word exercise - dvusd.org many words that end in “tion” mean a process or ......
TRANSCRIPT
Word exercise
• Invention Creation
• Vacation Assimilation
• Application Conjugation
Words mean something!
• Many words that end in “tion” mean a process or action
• Name a history word that ends in tion. Does it involve a process/action?
• Name an English word that ends in “tion”. Does it involve action?
• You are going to learn a lot of words in Biology that end in “tion”. Suffixes and prefixes can help you determine meaning. So remember “tion” makes a noun or a process out of an action verb!
Central Dogma
Central Dogma
Protein synthesis occurs in new cells like skin cells
during the G1(gap1) or growth phase of cell cycle
http://www.cellsalive.com/cell_cycle.htm
Making protein is an important function performed by
cells
For example, skin cells produce the protein keratin that hardens and forms a protective layer. Melanocyte cells form a protein-based pigment called melanin that protects us from UV damage. Protein enzymes are needed during DNA synthesis and G2-polymerase and helicase
Protein Synthesis (making
proteins)
Involves 2 processes and several steps (image from London Health Sciences)
A. Transcription-The first
process. The literal
definition of
transcription is an
action meaning “to
transcribe”, copy, or
convert something!
A. Transcription • Happens in the
nucleus
• RNA polymerase, an
enzyme, unzips the
DNA. The DNA
strand code is
copied by mRNA,
then DNA zips back
up.
Click on the picture to see a video.
B. Translation-the 2nd Process in Protein Synthesis-
In the cytoplasm of the cell!
“tion” practice:
• Based on your experience/knowledge so far. What does translation mean?
• The process of translating a message. In the cell, the mRNA and ribosomes “translate” the DNA code or message to proteins!
Review:Protein structure-
The sequence or order of amino acids in a protein and hence protein function are determined by the genetic code and assembled by rRNA (ribosomes). -primary structure=order of amino acids -secondary structure is the shape of the polypeptide-alpha helix or beta sheet -tertiary contains both helix’s and beta sheets -quaternary is more than one polypeptide chain
http://www.youtube.com/watch?v=Q7dxi4ob2O4&feature=related
Ribosomes translate message into proteins • mRNA decodes/copies the
DNA nucleotides(e.g. AGT) into a matching codon sequence (e.g. UCA)that codes for specific amino acids like Serine.
• The sequence is taken to the ribosomes (rRNA) to build the proteins.
• The ribosomes read the codons to tRNA who can then get the proper amino acid to put into the polypeptide chain/protein.
Click on the picture to see a video.
Some of the proteins made by cell’s ribosomes during protein synthesis
include enzymes like polymerase!
Describe to
your partner
what is
happening
in this
picture.
Label the
correct
process for
each side of
the picture:
Protein Synthesis (making
proteins)SUMMARY
Involves 2 processes and several steps (image from London Health Sciences)
How to read Genetic code
• Codon – a group of 3 nucleotides in mRNA
that specify an amino acid.
• There are 20 amino acids found in different
combinations in proteins.
• Like a genetic message/sentence that needs
punctuation: AUGUAGUACCUCAGA-RNA is
broken into codon “words”
AUG-UAG-UAC-CUC-AGA
Codon sequence • Has start and stop codons – these do not
code for an amino acid only to tell when to
start and stop translation.
• Start = AUG = methionine (like “The”)
• Stop = UAA, UGA, UAG (like a period)
• mRNA codons are paired up with their opposite codon or
anti-codon on the tRNA. Ribosomes (rRNA) match the
correct tRNA and amino acid to each mRNA codon.
mRNA = codons = AUG GGA GUU UAA
tRNA = anticodons = UAC CCU CAA AUU
The above sequences reads as: “Start” Glycine (amino acid)
Valine (amino acid) “Stop”.
TACGGCCACGTTATAGGATAAATT
Below is a DNA sequence, Use the book page 244 to help
you and your partner come up with:
1) The complementary mRNA codons
2) The amino acids coded for
The first team to get a right answer is the winner!
MRNA=AUG-CCG-GUG-CAA-UAU-CCU-AUU-UAA
met-pro-val-glu-try-pro-ile-stop
Group Poster Without using any resources, can your group work together to remember at least 3 parts of protein synthesis from yesterday (illustrate and label)-They don’t have to be in order yet Then answer the following on your poster: • What is the first part/process of protein synthesis called? • Protein synthesis always starts in what part of the cell with what
type of nucleic acid molecule (s)? • What is the mRNA codon for the following DNA bases: TAG • What is the second process of protein synthesis—what are the RNA
molecules (at least 2) involved and where does it take place? • What is involved in the last step of “makin’ protein? List the
molecules involved (there are 3 RNA molecules and 1 type of organic molecule)