write an essay on the topic below. the causes of...

Q1.S Write an essay on the topic below.

The causes of variation and its biological importance

In the answer to this question you should bring together relevant principles and concepts from as many different modules as possible. Your essay will be marked not only for its scientific accuracy, but also for the selection of relevant material. The essay should be written in continuous prose.

The maximum number of marks that can be awarded is:

Scientific content 16 Breadth of knowledge 3 Relevance 3 Quality of Written Communication

(Total 25 marks)

Q2.S Write an essay on the topic below.

How the structure of proteins is related to their functions

In the answer to this question you should bring together relevant principles and concepts from as many different modules as possible. Your essay will be marked not only for its scientific accuracy, but also for the selection of relevant material. The essay should be written in continuous prose.



(Total 25 marks)

3

3

of 108

Q3. S The diagram shows apparatus used to measure the oxygen uptake of snails that live on the seashore. The apparatus was kept at a constant temperature.

(a) (i) Explain the purpose of the strip of filter paper in the potassium hydroxide solution.

.............................................................................................................

............................................................................................................. (1)

(ii) The level of liquid in the right-hand side of the manometer went down during the experiment. Explain why.

.............................................................................................................

.............................................................................................................

.............................................................................................................

............................................................................................................. (2)

(iii) What measurements are needed to calculate the rate of oxygen uptake by the snails in mm3 g–1 h–1?

.............................................................................................................

.............................................................................................................

............................................................................................................. (3)

of 108

(b) Two experiments were carried out using the apparatus shown in the diagram.

1 The oxygen uptake of batches of 10 seashore snails kept in moist air was measured at temperatures between 5 °C and 35 °C.

2 Experiment 1 was repeated but with batches of 10 seashore snails covered by aerated seawater.

The experiments were repeated several times and means and standard deviations calculated. The results are shown in the table. The values given are means plus or minus one standard deviation.

Temperature / °C Oxygen uptake of

snails kept in moist

air / mm3 g–1 h–1

Oxygen uptake of snails kept in

seawater / mm3 g–1 h–1

5 35 ± 2 28 ± 8

10 34 ± 6 32 ± 3

15 36 ± 3 35 ± 3

20 86 ± 8 52 ± 10

25 141 ± 13 96 ± 15

30 132 ± 14 108 ± 9

35 120 ± 16 79 ± 21

(i) Describe one similarity and one difference between the pattern of mean oxygen uptake of the snails kept in moist air and those covered by seawater.

.............................................................................................................

.............................................................................................................

.............................................................................................................

............................................................................................................. (2)

(ii) Explain why valid conclusions cannot be drawn about the trends in oxygen uptake at temperatures of 25 °C and above.

.............................................................................................................

.............................................................................................................

.............................................................................................................

............................................................................................................. (2)

(Total 10 marks)

of 108

Q4. (a) Give one function of LH in females.

......................................................................................................................

...................................................................................................................... (1)

In males, FSH stimulates sperm production and LH causes the release of testosterone. A hormone stimulates the release of FSH and LH by attaching to receptor molecules in the surface membrane of cells in the pituitary gland. The diagram shows one receptor molecule for this hormone.

Reproduced with permission from New Scientist magazine © RBI Ltd

S (b) (i) Give two pieces of evidence from the diagram which suggest that the receptor molecule is a protein.

.............................................................................................................

.............................................................................................................

.............................................................................................................

............................................................................................................. (2)

of 108

(ii) Explain how the tertiary structure of this protein is important for its function as a receptor molecule.

.............................................................................................................

.............................................................................................................

.............................................................................................................

............................................................................................................. (2)

(c) Research has identified a substance which could be used as a male contraceptive pill. This substance binds to the receptor molecules in the pituitary gland and stops the release of FSH, but allows the release of LH to continue.

(i) Explain one advantage of the substance not inhibiting LH release.

.............................................................................................................

.............................................................................................................

.............................................................................................................

............................................................................................................. (2)

S (ii) This substance is not a protein. Explain why a protein could not be used as an oral contraceptive.

.............................................................................................................

.............................................................................................................

.............................................................................................................

............................................................................................................. (2)

(Total 9 marks)

of 108

Q5. Emperor penguins are birds which live in the Antarctic. They cannot fly, but they are very good swimmers and feed on fish from the oceans around the Antarctic continent. To breed they have to leave the sea and move on to the ice. The drawing shows a male emperor penguin.

(a) Like mammals, birds maintain a constant body temperature. The emperor penguin maintains a core body temperature of about 38 °C. On the Antarctic ice the air temperature is often as low as –40 °C.

(i) Use the drawing to suggest how its shape helps the penguin to maintain its core body temperature in such low air temperatures.

.............................................................................................................

.............................................................................................................

.............................................................................................................

............................................................................................................. (2)

S (ii) At rest a penguin maintains a constant metabolic rate as the air temperature falls to –10 °C. Below this temperature its metabolic rate increases. Explain why the metabolic rate can stay constant down to –10 °C, but rises when the temperature falls below this.

.............................................................................................................

.............................................................................................................

.............................................................................................................

............................................................................................................. (2)

of 108

(b) At the start of winter emperor penguins walk about 100 km from the sea to the permanent ice shelf. Here each female lays a single egg which the male incubates in a pouch above his feet. The females return to the sea, but the males stay at the breeding site and do not feed. Large groups, often more than a thousand birds, huddle close together. They regularly change position within the huddle. When the chicks have developed, after 100 days, their fathers walk the 100 km back to the sea so that they can feed again.

When they leave the sea at the start of winter, the males weigh 35 kg and may have up to 20 kg of stored fat. Walking uses 7.5 g of fat per km. Research has shown that at the average temperatures on the ice a penguin standing on its own loses 200 g of its stored fat per day. However, when in a huddle only 100 g per day is lost.

(i) Explain how huddling close together helps to reduce the loss in mass from 200 g to 100 g per day.

.............................................................................................................

.............................................................................................................

.............................................................................................................

............................................................................................................. (2)

(ii) Use the information above to explain why the huddling behaviour is essential to the survival of the male penguins. You should include relevant calculations in your answer.

.............................................................................................................

.............................................................................................................

.............................................................................................................

.............................................................................................................

.............................................................................................................

............................................................................................................. (3)

(Total 9 marks)

of 108

Q6. IAA is an auxin which stimulates plant growth. It binds to proteins in cell walls. This changes the arrangement of the cellulose molecules, so the walls are more easily stretched. IAA also lowers the pH around the cells.

2,4-D is a systemic herbicide which has the same effect on cell walls as IAA, but it is less easily broken down in plants.

S (a) The diagram shows the molecular structures of IAA and 2,4-D.

Use evidence from the diagram to suggest

(i) why IAA lowers pH;

.............................................................................................................

............................................................................................................. (1)

(ii) why IAA and 2,4-D have similar effects on cell walls.

.............................................................................................................

............................................................................................................. (1)

(b) When 2,4-D is applied to weeds their growth is very rapid but very distorted. After a short time they die. Suggest one explanation for the rapid and distorted growth of weeds when 2,4-D is applied.

......................................................................................................................

......................................................................................................................

......................................................................................................................

...................................................................................................................... (2)

(Total 4 marks)

of 108

Q7. The graph shows the cumulative mass of carbon removed from the atmosphere by a pine forest in the 20 years after planting.

(a) Explain how the growth of the forest results in a decrease in the carbon content of the atmosphere.

......................................................................................................................

......................................................................................................................

......................................................................................................................

...................................................................................................................... (2)

(b) A new power station is to be built which will emit a total of 3800 tonnes of carbon over 20 years. In order to balance the carbon emissions a pine forest will be planted to remove an equivalent amount over 20 years. Use the graph to work out the smallest area of forest that would be needed. Show your working.

Area .................................................... hectares (2)

of 108

S (c) Explain how carbon-containing compounds present in the pine leaves that fall from the trees are absorbed and used for growth by fungi that live in the soil.

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

...................................................................................................................... (4)

S (d) Give one reason to explain why the rate of recycling of carbon would be greater in summer than in winter.

......................................................................................................................

...................................................................................................................... (1)

(Total 9 marks)

Q8. This question should be written in continuous prose, where appropriate.

(a) Explain how a resting potential is maintained in a neurone.

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

...................................................................................................................... (4)

of 108

(b) In an investigation, an impulse was generated in a neurone using electrodes. During transmission along the neurone, an action potential was recorded at one point on the neurone. When the impulse reached the neuromuscular junction, it stimulated a muscle cell to contract. The force generated by the contraction was measured. The results are shown in the graph.

The distance between the point on the neurone where the action potential was measured and the neuromuscular junction was exactly 18 mm.

(i) Use the graph to estimate the time between the maximum depolarisation and the start of contraction by the muscle cell.

Time ................................ ms (1)

(ii) Use your answer to part (i) to calculate the speed of transmission along this neurone to the muscle cell. Give your answer in mm per second.

Show your working.

Speed .................................. mm s–1

(2)

(iii) Give one reason why the value calculated in part (ii) would be an underestimate of the speed of transmission of an impulse along a neurone.

.............................................................................................................

............................................................................................................. (1)

of 108

Acetylcholine is the neurotransmitter at neuromuscular junctions.

(c) Describe how the release of acetylcholine into a neuromuscular junction causes the cell membrane of a muscle fibre to depolarise.

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

...................................................................................................................... (3)

(d) Use your knowledge of the processes occurring at a neuromuscular junction to explain each of the following.

(i) The cobra is a very poisonous snake. The molecular structure of cobra toxin is similar to the molecular structure of acetylcholine. The toxin permanently prevents muscle contraction.

.............................................................................................................

.............................................................................................................

.............................................................................................................

............................................................................................................. (2)

(ii) The insecticide DFP combines with the active site of the enzyme acetylcholinesterase. The muscles stay contracted until the insecticide is lost from the neuromuscular junction.

.............................................................................................................

.............................................................................................................

.............................................................................................................

............................................................................................................. (2)

(Total 15 marks)

of 108

Q9. (a) Describe how insulin reduces the concentration of glucose in the blood.

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

...................................................................................................................... (3)

Some people produce no insulin. As a result they have a condition called diabetes. In an investigation, a man with diabetes drank a glucose solution. The concentration of glucose in his blood was measured at regular intervals. The results are shown in the graph.

(b) Suggest two reasons why the concentration of glucose decreased after 1 hour even though this man’s blood contained no insulin.

1 ...................................................................................................................

......................................................................................................................

2 ...................................................................................................................

...................................................................................................................... (2)

(c) The investigation was repeated on a man who did not have diabetes. The concentration of

glucose in his blood before drinking the glucose solution was 80 mg per 100 cm3. Sketch a curve on the graph to show the results you would expect.

(1)

of 108

(d) The diabetic man adopted a daily routine to stabilise his blood glucose concentration within narrow limits. He ate three meals a day: breakfast, a midday meal and an evening meal. He injected insulin once before breakfast and once before the evening meal.

The injection he used before breakfast was a mixture of two types of insulin. The mixture contained slow-acting insulin and fast-acting insulin.

(i) Explain the advantage of injecting both types of insulin before breakfast.

.............................................................................................................

.............................................................................................................

.............................................................................................................

............................................................................................................. (2)

(ii) One day, the man did not eat a midday meal. Suggest one reason why his blood glucose concentration did not fall dangerously low even though he had injected himself with the mixture of insulin before breakfast.

.............................................................................................................

.............................................................................................................

............................................................................................................. (1)

(Total 9 marks)

of 108

Q10. Figure 1 shows a diagram of part of a muscle myofibril.

Figure 1

(a) Name the protein present in the filaments labelled W and X.

W ..................................................................................................................

X ................................................................................................................... (1)

(b) Figure 2 shows the cut ends of the protein filaments when the myofibril was cut at position Y. Figure 3 shows the protein filaments when the myofibril was cut at the same distance from a Z line at a different stage of contraction.

Figure 2 Figure 3

Explain why the pattern of protein filaments differs in Figure 2 and Figure 3.

......................................................................................................................

......................................................................................................................

......................................................................................................................

...................................................................................................................... (2)

of 108

(c) Describe the role of calcium ions in the contraction of a sarcomere.

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

...................................................................................................................... (4)

(Total 7 marks)

Q11. This question should be answered in continuous prose. Quality of Written Communication will be assessed in the answer.

(i) Starting with mRNA, describe how the process of translation leads to the production of a polypeptide.

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

...................................................................................................................... (4)

of 108

(ii) Normal tomato plants have an enzyme that softens tomatoes as they ripen. Genetically engineered tomatoes ripen and soften more slowly. A gene was inserted which reduces the amount of softening enzyme produced.

The diagram shows matching parts of the base sequences for the mRNA produced by the gene for the softening enzyme and that produced by the inserted gene.

Softening gene mRNA …AAUCGGAAU…

Inserted gene mRNA …UUAGCCUUA…

Suggest how the inserted gene reduces the production of the softening enzyme.

......................................................................................................................

......................................................................................................................

......................................................................................................................

...................................................................................................................... (2)

(Total 6 marks)

of 108

Q12. (a) Agrobacterium is a bacterium used in genetic engineering of plants. The diagram shows stages in the transfer of a gene into a plant.

(i) Name structure X in stage 1.

............................................................................................................. (1)

of 108

(ii) In stage 2, explain why the bacteria are cultured before the plant tissue is added.

.............................................................................................................

............................................................................................................. (1)

(iii) In stage 4, explain why the growth medium contains antibiotic.

.............................................................................................................

.............................................................................................................

.............................................................................................................

............................................................................................................. (2)

(iv) Suggest why stages 5 and 6 are necessary for the commercial production of genetically engineered plants.

.............................................................................................................

.............................................................................................................

.............................................................................................................

............................................................................................................. (2)

(b) (i) A toxin that kills insects can be sprayed directly onto the leaves of crop plants. A gene has now been transferred into crop plants that makes their leaves produce this toxin.

Explain one advantage to farmers of growing the genetically engineered crop plants, rather than spraying leaves with the toxin.

.............................................................................................................

............................................................................................................. (1)

(ii) Suggest one reason why some people are concerned that the toxin gene might get transferred to wild plants that are related to the crop plants.

.............................................................................................................

............................................................................................................. (1)

(Total 8 marks)

of 108

Q13. The diagram shows part of the metabolic pathway involved in the clotting of blood in response to an injury.

Haemophilia is a condition in which blood fails to clot. This is usually because of a mutant allele of the gene for Factor VIII.

(a) Explain how mutation could lead to faulty Factor VIII.

......................................................................................................................

......................................................................................................................

......................................................................................................................

...................................................................................................................... (2)

(b) Use information in the diagram to explain how faulty Factor VIII causes haemophilia.

......................................................................................................................

......................................................................................................................

......................................................................................................................

...................................................................................................................... (2)

(c) A boy had haemophilia caused by faulty Factor IX. When his blood was mixed with blood from a haemophiliac with faulty Factor VIII, the mixture clotted. Suggest an explanation for clotting of the mixture.

......................................................................................................................

......................................................................................................................

......................................................................................................................

...................................................................................................................... (2)

(Total 6 marks)

of 108

Q14. (a) Describe how a gene can be isolated from human DNA.

......................................................................................................................

......................................................................................................................

......................................................................................................................

...................................................................................................................... (2)

(b) Describe how an isolated gene can be replicated by the polymerase chain reaction (PCR).

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

...................................................................................................................... (4)

(c) (i) Describe how a harmless virus, genetically engineered to contain a CFTR gene, can be used to insert the gene into a cystic fibrosis sufferer.

.............................................................................................................

.............................................................................................................

.............................................................................................................

............................................................................................................. (2)

(ii) A virus used in gene therapy has RNA as its genetic material and has an enzyme called reverse transcriptase. Inside a human cell, reverse transcriptase uses viral RNA to make viral DNA.

Explain why the enzyme is called reverse transcriptase.

.............................................................................................................

.............................................................................................................

............................................................................................................. (1)

(Total 9 marks)

of 108

Q15. Write an essay on the topic below.

Energy transfers which take place inside living organisms.

In the answer to this question you should bring together relevant principles and concepts from different parts of the specification. Your essay will be marked not only for its scientific accuracy, but also for the selection of relevant material. The essay should be written in continuous prose.



(Total 25 marks)

Q16. Write an essay on the topic below.

The process of osmosis and its importance to living organisms.

In the answer to this question you should bring together relevant principles and concepts from different parts of the specification. Your essay will be marked not only for its scientific accuracy, but also for the selection of relevant material. The essay should be written in continuous prose.



(Total 25 marks)

3

3

of 108

Q17. S Penstemon plants have mechanisms that regulate the amount of nectar produced by their flowers. Nectar is a solution containing sucrose which attracts insect pollinators. The diagram shows a section through a penstemon flower.

To investigate these mechanisms the volume of nectar produced was determined. A thin strip of filter paper was dipped into the nectar until all the nectar was absorbed. The distance the nectar moved up the paper was measured. The actual volume of nectar was found by reading the value from a calibration curve on a graph. A sucrose solution similar to nectar was used to produce this calibration curve.

(a) (i) The solution contained 22% by mass of sucrose. Describe how you would make 50 cm3 of this solution.

.............................................................................................................

.............................................................................................................

............................................................................................................. (1)

(ii) Describe how you would use the solution to produce the calibration curve.

.............................................................................................................

.............................................................................................................

.............................................................................................................

............................................................................................................. (2)

of 108

In one experiment the effect of removing nectar at regular intervals was investigated. First all the nectar was removed from two penstemon flowers. From one flower (A) all the nectar produced was removed each hour for the next six hours. In the second flower (B) the nectar was allowed to accumulate for six hours. Each time the nectar was removed, the sugar was extracted from the strip of filter paper and its mass was measured. The graphs show the results.

(b) (i) Describe the effects on nectar production and on sucrose secretion of removing the nectar every hour compared with removing it after 6 hours.

.............................................................................................................

.............................................................................................................

.............................................................................................................

............................................................................................................. (2)

(ii) How would the nectar collected after 6 hours from plant B differ from that collected after 6 hours from plant A.

.............................................................................................................

............................................................................................................. (1)

(iii) Pollinating insects such as bees visit flowers and collect nectar. Suggest one advantage for penstemon flowers of the response to regular removal of nectar.

.............................................................................................................

.............................................................................................................

.............................................................................................................

............................................................................................................. (1)

of 108

(c) In a different experiment the nectar was removed from two penstemon flowers. In one

flower the nectar was replaced with 5 mm3 of a solution containing a total of 120 µg of sucrose. The second flower was left empty as a control. The two flowers were protected from insects. After three hours the nectar solutions in the flowers were removed. The table shows the results.

Describe the effect of the addition of sucrose solution on the volume of nectar produced and on the movement of sucrose.

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

...................................................................................................................... (3)

Volume of solution / mm3

Mass of sucrose in solution / µg

Time / h Experimental Control Experimental Control

0 5.00 0.00 120 0

3 5.75 1.65 104 20

(d) Nectar is formed by specialised cells in the flower which synthesise sucrose. Describe how sucrose is moved against a concentration gradient from these cells into the nectar.

......................................................................................................................

......................................................................................................................

......................................................................................................................

...................................................................................................................... (2)

(Total 12 marks)

of 108

Q18. Mitochondria contain the genes needed for the synthesis of the enzymes involved in the electron transport chain. One of these enzymes is cytochrome oxidase. If a mutation occurs during replication of the mitochondrial genes, functional cytochrome oxidase may not be produced.

S Explain why mutation of a mitochondrial gene might result in no functional cytochrome oxidase being produced.

...............................................................................................................................

...............................................................................................................................

...............................................................................................................................

...............................................................................................................................

...............................................................................................................................

...............................................................................................................................

...............................................................................................................................

............................................................................................................................... (Total 5 marks)

Q19. In an investigation of leaf decay, discs cut from oak leaves were placed in a number of bags. These bags were made from nylon mesh with 1 mm diameter holes. The bags were buried in soil. Each month one bag was removed and the surface areas of the remaining leaf discs were measured.

(a) Suggest two precautions that should be taken when carrying out this investigation to ensure a valid comparison between the results from the bags of leaf discs. In each case give a reason for the precaution.

1 ...................................................................................................................

......................................................................................................................

......................................................................................................................

2 ...................................................................................................................

......................................................................................................................

...................................................................................................................... (3)

of 108

S (b) The graph shows the surface area of the discs remaining each month as a percentage of the area at the start of the investigation.

Describe and explain the shape of the curve.

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

...................................................................................................................... (3)

of 108

S (c) Explain how microorganisms obtain the carbon compounds from cell walls.

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

...................................................................................................................... (3)

(Total 9 marks)

Q20. After moving from bright light into darkness, it takes several minutes for the rod cells to recover their sensitivity. Researchers measured the ability of the rod cells to detect small spots of light of different colours and intensity after a person moved into darkness. The results are shown in Figure 1.

Figure 2 shows the amount of light of different wavelengths that rhodopsin absorbs.

Figure 1 Figure 2

(i) Explain why it takes time for the rod cells to recover their sensitivity to light after moving into darkness.

......................................................................................................................

......................................................................................................................

......................................................................................................................

...................................................................................................................... (2)

of 108

(ii) Use information in Figures 1 and 2 to explain the differences in sensitivity of rod cells to red and green light.

......................................................................................................................

......................................................................................................................

......................................................................................................................

...................................................................................................................... (2)

(iii) Suggest an explanation for the difference in sensitivity of rod cells to the white and green spots after 30 minutes.

......................................................................................................................

...................................................................................................................... (1)

(Total 5 marks)

Q21. (a) One effect of getting into a cold shower is a reduction in the amount of blood flowing through the capillaries near the surface of the skin. Explain how the cold water causes this response.

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

...................................................................................................................... (4)

(b) (i) When exercising at 30 °C, the body is more likely to overheat in humid conditions than in dry conditions. Explain why.

.............................................................................................................

.............................................................................................................

.............................................................................................................

............................................................................................................. (2)

of 108

(ii) Strenuous exercise leads to exhaustion more quickly in hot conditions than in cool conditions. One reason for this is a reduced blood supply to the muscles, which means that they receive less oxygen.

Suggest an explanation for the reduced blood supply to the muscles.

.............................................................................................................

.............................................................................................................

.............................................................................................................

............................................................................................................. (2)

(Total 8 marks)

Q22. A gardener accidentally pricks a finger on a thorn. She quickly pulls the finger away. This reaction results from a simple reflex arc involving three neurones.

(a) The diagram shows part of the pathway involved in this reaction.

(i) Complete the diagram to show the rest of the simple reflex arc. (1)

On your diagram

(ii) name and label the three neurones;

(iii) label the effector. (2)

of 108

(b) As well as pulling the finger away, the gardener also feels pain caused by the thorn. Explain how she becomes aware of the pain.

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

...................................................................................................................... (3)

(Total 6 marks)

Q23. (a) Plasmids can be modified by genetic engineering and inserted into bacteria. These bacteria can then make useful substances normally made by another organism. Explain how modified plasmids are made by genetic engineering and how the use of markers enable bacteria containing these plasmids to be detected.

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

...................................................................................................................... (6)

of 108

(b) In gene therapy, genes are introduced into a person who has defective genes which do not produce an important substance. Three experiments were done to compare techniques for introducing an important substance into a person with defective genes.

1. The substance was injected directly. 2. Harmless viruses carrying genes coding for the substance were injected. 3. The genes were put into a protein capsule which was inserted into the tissues.

The graph shows results of the experiments.

Takahiro Ochiya et al, Biomaterials for Gene Delivery: Studies on Metastasis, (National Cancer Centre, Research Institute, Tokyo, Japan) 1999

(i) Describe the results of the three experiments.

.............................................................................................................

.............................................................................................................

.............................................................................................................

.............................................................................................................

.............................................................................................................

............................................................................................................. (3)

(ii) Using the information in the graph, suggest one advantage and one disadvantage of the capsule method compared to the others.

Advantage ...........................................................................................

.............................................................................................................

Disadvantage ............................................................................….......

............................................................................................................. (2)

(Total 11 marks)

of 108

Q24. (a) CFTR is a transmembrane regulator protein. Its molecules have 1480 amino acids. People with cystic fibrosis produce defective CFTR protein which is missing one amino acid from its structure.

(i) What is the minimum number of bases on DNA which would code for the normal CFTR protein? Explain your answer.

Number of bases ...............................

.............................................................................................................

.............................................................................................................

.............................................................................................................

............................................................................................................. (2)

(ii) Which type of gene mutation produced the cystic fibrosis allele? Explain your answer.

.............................................................................................................

.............................................................................................................

.............................................................................................................

............................................................................................................. (2)

(b) The diagram shows part of the process of making normal and defective CFTR in a cell. A normal CFTR protein molecule has sugar molecules attached to it which make it functional.

of 108

(i) Describe how the information on mRNA is translated into CFTR at the ribosome.

.............................................................................................................

.............................................................................................................

.............................................................................................................

.............................................................................................................

.............................................................................................................

.............................................................................................................

.............................................................................................................

............................................................................................................. (4)

(ii) Using information in the diagram and your own knowledge, suggest why defective CFTR, missing one amino acid, is not functional.

.............................................................................................................

.............................................................................................................

.............................................................................................................

............................................................................................................. (2)

(Total 10 marks)

Q25. (a) Explain the reason for each of the following in the polymerase chain reaction (PCR).

(i) DNA is heated to 95 °C.

.............................................................................................................

............................................................................................................. (1)

(ii) DNA polymerase used is heat-stable.

.............................................................................................................

............................................................................................................. (1)

(iii) The reaction mixture is cooled to 40 °C.

.............................................................................................................

............................................................................................................. (1)

of 108

(b) The graph shows the number of DNA molecules made using PCR, starting with one molecule.

(i) Explain the shape of the curve from cycles 1 to 16.

.............................................................................................................

.............................................................................................................

.............................................................................................................

............................................................................................................. (2)

(ii) Suggest one explanation for the levelling out of the curve from cycles 17 to 20.

.............................................................................................................

.............................................................................................................

.............................................................................................................

............................................................................................................. (2)

(Total 7 marks)

of 108

Q26. S Essay

In the answer to this question you should bring together relevant principles and concepts from as many different parts of the specification as possible. Your essay will be marked not only for its scientific accuracy, but also for the selection of relevant material. The essay should be written in continuous prose.



Write an essay on the following topic:

Enzymes and their importance in plants and animals (Total 25 marks)

Q27. S In an investigation, the effects of caffeine on performance during exercise were measured. One group of athletes (A) was given a drink of decaffeinated coffee. Another group (B) was given a drink of decaffeinated coffee with caffeine added. One hour later the athletes started riding an exercise bike and continued until too exhausted to carry on. Three days later the same athletes repeated the experiment, with the drinks exchanged.

(a) (i) The researchers added caffeine to decaffeinated coffee. Explain why they did not just use normal coffee.

.............................................................................................................

............................................................................................................. (1)

(ii) The performance of the athletes might have been influenced by how they expected the caffeine to affect them. How could the researchers avoid this possibility?

.............................................................................................................

............................................................................................................. (1)

3

of 108

During the exercise the concentrations of glycerol and fatty acids in the blood plasma were measured. The results are shown in the table.

(b) (i) Describe the effect of caffeine on exercise performance.

.............................................................................................................

............................................................................................................. (1)

Drink Mean time to exhaustion

/minutes

Mean concentration of blood glycerol/

mmol dm–3

Mean concentration of blood fatty acids/

mmol dm–3

With caffeine 90.2 0.20 0.53

Without caffeine 75.5 0.09 0.31

(ii) Suggest one explanation for the higher glycerol and fatty acid concentrations in the blood plasma of the athletes after they were given caffeine.

.............................................................................................................

.............................................................................................................

.............................................................................................................

............................................................................................................. (2)

(c) The researchers measured the volumes of carbon dioxide exhaled and oxygen inhaled during the exercise. From the results they calculated the respiratory quotient (RQ), using the formula

When a person is respiring carbohydrate only, RQ = 1.0

When a person is respiring fatty acids only, RQ = 0.7

(i) The basic equation for the respiration of glucose is

C6H

12O

6 + 6O

2 → 6CO

2 + 6H

2O

Explain why the RQ for glucose is 1.0.

.............................................................................................................

.............................................................................................................

.............................................................................................................

............................................................................................................. (2)

of 108

(ii) The researchers found that, when the athletes were given the drink containing caffeine, their mean RQ was 0.85. When given the drink without caffeine their mean RQ was 0.92.

The researchers concluded that when the athletes had caffeine they used glycogen more slowly than when they did not have caffeine, and that the store of glycogen in their muscles was used up less quickly during the exercise.

Explain the evidence from the information above and from the table which supports these conclusions.

.............................................................................................................

.............................................................................................................

.............................................................................................................

.............................................................................................................

.............................................................................................................

............................................................................................................. (3)

(Total 10 marks)

Q28. The diagram shows the events that occur in the human ovary during one menstrual cycle.

(a) (i) Describe the role of follicle stimulating hormone (FSH) in the menstrual cycle.

.............................................................................................................

.............................................................................................................

.............................................................................................................

............................................................................................................. (2)

of 108

S (ii) FSH is a globular protein and specifically targets cells in the ovary. Explain how the structure of FSH accounts for this specific targeting.

.............................................................................................................

.............................................................................................................

.............................................................................................................

.............................................................................................................

.............................................................................................................

............................................................................................................. (3)

(b) (i) Name the hormones P and Q.

P ….....................................................................................................

Q ……………………............................................................................

............................................................................................................. (2)

(ii) After the menopause, when the menstrual cycle ceases, hormone secretion by the ovary is much reduced. Explain why the blood of post-menopausal women contains high levels of FSH.

.............................................................................................................

.............................................................................................................

.............................................................................................................

............................................................................................................. (2)

(Total 9 marks)

of 108

Q29. The mule deer is a large mammal that lives in hot deserts. It is most active for a few hours around dawn and dusk each day. During the day it keeps cool by lying in the shade. Its large ears also help it to keep cool.

(a) Explain how the ears of the mule deer help it to keep cool.

......................................................................................................................

......................................................................................................................

......................................................................................................................

...................................................................................................................... (2)

S (b) Explain one way in which activity during the day would raise body temperature.

.......................................................................................................................

......................................................................................................................

......................................................................................................................

...................................................................................................................... (2)

(Total 4 marks)

of 108

Q30. The diagram shows the energy flow through a freshwater ecosystem.

All units are kJ m–2year–1.

(a) Name

(i) process A;

............................................................................................................. (1)

(ii) the group of organisms represented by box B.

............................................................................................................. (1)

(b) Calculate the percentage efficiency with which light energy is transferred to energy in producers. Show your working.

Answer ........................................ (2)

of 108

S (c) Describe the effect of light energy in the light-dependent reaction of photosynthesis.

......................................................................................................................

......................................................................................................................

......................................................................................................................

...................................................................................................................... (2)

S (d) If a plant is kept in the dark it is still able to produce carbohydrates, as long as it is provided with two products of the light-dependent reaction of photosynthesis. Give the name of these products and explain their function in the light-independent reaction of photosynthesis.

Name ............................................................................................................

Function ........................................................................................................

......................................................................................................................

Name ............................................................................................................

Function ........................................................................................................

...................................................................................................................... (4)

(Total 10 marks)

Q31. Figure 1 shows a seal which lives in the Arctic ocean. It is a mammal with a core body temperature of 37 °C. It has a layer of fat (blubber) under the skin which is 50 mm thick and which insulates it from the cold.

Figure 1

of 108

Figure 2 shows the temperature gradient in the surface tissues of the seal when it is in water at 0 °C.

Figure 2

(a) Describe the evidence from Figure 2 that blubber is an effective insulator.

......................................................................................................................

......................................................................................................................

......................................................................................................................

...................................................................................................................... (2)

of 108

(b) Figure 3 shows the arrangement of the blood vessels in the surface tissues of the seal.

Figure 3

Explain how this arrangement of the blood vessels helps the seal to maintain a constant body temperature.

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

...................................................................................................................... (4)

of 108

(c) The seal has no blubber in the flippers. Each artery carrying blood to the flipper is surrounded by veins from the flipper, as shown in Figure 4.

Figure 4

Explain how this arrangement of blood vessels prevents excessive heat loss.

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

...................................................................................................................... (3)

(d) Like other mammals, seals produce urine which is more concentrated than their blood plasma. Explain the role of the loop of Henle in producing concentrated urine.

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

...................................................................................................................... (6)

(Total 15 marks)

of 108

Q32. The diagram shows the change in the charge across the surface membrane of a non-myelinated axon when an action potential is produced.

(a) Describe how the change shown in the diagram occurs when an action potential is produced.

......................................................................................................................

......................................................................................................................

......................................................................................................................

...................................................................................................................... (2)

(b) Explain what causes the conduction of impulses along a non-myelinated axon to be slower than along a myelinated axon.

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

...................................................................................................................... (3)

(Total 5 marks)

of 108

Q33. The diagram shows the stages in one cycle that results in movement of an actin filament in a muscle sarcomere.

(a) Describe how stimulation of a muscle by a nerve impulse starts the cycle shown in the diagram.

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

...................................................................................................................... (3)

of 108

(b) Each cycle requires hydrolysis of one molecule of ATP and moves one actin filament 40 nm. During contraction of a muscle sarcomere, a single actin filament moves 0.6 µm. Calculate how many molecules of ATP are required to produce this movement.

Answer ................................................................ (2)

(c) After death, cross bridges between actin and myosin remain firmly bound resulting in rigor mortis. Using information in the diagram, explain what causes the cross bridges to remain firmly bound.

......................................................................................................................

......................................................................................................................

......................................................................................................................

...................................................................................................................... (2)

(Total 7 marks)

of 108

Q34. (a) A woman takes moderate exercise. Explain what causes her heart rate to increase while she exercises.

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

...................................................................................................................... (6)

(b) An electrocardiogram (ECG) measures the electrical changes occurring in cardiac muscle as a heart is beating. An ECG trace for a healthy person and an ECG trace for a person suffering from heart disease are shown.

of 108

(i) Describe the route taken when electrical impulses are transmitted from the sinoatrial node to the muscles of the ventricles in a healthy heart.

.............................................................................................................

.............................................................................................................

.............................................................................................................

............................................................................................................. (2)

(ii) Explain how information from these ECG traces suggests that the damage caused to the diseased heart is unlikely to have affected the sinoatrial node.

.............................................................................................................

.............................................................................................................

.............................................................................................................

............................................................................................................. (2)

(Total 10 marks)

Q35. Research scientists can increase the nutritional value of potatoes by genetically engineering potato plants. A gene which results in increased protein production has been removed from cells of an amaranth plant and inserted into cells of a potato plant.

(a) Describe how a gene could be removed from cells of an amaranth plant and inserted into cells of a potato plant.

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

...................................................................................................................... (6)

of 108

(b) Describe the advantages of using vegetative propagation rather than sexual reproduction to reproduce genetically engineered potato plants.

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

...................................................................................................................... (3)

(c) Whole potato plants can be produced from genetically identical potato cells grown in a tissue culture. Use your knowledge of genes to suggest how different cells, such as leaf and root cells, can develop from genetically identical cells.

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

...................................................................................................................... (2)

(Total 11 marks)

Q36. Lysozyme is an enzyme consisting of a single polypeptide chain of 129 amino acids.

(a) What is the minimum number of nucleotide bases needed to code for this enzyme?

...................................................................................................................... (1)

(b) The diagram shows the sequence of bases in a section of the mRNA strand used to synthesise this enzyme.

G G U C U U U C U U A U G G U A G A U A U

(i) Give the DNA sequence which would be complementary to the first four bases in this section of mRNA.

............................................................................................................. (1)

(ii) How many different types of tRNA molecule would attach to the section of mRNA shown in the diagram?

............................................................................................................. (1)

of 108

(c) Give two factors which might increase the frequency at which a mutation in DNA occurs.

1 ...................................................................................................................

2 ................................................................................................................... (2)

(d) Two single base mutations occurred in the DNA coding for this section of mRNA. These mutations caused an alteration in the sequence of amino acids in the enzyme. The diagram shows the original and altered sequences of amino acids.

Original amino acid sequence

Gly Leu Ser Tyr Gly Arg Tyr

Original mRNA base sequence

GGU CUU UCU UAU GGU AGA UAU

Altered amino acid sequence

Gly Leu Tyr Leu Trp Arg Tyr

Altered mRNA base sequence

GGU CUU AGA UAU

(i) Use the mRNA codons provided in the table to complete the altered mRNA base sequence in the diagram.

(1)

Amino acid mRNA codons which can be used

Arg AGA

Gly GGU

Leu CUU or UUA

Ser UCU

Trp UGG

Tyr UAU or UAC

of 108

(ii) Use the information provided to determine the precise nature of the two single base mutations in the DNA.

.............................................................................................................

.............................................................................................................

.............................................................................................................

.............................................................................................................

.............................................................................................................

............................................................................................................. (3)

(Total 9 marks)

Q37. The polymerase chain reaction is a process which can be carried out in a laboratory to replicate DNA. The diagram shows the main stages involved in the polymerase chain reaction.

(a) Explain why DNA is heated to 95 °C.

......................................................................................................................

...................................................................................................................... (1)

(b) What is the role of

(i) a primer in this process;

.............................................................................................................

............................................................................................................. (1)

(ii) DNA polymerase?

.............................................................................................................

............................................................................................................. (1)

of 108

(c) (i) How many DNA molecules will have been produced from one molecule of DNA after 6 complete cycles?

............................................................................................................. (1)

(ii) Suggest one use of the polymerase chain reaction.

.............................................................................................................

............................................................................................................. (1)

(d) Give two ways in which the polymerase chain reaction differs from the process of transcription.

1 ...................................................................................................................

......................................................................................................................

2 ...................................................................................................................

...................................................................................................................... (2)

(Total 7 marks)

Q38. Gene therapy is used to treat the genetic disorder, ADA deficiency. Affected individuals are unable to produce the enzyme adenosine deaminase (ADA). Without this enzyme, T lymphocytes, a type of white blood cell, cannot provide immunity to infection. The diagram shows the processes involved in the treatment of ADA deficiency by gene therapy.

(a) What is meant by gene therapy?

......................................................................................................................

...................................................................................................................... (1)

of 108

(b) The ADA gene is inserted into a virus. Give two advantages of using a virus in gene therapy.

1 ...................................................................................................................

......................................................................................................................

2 ...................................................................................................................

...................................................................................................................... (2)

(c) Individuals who have been treated by this method of gene therapy do not pass on the ADA gene to their children. Explain why.

......................................................................................................................

...................................................................................................................... (1)

(d) T lymphocytes are produced in bone marrow. A bone marrow transplant from a genetically matched donor can provide a permanent cure for ADA deficiency.

(i) Suggest why bone marrow for a transplant is obtained from a genetically matched donor.

.............................................................................................................

............................................................................................................. (1)

(ii) Explain why treatment of ADA deficiency by gene therapy must be repeated at regular intervals, whereas a single bone marrow transplant can provide a permanent cure.

.............................................................................................................

.............................................................................................................

.............................................................................................................

............................................................................................................. (2)

(Total 7 marks)

of 108

Q39. S Write an essay on the topic below.

Mean temperatures are rising in many parts of the world. The rising temperatures may result in physiological and ecological effects on living organisms. Describe and explain these effects.

In the answer to this question you should bring together relevant principles and concepts from different parts of the specification.

Your essay will be marked not only for its scientific accuracy, but also for the selection of relevant material.

The essay should be written in continuous prose.



(Total 25 marks)

Q40. S Write an essay on the topic below.

Negative feedback in living organisms

In the answer to this question you should bring together relevant principles and concepts from different parts of the specification.


The essay should be written in continuous prose.



(Total 25 marks)

3

3

of 108

Q41. S The diagram shows a single-celled organism called Chlamydomonas.

(a) Chlamydomonas lives in fresh-water ponds. It uses its flagella to swim towards light of moderate intensity but away from very bright light. Using information in the diagram, explain the advantage of this behaviour.

......................................................................................................................

......................................................................................................................

......................................................................................................................

...................................................................................................................... (2)

(b) A Chlamydomonas cell has two flagella. These flagella contain a single sort of protein. A flagellum consists of a bundle of 242 filaments. Each filament consists of 7500 protein molecules. Each protein molecule contains 900 amino acid units.

(i) What would be the minimum number of nucleotides in the coding region of the mRNA used to synthesise this protein?

............................................................................................................. (1)

(ii) In an investigation, a culture of Chlamydomonas was treated in a way that caused them to lose their flagella without any other damage to the cells. The flagella grew back to their original length in 60 minutes.

How many amino acid molecules would be incorporated into each growing flagellum per minute? Show your working.

Answer ......................................... (2)

of 108

(c) The researchers investigated the rate at which the flagella grew in three different media.

1. A medium containing actinomycin D, which prevents transcription by binding to the guanine in DNA

2. A medium containing puromycin, which prevents translation by attaching to ribosomes

3. A control medium

The results are shown in the graph.

(i) Describe how the rate of growth was affected by puromycin.

.............................................................................................................

.............................................................................................................

.............................................................................................................

............................................................................................................. (2)

of 108

(ii) The researchers concluded

1. that the cells used mRNA that is already present in the cytoplasm for the regrowth of the flagella;

2. that some of the regrowth uses protein molecules already present in the cell.

Explain the evidence for each of these conclusions.

1 ..........................................................................................................

.............................................................................................................

.............................................................................................................

.............................................................................................................

2 ..........................................................................................................

.............................................................................................................

.............................................................................................................

............................................................................................................. (4)

(Total 11 marks)

Q42. S In an investigation by a student into the responses of maggots, the bottom of a large box was marked with six coloured segments, as shown in the diagram.

30 maggots were placed on each segment in the box. A transparent cover was put on the box and light bulbs were positioned so that the segments were evenly illuminated. The positions of the maggots were recorded after one hour. The intensity of the light reflected by each segment was measured.

of 108

The experiment was repeated three more times. The total number of maggots in each segment from the four experiments is shown in the table.

Colour of segment

Intensity of reflected light / arbitrary units

Total number of maggots

Black 4 154

Red 25 229

Blue 10 178

White 44 47

Green 25 48

Yellow 40 64

(a) Give one conclusion about the responses of maggots which is supported by these results.

......................................................................................................................

......................................................................................................................

Give the evidence from the table for your conclusion.

......................................................................................................................

...................................................................................................................... (2)

(b) The chi-squared test was used to analyse the data. For the results obtained, suggest one null hypothesis which might be analysed by a chi-squared test.

......................................................................................................................

...................................................................................................................... (1)

(c) It was suggested that the movement of the maggots might have been influenced by the Earth’s magnetic field. Suggest one simple way of repeating the investigation which would avoid this possibility.

......................................................................................................................

...................................................................................................................... (1)

(Total 4 marks)

of 108

Q43. The body temperature of desert-living lizards is greatly affected by the temperature of their environment. A lizard was placed in a chamber where one half was maintained at 20 °C and the other at 40 °C. The lizard was free to move from one half to the other. The lizard’s behaviour was observed using an infra-red camera, which records 20 °C surfaces as black and 40 °C surfaces as white. Temperatures between 20 °C and 40 °C appear as shades of grey. A series of photographs was taken.

of 108

(a) The position and appearance of the lizard, as recorded by the infra-red camera, changed during the experiment. Describe and explain these changes.

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

...................................................................................................................... (3)

(b) Suggest the advantage to the lizard of the behaviour shown.

......................................................................................................................

......................................................................................................................

......................................................................................................................

...................................................................................................................... (2)

S (c) The lizard responds to the stimulus of a change in its body temperature. Describe how the nervous system brings about this response.

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

...................................................................................................................... (3)

(Total 8 marks)

of 108

Q44. When a finger accidentally touches a hot object, a reflex action occurs. The biceps muscle contracts, causing the arm to be flexed and the finger is pulled away. The diagram shows the arrangement of the bones in the arm, the muscles used for flexing and straightening the arm and the nervous pathways associated with the contraction of these muscles.

(a) Explain the importance of reflex actions.

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

...................................................................................................................... (3)

of 108

(b) (i) Describe the sequence of events which allows information to pass from one neurone to the next neurone across a cholinergic synapse.

.............................................................................................................

.............................................................................................................

.............................................................................................................

.............................................................................................................

.............................................................................................................

.............................................................................................................

.............................................................................................................

.............................................................................................................

.............................................................................................................

.............................................................................................................

.............................................................................................................

............................................................................................................. (6)

(ii) Give two differences between a cholinergic synapse and a neuromuscular junction.

1 ..........................................................................................................

.............................................................................................................

2 ..........................................................................................................

............................................................................................................. (2)

(Total 11 marks)

Q45. Diabetes is a disorder affecting the ability to control blood glucose concentration. One type of diabetes can be due to an abnormality of the insulin receptors in the cell surface membranes of cells in the liver and muscles. A high blood glucose concentration and the presence of glucose in the urine are signs of this type of diabetes.

(a) (i) Suggest one way in which the insulin receptors might be abnormal.

.............................................................................................................

............................................................................................................. (1)

of 108

(ii) Explain how the presence of abnormal insulin receptors results in a high blood glucose concentration.

.............................................................................................................

.............................................................................................................

.............................................................................................................

............................................................................................................. (2)

(iii) Explain how the kidneys normally prevent glucose appearing in the urine of a non-diabetic person.

.............................................................................................................

.............................................................................................................

.............................................................................................................

.............................................................................................................

.............................................................................................................

............................................................................................................. (3)

(b) Twin studies have been used to determine the relative effects of genetic and environmental factors on the development of this type of diabetes. The table shows the concordance (where both twins have the condition) in genetically identical and genetically non-identical twins.

(i) What do the data show about the relative effects of environmental and genetic factors on the development of diabetes?

.............................................................................................................

............................................................................................................. (1)

Concordance in genetically identical twins / %

Concordance in genetically non-identical twins /%

85 35

of 108

(ii) Suggest two factors which should be taken into account when collecting the data in order to draw valid conclusions.

1 ..........................................................................................................

.............................................................................................................

2 ..........................................................................................................

............................................................................................................. (2)

(Total 9 marks)

Q46. (a) Cystic fibrosis can be caused by any one of several mutant alleles of the cystic fibrosis gene. The most common of these mutant alleles accounts for about 70% of cases of cystic fibrosis. The use of gene probes can identify individuals carrying this allele. Gene probes are single strands of DNA which are radioactively labelled. They have a base sequence that is complementary to a mutant allele. The main stages in using a gene probe are shown in the diagram.

↓

↓

↓

Using the information given, explain how the use of a gene probe could enable the presence of a mutant allele of the cystic fibrosis gene to be detected.

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

...................................................................................................................... (4)

Sample of DNA extracted from a person’s tissue and heated to

separate the strands

Radioactive gene probe added to the DNA

Excess probe washed away

Sample tested for radioactivity

of 108

(b) Sheep have been genetically engineered to produce alpha-1-antitrypsin which is used to treat cystic fibrosis. Use your knowledge of this process to explain one argument for and one against using sheep in this way.

For

......................................................................................................................

......................................................................................................................

Against

......................................................................................................................

...................................................................................................................... (2)

(Total 6 marks)

Q47. One technique used to determine the sequence of nucleotides in a sample of DNA is the Sanger procedure. This requires four sequencing reactions to be carried out at the same time. The sequencing reactions occur in four separate tubes. Each tube contains

• a large quantity of the sample DNA

• a large quantity of the four nucleotides containing thymine, cytosine, guanine and adenine

• DNA polymerase

• radioactive primers

of 108

A modified nucleotide is also added to each tube, as shown in Figure 1.

(a) A large quantity of the DNA sample is required for this procedure. Name the reaction used to amplify small amounts of DNA into quantities large enough for this procedure.

...................................................................................................................... (1)

(b) Explain the reason for adding each of the following to the tubes.

(i) DNA polymerase

.............................................................................................................

............................................................................................................. (1)

(ii) Primers

.............................................................................................................

............................................................................................................. (1)

(c) (i) When a modified nucleotide is used to form a complementary DNA strand, the sequencing reaction is terminated. Suggest how this sequencing reaction is terminated.

.............................................................................................................

............................................................................................................. (1)

of 108

(ii) A sample of DNA analysed by this technique had the following nucleotide base sequence.

T G G T C A C G A

Give the base sequence of the shortest DNA fragment which would be produced in Tube 2.

............................................................................................................. (1)

(d) A different sample of DNA was then analysed. The DNA fragments from the four tubes were separated in a gel by electrophoresis and analysed by autoradiography. Figure 2 shows the banding pattern produced.

Figure 2

(i) Explain why the DNA fragments move different distances in the gel.

.............................................................................................................

............................................................................................................. (1)

(ii) What makes the DNA fragments visible on the autoradiograph?

.............................................................................................................

............................................................................................................. (1)

of 108

(iii) Use Figure 2 to determine the sequence of nucleotides in this sample of DNA.

.............................................................................................................

............................................................................................................. (1)

(Total 8 marks)

Q48. New alleles arise as a result of mutations in existing genes. These mutations may occur during DNA replication.

(a) Explain what is meant by an allele.

......................................................................................................................

...................................................................................................................... (1)

(b) Explain how DNA replicates.

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

...................................................................................................................... (4)

(c) Explain why a mutation involving the deletion of a base may have a greater effect than one involving substitution of one base for another.

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

...................................................................................................................... (3)

(Total 8 marks)

of 108

Q49. (a) The mRNA codon for the amino acid tyrosine is UAU.

(i) Give the DNA triplet for tyrosine.

............................................................................................................. (1)

(ii) Give the tRNA anticodon for tyrosine.

............................................................................................................. (1)

(b) Give two ways in which the structure of a molecule of tRNA differs from the structure of a molecule of mRNA.

1 ...................................................................................................................

......................................................................................................................

2 ...................................................................................................................

...................................................................................................................... (2)

(Total 4 marks)

Q50. (a) The diagram shows the banding pattern observed in part of a relaxed muscle fibril.

(i) Describe what causes the different bands seen in the muscle fibril.

.............................................................................................................

.............................................................................................................

.............................................................................................................

............................................................................................................. (2)

of 108

(ii) Describe how the banding pattern will be different when the muscle fibril is contracted.

.............................................................................................................

.............................................................................................................

.............................................................................................................

............................................................................................................. (2)

(b) There is an increase in the activity of the enzyme ATPase during muscle contraction. An investigation into muscle contraction involved measuring the activity of ATPase in solutions containing ATP, myosin and different muscle components. The table shows the results.

(i) Explain the importance of ATPase during muscle contraction.

.............................................................................................................

.............................................................................................................

.............................................................................................................

............................................................................................................. (2)

Solution Contents ATPase activity /

arbitrary units

A ATP, myosin and actin 1.97

B ATP, myosin, actin and tropomyosin 0.54

C ATP, myosin, actin, tropomyosin and calcium ions 3.85

(ii) Using your knowledge of muscle contraction, explain the difference in the results between

A and B;

.............................................................................................................

.............................................................................................................

.............................................................................................................

............................................................................................................. (2)

of 108

B and C.

.............................................................................................................

.............................................................................................................

.............................................................................................................

............................................................................................................. (2)

(Total 10 marks)

Q51. The graph shows the effect of increasing the environmental temperature on the metabolic rate of a small mammal.

(a) Suggest one way of measuring the metabolic rate.

......................................................................................................................

...................................................................................................................... (1)

(b) The small mammal has ears which are usually pink, but they appear pale when the environmental temperature is low. Explain the pale appearance of the mammal’s ears when the environmental temperature is low.

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

...................................................................................................................... (3)

of 108

(c) Use your knowledge of thermoregulation to explain

(i) the change in metabolic rate of the mammal when the environmental temperature increases from 5°C to 40°C;

.............................................................................................................

.............................................................................................................

.............................................................................................................

.............................................................................................................

.............................................................................................................

............................................................................................................. (3)

(ii) the increase in metabolic rate after 40°C.

.............................................................................................................

.............................................................................................................

.............................................................................................................

............................................................................................................. (2)

(Total 9 marks)

Q52. The diagram shows the distribution of cone cells across the retina of a human eye.

(a) On the diagram draw a line to show the distribution of rod cells across the retina. (2)

of 108

(b) Nocturnal mammals are active at night. Describe how the number and distribution of rods and cones across the retina would differ in a nocturnal mammal from the number and distribution in a human. Explain your answer.

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

...................................................................................................................... (3)

(Total 5 marks)

Q53. (a) Name one mutagenic agent.

...................................................................................................................... (1)

(b) In flax plants the flowers are white, lilac or blue. The diagram shows the pathway by which the flower cells produce coloured pigments.

(i) A deletion mutation occurs in gene 1. Describe how a deletion mutation alters the structure of a gene.

.............................................................................................................

.............................................................................................................

.............................................................................................................

............................................................................................................. (2)

of 108

(ii) Describe and explain how the altered gene could result in flax plants with white-coloured flowers.

.............................................................................................................

.............................................................................................................

.............................................................................................................

.............................................................................................................

.............................................................................................................

.............................................................................................................

.............................................................................................................

............................................................................................................. (4)

(iii) Electrophoresis was used to separate the enzymes involved in this pathway. When extracts of the differently coloured flax petals were analysed, four different patterns of bands were produced. In the table, only bands that contain functional enzymes are shown.

Complete the table to give the colour of the petal from which each extract was taken. (2)

(Total 9 marks)

Result of electrophoresis Colour of petal

White

of 108

Q54. (a) Figure 1 shows the exposed bases (anticodons) of two tRNA molecules involved in the synthesis of a protein.

Figure 1

Complete the boxes to show the sequence of bases found along the corresponding section of the coding DNA strand.

(2)

(b) Describe the role of tRNA in the process of translation.

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

...................................................................................................................... (3)

(c) Figure 2 shows the sequence of bases in a section of DNA coding for a polypeptide of seven amino acids.

Figure 2

TACAAGGTCGTCTTTGTCAAG

The polypeptide was hydrolysed. It contained four different amino acids. The number of each type obtained is shown in the table.

Amino acid Number present

Phe 2

Met 1

Lys 1

Gln 3

of 108

Use the base sequence shown in Figure 2 to work out the order of amino acids in the polypeptide. Write your answer in the table below.

(2) (Total 7 marks)

Met

Q55. A protein produced by a species of bacterium is toxic to caterpillars. The gene coding for this protein was removed and transferred into a crop plant.

(a) (i) Describe how the gene could have been removed from the bacterial DNA.

.............................................................................................................

.............................................................................................................

.............................................................................................................

............................................................................................................. (2)

(ii) Many copies of the isolated gene were required. Name the process used in a laboratory to produce many copies of DNA from a small amount.

............................................................................................................. (1)

(b) The gene was injected into isolated cells from the crop plant. These cells were then cloned and new plants grown from the cloned cells. Explain the advantage of inserting the gene into isolated plant cells rather than directly into cells within a whole plant.

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

...................................................................................................................... (3)

(Total 6 marks)

of 108

Q56. S Write an essay on the following topic:

Cells are easy to distinguish by their shape. How are the shapes of cells related to their function?

In the answer to this question you should select and use relevant principles and concepts from different parts of the specification.


Write your essay in continuous prose.



(Total 25 marks)

Q57. S Figure 1 shows the life cycle of a species of insect. Adults lay eggs which hatch into larvae. Larvae feed and grow and eventually turn into pupae. During the pupal stage, no feeding takes place and the adult body is formed. The adults and larvae feed on plants.

Figure 1

3

of 108

(a) Pupae that develop in late summer enter diapause, a state in which the rate of metabolism is very greatly reduced. Adults do not emerge from these pupae until the following spring. This is an adaptation to changes in food availability and abiotic conditions. Explain how a slower metabolic rate is of benefit to the insect.

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

...................................................................................................................... (3)

(b) The factors which bring about diapause were investigated. Three groups of larvae, A, B and C, were exposed to different patterns of light and dark periods during each 24 hours for several days. It was noted whether or not diapause developed in the pupae that formed later. Figure 2 shows the results.

Figure 2

of 108

Is it the length of the light period or the length of the dark period that affects whether diapause develops? Give evidence from Figure 2 to support your answer.

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

...................................................................................................................... (3)

(Total 6 marks)

Q58. Acetylcholine is a neurotransmitter which binds to postsynaptic membranes and stimulates the production of nerve impulses. GABA is another neurotransmitter. It is produced by certain neurones in the brain and spinal cord. GABA binds to postsynaptic membranes and inhibits the production of nerve impulses. The diagram shows a synapse involving three neurones.

(a) Describe the sequence of events leading to the release of acetylcholine and its binding to the postsynaptic membrane.

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

...................................................................................................................... (4)

of 108

(b) The binding of GABA to receptors on postsynaptic membranes causes negatively charged chloride ions to enter postsynaptic neurones. Explain how this will inhibit transmission of nerve impulses by postsynaptic neurones.

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

...................................................................................................................... (3)

(c) Epilepsy may result when there is increased neuronal activity in the brain.

(i) One form of epilepsy is due to insufficient GABA. GABA is broken down on the postsynaptic membrane by the enzyme GABA transaminase. Vigabatrin is a new drug being used to treat this form of epilepsy. The drug has a similar molecular structure to GABA. Suggest how Vigabatrin may be effective in treating this form of epilepsy.

.............................................................................................................

.............................................................................................................

.............................................................................................................

............................................................................................................. (2)

(ii) A different form of epilepsy has been linked to an abnormality in GABA receptors. Suggest and explain how an abnormality in GABA receptors may result in epilepsy.

.............................................................................................................

.............................................................................................................

.............................................................................................................

.............................................................................................................

.............................................................................................................

............................................................................................................. (3)

(Total 12 marks)

Q59. (a) (i) What is meant by homeostasis?

.............................................................................................................

............................................................................................................. (1)

of 108

(ii) Giving one example, explain why homeostasis is important in mammals.

.............................................................................................................

.............................................................................................................

.............................................................................................................

............................................................................................................. (2)

(b) (i) Cross-channel swimmers experience a large decrease in external temperature when they enter the water. Describe the processes involved in thermoregulation in response to this large decrease in external temperature.

.............................................................................................................

.............................................................................................................

.............................................................................................................

.............................................................................................................

.............................................................................................................

.............................................................................................................

.............................................................................................................

.............................................................................................................

.............................................................................................................

.............................................................................................................

.............................................................................................................

.............................................................................................................

.............................................................................................................

............................................................................................................. (7)

(ii) A person swimming in cold water may not be able to maintain their core body temperature and begins to suffer from hypothermia. Explain why a tall, thin swimmer is more likely to suffer from hypothermia than a short, stout swimmer of the same body mass.

.............................................................................................................

.............................................................................................................

.............................................................................................................

............................................................................................................. (2)

of 108

(c) Cross-channel swimmers may suffer from muscle fatigue during which the contraction mechanism is disrupted. One factor thought to contribute to muscle fatigue is a decrease in the availability of calcium ions within muscle fibres. Explain how a decrease in the availability of calcium ions could disrupt the contraction mechanism in muscles.

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

...................................................................................................................... (3)

(Total 15 marks)

Q60. (a) Explain how a rise in blood pressure results in a decrease in the rate of heartbeat.

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

...................................................................................................................... (6)

of 108

(b) Some drugs inhibit the transmission of nerve impulses to the heart. Explain how these drugs reduce high blood pressure.

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

...................................................................................................................... (2)

(Total 8 marks)

Q61. (a) The polymerase chain reaction (PCR) can be used to produce large quantities of DNA. Describe how the PCR is carried out.

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

...................................................................................................................... (6)

of 108

(b) About twenty percent of the DNA produced by the PCR is copied inaccurately. Suggest and explain why it is not safe to use the PCR to clone the CFTR gene for use in treating cystic fibrosis.

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

...................................................................................................................... (4)

(Total 10 marks)

Q62. (a) Plasmids are often used as vectors in genetic engineering.

(i) What is the role of a vector?

.............................................................................................................

............................................................................................................. (1)

(ii) Describe the role of restriction endonucleases in the formation of plasmids that contain donor DNA.

.............................................................................................................

.............................................................................................................

.............................................................................................................

............................................................................................................. (2)

(iii) Describe the role of DNA ligase in the production of plasmids containing donor DNA.

.............................................................................................................

............................................................................................................. (1)

of 108

(b) There are many different restriction endonucleases. Each type cuts the DNA of a plasmid at a specific base sequence called a restriction site. The diagram shows the position of four restriction sites, J, K, L and M, for four different enzymes on a single plasmid. The distances between these sites is measured in kilobases of DNA.

1 kb = 1 kilobase

The plasmid was cut using only two restriction endonucleases. The resulting fragments were separated by gel electrophoresis. The positions of the fragments are shown in the chart below.

(i) Which of the restriction sites were cut?

............................................................................................................. (1)

of 108

(ii) Explain your answer.

.............................................................................................................

............................................................................................................. (1)

(Total 6 marks)

Q63. (a) (i) What is the role of RNA polymerase in transcription?

.............................................................................................................

............................................................................................................. (1)

(ii) Name the organelle involved in translation.

............................................................................................................. (1)

(b) Figure 1 shows some molecules involved in protein synthesis.

Figure 1

Complete Figure 1 to show

(i) the bases on the DNA strand from which the mRNA was transcribed;

(ii) the bases forming the anticodons of the tRNA molecules. (2)

of 108

Figure 2 shows the effects of two different mutations of the DNA on the base sequence of the mRNA. The table shows the mRNA codons for three amino acids.

Figure 2

(c) Name the type of mutation represented by mutation 1.

...................................................................................................................... (1)

(d) Use the information in the table to

(i) identify amino acid X in Figure 1;

............................................................................................................. (1)

(ii) explain how each mutation may affect the polypeptide for which this section of DNA is part of the code.

Mutation 1 ...........................................................................................

.............................................................................................................

.............................................................................................................

............................................................................................................. (2)

Mutation 2 ...........................................................................................

.............................................................................................................

.............................................................................................................

............................................................................................................. (2)

(Total 10 marks)

of 108

Q64. Write an essay on the following topic.

How carbon dioxide gets from a respiring cell to the lumen of an alveolus in the lungs.

You should select and use information from different parts of the specification. Credit will be given not only for the biological content, but also for the selection and use of relevant information, and for the organisation and presentation of the essay.

(Total 25 marks)

Q65. Read the following passage.

Malaria is a disease so deadly that it has devastated armies and destroyed great civilisations. It has been estimated that in the course of history malaria has been responsible for the death of one out of every two people who have ever lived. Even today, with all the advantages of modern technology, it is still responsible for some three million deaths a year.

5 The first half of the twentieth century was a time of hope for malarial control. The drugs chloroquine and proguanil had just been discovered and there seemed a real possibility of a malaria-free world. Unfortunately, this honeymoon ended almost as soon as it had started, with the emergence of drug-resistant parasite populations. Scientists now accept that whatever new drug they come up with, it is likely to have a very limited effective life. As a result, they

10 are increasingly looking at combinations of drugs.

The approach to malaria control which holds the best hope is the production of a vaccine. One of these is being developed by a researcher in South America. His vaccine is based on a small synthetic polypeptide called SPf66 which is dissolved in a saline solution and given as an injection. A series of early trials on human volunteers produced confusing results. In one trial

15 the effectiveness of the vaccine was claimed to be 80% while, in others, the results were statistically insignificant. Not only were the results inconclusive but the methods used were challenged by other scientists. In particular, the controls were considered inappropriate.

Another, possibly more promising, approach has been the development of a DNA-based vaccine. In theory, all that is required is to identify the DNA from the parasite which encodes

20 key antigens. Unfortunately, scientists have hit snags. Although they have succeeded in sequencing the human genome, the genome of the malarial parasite has created major difficulties. This is partly because of the very high proportion of the bases adenine and thymine. In some places these two bases average 80%, and on chromosomes 2 and 3 nearly 100% of the bases present are adenine and thymine. Because of this, it has proved impossible

25 to cut the relevant DNA with the commonly available restriction enzymes into pieces of a suitable size for analysis.

Use information from the passage and your own knowledge to answer the following questions.

(a) Explain how a resistant parasite population is likely to arise and limit the life of any new anti-malarial drug (lines 8 - 9).

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

...................................................................................................................... (3)

of 108

(b) A person has a 1 in 500 probability of being infected by a chloroquine-resistant strain of malarial parasite and a 1 in 500 probability of being infected by a proguanil-resistant strain. Use a calculation from these figures to explain why scientists are “increasingly looking at combinations of drugs” (lines 9 - 10).

......................................................................................................................

......................................................................................................................

......................................................................................................................

...................................................................................................................... (2)

(c) (i) Explain why trials of the SPf66 vaccine needed a control.

.............................................................................................................

............................................................................................................. (1)

(ii) The controls for the SPf66 vaccine trials were considered inappropriate (line 17).

Suggest how the control groups in these trials should have been treated.

.............................................................................................................

.............................................................................................................

.............................................................................................................

............................................................................................................. (2)

(d) In some of the DNA of a malarial parasite, the proportion of adenine and thymine bases averages 80% (lines 22 - 23). In this DNA what percentage of the nucleotides would you expect to contain

(i) phosphate; ..........................................................................................

(ii) guanine? ............................................................................................. (2)

(e) (i) Use your knowledge of enzymes to explain why restriction enzymes only cut DNA at specific restriction sites.

.............................................................................................................

.............................................................................................................

.............................................................................................................

.............................................................................................................

.............................................................................................................

............................................................................................................. (3)

of 108

(ii) Restriction enzymes that can cut the DNA of chromosomes 2 and 3 produce pieces that are too small for analysis. Explain why these restriction enzymes produce small DNA fragments.

.............................................................................................................

.............................................................................................................

.............................................................................................................

............................................................................................................. (2)

(Total 15 marks)

Q66. The resting potential of a neurone is maintained by the unequal distribution of ions inside and outside the plasma membrane. The diagram shows the plasma membrane of a neurone and the three different proteins that are involved in maintaining the resting potential.

(a) Protein C requires ATP to function. Describe the role of protein C.

......................................................................................................................

......................................................................................................................

......................................................................................................................

...................................................................................................................... (2)

S (b) (i) Proteins A and B differ from each other. Explain why different proteins are required for the diffusion of different ions through the membrane.

............................................................................................................. (2)

of 108

(ii) The plasma membrane of the neurone is more permeable to potassium ions than to sodium ions. Give the evidence from the diagram that supports this observation.

.............................................................................................................

.............................................................................................................

.............................................................................................................

............................................................................................................. (1)

(Total 5 marks)

Q67. A flatworm is a simple soft-bodied animal. The diagram shows the movements of an aquatic flatworm in light and in shade. The path followed by the flatworm over a period of three minutes was traced on the side of a tank.

(i) Name the type of behaviour shown. Give a reason for your answer.

Type of behaviour .........................................................................................

Reason .........................................................................................................

...................................................................................................................... (2)

(ii) Suggest one advantage of the behaviour shown in the diagram.

......................................................................................................................

...................................................................................................................... (1)

(Total 3 marks)

of 108

Q68. The diagram shows some of the events which maintain blood glucose concentration in a mammal.

(a) Name

(i) hormone A; .........................................................................................

(ii) organ B. .............................................................................................. (2)

(b) Explain why the events shown in the diagram can be described as an example of negative feedback.

......................................................................................................................

...................................................................................................................... (1)

(Total 3 marks)

of 108

Q69. Read the following passage.

In 1991, nine skeletons were found in Russia. They were believed to be those of Tsar Nicholas II, his family and staff who were killed in 1917 during the Russian revolution. Very small amounts of DNA were isolated from these skeletons. This DNA was used in the polymerase chain reaction (PCR). Genetic fingerprinting was then carried out on this DNA to identify the skeletons.

The chart shows some of the results obtained from the genetic fingerprinting of seven of the skeletons, three children and four adults.

Use information from the passage and your own knowledge to answer the following questions.

(a) Explain why the polymerase chain reaction was used in this investigation.

......................................................................................................................

......................................................................................................................

......................................................................................................................

...................................................................................................................... (2)

(b) In the polymerase chain reaction, DNA is heated to 95 °C and nucleotides, enzymes and DNA primers are added to the mixture.

(i) Explain why the DNA is heated to 95 °C.

.............................................................................................................

............................................................................................................. (1)

of 108

(ii) What are DNA primers?

.............................................................................................................

............................................................................................................. (1)

(iii) Why are DNA primers added during the polymerase chain reaction?

.............................................................................................................

............................................................................................................. (1)

(iv) What is the advantage of the enzyme used in the polymerase chain reaction being thermostable?

.............................................................................................................

.............................................................................................................

.............................................................................................................

............................................................................................................. (2)

(c) Describe how genetic fingerprinting is carried out.

.......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

...................................................................................................................... (6)

of 108

(d) All three children on the chart had the same parents. One of the parents was Adult 1.

Which of the other three adults on the chart was the other parent? Give the reason for your answer.

......................................................................................................................

......................................................................................................................

......................................................................................................................

...................................................................................................................... (2)

(Total 15 marks)

Q70. ‘Take-all’ is a disease of wheat caused by a fungus. It can cause serious damage to the crop.

There is no gene for resistance to this fungus in wheat. There is, however, a gene for resistance to this fungus present in oats.

The diagram shows how this gene might be transferred to wheat.

of 108

(a) (i) The wheat plant with the resistance gene contains recombinant DNA. What is recombinant DNA?

.............................................................................................................

............................................................................................................. (1)

(ii) The plasmids act as vectors for the resistance gene. What is a vector?

.............................................................................................................

............................................................................................................. (1)

(iii) Suggest how cells with the resistance gene might be selected.

..............................................................................................................

.............................................................................................................

.............................................................................................................

............................................................................................................. (2)

(b) A laboratory has oat plants containing the resistance gene and a supply of plasmids.

Describe how bacteria may be produced which have the resistance gene in their plasmids.

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

...................................................................................................................... (6)

(Total 10 marks)

of 108

Q71. (a) The diagram shows structures present in an ovary during an oestrous cycle of a mammal.

(i) Starting with structure A, give the structures A to E in the order in which they appear in an oestrous cycle.

A …… …… …… …… (1)

(ii) Which of these structures produces most of the progesterone during an oestrous cycle?

(1)

(iii) Describe one effect of progesterone on the uterus.

.............................................................................................................

............................................................................................................. (1)

of 108

(b) The graph shows the concentration of the hormones LH and FSH over 40 days.

(i) On which day would you expect this mammal to ovulate?

............................................................................................................. (1)

(ii) Give the evidence from the graph which shows that pregnancy did not occur.

.............................................................................................................

............................................................................................................. (1)

(Total 5 marks)


Ways in which different species of organisms differ from each other

You should select and use information from different parts of the specification. Credit will be given not only for the biological content but also for the selection and use of relevant information, and for the organisation and presentation of the essay.

(Total 25 marks)

of 108


The transfer of energy between different organisms and between these organisms and their environment

You should select and use information from different parts of the specification. Credit will be given not only for the biological content but also for the selection and use of relevant information, and for the organisation and presentation of the essay.

(Total 25 marks)

Q74. (a) Figure 1 shows part of a myofibril from skeletal muscle.

Figure 1

(i) Describe two features, visible in the diagram, which show that the myofibril is contracted.

1 ..........................................................................................................

.............................................................................................................

2 ..............................................................…........................................

............................................................................................................. (2)

of 108

(ii) Explain the role of calcium ions and ATP in bringing about contraction of a muscle fibre.

Calcium ions ................................................................................……

.............................................................................................................

.............................................................................................................

ATP .....................................................................................................

.............................................................................................................

............................................................................................................. (3)

(b) Figure 2 shows the structure of a neuromuscular junction. The vesicles contain acetylcholine.

Figure 2

(i) An action potential is generated at the cell body of the motor neurone. Explain how this action potential passes along the motor neurone to the neuromuscular junction.

.............................................................................................................

.............................................................................................................

.............................................................................................................

.............................................................................................................

.............................................................................................................

............................................................................................................. (3)

of 108

(ii) When the action potential arrives at the neuromuscular junction, it results in the secretion of acetylcholine into the synaptic cleft. Explain how.

.............................................................................................................

.............................................................................................................

.............................................................................................................

.............................................................................................................

.............................................................................................................

............................................................................................................. (3)

(c) Between the ages of 20 and 50, 10% of total muscle mass is lost. Between the ages of 50 and 80, a further 40% of the original total muscle mass is lost. Most of the muscle lost consists of fast fibres.

(i) Plot a graph on the grid below to show the percentage of muscle mass remaining between the ages of 20 and 80. Assume that the rate of muscle loss in each age range is constant.

(3)

of 108

(ii) Explain why explosive exercises, such as sprinting and weightlifting, will be more affected by this muscle loss than aerobic exercises, such as jogging.

.............................................................................................................

............................................................................................................. (1)

(Total 15 marks)

Q75. (a) Figure 1 shows part of a myofibril from skeletal muscle.

Figure 1

(i) Describe two features, visible in the diagram, which show that the myofibril is contracted.

1 ..........................................................................................................

.............................................................................................................

2 ..............................................................…........................................

............................................................................................................. (2)

of 108

(ii) Explain the role of calcium ions and ATP in bringing about contraction of a muscle fibre.

Calcium ions ................................................................................……

.............................................................................................................

.............................................................................................................

ATP .....................................................................................................

.............................................................................................................

............................................................................................................. (3)

(b) Figure 2 shows the structure of a neuromuscular junction. The vesicles contain acetylcholine.

Figure 2

(i) An action potential is generated at the cell body of the motor neurone. Explain how this action potential passes along the motor neurone to the neuromuscular junction.

.............................................................................................................

.............................................................................................................

.............................................................................................................

.............................................................................................................

.............................................................................................................

............................................................................................................. (3)

of 108

(ii) When the action potential arrives at the neuromuscular junction, it results in the secretion of acetylcholine into the synaptic cleft. Explain how.

.............................................................................................................

.............................................................................................................

.............................................................................................................

.............................................................................................................

.............................................................................................................

............................................................................................................. (3)

(c) Between the ages of 20 and 50, 10% of total muscle mass is lost. Between the ages of 50 and 80, a further 40% of the original total muscle mass is lost. Most of the muscle lost consists of fast fibres.

(i) Plot a graph on the grid below to show the percentage of muscle mass remaining between the ages of 20 and 80. Assume that the rate of muscle loss in each age range is constant.

(3)

of 108

(ii) Explain why explosive exercises, such as sprinting and weightlifting, will be more affected by this muscle loss than aerobic exercises, such as jogging.

.............................................................................................................

............................................................................................................. (1)

(Total 15 marks)

of 108

of 108

write an essay on the topic below. the causes of...

Documents