

induction of nitric oxide synthase-2 in human optic nerve head astrocytes in

glaucomatous optic neuropathy. Neurobiol Dis. 13: 109-123.

167

Lopez-Garrido, M. P., Medina-Trillo, C., Morales-Fernandez, L., Garcia-Feijoo, J.,

Martinez-De-La-Casa, J. M., Garcia-Anton, M. & Escribano, J. (2013). Null

CYP1B1 genotypes in primary congenital and nondominant juvenile glaucoma.

Ophthalmology. 120: 716-723.

Luibl, V., Isas, J. M., Kayed, R., Glabe, C. G., Langen, R. & Chen, J. (2006). Drusen

deposits associated with aging and age-related macular degeneration contain

nonfibrillar amyloid oligomers. J Clin Invest. 116: 378-385.

Mabuchi, F., Sakurada, Y., Kashiwagi, K., Yamagata, Z., Iijima, H. & Tsukahara, S.

(2009). Lack of association between p53 gene polymorphisms and primary open

angle glaucoma in the Japanese population. Mol Vis. 15: 1045-1049.

Mackey, D. A., Healey, D. L., Fingert, J. H., Coote, M. A., Wong, T. L., Wilkinson, C. H.,

Mccartney, P. J., Rait, J. L., De Graaf, A. P., Stone, E. M. & Craig, J. E. (2003).

Glaucoma phenotype in pedigrees with the myocilin Thr377Met mutation. Arch

Ophthalmol. 121: 1172-1180.

Malek, A. M., Izumo, S. & Alper, S. L. (1999). Modulation by pathophysiological stimuli

of the shear stress-induced up-regulation of endothelial nitric oxide synthase

expression in endothelial cells. Neurosurgery. 45: 334-344; discussion 344-335.

Malek, G., Li, C. M., Guidry, C., Medeiros, N. E. & Curcio, C. A. (2003). Apolipoprotein

B in cholesterol-containing drusen and basal deposits of human eyes with age-

related maculopathy. Am J Pathol. 162: 413-425.

Maller, J. B., Fagerness, J. A., Reynolds, R. C., Neale, B. M., Daly, M. J. & Seddon, J. M.

(2007). Variation in complement factor 3 is associated with risk of age-related

macular degeneration. Nat Genet. 39: 1200-1201.

Mancebo, J. (1992). PEEP, ARDS, and alveolar recruitment. Intensive Care Med. 18: 383-

385.

Mcbride, H. M., Neuspiel, M. & Wasiak, S. (2006). Mitochondria: more than just a

powerhouse. Curr Biol. 16: R551-560.

Mcconnell, V. & Silvestri, G. (2005). Age-related macular degeneration. Ulster Med J. 74:

82-92.

Mckay, G. J., Patterson, C. C., Chakravarthy, U., Dasari, S., Klaver, C. C., Vingerling, J.

R., Ho, L., De Jong, P. T., Fletcher, A. E., Young, I. S., Seland, J. H., Rahu, M.,

Soubrane, G., Tomazzoli, L., Topouzis, F., Vioque, J., Hingorani, A. D., Sofat, R.,

Dean, M., Sawitzke, J., Seddon, J. M., Peter, I., Webster, A. R., Moore, A. T.,

Yates, J. R., Cipriani, V., Fritsche, L. G., Weber, B. H., Keilhauer, C. N., Lotery,

A. J., Ennis, S., Klein, M. L., Francis, P. J., Stambolian, D., Orlin, A., Gorin, M.

168

B., Weeks, D. E., Kuo, C. L., Swaroop, A., Othman, M., Kanda, A., Chen, W.,

Abecasis, G. R., Wright, A. F., Hayward, C., Baird, P. N., Guymer, R. H., Attia, J.,

Thakkinstian, A. & Silvestri, G. (2011). Evidence of association of APOE with age-

related macular degeneration: a pooled analysis of 15 studies. Hum Mutat. 32:

1407-1416.

Melki, R., Belmouden, A., Akhayat, O., Brezin, A. & Garchon, H. J. (2003). The M98K

variant of the OPTINEURIN (OPTN) gene modifies initial intraocular pressure in

patients with primary open angle glaucoma. J Med Genet. 40: 842-844.

Michael, O. H. (2005). Anatomy of the Anterior Eye for Ocularists. Journal of Ophthalmic

Prosthetics. pp. 25-35.

Michael, S., Qamar, R., Akhtar, F., Khan, W. A. & Ahmed, A. (2008). C677T

polymorphism in the methylenetetrahydrofolate reductase gene is associated with

primary closed angle glaucoma. Mol Vis. 14: 661-665.

Micheal, S., Ayub, H., Zafar, S. N., Bakker, B., Ali, M., Akhtar, F., Islam, F., Khan, M. I.,

Qamar, R. & Den Hollander, A. I. (2014). Identification of novel CYP1B1 gene

mutations in patients with primary congenital and primary open-angle glaucoma.

Clin Experiment Ophthalmol. doi: 10.1111/ceo.12369.

Monemi, S., Spaeth, G., Dasilva, A., Popinchalk, S., Ilitchev, E., Liebmann, J., Ritch, R.,

Heon, E., Crick, R. P., Child, A. & Sarfarazi, M. (2005). Identification of a novel

adult-onset primary open-angle glaucoma (POAG) gene on 5q22.1. Hum Mol

Genet. 14: 725-733.

Moren, A., Olofsson, A., Stenman, G., Sahlin, P., Kanzaki, T., Claesson-Welsh, L., Ten

Dijke, P., Miyazono, K. & Heldin, C. H. (1994). Identification and characterization

of LTBP-2, a novel latent transforming growth factor-beta-binding protein. J Biol

Chem. 269: 32469-32478.

Morré, D. J. & Morré, D. M. (2012). ECTO-NOX Proteins: Growth, Cancer, and Aging,

New York, Springer.

Morris, B., Imrie, F., Armbrecht, A. M. & Dhillon, B. (2007). Age-related macular

degeneration and recent developments: new hope for old eyes? Postgrad Med J.

83: 301-307.

Morrison, J. C. & Pollack, I. P. (2011). Glaucoma: Science and Practice, Hongkong,

Thiemes Medical Publishers.

Morrison, J. C., Johnson, E. C., Cepurna, W. & Jia, L. (2005). Understanding mechanisms

of pressure-induced optic nerve damage. Prog Retin Eye Res. 24: 217-240.

169

Mossbock, G., Renner, W., El-Shabrawi, Y., Faschinger, C., Schmut, O., Wedrich, A.,

Zimmermann, C. & Weger, M. (2009). TNF-alpha -308 G>A and -238 G>A

polymorphisms are not major risk factors in Caucasian patients with exfoliation

glaucoma. Mol Vis. 15: 518-522.

Mozaffarieh, M., Grieshaber, M. C. & Flammer, J. (2008). Oxygen and blood flow: players

in the pathogenesis of glaucoma. Mol Vis. 14: 224-233.

Mukesh, B. N., Mccarty, C. A., Rait, J. L. & Taylor, H. R. (2002). Five-year incidence of

open-angle glaucoma: the visual impairment project. Ophthalmology. 109: 1047-

1051.

Nakamura, K., Ota, M., Meguro, A., Nomura, N., Kashiwagi, K., Mabuchi, F., Iijima, H.,

Kawase, K., Yamamoto, T., Nakamura, M., Negi, A., Sagara, T., Nishida, T.,

Inatani, M., Tanihara, H., Aihara, M., Araie, M., Fukuchi, T., Abe, H., Higashide,

T., Sugiyama, K., Kanamoto, T., Kiuchi, Y., Iwase, A., Ohno, S., Inoko, H. &

Mizuki, N. (2009). Association of microsatellite polymorphisms of the GPDS1

locus with normal tension glaucoma in the Japanese population. Clin Ophthalmol.

3: 307-312.

Narooie-Nejad, M., Paylakhi, S. H., Shojaee, S., Fazlali, Z., Rezaei Kanavi, M.,

Nilforushan, N., Yazdani, S., Babrzadeh, F., Suri, F., Ronaghi, M., Elahi, E. &

Paisan-Ruiz, C. (2009). Loss of function mutations in the gene encoding latent

transforming growth factor beta binding protein 2, LTBP2, cause primary

congenital glaucoma. Hum Mol Genet. 18: 3969-3977.

Nathanson, J. A. & Mckee, M. (1995). Identification of an extensive system of nitric oxide-

producing cells in the ciliary muscle and outflow pathway of the human eye. Invest


Naumann, G. O., Schlotzer-Schrehardt, U. & Kuchle, M. (1998). Pseudoexfoliation

syndrome for the comprehensive ophthalmologist. Intraocular and systemic

manifestations. Ophthalmology. 105: 951-968.

Neale, B. M., Fagerness, J., Reynolds, R., Sobrin, L., Parker, M., Raychaudhuri, S., Tan,

P. L., Oh, E. C., Merriam, J. E., Souied, E., Bernstein, P. S., Li, B., Frederick, J.

M., Zhang, K., Brantley, M. A., Jr., Lee, A. Y., Zack, D. J., Campochiaro, B.,

Campochiaro, P., Ripke, S., Smith, R. T., Barile, G. R., Katsanis, N., Allikmets, R.,

Daly, M. J. & Seddon, J. M. (2010). Genome-wide association study of advanced

age-related macular degeneration identifies a role of the hepatic lipase gene (LIPC).

Proc Natl Acad Sci U S A. 107: 7395-7400.

Ni Dhubhghaill, S. S., Cahill, M. T., Campbell, M., Cassidy, L., Humphries, M. M. &

Humphries, P. (2010). The pathophysiology of cigarette smoking and age-related

macular degeneration. Adv Exp Med Biol. 664: 437-446.

170

Nickells, R. W. (1999). Apoptosis of retinal ganglion cells in glaucoma: an update of the

molecular pathways involved in cell death. Surv Ophthalmol. 43 Suppl 1: S151-

161.

Nikopoulos, K., Schrauwen, I., Simon, M., Collin, R. W., Veckeneer, M., Keymolen, K.,

Van Camp, G., Cremers, F. P. & Van Den Born, L. I. (2011). Autosomal recessive

Stickler syndrome in two families is caused by mutations in the COL9A1 gene.


Nowak, J. Z. (2006). Age-related macular degeneration (AMD): pathogenesis and therapy.

Pharmacol Rep. 58: 353-363.

Ntim-Amponsah, C. T., Amoaku, W. M., Ofosu-Amaah, S., Ewusi, R. K., Idirisuriya-

Khair, R., Nyatepe-Coo, E. & Adu-Darko, M. (2004). Prevalence of glaucoma in

an African population. Eye (Lond). 18: 491-497.

Ohno-Matsui, K. (2011). Parallel findings in age-related macular degeneration and

Alzheimer's disease. Prog Retin Eye Res. 30: 217-238.

Osborne, N. N., Melena, J., Chidlow, G. & Wood, J. P. (2001). A hypothesis to explain

ganglion cell death caused by vascular insults at the optic nerve head: possible

implication for the treatment of glaucoma. Br J Ophthalmol. 85: 1252-1259.

Owen, C. G., Fletcher, A. E., Donoghue, M. & Rudnicka, A. R. (2003). How big is the

burden of visual loss caused by age related macular degeneration in the United

Kingdom? Br J Ophthalmol. 87: 312-317.

Pagon, R.A., Bird, T.D., Dolan, C.R., Stephens, K., Adam, M.P. (2012). Stickler

Syndrome; Gene Reviews, University of Washington. Last reviewed:13 Janurary

2015, (http://www.ncbi.nlm.nih.gov/books/NBK1302/)

Pang, C. P., Fan, B. J., Canlas, O., Wang, D. Y., Dubois, S., Tam, P. O., Lam, D. S.,

Raymond, V. & Ritch, R. (2006). A genome-wide scan maps a novel juvenile-onset

primary open angle glaucoma locus to chromosome 5q. Mol Vis. 12: 85-92.

Pang, C. P., Leung, Y. F., Fan, B., Baum, L., Tong, W. C., Lee, W. S., Chua, J. K., Fan, D.

S., Liu, Y. & Lam, D. S. (2002). TIGR/MYOC gene sequence alterations in

individuals with and without primary open-angle glaucoma. Invest Ophthalmol Vis

Sci. 43: 3231-3235.

Papadopoulos, M., Cable, N., Rahi, J. & Khaw, P. T. (2007). The British Infantile and

Childhood Glaucoma (BIG) Eye Study. Invest Ophthalmol Vis Sci. 48: 4100-4106.

Papiol, S., Molina, V., Desco, M., Rosa, A., Reig, S., Sanz, J., Palomo, T. & Fananas, L.

(2008). Gray matter deficits in bipolar disorder are associated with genetic

variability at interleukin-1 beta gene (2q13). Genes Brain Behav. 7: 796-801.

171

Parmeggiani, F., Romano, M. R., Costagliola, C., Semeraro, F., Incorvaia, C., D'angelo,

S., Perri, P., De Palma, P., De Nadai, K. & Sebastiani, A. (2012). Mechanism of

inflammation in age-related macular degeneration. Mediators Inflamm. 2012:

546786.

Pasutto, F., Matsumoto, T., Mardin, C. Y., Sticht, H., Brandstatter, J. H., Michels-

Rautenstrauss, K., Weisschuh, N., Gramer, E., Ramdas, W. D., Van Koolwijk, L.

M., Klaver, C. C., Vingerling, J. R., Weber, B. H., Kruse, F. E., Rautenstrauss, B.,

Barde, Y. A. & Reis, A. (2009). Heterozygous NTF4 mutations impairing

neurotrophin-4 signaling in patients with primary open-angle glaucoma. Am J Hum

Genet. 85: 447-456.

Patel, S. J. & Lundy, D. C. (2002). Ocular manifestations of autoimmune disease. Am Fam

Physician. 66: 991-998.

Pauleikhoff, D., Harper, C. A., Marshall, J. & Bird, A. C. (1990). Aging changes in Bruch's

membrane. A histochemical and morphologic study. Ophthalmology. 97: 171-178.

Penfold, P. L., Killingsworth, M. C. & Sarks, S. H. (1985). Senile macular degeneration:

the involvement of immunocompetent cells. Graefes Arch Clin Exp Ophthalmol.

223: 69-76.

Plantner, J. J. (1992). High molecular weight mucin-like glycoproteins of the bovine

interphotoreceptor matrix. Exp Eye Res. 54: 113-125.

Plantner, J. J., Jiang, C. & Smine, A. (1998a). Increase in interphotoreceptor matrix

gelatinase A (MMP-2) associated with age-related macular degeneration. Exp Eye

Res. 67: 637-645.

Plantner, J. J., Smine, A. & Quinn, T. A. (1998b). Matrix metalloproteinases and

metalloproteinase inhibitors in human interphotoreceptor matrix and vitreous. Curr

Eye Res. 17: 132-140.

Price, M., Lazzaro, D., Pohl, T., Mattei, M. G., Ruther, U., Olivo, J. C., Duboule, D. & Di

Lauro, R. (1992). Regional expression of the homeobox gene Nkx-2.2 in the

developing mammalian forebrain. Neuron. 8: 241-255.

Provencio, I., Rodriguez, I. R., Jiang, G., Hayes, W. P., Moreira, E. F. & Rollag, M. D.

(2000). A novel human opsin in the inner retina. J Neurosci. 20: 600-605.

Qui, M. (1990). [Bone histomorphometric study of iliac crest in normal Chinese subjects].

Zhonghua Yi Xue Za Zhi. 70: 685-690, 648.

Quigley, H. A. & Broman, A. T. (2006). The number of people with glaucoma worldwide

in 2010 and 2020. Br J Ophthalmol. 90: 262-267.

172

Quigley, H. A. (1996). Number of people with glaucoma worldwide. Br J Ophthalmol. 80:

389-393.

Quigley, H. A. (1999). Neuronal death in glaucoma. Prog Retin Eye Res. 18: 39-57.

Quigley, H. A. (2011). Glaucoma. Lancet. 377: 1367-1377.

Quigley, H. A., Nickells, R. W., Kerrigan, L. A., Pease, M. E., Thibault, D. J. & Zack, D.

J. (1995). Retinal ganglion cell death in experimental glaucoma and after axotomy

occurs by apoptosis. Invest Ophthalmol Vis Sci. 36: 774-786.

Radu, R. A., Hu, J., Yuan, Q., Welch, D. L., Makshanoff, J., Lloyd, M., Mcmullen, S.,

Travis, G. H. & Bok, D. (2011). Complement system dysregulation and

inflammation in the retinal pigment epithelium of a mouse model for Stargardt

macular degeneration. J Biol Chem. 286: 18593-18601.

Rao, A. (2014). Intraocular Pressure: Is it a Risk Factor in Normal Tension Glaucoma? J

Glaucoma. (Epub ahead of print)

Ratnapriya, R. & Chew, E. Y. (2013). Age-related macular degeneration-clinical review

and genetics update. Clin Genet. 84: 160-166.

Reale, E., Groos, S., Eckardt, U., Eckardt, C. & Luciano, L. (2009). New components of

'basal laminar deposits' in age-related macular degeneration. Cells Tissues Organs.

190: 170-181.

Reddy, A. B., Panicker, S. G., Mandal, A. K., Hasnain, S. E. & Balasubramanian, D.

(2003). Identification of R368H as a predominant CYP1B1 allele causing primary

congenital glaucoma in Indian patients. Invest Ophthalmol Vis Sci. 44: 4200-4203.

Ren, J., Shi, M., Liu, R., Yang, Q. H., Johnson, T., Skarnes, W. C. & Du, C. (2005). The

Birc6 (Bruce) gene regulates p53 and the mitochondrial pathway of apoptosis and

is essential for mouse embryonic development. Proc Natl Acad Sci U S A. 102: 565-

570.

Resnikoff, S., Pascolini, D., Etya'ale, D., Kocur, I., Pararajasegaram, R., Pokharel, G. P. &

Mariotti, S. P. (2004). Global data on visual impairment in the year 2002. Bull

World Health Organ. 82: 844-851.

Ressiniotis, T., Griffiths, P. G., Keers, S. M., Chinnery, P. F. & Birch, M. (2005). A

polymorphism at codon 31 of gene p21 is not associated with primary open angle

glaucoma in Caucasians. BMC Ophthalmol. 5: 5.

173

Rezaie, T., Child, A., Hitchings, R., Brice, G., Miller, L., Coca-Prados, M., Heon, E.,

Krupin, T., Ritch, R., Kreutzer, D., Crick, R. P. & Sarfarazi, M. (2002). Adult-onset

primary open-angle glaucoma caused by mutations in optineurin. Science. 295:

1077-1079.

Riordan-Eva, P., Whitcher, J. & Asbury, T. Vaughan & Asbury's General Ophthalmology.

In “Anatomy & Embriology of the Eye”. McGraw-Hill Education. New York., pp.

12 (2007).

Risch, N. & Merikangas, K. (1996). The future of genetic studies of complex human

diseases. Science. 273: 1516-1517.

Ritch, R. & Schlotzer-Schrehardt, U. (2001). Exfoliation syndrome. Surv Ophthalmol. 45:

265-315.

Rivera, A., Fisher, S. A., Fritsche, L. G., Keilhauer, C. N., Lichtner, P., Meitinger, T. &

Weber, B. H. (2005). Hypothetical LOC387715 is a second major susceptibility

gene for age-related macular degeneration, contributing independently of

complement factor H to disease risk. Hum Mol Genet. 14: 3227-3236.

Rodriguez De Cordoba, S., Esparza-Gordillo, J., Goicoechea De Jorge, E., Lopez-Trascasa,

M. & Sanchez-Corral, P. (2004). The human complement factor H: functional roles,

genetic variations and disease associations. Mol Immunol. 41: 355-367.

Rosenbaum, D. M., Rosenbaum, P. S., Gupta, H., Singh, M., Aggarwal, A., Hall, D. H.,

Roth, S. & Kessler, J. A. (1998). The role of the p53 protein in the selective

vulnerability of the inner retina to transient ischemia. Invest Ophthalmol Vis Sci.

39: 2132-2139.

Rudolf, M., Clark, M. E., Chimento, M. F., Li, C. M., Medeiros, N. E. & Curcio, C. A.

(2008). Prevalence and morphology of druse types in the macula and periphery of

eyes with age-related maculopathy. Invest Ophthalmol Vis Sci. 49: 1200-1209.

Russell, S. R., Mullins, R. F., Schneider, B. L. & Hageman, G. S. (2000). Location,

substructure, and composition of basal laminar drusen compared with drusen

associated with aging and age-related macular degeneration. Am J Ophthalmol.

129: 205-214.

Ryan, S. J., Schachat, A. P., Wilkinson, C. P., Hinton, D. R., Sadda, S. V. R. & Wiedemann,

P. Retina. In “Structure, Function, and Pathology of Bruch’s Membrane”. Elsevier

Health Sciences., pp. 466-478 (2012)

Sacca, S. C., Izzotti, A., Rossi, P. & Traverso, C. (2007). Glaucomatous outflow pathway

and oxidative stress. Exp Eye Res. 84: 389-399.

174

Saglar, E., Yucel, D., Bozkurt, B., Ozgul, R. K., Irkec, M. & Ogus, A. (2009). Association

of polymorphisms in APOE, p53, and p21 with primary open-angle glaucoma in

Turkish patients. Mol Vis. 15: 1270-1276.

Saprunova, V. B., Pilipenko, D. I., Alexeevsky, A. V., Fursova, A., Kolosova, N. G. &

Bakeeva, L. E. (2010). Lipofuscin granule dynamics during development of age-

related macular degeneration. Biochemistry (Mosc). 75: 130-138.

Sarfarazi, M. (1997). Recent advances in molecular genetics of glaucomas. Hum Mol

Genet. 6: 1667-1677.

Sarfarazi, M., Akarsu, A. N., Hossain, A., Turacli, M. E., Aktan, S. G., Barsoum-Homsy,

M., Chevrette, L. & Sayli, B. S. (1995). Assignment of a locus (GLC3A) for

primary congenital glaucoma (Buphthalmos) to 2p21 and evidence for genetic

heterogeneity. Genomics. 30: 171-177.

Sarfarazi, M., Child, A., Stoilova, D., Brice, G., Desai, T., Trifan, O. C., Poinoosawmy, D.

& Crick, R. P. (1998). Localization of the fourth locus (GLC1E) for adult-onset

primary open-angle glaucoma to the 10p15-p14 region. Am J Hum Genet. 62: 641-

652.

Sarfarazi, M., Stoilov, I. & Schenkman, J. B. (2003). Genetics and biochemistry of primary

congenital glaucoma. Ophthalmol Clin North Am. 16: 543-554.

Schmidt, S., Klaver, C., Saunders, A., Postel, E., De La Paz, M., Agarwal, A., Small, K.,

Udar, N., Ong, J., Chalukya, M., Nesburn, A., Kenney, C., Domurath, R., Hogan,

M., Mah, T., Conley, Y., Ferrell, R., Weeks, D., De Jong, P. T., Van Duijn, C.,

Haines, J., Pericak-Vance, M. & Gorin, M. (2002). A pooled case-control study of

the apolipoprotein E (APOE) gene in age-related maculopathy. Ophthalmic Genet.

23: 209-223.

Schutt, F., Davies, S., Kopitz, J., Holz, F. G. & Boulton, M. E. (2000). Photodamage to

human RPE cells by A2-E, a retinoid component of lipofuscin. Invest Ophthalmol

Vis Sci. 41: 2303-2308.

Schwartz, M. & Ziv, Y. (2008). Immunity to self and self-maintenance: a unified theory of

brain pathologies. Trends Immunol. 29: 211-219.

Schwartz, S. G., Agarwal, A., Kovach, J. L., Gallins, P. J., Cade, W., Postel, E. A., Wang,

G., Ayala-Haedo, J., Spencer, K. M., Haines, J. L., Pericak-Vance, M. A. & Scott,

W. K. (2012). The ARMS2 A69S variant and bilateral advanced age-related

macular degeneration. Retina. 32: 1486-1491.

Seddon, J. M., Ajani, U. A., Sperduto, R. D., Hiller, R., Blair, N., Burton, T. C., Farber, M.

D., Gragoudas, E. S., Haller, J., Miller, D. T. & Et Al. (1994). Dietary carotenoids,

175

vitamins A, C, and E, and advanced age-related macular degeneration. Eye Disease

Case-Control Study Group. JAMA. 272: 1413-1420.

Seddon, J. M., George, S., Rosner, B. & Rifai, N. (2005). Progression of age-related

macular degeneration: prospective assessment of C-reactive protein, interleukin 6,

and other cardiovascular biomarkers. Arch Ophthalmol. 123: 774-782.

Sethi, C. S., Bailey, T. A., Luthert, P. J. & Chong, N. H. (2000). Matrix metalloproteinase

biology applied to vitreoretinal disorders. Br J Ophthalmol. 84: 654-666.

Shaarawy, T., Sherwood, M. B. & Crowston, J. G. (2009). Glaucoma: Medical diagnosis

& therapy, Saunders/Elsevier.

Shastry, B. S. (2013). Genetic susceptibility to primary angle closure glaucoma (PACG).

Discov Med. 15: 17-22.

Sheffield, V. C., Stone, E. M., Alward, W. L., Drack, A. V., Johnson, A. T., Streb, L. M.

& Nichols, B. E. (1993). Genetic linkage of familial open angle glaucoma to

chromosome 1q21-q31. Nat Genet. 4: 47-50.

Shi, H., Zhu, R., Hu, N., Shi, J., Zhang, J., Yang, M., Jiang, L., Jiang, H. & Guan, H.

(2014). Association of eNOS polymorphisms with anterior chamber depth in han

chinese: jiangsu eye study. J Ophthalmol. 2014: 164104.

Shibuya, E., Meguro, A., Ota, M., Kashiwagi, K., Mabuchi, F., Iijima, H., Kawase, K.,

Yamamoto, T., Nakamura, M., Negi, A., Sagara, T., Nishida, T., Inatani, M.,

Tanihara, H., Aihara, M., Araie, M., Fukuchi, T., Abe, H., Higashide, T., Sugiyama,

K., Kanamoto, T., Kiuchi, Y., Iwase, A., Ohno, S., Inoko, H. & Mizuki, N. (2008).

Association of Toll-like receptor 4 gene polymorphisms with normal tension

glaucoma. Invest Ophthalmol Vis Sci. 49: 4453-4457.

Shibuya, M. (2008). Vascular endothelial growth factor-dependent and -independent

regulation of angiogenesis. BMB Rep. 41: 278-286.

Shigenaga, M. K., Hagen, T. M. & Ames, B. N. (1994). Oxidative damage and

mitochondrial decay in aging. Proc Natl Acad Sci U S A. 91: 10771-10778.

Shirts, B. H., Wood, J., Yolken, R. H. & Nimgaonkar, V. L. (2006). Association study of

IL10, IL1beta, and IL1RN and schizophrenia using tag SNPs from a comprehensive

database: suggestive association with rs16944 at IL1beta. Schizophr Res. 88: 235-

244.

Sivaprasad, S., Bailey, T. A. & Chong, V. N. (2005). Bruch's membrane and the vascular

intima: is there a common basis for age-related changes and disease? Clin

Experiment Ophthalmol. 33: 518-523.

176

Smith, W., Mitchell, P. & Wang, J. J. (1997). Gender, oestrogen, hormone replacement

and age-related macular degeneration: results from the Blue Mountains Eye Study.

Aust N Z J Ophthalmol. 25 Suppl 1: S13-15.

Sobrin, L., Reynolds, R., Yu, Y., Fagerness, J., Leveziel, N., Bernstein, P. S., Souied, E.

H., Daly, M. J. & Seddon, J. M. (2011). ARMS2/HTRA1 locus can confer

differential susceptibility to the advanced subtypes of age-related macular

degeneration. Am J Ophthalmol. 151: 345-352 e343.

Sofat, R., Casas, J. P., Webster, A. R., Bird, A. C., Mann, S. S., Yates, J. R., Moore, A. T.,

Sepp, T., Cipriani, V., Bunce, C., Khan, J. C., Shahid, H., Swaroop, A., Abecasis,

G., Branham, K. E., Zareparsi, S., Bergen, A. A., Klaver, C. C., Baas, D. C., Zhang,

K., Chen, Y., Gibbs, D., Weber, B. H., Keilhauer, C. N., Fritsche, L. G., Lotery, A.,

Cree, A. J., Griffiths, H. L., Bhattacharya, S. S., Chen, L. L., Jenkins, S. A., Peto,

T., Lathrop, M., Leveillard, T., Gorin, M. B., Weeks, D. E., Ortube, M. C., Ferrell,

R. E., Jakobsdottir, J., Conley, Y. P., Rahu, M., Seland, J. H., Soubrane, G.,

Topouzis, F., Vioque, J., Tomazzoli, L., Young, I., Whittaker, J., Chakravarthy, U.,

De Jong, P. T., Smeeth, L., Fletcher, A. & Hingorani, A. D. (2012). Complement

factor H genetic variant and age-related macular degeneration: effect size,

modifiers and relationship to disease subtype. Int J Epidemiol. 41: 250-262.

Sparrow, J. R., Nakanishi, K. & Parish, C. A. (2000). The lipofuscin fluorophore A2E

mediates blue light-induced damage to retinal pigmented epithelial cells. Invest


Spencer, K. L., Olson, L. M., Schnetz-Boutaud, N., Gallins, P., Agarwal, A., Iannaccone,

A., Kritchevsky, S. B., Garcia, M., Nalls, M. A., Newman, A. B., Scott, W. K.,

Pericak-Vance, M. A. & Haines, J. L. (2011). Using genetic variation and

environmental risk factor data to identify individuals at high risk for age-related

macular degeneration. PLoS One. 6: e17784.

Sripriya, S., Nirmaladevi, J., George, R., Hemamalini, A., Baskaran, M., Prema, R., Ve

Ramesh, S., Karthiyayini, T., Amali, J., Job, S., Vijaya, L. & Kumaramanickavel,

G. (2006). OPTN gene: profile of patients with glaucoma from India. Mol Vis. 12:

816-820.

Sripriya, S., Uthra, S., Sangeetha, R., George, R. J., Hemamalini, A., Paul, P. G., Amali,

J., Vijaya, L. & Kumaramanickavel, G. (2004). Low frequency of myocilin

mutations in Indian primary open-angle glaucoma patients. Clin Genet. 65: 333-

337.

Stein, J. D., Kim, D. S., Niziol, L. M., Talwar, N., Nan, B., Musch, D. C. & Richards, J. E.

(2011). Differences in rates of glaucoma among Asian Americans and other racial

groups, and among various Asian ethnic groups. Ophthalmology. 118: 1031-1037.

177

Sternlicht, M. D. & Werb, Z. (2001). How matrix metalloproteinases regulate cell behavior.

Annu Rev Cell Dev Biol. 17: 463-516.

Stoilov, I., Akarsu, A. N. & Sarfarazi, M. (1997). Identification of three different truncating

mutations in cytochrome P4501B1 (CYP1B1) as the principal cause of primary

congenital glaucoma (Buphthalmos) in families linked to the GLC3A locus on

chromosome 2p21. Hum Mol Genet. 6: 641-647.

Stoilov, I., Akarsu, A. N., Alozie, I., Child, A., Barsoum-Homsy, M., Turacli, M. E., Or,

M., Lewis, R. A., Ozdemir, N., Brice, G., Aktan, S. G., Chevrette, L., Coca-Prados,

M. & Sarfarazi, M. (1998). Sequence analysis and homology modeling suggest that

primary congenital glaucoma on 2p21 results from mutations disrupting either the

hinge region or the conserved core structures of cytochrome P4501B1. Am J Hum

Genet. 62: 573-584.

Stoilova, D., Child, A., Trifan, O. C., Crick, R. P., Coakes, R. L. & Sarfarazi, M. (1996).

Localization of a locus (GLC1B) for adult-onset primary open angle glaucoma to

the 2cen-q13 region. Genomics. 36: 142-150.

Stone, E. M., Sheffield, V. C. & Hageman, G. S. (2001). Molecular genetics of age-related

macular degeneration. Hum Mol Genet. 10: 2285-2292.

Strauss, O. (2005). The retinal pigment epithelium in visual function. Physiol Rev. 85: 845-

881.

Streeten, B. W., Dark, A. J., Wallace, R. N., Li, Z. Y. & Hoepner, J. A. (1990).

Pseudoexfoliative fibrillopathy in the skin of patients with ocular

pseudoexfoliation. Am J Ophthalmol. 110: 490-499.

Streeten, B. W., Li, Z. Y., Wallace, R. N., Eagle, R. C., Jr. & Keshgegian, A. A. (1992).

Pseudoexfoliative fibrillopathy in visceral organs of a patient with

pseudoexfoliation syndrome. Arch Ophthalmol. 110: 1757-1762.

Sugiyama, T., Moriya, S., Oku, H. & Azuma, I. (1995). Association of endothelin-1 with

normal tension glaucoma: clinical and fundamental studies. Surv Ophthalmol. 39

Suppl 1: S49-56.

Sundaresan, P., Vashist, P., Ravindran, R. D., Shanker, A., Nitsch, D., Nonyane, B. A.,

Smeeth, L., Chakravarthy, U. & Fletcher, A. E. (2012). Polymorphisms in

ARMS2/HTRA1 and complement genes and age-related macular degeneration in

India: findings from the INDEYE study. Invest Ophthalmol Vis Sci. 53: 7492-7497.

Suriyapperuma, S. P., Child, A., Desai, T., Brice, G., Kerr, A., Crick, R. P. & Sarfarazi, M.

(2007). A new locus (GLC1H) for adult-onset primary open-angle glaucoma maps

to the 2p15-p16 region. Arch Ophthalmol. 125: 86-92.

178

Suzuki, Y., Shirato, S., Taniguchi, F., Ohara, K., Nishimaki, K. & Ohta, S. (1997).

Mutations in the TIGR gene in familial primary open-angle glaucoma in Japan. Am

J Hum Genet. 61: 1202-1204.

Swaroop, A., Chew, E. Y., Rickman, C. B. & Abecasis, G. R. (2009). Unraveling a

multifactorial late-onset disease: from genetic susceptibility to disease mechanisms

for age-related macular degeneration. Annu Rev Genomics Hum Genet. 10: 19-43.

Taft, M. H., Behrmann, E., Munske-Weidemann, L. C., Thiel, C., Raunser, S. & Manstein,

D. J. (2013). Functional characterization of human myosin-18A and its interaction

with F-actin and GOLPH3. J Biol Chem. 288: 30029-30041.

Tamm, E. R. (2009). The trabecular meshwork outflow pathways: structural and functional

aspects. Exp Eye Res. 88: 648-655.

Tamm, E. R., Russell, P., Epstein, D. L., Johnson, D. H. & Piatigorsky, J. (1999).

Modulation of myocilin/TIGR expression in human trabecular meshwork. Invest


Tarongoy, P., Ho, C. L. & Walton, D. S. (2009). Angle-closure glaucoma: the role of the

lens in the pathogenesis, prevention, and treatment. Surv Ophthalmol. 54: 211-225.

Taylor, H. R. & Keeffe, J. E. (2001). World blindness: a 21st century perspective. Br J


Taylor, H. R., West, S., Munoz, B., Rosenthal, F. S., Bressler, S. B. & Bressler, N. M.

(1992). The long-term effects of visible light on the eye. Arch Ophthalmol. 110:

99-104.

Terman, A. & Brunk, U. T. (1998). Lipofuscin: mechanisms of formation and increase with

age. APMIS. 106: 265-276.

Tezel, G. (2009). The role of glia, mitochondria, and the immune system in glaucoma.


Tezel, G., Hernandez, R. & Wax, M. B. (2000). Immunostaining of heat shock proteins in

the retina and optic nerve head of normal and glaucomatous eyes. Arch Ophthalmol.

118: 511-518.

Tezel, G., Yang, J. & Wax, M. B. (2004). Heat shock proteins, immunity and glaucoma.

Brain Res Bull. 62: 473-480.

Thomas, J. L., Pan, D., Haixi, M. & Simon, L. (2011). Differential Effects of Elevated

Hydrostatic Pressure on Gene Expression and Protein Phosphorylation in Optic

Nerve Head Astrocytes. In “The mystery of glaucoma” Croatia, InTech.

179

Tielsch, J. M., Katz, J., Sommer, A., Quigley, H. A. & Javitt, J. C. (1994). Family history

and risk of primary open angle glaucoma. The Baltimore Eye Survey. Arch


Toda, N. & Nakanishi-Toda, M. (2007). Nitric oxide: ocular blood flow, glaucoma, and

diabetic retinopathy. Prog Retin Eye Res. 26: 205-238.

Tomany, S. C., Cruickshanks, K. J., Klein, R., Klein, B. E. & Knudtson, M. D. (2004a).

Sunlight and the 10-year incidence of age-related maculopathy: the Beaver Dam

Eye Study. Arch Ophthalmol. 122: 750-757.

Tomany, S. C., Wang, J. J., Van Leeuwen, R., Klein, R., Mitchell, P., Vingerling, J. R.,

Klein, B. E., Smith, W. & De Jong, P. T. (2004b). Risk factors for incident age-

related macular degeneration: pooled findings from 3 continents. Ophthalmology.

111: 1280-1287.

Tosaka, K., Mashima, Y., Funayama, T., Ohtake, Y. & Kimura, I. (2007). Association

between open-angle glaucoma and gene polymorphism for heat-shock protein 70-

1. Jpn J Ophthalmol. 51: 417-423.

Totan, Y., Cekic, O., Borazan, M., Uz, E., Sogut, S. & Akyol, O. (2001). Plasma

malondialdehyde and nitric oxide levels in age related macular degeneration. Br J

Ophthalmol. 85: 1426-1428.

Trifan, O. C., Traboulsi, E. I., Stoilova, D., Alozie, I., Nguyen, R., Raja, S. & Sarfarazi, M.

(1998). A third locus (GLC1D) for adult-onset primary open-angle glaucoma maps

to the 8q23 region. Am J Ophthalmol. 126: 17-28.

Tsai, F. J., Lin, H. J., Chen, W. C., Chen, H. Y. & Fan, S. S. (2003). Insulin-like growth

factor-II gene polymorphism is associated with primary open angle glaucoma. J

Clin Lab Anal. 17: 259-263.

Tsai, F. J., Lin, H. J., Chen, W. C., Tsai, C. H. & Tsai, S. W. (2004). A codon 31ser-arg

polymorphism of the WAF-1/CIP-1/p21/tumour suppressor gene in Chinese

primary open-angle glaucoma. Acta Ophthalmol Scand. 82: 76-80.

Tsai, Y. Y., Lin, J. M., Wan, L., Lin, H. J., Tsai, Y., Lee, C. C., Tsai, C. H., Tsai, F. J. &

Tseng, S. H. (2008). Interleukin gene polymorphisms in age-related macular

degeneration. Invest Ophthalmol Vis Sci. 49: 693-698.

Tunny, T. J., Richardson, K. A. & Clark, C. V. (1998). Association study of the 5' flanking

regions of endothelial-nitric oxide synthase and endothelin-1 genes in familial

primary open-angle glaucoma. Clin Exp Pharmacol Physiol. 25: 26-29.

180

Tunny, T. J., Richardson, K. A., Clark, C. V. & Gordon, R. D. (1996). The atrial natriuretic

peptide gene in patients with familial primary open-angle glaucoma. Biochem

Biophys Res Commun. 223: 221-225.

Tuo, J., Bojanowski, C. M. & Chan, C. C. (2004). Genetic factors of age-related macular

degeneration. Prog Retin Eye Res. 23: 229-249.

Tuo, J., Smith, B. C., Bojanowski, C. M., Meleth, A. D., Gery, I., Csaky, K. G., Chew, E.

Y. & Chan, C. C. (2004). The involvement of sequence variation and expression of

CX3CR1 in the pathogenesis of age-related macular degeneration. FASEB J. 18:

1297-1299.

U.S. Preventive Services Task Force. (2005). Screening for glaucoma: recommendation

statement. Ann Fam Med. 3: 171-172.

Van Der Valk, R., Webers, C. A., Schouten, J. S., Zeegers, M. P., Hendrikse, F. & Prins,

M. H. (2005). Intraocular pressure-lowering effects of all commonly used

glaucoma drugs: a meta-analysis of randomized clinical trials. Ophthalmology.

112: 1177-1185.

Varma, R., Lee, P. P., Goldberg, I. & Kotak, S. (2011). An assessment of the health and

economic burdens of glaucoma. Am J Ophthalmol. 152: 515-522.

Vasiliou, V. & Gonzalez, F. J. (2008). Role of CYP1B1 in glaucoma. Annu Rev Pharmacol

Toxicol. 48: 333-358.

Vassalli, P. (1992). The pathophysiology of tumor necrosis factors. Annu Rev Immunol.

10: 411-452.

Venkateswaran, A., Sekhar, K. R., Levic, D. S., Melville, D. B., Clark, T. A., Rybski, W.

M., Walsh, A. J., Skala, M. C., Crooks, P. A., Knapik, E. W. & Freeman, M. L.

(2014). The NADH oxidase ENOX1, a critical mediator of endothelial cell

radiosensitization, is crucial for vascular development. Cancer Res. 74: 38-43.

Villemain, F. M., Bach, J. F. & Chatenoud, L. M. (1990). Characterization of histamine

H1 binding sites on human T lymphocytes by means of 125I-iodobolpyramine.

Preferential expression of H1 receptors on CD8 T lymphocytes. J Immunol. 144:

1449-1454.

Vincent, A. L., Billingsley, G., Buys, Y., Levin, A. V., Priston, M., Trope, G., Williams-

Lyn, D. & Heon, E. (2002). Digenic inheritance of early-onset glaucoma: CYP1B1,

a potential modifier gene. Am J Hum Genet. 70: 448-460.

Viso, E., Rodriguez-Ares, M. T. & Gude, F. (2010). Prevalence of pseudoexfoliation

syndrome among adult Spanish in the Salnes eye Study. Ophthalmic Epidemiol. 17:

118-124.

181

Vithana, E. N., Khor, C. C., Qiao, C., Nongpiur, M. E., George, R., Chen, L. J., Do, T.,

Abu-Amero, K., Huang, C. K., Low, S., Tajudin, L. S., Perera, S. A., Cheng, C. Y.,

Xu, L., Jia, H., Ho, C. L., Sim, K. S., Wu, R. Y., Tham, C. C., Chew, P. T., Su, D.

H., Oen, F. T., Sarangapani, S., Soumittra, N., Osman, E. A., Wong, H. T., Tang,

G., Fan, S., Meng, H., Huong, D. T., Wang, H., Feng, B., Baskaran, M., Shantha,

B., Ramprasad, V. L., Kumaramanickavel, G., Iyengar, S. K., How, A. C., Lee, K.

Y., Sivakumaran, T. A., Yong, V. H., Ting, S. M., Li, Y., Wang, Y. X., Tay, W. T.,

Sim, X., Lavanya, R., Cornes, B. K., Zheng, Y. F., Wong, T. T., Loon, S. C., Yong,

V. K., Waseem, N., Yaakub, A., Chia, K. S., Allingham, R. R., Hauser, M. A., Lam,

D. S., Hibberd, M. L., Bhattacharya, S. S., Zhang, M., Teo, Y. Y., Tan, D. T., Jonas,

J. B., Tai, E. S., Saw, S. M., Hon Do, N., Al-Obeidan, S. A., Liu, J., Chau, T. N.,

Simmons, C. P., Bei, J. X., Zeng, Y. X., Foster, P. J., Vijaya, L., Wong, T. Y., Pang,

C. P., Wang, N. & Aung, T. (2012). Genome-wide association analyses identify

three new susceptibility loci for primary angle closure glaucoma. Nat Genet. 44:

1142-1146.

Vittitow, J. & Borras, T. (2002). Expression of optineurin, a glaucoma-linked gene, is

influenced by elevated intraocular pressure. Biochem Biophys Res Commun. 298:

67-74.

Vohra, R., Tsai, J. C. & Kolko, M. (2013). The role of inflammation in the pathogenesis of

glaucoma. Surv Ophthalmol. 58: 311-320.

Wand, M., Grant, W. M., Simmons, R. J. & Hutchinson, B. T. (1977). Plateau iris

syndrome. Trans Sect Ophthalmol Am Acad Ophthalmol Otolaryngol. 83: 122-130.

Wang, D. Y., Fan, B. J., Chua, J. K., Tam, P. O., Leung, C. K., Lam, D. S. & Pang, C. P.

(2006a). A genome-wide scan maps a novel juvenile-onset primary open-angle

glaucoma locus to 15q. Invest Ophthalmol Vis Sci. 47: 5315-5321.

Wang, I. J., Chiang, T. H., Shih, Y. F., Lu, S. C., Lin, L. L., Shieh, J. W., Wang, T. H.,

Samples, J. R. & Hung, P. T. (2006b). The association of single nucleotide

polymorphisms in the MMP-9 genes with susceptibility to acute primary angle

closure glaucoma in Taiwanese patients. Mol Vis. 12: 1223-1232.

Wang, L., Clark, M. E., Crossman, D. K., Kojima, K., Messinger, J. D., Mobley, J. A. &

Curcio, C. A. (2010). Abundant lipid and protein components of drusen. PLoS One.

5: e10329.

Wang, S. & Kaufman, R. J. (2012). The impact of the unfolded protein response on human

disease. J Cell Biol. 197: 857-867.

Waryah, A. M., Narsani, A. K., Sheikh, S. A., Shaikh, H. & Shahani, M. Y. (2013). The

novel heterozygous Thr377Arg MYOC mutation causes severe Juvenile Open

Angle Glaucoma in a large Pakistani family. Gene. 528: 356-359.

182

Wax, M. B., Tezel, G., Yang, J., Peng, G., Patil, R. V., Agarwal, N., Sappington, R. M. &

Calkins, D. J. (2008). Induced autoimmunity to heat shock proteins elicits

glaucomatous loss of retinal ganglion cell neurons via activated T-cell-derived fas-

ligand. J Neurosci. 28: 12085-12096.

Weber, B. H., Vogt, G., Pruett, R. C., Stohr, H. & Felbor, U. (1994). Mutations in the tissue

inhibitor of metalloproteinases-3 (TIMP3) in patients with Sorsby's fundus

dystrophy. Nat Genet. 8: 352-356.

Weeks, D. E., Conley, Y. P., Tsai, H. J., Mah, T. S., Schmidt, S., Postel, E. A., Agarwal,

A., Haines, J. L., Pericak-Vance, M. A., Rosenfeld, P. J., Paul, T. O., Eller, A. W.,

Morse, L. S., Dailey, J. P., Ferrell, R. E. & Gorin, M. B. (2004). Age-related

maculopathy: a genomewide scan with continued evidence of susceptibility loci

within the 1q31, 10q26, and 17q25 regions. Am J Hum Genet. 75: 174-189.

Wiggs, J. L. (2007). Genetic etiologies of glaucoma. Arch Ophthalmol. 125: 30-37.

Wiggs, J. L., Lynch, S., Ynagi, G., Maselli, M., Auguste, J., Del Bono, E. A., Olson, L. M.

& Haines, J. L. (2004). A genomewide scan identifies novel early-onset primary

open-angle glaucoma loci on 9q22 and 20p12. Am J Hum Genet. 74: 1314-1320.

Wilensky, J. T. (1999). The role of medical therapy in the rank order of glaucoma

treatment. Curr Opin Ophthalmol. 10: 109-111.

Wilkinson, C. H., Van Der Straaten, D., Craig, J. E., Coote, M. A., Mccartney, P. J.,

Stankovich, J., Stone, E. M. & Mackey, D. A. (2003). Tonography demonstrates

reduced facility of outflow of aqueous humor in myocilin mutation carriers. J

Glaucoma. 12: 237-242.

Wilson, A. G., Symons, J. A., Mcdowell, T. L., Mcdevitt, H. O. & Duff, G. W. (1997).

Effects of a polymorphism in the human tumor necrosis factor alpha promoter on

transcriptional activation. Proc Natl Acad Sci U S A. 94: 3195-3199.

Wilson, M. R., Hertzmark, E., Walker, A. M., Childs-Shaw, K. & Epstein, D. L. (1987). A

case-control study of risk factors in open angle glaucoma. Arch Ophthalmol. 105:

1066-1071.

Wirtz, M. K., Samples, J. R., Kramer, P. L., Rust, K., Topinka, J. R., Yount, J., Koler, R.

D. & Acott, T. S. (1997). Mapping a gene for adult-onset primary open-angle

glaucoma to chromosome 3q. Am J Hum Genet. 60: 296-304.

Wirtz, M. K., Samples, J. R., Rust, K., Lie, J., Nordling, L., Schilling, K., Acott, T. S. &

Kramer, P. L. (1999). GLC1F, a new primary open-angle glaucoma locus, maps to

7q35-q36. Arch Ophthalmol. 117: 237-241.

183

Wolf, C., Gramer, E., Muller-Myhsok, B., Pasutto, F., Reinthal, E., Wissinger, B. &

Weisschuh, N. (2009). Evaluation of nine candidate genes in patients with normal

tension glaucoma: a case control study. BMC Med Genet. 10: 91.

Wolfs, R. C., Klaver, C. C., Ramrattan, R. S., Van Duijn, C. M., Hofman, A. & De Jong,

P. T. (1998). Genetic risk of primary open-angle glaucoma. Population-based

familial aggregation study. Arch Ophthalmol. 116: 1640-1645.

Xu, C., Bailly-Maitre, B. & Reed, J. C. (2005). Endoplasmic reticulum stress: cell life and

death decisions. J Clin Invest. 115: 2656-2664.

Xu, Q., Bernardo, A., Walker, D., Kanegawa, T., Mahley, R. W. & Huang, Y. (2006).

Profile and regulation of apolipoprotein E (ApoE) expression in the CNS in mice

with targeting of green fluorescent protein gene to the ApoE locus. J Neurosci. 26:

4985-4994.

Yamada, Y., Ishibashi, K., Bhutto, I. A., Tian, J., Lutty, G. A. & Handa, J. T. (2006). The

expression of advanced glycation endproduct receptors in rpe cells associated with

basal deposits in human maculas. Exp Eye Res. 82: 840-848.

Yang, X., Hu, J., Zhang, J. & Guan, H. (2010). Polymorphisms in CFH, HTRA1 and

CX3CR1 confer risk to exudative age-related macular degeneration in Han

Chinese. Br J Ophthalmol. 94: 1211-1214.

Yates, J. R., Sepp, T., Matharu, B. K., Khan, J. C., Thurlby, D. A., Shahid, H., Clayton, D.

G., Hayward, C., Morgan, J., Wright, A. F., Armbrecht, A. M., Dhillon, B., Deary,

I. J., Redmond, E., Bird, A. C. & Moore, A. T. (2007). Complement C3 variant and

the risk of age-related macular degeneration. N Engl J Med. 357: 553-561.

Yildirim, O., Ates, N. A., Tamer, L., Muslu, N., Ercan, B., Atik, U. & Kanik, A. (2004).

Changes in antioxidant enzyme activity and malondialdehyde level in patients with

age-related macular degeneration. Ophthalmologica. 218: 202-206.

Yorio, T., Krishnamoorthy, R. & Prasanna, G. (2002). Endothelin: is it a contributor to

glaucoma pathophysiology? J Glaucoma. 11: 259-270.

Yoshioka, K., Yoshida, T., Takakura, Y., Umekawa, T., Kogure, A., Toda, H. &

Yoshikawa, T. (2006). Relationship between polymorphisms 804C/A and 252A/G

of lymphotoxin-alpha gene and -308G/A of tumor necrosis factor alpha gene and

diabetic retinopathy in Japanese patients with type 2 diabetes mellitus. Metabolism.

55: 1406-1410.

Yu, L., Croze, E., Yamaguchi, K. D., Tran, T., Reder, A. T., Litvak, V. & Volkert, M. R.

(2014). Induction of a Unique Isoform of the NCOA7 Oxidation Resistance Gene

by Interferon beta-1b. J Interferon Cytokine Res. DOI: 10.1089/jir.2014.0115

184

Yu, Y., Bhangale, T. R., Fagerness, J., Ripke, S., Thorleifsson, G., Tan, P. L., Souied, E.

H., Richardson, A. J., Merriam, J. E., Buitendijk, G. H., Reynolds, R.,

Raychaudhuri, S., Chin, K. A., Sobrin, L., Evangelou, E., Lee, P. H., Lee, A. Y.,

Leveziel, N., Zack, D. J., Campochiaro, B., Campochiaro, P., Smith, R. T., Barile,

G. R., Guymer, R. H., Hogg, R., Chakravarthy, U., Robman, L. D., Gustafsson, O.,

Sigurdsson, H., Ortmann, W., Behrens, T. W., Stefansson, K., Uitterlinden, A. G.,

Van Duijn, C. M., Vingerling, J. R., Klaver, C. C., Allikmets, R., Brantley, M. A.,

Jr., Baird, P. N., Katsanis, N., Thorsteinsdottir, U., Ioannidis, J. P., Daly, M. J.,

Graham, R. R. & Seddon, J. M. (2011). Common variants near FRK/COL10A1 and

VEGFA are associated with advanced age-related macular degeneration. Hum Mol

Genet. 20: 3699-3709.

Yucel, D., Yilmaz, M., Durukan, A. H. & Ozgul, R. K. (2012). Association of CFH Y402H

polymorphism with both forms of advanced age-related macular degeneration in

Turkish patients. Ophthalmic Genet. 33: 144-149.

Zareparsi, S., Branham, K. E., Li, M., Shah, S., Klein, R. J., Ott, J., Hoh, J., Abecasis, G.

R. & Swaroop, A. (2005). Strong association of the Y402H variant in complement

factor H at 1q32 with susceptibility to age-related macular degeneration. Am J Hum

Genet. 77: 149-153.

Zeng, R., Zhang, X., Wu, K., Su, Y. & Wen, F. (2014). MMP9 gene polymorphism is not

associated with polypoidal choroidal vasculopathy and neovascular age-related

macular degeneration in a Chinese Han population. Ophthalmic Genet. 35: 235-

240.

Zenkel, M., Kruse, F. E., Junemann, A. G., Naumann, G. O. & Schlotzer-Schrehardt, U.

(2006). Clusterin deficiency in eyes with pseudoexfoliation syndrome may be

implicated in the aggregation and deposition of pseudoexfoliative material. Invest


Zenkel, M., Poschl, E., Von Der Mark, K., Hofmann-Rummelt, C., Naumann, G. O., Kruse,

F. E. & Schlotzer-Schrehardt, U. (2005). Differential gene expression in

pseudoexfoliation syndrome. Invest Ophthalmol Vis Sci. 46: 3742-3752.

Zhang, K., Zhang, L. & Weinreb, R. N. (2012). Ophthalmic drug discovery: novel targets

and mechanisms for retinal diseases and glaucoma. Nat Rev Drug Discov. 11: 541-

559.

Zhang, M. X., Ou, H., Shen, Y. H., Wang, J., Coselli, J. & Wang, X. L. (2005). Regulation

of endothelial nitric oxide synthase by small RNA. Proc Natl Acad Sci U S A. 102:

16967-16972.

Zhang, M. X., Zhang, C., Shen, Y. H., Wang, J., Li, X. N., Zhang, Y., Coselli, J. & Wang,

X. L. (2008). Biogenesis of short intronic repeat 27-nucleotide small RNA from

endothelial nitric-oxide synthase gene. J Biol Chem. 283: 14685-14693.

185

Zhao, Y., Wang, S., Sorenson, C. M., Teixeira, L., Dubielzig, R. R., Peters, D. M., Conway,

S. J., Jefcoate, C. R. & Sheibani, N. (2013). Cyp1b1 mediates periostin regulation

of trabecular meshwork development by suppression of oxidative stress. Mol Cell

Biol. 33: 4225-4240.

Zheng, W., Reem, R. E., Omarova, S., Huang, S., Dipatre, P. L., Charvet, C. D., Curcio,

C. A. & Pikuleva, I. A. (2012). Spatial distribution of the pathways of cholesterol

homeostasis in human retina. PLoS One. 7: e37926.

Zhou, L., Cheng, E. L., Rege, P. & Yue, B. Y. (2000). Signal transduction mediated by

adhesion of human trabecular meshwork cells to extracellular matrix. Exp Eye Res.

70: 457-465.

Zhou, L., Li, Y. & Yue, B. Y. (1999). Oxidative stress affects cytoskeletal structure and

cell-matrix interactions in cells from an ocular tissue: the trabecular meshwork. J

Cell Physiol. 180: 182-189.

Zimmerman, T. J. & Kaufman, H. E. (1977). Timolol. A beta-adrenergic blocking agent

for the treatment of glaucoma. Arch Ophthalmol. 95: 601-604.

Annexures

187

Annexure 1 Product size and primer sequences used to amplify the exons and intron-exon

junctions of MYOC and OPTN

Gene Exon Primer sequence 5’ to 3’ Product size (bp)

MYOC 1_A F-CAGGCACCTCTCAGCACAG

406 R-AGCCCCTCCTGGGTCTC

MYOC 1_B F-ACCCAACGCTTAGACCTGG

432 R-TGTAGCAGGTCACTACGAGCC

MYOC 2 F-CAACATAGTCAATCCTTGGGC

255 R-AACACAGCACTAGACATGAATAAAGAC

MYOC 3_A F-GCATGATCATTGTCTGTGTTTG

521 R-GCTGTAAATGACCCAGAGGC

MYOC 3_B F-GAGAAGGAAATCCCTGGAGC

500 R-CCAGGAGCCCTGAGCATC

OPTN 4_A F-GGGGGACAGCTCTATTTTCA

224 R-CTGCTCACCTTTCAGCTGGT

OPTN 4_B F-AAACCTGGACACGTTTACCC

146 R-TAGTGCAAAGGGATGGCATT

OPTN 5_A F-TCCACTTTCCTGGTGTGTGA

218 R-TTTTCCAAGCTCTTCCTTCAA

OPTN 5_B F-CAGAAGGAAGAACGCCAGTT

160 R-CATCACAATGGATCGGTCTG

OPTN 6_A F-ATGGTGCCCAGCCTTAGTTT

201 R-CGCTGGAGTTCAGCTTGAG

OPTN 6_B

F-CCAGGTGGTGAGGCTACAAG 219

R-CAATCCTTGGCTTGTGTTGA

OPTN 7

F-TGGGTTGCATGTCACAAAAA 206

R-GACAGCCCGAGTCTTCCTTC

OPTN 8_A

F-TTGGAATTTTTCTGATGAAAACC 154

R-CTGATTCCCTTCCCTTAGGC

OPTN 8_B F-CAGATGGGGCCAAGAATTAC

214 R-CTTTAAATGGGTGAACTGTATGG

OPTN 9 F-CCCAATTGTAAACAATGTTCTTTTT

244 R-GTGTGTGGGTGTGGTAGTGG

Larger exons were split into two amplicons A & B. F; Forward, R; Reverse

188

Annexure 1 cont.

Gene Exon Primer sequence 5’ to 3’ Product

size (bp)

OPTN 10

F-TGGTTCAGCCTGTTTTCTCC 235

R-TCAAAGGAGGATAAAATTGCTCTC

OPTN 11

F-TTAAAAGCCACTGCGACGTA 239

R-GCTGCCCTTCTGACTCAACA

OPTN 12

F-ATTTTCCCCAGGATTCCATT 194

R-AACGTTCAACAGTTTCTGTTCATT

OPTN 13

F-ACTAAAACAGGCAGAATTATTTCAA 242

R-AGCTGGGGTTTTGGAAGGT

OPTN 14

F-CGCATAAACACTGTAAGAATCTGC 236

R-GATGTGAGCTCTGGGTCCTC

OPTN 15

F-TGTCATGTTTCGGGGTTGTA 213

R-TGAAGTGGAATTTTTCTTCAAGC

OPTN 16

F-CGCCATCTGTTCTTCAAGTG 232

R-ACCAACAGTTTTGGGGAGGT

F; Forward, R; Reverse

189

Annexure 2 Product size and primer sequences used to amplify exons and intron-exon

junctions of WRD36 and CYP1B1

Gene Exon Primer sequence 5’to 3’ Product size (bp)

CYP1B1 1_A F-GGAGTCCGGGTCAAAGC

577 R-AAAGTACCTACCACGCCACC

CYP1B1 1_B F-GTCACTGAGCTAGATAGCCT

844 R-GGACAGTTGATTTATGCTCACC

CYP1B1 2 F-AGACCACGCTCCTGCTACTC

168 R-GAGCGAACGAGAGGTGAGC

WDR36 1 F-CTAGGCAACGTGCTGGAGAC

463 R-GAGTTAGAGGCCAAGGAGGG

WDR36 2 F-GAGGTTATATCTTAATCTTCAGGTG

211 R-TTACCTTGGCTTCCTTATATGC

WDR36 3 F-CAAGGTGATTTCCTATCCTTAGTTTG

409 R-TAGTTCCAGAGTGTGCTGGG

WDR36 4 F-AACAGAAGCATCTCAGGATTAGC

321 R-TTTACAGGCAAAATCTCTGGC

WDR36 5 F-AAATTACATTTACAAGTTGCCTCTC

475 R-CCTCTGATACAGGGGACCAAC

WDR36 6 F-TGTAGCTGATATTGTTTTCCTCC

185 R-TCCTGAAACTGAAGGATTTTCC

WDR36 7 F-TTTGATAACACCTAATAATGATGCG

350 R-TTGCCTTTTACTCCAGTATTCATTC

WDR36 8 F-TGAATACTGGAGTAAAAGGCAAAG

492 R-TGCAATCATGTCACCTGCTG

WDR36 9 F-GCTTGCAGATCAGATGGAAC

247 R-CAAACCTCATACTGGGCACC

WDR36 10 F-TTCCCTTTAAAGTGTCCCAAAC

274 R-TTGATGAAACTTCCTCCAGTTG

WDR36 11 F-TTTCTGACTTAAATGGGAATATCTTG

278 R-AAAACAGCATACAGTAGGAAATAAATG

WDR36 12 F-AGTGTCTGAAATATTGGATGCC

375 R-TTTGTGGCTTTGGGTTATGC

WDR36 13 F-GCTTTGGAAAGCATAAAGTGC

306 R-TGATTATAACCCATCTTCAACTTTAG

Exon 1 was split into two amplicons A & B, F; Forward, R; Reverse

190

Annexure 2 cont.

Gene Exon Primer sequence 5’to 3’ Product size (bp)

WDR36 14-15

F-TGTGTATTGTTCAGAGAGAAACACTG 620

R-GGATAACACACCCAAACAAAAG

WDR36 16

F-TGAAGCCTGCATTATCTTTTC 318

R-AAAGCATATAACCCATTAACTATCGG

WDR36 17

F-GACTTTCTGATCAATGCTGGTG 437

R-GCTGTCTACATTATCAAGCAGATG

WDR36 18

F-GCATATTCGCACTCTGACTTACTC 551

R-TGCACTAAACTTTGCCTTTGG

WDR36 19

F-CATTGAAGAAGGTGTTTTGGG 577

R-CATCCAAATGTCTGCTGAGTG

WDR36 20-21

F-GAAATTAAATATGAGAAACTGTTGGC 541

R-TGAGAACGCTGATATTTCCTTC

WDR36 22

F-TCAATTATTTTGGGTTTCATTCTAC 413

R-AGATAGCACTGCCCCAGAAG

WDR36 23

F-TGTCTTTTGTGGTTCCTTGG 326

R-TCACATTGACACTTGGAAAATAAG

F; Forward, R; Reverse

191

Annexure 3 Standard PCR reagent concentrations

Reagent Stock

Concentration

Working

concentration

Reaction

volume (25µl)

Annealing

temperature

dNTPs 25mM 0.2mM 0.2µl

58 oC

Buffer 10X 1X 2.5µl

MgCl2 25mM 1.5mM 1.5µl

Forward Primer 10µM 0.2µM 0.5µl

Reverse primer 10µM 0.2µM 0.5µl

Taq polymerase 5U/µl 1U 0.2µl

gDNA - 100ng/µl 2µl

PCR water - - 17.6µl

192

Annexure 4 Product size and primer sequence and PCR products for candidate genes in the

homozygous regions of GLC 2, GLC 4 and GLC 8

Gene Exon Primer Sequence Product size

(bp)

TMEM74 1 F-CTGGCCTACAACTCCCG

R-ATTCGAGGTACGGATGTGTC 340

2_A F-AGGAGCAACACTCCTGGAAG

R-TCCCCAGGGTGATTATGC 523

2_B F-TGCAGCCAGGAATTAGAAAC

R-AGTTTTGCAGACTCTTTGGAAG 515

2_C F-GGCGTCATCCTGTCCTG

R-AAGAAATAATTTGTAGACTGGGTC 501

2_D F-CAGCCACACCTATCCTTCTG

R-TGACCCTGGCTAATATCTGG 507

2_E F-ATGTTGGGCTTTCCTTATTG

R-TGTGAGTGGGAGGTGAGTTC 616

PXDN 1 F-CCCTCGGGGATTCAGAG

R-TTCGGAGGTTCCCTTCTG 518

2 F-GCAAATGTGTAGCGATGTTTG

R-TGAGTTCTACCTACAGATAAACAATG 212

3 F-AATGTGACCTTTTCCAAGGC

R-CAATAATTCATAAGCAGCACG 260

4 F-TTTCCGTCTGAAGTTTGACC

R-ACTCCACTGGTCCCTACAAG 210

5 & 6 F-TGATATCTGAATTTGAAATGACTAGG

R-GAATCAGATTGTTATCAACATTTCAC 709

7_A F-CTGATGGATGGATGGACAAG

R-TGATGGTTGCCACTGAGC 213

7_B F-CTCAAACACACTTCACTGCG

R-GTCTGTGTCTGCATGTGTGTC 664

8 F-CATCTGTGGTTTCCTTTTGG

R-TGTGGTTTGGGTGTCTGAG 290

9 F-GGGTGAGGTACGTCTTTGTG

R-AGGCAGATAGTGAGGGACG 291

10 F-AAACCATGTCAAACCGGG

R-GCTAGTGGAGGGGTGAGG 388

Larger exons were split into two or more amplicons A, B, C, D & E, F; Forward, R; Reverse

193

Annexure 4 Cont.

Gene Exon Primer Sequence Product size

(bp)

11 F-AGACGTCTGCCAAGACTGTG

R-GTGGAAATGTGTGCTTCCTG 399

12 F-CAGGAGTTCTCCATGCG

R- CAACGCTTTATAACGAAGAGTAAC 319

13 F- GCAGGGGATTTTGTTCTTC

R- CAGCCCGTCTACCTTGTATC 244

14 F- CCCAACCCTAGGTCAGATAAC

R- ACACTAGGGACCTGCGG 297

15 F- ATGCCTTGTGGCTAATGATG

R- TAATCACTCCCACCTTCACC 271

16 F- AGCAATGATTATATTTTGGGG

R- GTTCAACCCCGTTACTCAG 298

17_A F- CCCTCACACATCCTCCAG

R- CTGTCCGTCGGAGAAGC 486

17_B F-GAGAATGGCTTCAACACCC

R-CATAGTAGATGGTGTCGCCG 736

17_C F-TCAACCAGCTCACCTCCTAC

R-TTGCAGTAGACCCTGTAGTCG 826

17_D F-CGGCGACACCATCTACTATG

R-AGGTTCCCATCTTGACCTTC 735

18 F-AGCATTGTGGAGAGATGCAG

R-AGAAGATACCAGGGCCTCAG 465

19 F-GTGACCTGTGAGTCTCCTGC

R-AGCAGTCACCAAAACCAGG 322

20 F-CTTAATTTCCCCGAGGTCAG

R-AGGATGCCGGTCCTACTG 260

21 F-CCAGGAAACCTTGAAATGAG

R-AGGGCTGTGCTGCTGTG 268

22 F-GCCAAGCTGTTACTCTGAAG

R-GGACTCTCGGACTTGCG 225

23 F-GAGCTGACAGGCTTTGCTC

R-ACCCGATCTCACGATGG 243

Exons 17 was split into 4 amplicons A, B, C & D. F; Forward, R; Reverse

194

Annexure 5 Product size and primer sequences for the gene SH3PXD2B

Exon Primer sequence Product

size (bp)

1 F-AGCTCCAGGTTCCCTGC

R-GGAGGCAGAAGTTTTCCAAG 262

2 F-AACCCACGTCTTTCTGACTCT

R-TGGACTCTAAAGCTGTAGTGGAA 266

3 F-AAATGTCCTAGATGATGTTTAGTGC

R-AGGGCTCTGGGAACTGTAAC 206

4 F-CTGAGAGCTTGTCCCTGTTC

R-TTTTATTGTTGAGCATCTTGTAGC 221

5 F-TGGGTTTGCTTTTGTGTTTG

R-GCTAAGTGAAGTGCGGTCTC 452

6 F-TCACGTCAATACATGGCAAG

R-CCTGGTGCACAGTTGGTG 164

7 F-GCTCTGACTCCTGCTCTTTC

R-TTCCAAATGTTTCATGTCCC 270

8 F-ATTCACTGGTACAGTGGCTG

R-AGGCCAAAAGAAGAGATTGG 295

9 F-GGATTACGGCATCCCAAG

R-GTCCCTGTGACCCCAAAC 255

10 F-GTGATTCCCAGTAGGAGCAA

R-TCTGGGCCTCTGTTTTCTTA 445

11 F-ATAGACCCGACCTGGCAC

R-CTAGTGGACACCCCTCACAG 189

12 F-ACAGGGTCGCAGGAGTG

R-GACAGGGGAGAAGTAGGAGG 257

13_A

F-CAAACCATTCCATCTGCTG

R-ATCGGCAAAATCACGCC 564

13_B

F-TCAGCAGGCTACGAGGAG

R-GGCAGGCCTGAGCTTAC 507

13_C

F-GAGAAGCCAGATGCCACTC

R-TGGAGAGAAAAGGTTTGGC 556

13_D

F-AAACCTCTTCGTCATCCAGG

R-AATACGTGGGTAAAGCCAGC 494

Exon 13 was split into 4 amplicons A, B, C & D. F; Forward, R; Reverse

195

Annexure 6 Homozygous regions obtained in the affected members of family GLC 2, GLC

4 and GLC 8

Family GLC 2

Chromosome Flanking SNP Boundaries (Mbs) Size (Mbs)

Chr. 3 rs2372548-rs12715538 43,801,895-58,931,816 15.1

Chr. 7 rs2354332-rs4727933 138,534,971-147,937,132 9.4

Chr. 15 rs1104848-rs12914158 56,112,714-58,070,608 1.9

Chr. 15 rs2970374-rs1816625 60,108,779-61,437,557 1.3

Chr. 15 rs2044029-rs9920103 71,679,959-78,435,527 6.7

Family GLC 4

Chr. 1 rs7512461-rs16861320 102408762-168665346 66.25

Chr. 2 rs4954099-rs6758983 134757957-175192260 40.43

Chr.10 rs4980024-rs10886726 80839269-122386632 41.54

Family GLC 8

Chr. 3 rs17746160-rs2710779 148,533,397-192,100,439 43.56

Chr. 4 rs1315962-rs6535574 111,033,550-148,928,801 37.89

Chr. 6 rs6927090-rs6456313 25,214,5-20,251,699 19.99

Chr.11 rs11602762-rs7121949 116,129,53-312,881,60 19.67

SNP, single nucleotide polymorphism; Mbs, mega bases

196

Annexure 7 Unsolved glaucoma Families A; JOAG family GLC4, B; Late glaucoma onset family GLC6, C; Late glaucoma onset

family GLC7, D; Late glaucoma onset family GLC 9, E; A PACG family GLC10 and F; Late glaucoma onset family GLC11.

197

Annexure 7 Continued. G; Late onset POAG family GLC12, H; A PACG GLC13, I; A PACG family GLC14, J; A JOAG family

GLC15, K; Recessive PCG Family GLC1

Published and Submitted Data

199

1. Association of a polymorphism in the BIRC6 gene with Pseudoexfoliative

Glaucoma. Ayub H., Micheal S., Akhtar F., Khan M.I., Bashir S., Waheed

N.K., Ali M., E-Koller F., Shafique S., Qamar R and Hollander AI. PLoS One.

2014;13;9(8):e105023.

2. Association of known common genetic variants with primary open angle,

primary angle closure, and pseudoexfoliation glaucoma in Pakistani cohorts.

Micheal S., Ayub H., Khan M.I., Bakker B., E-Koller F., Ali M., Akhtar F.,

Khan W., Qamar R and Hollander AI. Mol Vis 2014 20: 1471-1479.

3. Identification of novel CYP1B1 gene mutations in patients with primary

congenital and primary open angle glaucoma. Micheal S., Ayub H., Zafar SN.,

Bakker B., Ali M., Akhtar F., Islam F., Khan MI., Qamar R and Hollander A.I.

Clin Experiment Ophthalmol. doi: 10.1111/ceo.12369.

4. Genetic spectrum of autosomal recessive non-syndromic hearing loss in

Pakistani families. Shafique S., Siddiqi S., Schraders M., Oostrik J., Ayub H.,

Bilal A., Ajmal M., Seco C.Z., Strom T.M., Mansoor A., Mazhar K., Shah S.T.,

Hussain A., Azam M., Kremer H and Qamar R. PLoS One. 2014;

20;9(6):e100146.

5. Exome sequencing identifies three novel candidate genes implicated in

intellectual disability. Agha Z., Iqbal Z., Azam M., Ayub H., Vissers E.L.M.,

Gilissen C., Ali S.H.B., Riaz M., Veltman J.A., Pfundt R., van Bokhoven H and

Qamar R. DOI: 10.1371/journal.pone.0112687.

6. A genetic variant in TMCO1 is strongly associated with primary open angle,

primary angle closure and pseudoexfolation glaucoma. Micheal S., Ayub H.,

Islam F., Khan W.A., Akhtar F., Khan M.I., Qamar R and Hollander I.A. Invest

Ophthalmol Vis Sci 2013;54: E-Abstract 6233.

7. Exome sequencing identifies a novel and a recurrent BBS1 mutation in

Pakistani families with Bardet-Biedl syndrome. Ajmal M., Khan M.I., Neveling

200

K., Tayyab A., Jaffar S., Sadeque A., Ayub H., Abbasi N.M., Riaz M., Micheal

S., Gilissen C., Ali S.H., Azam M., Collin RW., Cremers F.P and Qamar R. Mol

Vis. 2013;19:644-53.

8. The genetic spectrum of familial hypercholesterolemia in Pakistan. Ahmed W.,

Whittall R., Riaz M., Ajmal M., Sadeque A., Ayub H., Qamar R and Humphries

SE. Clin Chim Acta. 2013 Jun 5;421:219-25. doi: 10.1016/j.cca.2013.03.017.

9. Association of eNOS and HSP70 gene polymorphisms with glaucoma in

Pakistani cohorts. Ayub H., Khan M.I., Micheal S., Akhtar F., Ajmal M.,

Shafique S., Ali S.H.B., Hollander A.I, Ahmed A and Qamar R. Mol. Vis. 2010;

16:18-25.

10. Association studies of tumor necrosis factor-alpha -308G/A polymorphism with

primary open-angle and angle closure glaucoma in Pakistani patients Asghar

J., Micheal S., Akhtar F., Ayub H., Khan M.I., Waheed N.K., Khurram R., Ali

M., Ali S.H.B., Hollander A.I and Qamar R. (Submitted).

11. Screening of myocilin and optineurin genes in a cohort of Pakistani glaucoma

families and sporadic cases. Ayub H., Micheal S., Akhtar F., Ali M., Waheed

N.K., Ali S.H.B., Bashir S., Riaz M., Shafique S., Qazi N.A., Hashmi S., Khan

M.I., E-Koller F., Hollander A.I and Qamar R. (Submitted).

12. Homozygosity mapping and targeted Sanger sequencing reveal genetic defects

underlying inherited retinal disease in families from Pakistan. Maria M., Ajmal

M., Azam M., Waheed NK., Siddiqui SN., Mustafa B., Ayub H., Ali L., Ahmad

S., Micheal S., Hussain A., Shah S.T.A., Ali S.H.B., Ahmed W., Khan Y.M.,

Hollander A.I., Haer-Wigman L., Collin R.W.J., Khan M.I, Qamar R and

Cremers F. (Submitted).

13. Variants in the ASB10 gene are associated with primary open angle glaucoma.

Micheal S., Ayub H., Islam F., Khan W.A., Akhtar F., Khan M.I., Qamar R and

Hollander I.A. (Submitted).

201

14. Case control association study relates the Apoptotic and Stress related gene

polymorphisms with glaucoma in Pakistani population. Ayub H., Shafique S.,

Micheal S., Akhtar F., Khan M. I., Ali M., Ali L., Ali S. H. B., Riaz M., Ahmad

S., Hollander A.I and Qamar R. (In preparation).

15. Association of a polymorphism in the HTRA1/ARMS2 with Age Related

Macular Degeneration in Pakistani population. Ayub H., Shafique S., Azam A.,

Qazi N.A., Akhtar F., Khan M.A., Ayub A., Bashir S., Bakker B., E-Koller F.,

Shakil A., Qamar R and Hollander, A.I. (In preparation)

16. Association of a polymorphism in the MMPs with Age Related Macular

Degeneration in Pakistani population. Ayub H., Shafique S., Azam A., Qazi N.

A., Akhtar F., Khan M.A., Ayub A., Bashir S., Ali L., Qamar R and Hollander,

A.I. (In preparation)

17. Association of a polymorphism in the CX3CR1 with Wet AMD in Pakistani

population. Ayub H., Shafique S., Azam A., Qazi N. A., Akhtar F., Khan M.A.,

Ayub A., Bashir S., Qamar R and Hollander, A.I. (In preparation)

welcome to pakistan research repository:...

Documents