you magazine

edition7.7.10

summer

inside:Red Hat Society

Make your summer party a success

Shedding light on skin cancer

Local Fond du Lac Calendar of Events

y | YOU SUMMER Edition | JULY 7, 2010 | www.fdlreporter.com2 y | YOU SUMMER Edition | JULY 7, 2010 | www.fdlreporter.com

Y o U M A G A Z i n E S t A F F

FoR AdVERtiSinG inFoRMAtion, CALL JEN MEMMEL AT 920.907.7901

made just for you.

General Manager / Richard Roesgen

Advertising Director / Joe Bembnister | Advertising Manager / Jen Memmel

Graphic Artist / Heather nohr

PAGE 3 Red Hat Society’s Marlene Berenz of Fond du Lac attends the Red Hat Society crowning of the new Queen Bee at the Senior Center.

on the cover

inside 3 Red Hat Society Fond du Lac’s Red

Hat Honeys

your home &entertaining 4 How to Make your

summer party a Success

5 Recipes A refreshing take on tea

6 How to Make your Home Healthier for your Family

your relationships 7 Family Travel Unplugged

your healthy living 8 Post-Workout Protocol

your hair andskin care 8 Shedding light on skin

cancer 9 Hair yesterday, gone

today? calendar of events 10 April, May & June 2010

events in the Fond du Lac area

your finances 11 FVS Bank column

Need a career with a future but not sure how to fit college into your busy schedule?

Check out Moraine Park’s FLEx degrees.

morainepark.edu/flex3

Degreesthat

fit yourschedule.

MORAINE PARK TECHNICAL COLLEGE

5001134477

5001

1337

80

y | YOU SUMMER Edition | JULY 7, 2010 | www.fdlreporter.com 3y | YOU SUMMER Edition | JULY 7, 2010 | www.fdlreporter.com

Tthe Red Hat Society is alive and well in Fond du Lac and have been kicking up their heels ever since the local Red Hat Honeys chapter was formed in 2002.

Available as one of the programs offered through the Fond du Lac Senior Center, the fun-loving group of women at age 50 begin to wear red hats and purple attire and often initiate some light-hearted antics and crazy events. Although any woman over 18 can join (under 50 requires a pink hat), the majority are near 50 or beyond.

“the only requirements are to be willing to wear a red hat and purple clothing – and to pledge that you will ‘practice having fun,’” said dottie Winkelmann, director at the Senior Center and a member of the Red Hat Honeys. “the Red Hat Society is all about having fun and friendship after 50 and connecting with other Red Hat women all over the world.”

the local group is part of the international Red Hat Society based in California and started in 2001 by Californian Sue Ellen Cooper who had been giving a red hat to each of her friends as they turned 50. the group of ladies began to wear their red hats to birthday outings, teas and luncheons. the idea developed and mushroomed to more than a million members worldwide.

“Being a member of Red Hats is a time when we can dress up with gloves, have tea and yet we don’t have to act all prim and proper,” Winklemann grinned. “it’s a different attitude – we call it ‘hattitude’ – it’s comical, unconventional and a bit out-of-the-ordinary, but always respectful.”

the FdL Senior Center is the “hive” or headquarters for approximately 80 Red Hat Honeys. Every six months, a new Queen Bee is crowned to rein as royalty over the group. the Queen, along with her appointed court of honor, and the rest of the worker bees make the fun fly. there are no monthly meetings to attend and no Roberts Rules to follow. the fun just happens due to the camaraderie and creativity of the women.

take the recent bubble wrap party, for example, where guests did everything imaginable with the clear ‘pop-it’ wrap. Party favors at the place settings featured real bubbles and handmade bubble wrap coin purses containing a penny. Bubble wrap appeared on hats, outfits and who knows what else.

“We’ve had so many wild and crazy parties and activities over the years. You name it, we’ve done it,” Winklemann said. “i think the only party we

haven’t had yet is a duct tape Party, but we’ve talked about it.”

tours to places like Kohler and lunch outings to restaurants like Country Craft Barn, near Plymouth, have been highlights as well. A belly dance instructor taught the women some moves over lunch at one memorable and humorous occasion.

“this group is really my cup of tea,” Winklemann said, noting she is also a member of the Red Hatter’s sub-group, the Umbrella Brigade, where they perform for area audiences by dancing, twirling and tapping umbrellas to the rhythm of rain-themed songs.

A Red Hat chorus made up of members puts on a humorous show of music to audiences, where silly limericks are substituted for the real words of familiar tunes. the clown group, Queens Club, Scrapbook Keepers and Good deeds Gals are some of the other groups some members choose to get involved with.

Member Elaine Katzfey, 69, a former Queen Bee, recalls some mischievous fun she and her court of honor planned during her recent rein. they threw a mystery dinner. What you got to eat was a mystery. Menu items and the silverware were given odd names so guests couldn’t detect what they were ordering. ice cream was Pikes Peak. Jello was called Elvis Presley. A fork was a Landing net.

“We brought things to them in the order they requested them,” Katzfey said. “Some ended up with dessert first. one lady had to eat her dessert with a celery stick because she hadn’t ordered a Landing Stick (fork).

“i guess if you can’t have fun when you get over 50, when can you?” Katzfey smiled.

Current Queen Bee, Cathy Stratz, 56, moved here from Virginia and joined two years ago because her mother-in-law, who was in the Red Hat chorus, made it sound like so much fun. “i joined the chorus too,” Stratz said, noting she hopes to attract new members during her rein as Queen. “i want to spread the word that we Red Hats have a lot of fun.”

Winklemann said she knew the Fond du Lac group was going to be a success when she asked at the very first tea in 2002 how much fun each of the tables of women were having. “one of the ladies stood up on the table to demonstrate,” Winklemann chuckled. “the fun hasn’t stopped since.”

Red Hat Honeys still turning out Queen Bees from their FDL“Hive”

How to join the Red Hat Honeys

Women can join at any time during the year. Registration forms are available at the Fond du Lac Senior Center, 151 E. 1st St. The cost to join is $15 per year -- $5 goes to your membership as a Red Hat Honeys member and $10 denotes you are also a member of the Senior Center Friends organization. Upcoming events include an Aug. 11 School Daze tour in Ripon and a Sept. 9 luncheon at Country Crafts Barn. For more information, call the FDL Senior Center at 322-3630.

tHE REPoRtER PHoto BY JUSTin COnnAHER

BY DOROTHY BLiSKEY | SPECiAL to tHE REPoRtER


As the sun shines brightly and temperatures rise, the party season officially is upon us. Mother nature can bring plenty to a party, but your own unique additions will guarantee your shindig is a hit.

Making sure everyone has fun requires attention be paid to multiple elements, both big and small. no matter how alluring the host is, bad food or music can send guests running for the hills.

it’s all about mixing traditional and contemporary ideas, and being prepared.

Food, Glorious Food

You can’t go wrong with traditional favorites, be they finger foods or entire meals. But in an age where many people are experimenting with new culinary ideas, consider bringing some new food choices to the party. Many local grocery stores now carry exotic prepared or packaged foods.

if you insist on sticking with the classics, there are new ways to present them. if you’re grilling, hot dogs and hamburgers can be decorated with interesting toppings - such as spicy peppers, guacamole, pesto or tapenade. other meats can be marinated in exciting flavors. Before chowing down, check if any guests have dietary restrictions.

Play That Funky Music

the right tunes can make or break a party. depending on the people attending, selecting the right music

can be difficult. it’s generally a bad idea to put one person in charge of all the music, as this can lead to micro-managing and questions about taste. But new technology makes it all so much easier with new music players and the internet available to help.

one innovative and easy option is to mix internet radio with your favorite song playlist, using one of the new compact music hubs on the market, such as the Vtech iS9181. this device costs less than $150 and connects to any digital audio player like an iPod and can access more than 11,000 free internet radio stations plus FM radio, as well as the music saved on any Wi-Fi-enabled computer. its high-fidelity stereo speakers and integrated subwoofer provide a great punch for parties. For more information, visit www.vtechphones.com.

doing it yourself is definitely cheaper than hiring a dJ and you even can play tunes from your guests’ iPod or

other MP3 players.

Decorate and Coordinate

nobody is saying your home isn’t nice, but adding a few celebratory decorations can make a party more memorable. You can opt for store-bought decorations, but getting people involved in fun crafts projects can be more enjoyable.

if you want to get really creative, choose a theme -- anything from a particular decade to a specific locale to a special event. Alert guests about the theme and they’ll have the opportunity to contribute to the idea by making their own decorations. this communal concept can culminate in a memorable time.

Everyone hosting or attending a party wants to have fun. By staying on top of it all and getting others involved, you can send guests home happy.

T h e r a p e u t i c M a s s a g e L L C

5001133990

For More Details Call

Offer expires 8/31/10.

Not good with any other offers

or discounts

20% Off Your Next Massage with Tim!A Variety of

Packages to Fit

Your Needs!

74 S. Main St. Suite 301Fond du Lac, WI 54935

[email protected]

1680 Pine Ridge CourtMayville, WI 53050

Want No Knots”“Have Knots,(920)-539-8289

www.galleryframe.net

5001133982

� Family Portraits� Heirlooms� Wedding Photos� High School Seniors

� Shadow Boxes� Sports Memorabilia� And More

Gallery &Frame Shop

Mon thru Fri 9:30am-5:00pm

Sat 9:30am-4:00pmWed ‘til 7:00pm

94 S. MAIN ST | FOND DU LAC | 921-1144

Let Us Custom Frame Your Memories!Celebrating 3

5Years in Business

(1975-2

010)

Summer Party

How to make your

a successStAtEPoint MEdiA

your

hom

e & en

terta

inin

g


A refreshing take onTeaFAMiLY FEAtURES

❑ 2 cups boiling water

❑ 4 Lipton Bavarian Wild Berry Pyramid tea Bags

❑ 1/2 cup sugar

❑ 1 cup chopped strawberries

PREPARATiOn TiME:10 minutes

FREEzE TiME: 4 hours

MAkES 8 SERviNgS

Pour boiling water over tea bags; cover and brew 5 minutes. Remove tea bags and squeeze. Stir in sugar until dissolved; let cool slightly.

Combine tea with strawberries in medium bowl. Evenly pour into 8 (4-ounce) paper cups (or popsicle molds). Freeze until al-most firm, about 1 hour. insert wooden ice pop sticks into centers; freeze until firm. to serve, press firmly on bottom of paper cup to remove.

VARiATiOnS:

For island Mango & Peach Fruit-tea Pops, use Lipton White tea with island Mango & Peach Flavors Pyramid tea Bags and 1 cup

chopped peaches.

For Green tea & Mandarin orange Fruit-tea Pops, use Lipton Green tea with Man-darin orange Flavor Pyramid tea Bags and 1 cup blueberries.

For Black Pearl Fruit-tea Pops, use Lipton Black Pearl Black Pyramid tea Bags and

1 cup mixed berries (raspberries, blueber-ries and/or strawberries).

For Harvest Strawberry & Passionfruit-tea Pops, use Lipton Red tea with Harvest Strawberry & Passionfruit Flavor Pyramid tea Bags.

Fruit-Tea PopsFruit-Tea Pops

PREPARATiOn TiME: 15 minutes

CHiLL TiME: 2 hours

❑ 4 cups boiling water

❑ 12 Lipton tuscan Lemon Flavored

❑ Black Pyramid tea Bags

❑ 1/2 cup sugar

❑ 3 cups pineapple juice

❑ 1 cup orange juice

❑ 2 cups raspberries

Pour boiling water over tea bags; cover and brew 5 minutes. Remove tea bags and squeeze. Stir in sugar; chill.

in large pitcher, combine 2 cups chilled tea with remaining ingredients; chill.

Meanwhile, in 2 ice cube trays,* arrange 3 raspberries in each compartment. Pour remaining chilled tea over berries. Freeze 2 hours or until solid. to serve, pour punch into large pitcher or bowl. Add tea ice cubes. Serve immediately.

*if you don’t have ice cube trays, try using mini muffin pans or a 6-cup ring mold.

MAkES 8 SERviNgS

Fruity TeaIce CubesFruity Tea Ice Cubes

Tea can always be enjoyed as a simple, soothing cup of comfort. But with so many flavors and varieties available, tea lovers are discovering entirely new ways to enjoy their favorite brew.

Tea-drinking trends find people infusing their tea with fruit and other flavors, and experimenting with tea in recipes. These recipes from Lipton showcase the rich, ripe flavors of whole leaf teas infused with fruit and flavor. From frozen pops to tropical punch, cool smoothies to hot, spiced chocolate tea, you’ll find a refreshing take on tea that just might make your day.

Tea and a Healthy Lifestyle

keeping your body hydrated can help maintain overall well-being. Unsweetened tea is an excellent beverage for hydration. This con clusion is based on the Healthy Beverage guidelines that were created by a panel of independent scientists under an unrestricted grant from Unilever. Tea may help maintain a healthy lifestyle — for example, drinking 2 to 3 cups of tea throughout the day, as part of a healthy diet, may help maintain healthy vascular function.

For more recipes and information about Lipton’s Pyramid teas, visit lipton.com.

Bavarian Wild Berry Tropical Punch with

your

hom

e & en

terta

inin

g


Look for Green Cleaners

The right cleaning products can make your house spic and span. But many traditional cleaners contain solvents and chemicals that can be harmful to you and the environment. Mixing different types of cleaners, like bleach and ammonia, also can cause health problems -- including coughing, nausea and even pneumonia. And other cleaners containing phosphates and chlorine can harm the environment.

Fortunately, there are less-hazardous, environmentally-friendly cleaners now available. You even can mix your own eco-friendly cleaners at home, using non-toxic ingredients like vinegar, baking soda and water. A variety of recipes can be found by searching the internet.

As we learn more about how contaminants circulate inside our homes, more families are realizing a dirty home isn’t just an eyesore, but also could be a health hazard.

your

hom

e & en

terta

inin

g

Keeping your family healthy is about more than just making sure everybody eats right and get plenty of rest. Your home itself plays an important role in your health and especially that of young children.

Maintaining a visibly-clean home isn’t enough, as what you can’t see can be harmful. Airborne contaminants and irritants, such as bacteria, mold and pollen can circulate through homes that appear clean. And chemicals in some cleaning products also can be damaging to your family and pets.

“According to the Environmental Protection Agency, the air

in an average home has two to five times more pollutants than outdoor air. these include dust, mold, carcinogens and other toxins that can severely affect the health and well-being of your family,” says certified green building professional Lisa Beres of Greennest.com, who provides consultations to help people make their homes healthier.

Here are a few ideas to keep your home, your family and your planet clean and safe:

Check those Linens dust mites and bacteria tend to collect in large numbers in your blanket, pillows and bed sheets. these types of microbes can trigger asthma and allergies.

Washing linens once a week in hot water is a good way to kill bacteria, but there also are products that help. these include mattress barrier covers, which are woven tight enough that allergens can’t penetrate them. A variety of

bedding materials, including wool and natural rubber, are perfect for repelling dust from the average bed, which can potentially house millions of dust mites.

Clean the Air Even with all the corners and crannies of your home nicely scrubbed, many microbes, ragweed and pollen could be circulating through the air, contributing to allergy and asthma symptoms. there are several simple ways to air out your living space, like opening the windows, but nothing works as efficiently as a reliable air purifier.

“You definitely want to use an air purifier,” stresses Beres, who recommends the Sanyo Air Washer Plus. “it literally uses the power of water to clean the air and suppress the spread of bacteria and germs. it also uses the HEPA filtration system, which removes 99.97 percent of allergens and neutralizes odors.”

it’s all about cleaning the air, just as you do with your home’s surfaces. With this in mind, the portable Air Washer Plus features an air-distribution system that maximizes air flow and helps clean all areas of any room in which it operates. More information is available at us.sanyo.com.

Simple Steps to make your home healthier for your family

STATEPOinT MEDiA


JJust walking out the door for that big family vacation can be hectic. did you pack the kids’ swimsuits? How about sunscreen or bug repellant? did you turn off the lights and lock up?

Compiling a checklist of your vacation necessities and being properly prepared will keep things running smoothly.

Come Prepared no matter the destination, it’s important to pack specific protective products, especially if you’re going somewhere sunny. Sunscreen, band-aids and aloe could end up being the most important things you pack.

now that doctors are aware of the long-term damage caused by sun exposure, don’t forget to pack sun-protective clothing and water-resistant sunscreen. Apply sunscreen liberally, especially on children, who should be protected even if they are sitting under an umbrella for shade.

if you’re in the woods, be especially cautious when it comes to bugs and insects, hiking, open water and fires.

Keep Tabs on the Homestead it’s only natural for a vacationer’s thoughts to turn to the house left behind. if unresolved, these wandering thoughts can ruin a vacation. Keeping a list of all the things you did before leaving the house can provide some peace of mind.

to better track your home while on vacation, consider one of the affordable new home-management systems on the market, such as the Schlage LinK system. this do-it-yourself system starts with a wireless keypad lock on your front door. A unique four-digit code unlocks the front door, simultaneously sending homeowners an email or text-message alert on their mobile phones. Whether it’s a neighbor taking in the mail, or a cleaning lady entering, these systems tell you when somebody enters your home, letting you know who is coming and going.

You also can rely on this new technology to remotely control several home devices, including lighting and the thermostat. this way you can turn lights on and off to simulate activity while away and can crank up the air

conditioning when you’re nearing home. Partner the system with an optional Schlage network camera and you can keep tabs on your home from an internet-enabled computer or cell phone. For more information, visit www.link.schlage.com.

Keep Kids Busy Whether it’s a portable video game or a dVd, you’ll want to keep young ones occupied while in transit. Consider giving small children a coloring book or sketchpad. this will serve as a more creative outlet than staring at a screen.

if you’re looking for a simpler activity, try one of the many free printable games available online at such sites as kidprintables.com or abcteach.com. Better yet, involve yourself in games so the entire family can interact. Fun family activities include keeping a travel journal, visual scavenger hunts and sing-alongs.

Whether it’s a road trip to your favorite uncle or a family vacation to an exotic destination, taking the time to plan can make it more enjoyable.

for that familyVacationGet ready

STATEPOinT MEDiA

your

rela

tions

hips

backinact ionrehab.com

NEW HOLSTEIN • 920.898.4440FOND DU LAC • 920.922.7776 MAYVILLE • 920.387.9000 KEWASKUM • 262.626.6700

5001133799

Tell your doctor you want therapy that gets results. Ask for BACK IN ACTION!


your

hai

r and

skin

care

the skin is our body’s largest organ. Skin is exposed daily to the elements - sun, wind, rain and all kinds of microscopic organisms. it should be no surprise that skin cancer is the most common form of cancer among Americans. Fortunately, skin is strong, waterproof and capable of repairing itself. it’s also highly visible; so skin cancer is in some ways easier to detect and treat than a cancer on an internal organ.

there are several types of skin cancer. Medical professionals often make the distinction between melanoma and nonmelanoma skin cancer.

According to a current study, the number of nonmelanoma skin cancers increased by about 76 percent during the period from 1992 to 2006.

Most of these skin cancer cases were either basal cell or squamous cell carcinoma. Both are highly associated with exposure to the ultraviolet radiation, and providers see a link between these cases and the coming of age of a generation of sun worshipers.

in the 60’s, there became an increasing attractiveness to sun baking bodies at beaches. it was considered embarrasing to appear on the beach or even in the office, until a certain degree of tanning had taken place. Sun lamps and tanning bed came into vogue.

“these attitudes are still entrenched, and we would like to educate our patients and change this minds set,”

says Burt Steffes, Md, a board-certified dermatologist with Agnesian HealthCare’s dermatology & Skin Care services. “We are particularly concerned in the increase of case we see among young people, even teenagers.”

in normal skin, new cells push older ones upward toward the skin surface where they die and are sloughed off. Cancer occurs when the orderly pattern of renewal is disrupted because of damage to dnA.

Most of this damage occurs as a result of exposure to UV radiation from the sun and tanning beds.

“the greater the exposure, the higher the risk and that’s why skin cancer, at least until recently, occurred later in life,” says dr. Steffes.

nonmelanoma skins cancer, if detected early is highly treatable. they rarely spread to other parts of the body.

Early detection is key. this is a good reason to check your skin regularly and to have your provider complete a complete skin exam if you are over 40 and particularly if you have risk factors.

What you are looking for are growths that qualify for the acronym ABCdE:

• Assymetrical in shape

• Border that is irregular or notched

• Changes in color

• Diameter larger than a quarter of an inch

• Evolving in size, color and shape

to help prevent skin cancer, it is best to apply sunscreen daily to skin that is exposed - preferably with an SPF of 50 or greater. Avoid the sun when it is the strongest between 10 a.m. and 2 p.m. tanning beds are not healthy and should also be avoided.

Agnesian HealthCare’s dermatology & Skin Care services features three board-certified dermatologists, including: James Schuster, Md, Burt Steffes, Md and Michael tjoelker, Md.

Agnesian HealthCare offers quality care close to home. Serving Fond du Lac and dodge counties

with providers in Fond du Lac, Mayville, Ripon and Waupun. Call (920) 926-8722 for more

information.

Shedding lighton skin cancer

MOLLY HAACK

As summertime workouts heat up, proper post-exercise cool-downs become even more important. Whether you are a weekend warrior playing in local summer leagues or a serious runner getting ready for fall marathon season, warmer weather activities increase sweat, break down muscles and deplete the body of electrolytes and other essential nutrients. While most people know what to do before and during a workout to keep their bodies fit during the warmer summer months, many fall short when it comes to following a proper post-exercise routine.

Fitness expert Lorrie Henry says, “What you do after your workout is just as important as a pre-workout routine, especially during the summer when people tend to be more active.” Henry has shared some of her post-workout tips to help everyone have a fun and healthy summer season:

Cool It: Take the time to cool-down after an intense workout. Spend the last five to seven minutes of the workout on a lower speed or intensity to return your heart rate to normal, and consider walking the last two minutes on a treadmill.

Stretch Out: Avoid next day soreness and stretch your muscles immediately after exercise. Do the basic arm and leg stretches and move your joints by rotating your wrists, ankles and neck a few times.

Keep Track: Write down what you did during the workout (i.e. miles ran, fitness classes attended, etc.) to help keep you on target with your fitness goals.

Refuel Smart: After a tough workout, grab a nutrient-rich drink for maximum benefits. Henry shared, “it’s essential to get protein back into your body to help rebuild and repair muscles. ice-cold chocolate milk, such as protein fortified low-fat Rockin’ Refuel from Shamrock Farms, tastes delicious and helps your body recover after exercise with 20 grams of protein and nine essential nutrients -- making it a great on-the-go choice after a game or workout.”

Take A Breath: Take a few minutes to relax and reflect on what you have accomplished. Whether you are focused on fun, fitness or both, keeping an eye on and acknowledging where you have been and where you want to go can be a great motivator.

Remembering simple tips can help maximize your summer workout. For more information on the healthy benefits of refueling with chocolate milk, please visit RockinRefuel.com.

Post-Workout ProtocolExperts Say Post-Workout Routines Are Critical for Summer Exercise

FAMiLY FEATURES


5001131655

��

��

��

��

��

��

��

��

��

��

��

YM710

Hair yesterday,

5001134083

Introducing Our New State-of-the-ArtVirtually Painless Laser Hair Machine

Clinic Of Medical Electrolysis

Nancy Neusen RE Registered Electrologist

and Laser Technician145 N. Main St.

Fond du Lac • 923-3106

C

N

F

LOOK GREAT FOR SUMMER!• Backs • Legs • Ears• Shoulders • Chest

• Underarms • Bikini• Upper Lip

Laser Hair Removal For Men & Women

As a young adult, you saw men on the television with a receding hairline. You never paid much mind to it, but now, you might be that man. When it happens to you, you fully understand what hair loss is about.

Agnesian HealthCare’s dermatology & Skin Care, 145 n. Main Street, Fond du Lac, offers full service treatments for both male and female hair and pattern baldness.

By age 30, at least 25 percent of American men have lost enough hair to be noticed. in most cases, there is little they can do about a condition known as androgenetic alopecia or patterned baldness.

“the pattern of baldness and timing of hair loss is primarily genetic,” says Michael tjoelker, Md, a board-certified dermatologist with Agnesian HealthCare’s dermatology & Skin Care. “Contrary to popular belief, this gene can come from either parent. Both mothers and fathers carry the trait.”

Some women are affected, but to a lesser degree and usually later in life. Women experience mostly a thinning of hair on the crown around the part and rarely the complete balding that might occur in men.

there are topical treatments on the market, specifically Rogaine (minoxidil), that are available without a prescription. this isn’t a quick fix and those using Rogaine see 33 percent hair re-growth within four months and 26 percent to moderate to dense re growth.

if minoxidil is not effective, another option is Propecia (finasteride). this product is available by prescription only and is taken daily in a pill format.

“When Propecia is effective, you will experience a gradual filling of bald spots on the crown or front of the scalp,” says dr. tjoelker.

When using medication like Rogaine or Propecia, you must use the product indefinitely. if you quit, you will loose your new hair within three months and may be disappointed to find that your balding area is larger.

Other diseases that cause hair loss are

• Alopecia areata - an autoimmune disease

• Telogen effluvium - a disruption in the normal cycle of the scalp hairs due to diet or trauma

• Traction alopecia - caused by cornrows or tight braiding that damage the hair follicles

• Trichotillomania - caused by hair pulling disorders

Some men and women deal with the symptoms of hair thinning and loss by ignoring them, shaving, wearing hats or using creative hair styles. if you have concerns about patchy or unusual hair loss, consult your provider to assist in a course of treatment.

Agnesian HealthCare’s dermatology & Skin Care offers quality care close to home, serving in Fond du Lac, Mayville, Ripon and Waupun. Call (920) 926-8722 for more information.

Agnesian HealthCare’s dermatology & Skin Care services features three board-certified dermatologists, including: James Schuster, Md; Burt Steffes, Md; and Michael tjoelker, Md.

gone today?MOLLY HAACK

your

hai

r and

skin

care


mondays■ Music Under the Stars ConcertButtermilk Creek Park, S Park Ave, 7-8:30pm, Free admission

tuesdays■ Big Band TuesdaysWindhover Center for the Arts, 51 Sheboygan St., 7:30-10pm. Free admission. 920-921-5410. www.windhovercenter.org. First and third tues-days of every month.

wednesdays■ Windhover WednesdayWindhover Center for the Arts, 51 Sheboygan St., 11:30-1:30pm Free admission, 920-921-5410, www.windhovercenter.org; Enjoy some of the area’s finest music and enjoy great cuisine served up by Fond du Latte. Lunch specials in-clude: fresh sandwiches, salads, desserts, cof-fee/tea, wine, and other refreshments. Great midweek break or get together with friends.■ Farmers Marketdivision and Sophia Streets, 2-6pm, Free ad-mission, 920-921-9500■ Buttermilk Festival - First Brigade BandButtermilk Creek Park, S Park Ave., 7:15-9pm. Free admission; www.fdlsymphonicband.org. outdoor concert. 920-907-7678

saturdays■ Farmers MarketWestern Ave and Linden St., 6:30am-noon. Free admission, 920-921-9500

wednesday - monday, july 7-12■ Joseph and the Amazing Technicolor DreamcoatGoodrich Little theater, 72 W. 9th St., 7:30pm Wed-Sat, 2pm Sat-Sun. $14, Chilren 12 & under $10. 920-923-2206, www.fdlct.com. it is based on the biblical story of Joseph and his sons. “Joseph,” “the dreamer,” has dreams that turn out to be prophetic. First written as a school as-signment by composer Andrew Lloyd Webber.

sunday, july 11■ Garden WalkArea Gardens, 11-6pm. $10, 920-926-4997, [email protected]. tickets available at St. Agnes Hospital information desk.

friday-sunday, july 16-18■ Women’s 4 Game Guaranteed Slow Pitch TournamentLakeside Park diamonds, Promen dr., Free admission. 920-906-6667, [email protected], www.fonddulacsoftball.com. Contact Renee Wagner for registration fees and infor-mation.

saturday-sunday, july 17-18■ Dog Agility Trialn5480 deneveu Ln., 9-4pm, Free admission. View the exciting sport of dog Agility outside the kennel club grounds. Food and refresh-ments available. Come and cheer on your fa-vorite breed.

tuesday-sunday, july 20-25■ Fond du Lac County FairFdL Cty Fairgrounds, Hwy 45-S, 8am-midnight. Admission is charged. www.fonddulaccounty-fair.com. Exhibits, carnival, foods, and conces-sions. Grandstand shows included with general admission.

saturday-sunday, july 24-25■ Paddle Power and Sail’s Lake FestLakeside Park, Sat Frazier Point and Sun Light-house Harbor, Sat 9-5pm, Sun noon-4pm. Free admission. 920-921-7323, [email protected], paddlepowerand-saillakewinnebago.org. Rain or shine. Featuring boat building for kids, and other activities for children and adults.

monday-sunday, july 26-august 1■ EAA AirVentureWittman Regional Airport, oshkosh. 16 miles n of FdL, Hwy 41, times vary. Member/non-Member, daily & Weekly Fees, EAA infor-mation 800-236-4800. www.airventure.org. World’s largest fly-in and aviation convention. Features 10,000 planes and visitors from 70 na-tions. Shuttle service daily, every 1/2 hour, from Fond du Lac Airport to event site. Fond du Lac information 800-937-9123.

saturday, july 31■ Prairie FestUW-FdL, 400 University drive, 10-3pm. Free admission, fdl.uwc.edu/arboretum. An envi-romental fest for the whole family. Children’s activities, tours of the prairie. Programs on wolves, butterflies, bats, birds of prey and on-going activities all day.

sunday, august 8■ Holy Family FestivalFdL Cty Fairgrounds, Rec Bldg, Hwy 45-S, 10:30am. Free admission. Mass at 10:30 fol-lowed by Festival. Food, fun, games, raffle.■ A zoopolis Tour - nature in the CityVarious locations throughout Fond du Lac and surrounding communities, 11-6pm, $10. 920-922-7931, [email protected]. the tour features 6-7 private yards that encourage bio-diversity and offer habitat for wildlife.

wednesday-thursday, august 11-12■ Alto FairHwy EE and AF, Alto, 7am. Free admission. [email protected]. 4-H exhibits, tractor pulls, entertainment, and parade at 1pm thursday. Free admission and free parking

friday-sunday, august 20-22■ Wisconsin Big Bird Air ShowWellnitz Field, 2.5 miles S of Hwy 41 on Hickory Rd., 9-4pm, $3 per car. 920-926-0551, [email protected], www.fdlaa.com. one of the largest displays of large, flying remote control aircraft in the Midwest. Features amazing “Big Birds”, the largest RC aircraft. Huge warbirds, classic aircraft and sports planes. Great family fun. Food and refreshments for sale.

saturday-sunday, august 21-22■ Race the LakeLakeside Park, n Main St., 800-429-8044, [email protected], midwest-sportsevents.com. Sat. Kids duathlon 8am, Sun. adult bike event 5:50am ends at Lakeside Park. 94-mile scenic cycling race around Lake Winnebago.■ ice Cream Social, Vintage Car & Craft Show336 old Pioneer Road, Sat 9-5pm, Sun 9-4pm, $5, children 6 & under free. 920-922-0991, [email protected], www.fdlhistory.com. ice cream social, vintage autos from 1900s-today, artisans will demonstrate folk arts along with a craft sale. Food and refreshments available.

sunday, august 22■ Arts & Crafts FairWade House, Greenbush, 18 mi E of FdL, Hwy 23, 9-5pm, $3.50. 920-526-3271, [email protected]. Artisans and crafts peo-ple display and sell their wares. Baskets, grape-vine wreaths, handmade lace, jewelry, woodens bowls, and more.

saturday, august 28■ Eisenbahn Marathon and Half MarathonEisenbahn trail in Fond du Lac and Washington Counties, 6am. Entry fee required. Spectators free. 262-335-6892, [email protected], www.adrenalineraces.org. Eisenbahn is a German Word for railroad and the Eisenbahn trail is built on a former railroad corridor. the trail is 25-miles extending from the historic city of West Bend into the scenic countryside of eastern Wisconsin past the glacial landscape of the Kettle Moraine State Forest. the full mara-thon will begin in Eden and will leave the trail periodically and head out on to the rural, scenic roads of the Kettle Moraine area. A mostly flat route, the course is USAtF Certified. the trail is surfaced with limestone screenings for about 20 miles from Eden to northwestern Avenue in West Bend. Racers will finish the event on paved asphalt trail in West Bend. this is a point to point race. Participants will be transported to their respective starting lines.

sunday, august 29■ Fun Day on the FarmVilla Loretto, n8114 County WW, Mt. Calvary, 10:30am. Free admission. 920-753-3211, [email protected]. Polka Mass, Hay Rides, En-tertainment, Game tent, Food - Bakery, Pet-ting Zoo, Crafts, Face Painting, Raffle & door Prizes.

saturday-sunday, september 4-5■ Wisconsin Street Rod Show & Corn RoastFdL Cty Fairgrounds, Hwy 45-S, 8-4pm. Pa-rade Sat. 10am. Corn Roast Sun 11am, Adults $5, seniors $4, children under 12 free. 262-250-9505, www.WiRod.com. See 700 street rods, watch a parade, enjoy a corn roast, purchase car parts, and shop for souvenirs.

monday, september 6■ Labor Day Parade and PicnicMain St. and Lakeside Park, oven island, 11am Parade, noon-5pm picnic. Free admission. La-bor day parade begins at 11am on Main Street traveling north to Lakeside Park. Activities be-gin at noon. Live music from noon to 5pm. Food and refreshments available at oven island shel-ter. Free face painting from 1-3pm.

thursday-saturday, september 9-11■ Vintage FestivalRoad America, Elkhart Lake, 800-365-7223, www.roadamerica.com

saturday, september 11■ Fond du Lac Fondue Festivaldowntown FdL, 9-5pm. Free admission. 920-921-9500, [email protected], www.fonduefest.com. downtown’s largest event is a celebra-tion of family, community and culture on Main Street. Kids Zone with fun stuff to do; free en-tertainment, Farmers Market and great food and drink.■ Start Heart WalkMarian University, 45 S. national Avenue, 9am-12pm. Free admission. 414-254-6977, [email protected]. the Start Heart Walk is the American Heart Association’s premiere event for raising funds to save lives from this coun-try’s no. 1 and no. 3 killers - heart disease and stroke. designed to promote physical activity and heart-healthy living, the Start! Heart Walk creates an environment that’s fun and rewarding for the entire family. this year, more than 1 mil-lion walkers will participate in nearly 350 events. Your participation will help us raise even more in our fight to save lives. Walk with friends, family, coworkers or strangers you’ll bond with along the way. Any way you choose to do it, your heart will thank you for it.

monday-saturday, september 13-18■ Clydesdale Ranch - Special Week of ToursLarson’s Famous Clydesdales, 17 miles W of FdL, Hwy 23 n to KK to W12654 Reeds Cor-ner Rd., Mon-Sat 1pm. Adults $15, children $5 age 11 & under. Reservations required. 920-748-5466, www.larsonsclydesdales.com. Cel-ebrate the growth of the newest baby Clydes-dale, born last spring. Close-up view, ranch tour, and grandstand show.

saturday, september 25■ Rienzi Cemetery Walkn6101 Co. trk. K (Rienzi Cemetery) 9:30am. Free admission, [email protected]. Learn early FdL history with a walk to visit gravesites of those who helped to shape the community. Costumed actors will portray historic people. included in the tour are the gravesites of Wis-consin territorial Governor nathaniel P. tall-madge and Civil War General Edward Bragg.

calen

dar of events


5001134093

Knowing when to refinance is tricky, because there is no one right answer, it varies based on your unique family finances. As interest rates are dropping and you are looking to refinance, this was probably not the answer you were looking for; however, here are some techniques for determining your best move.

Knowing your current interest rate?

there is no magic number that your interest rate must go down by in order for you to refinance. Based on rate alone, if your current 30 year fixed mortgage rate is at 6.00% apr and you are looking to refinance into a 30 year fixed mortgage of 4.75% apr, for every $1,000 borrowed

30 YEAR FixED MoRTgAgE 6.00% apr, $1,000 borrowed, $6.00 monthly payment

30 YEAR FixED MoRTgAgE 4.75% apr, $1,000 borrowed, $5.22 monthly payment

now $.78 might not seem like a big difference, but for a $200,000 mortgage the difference is $156.00 a month. that may or may not be substantial for your family budget.

Are you planning on staying in your home for a while?

Generally there are costs associated with refinancing your loan, called closing costs. Closing costs fees can vary from hundreds to thousands. if you are planning on moving in a year or so, you might not be able to recoup the closing costs you would have to pay out in comparison to what you would save on your refinance. Yet, if you are looking to retire in your home you may be able to save money by refinancing now.

Know your break-even point

to determine if refinancing will save you money, calculate your break-even point. You can calculate it by dividing the closing costs by the monthly savings. the answer you get tells you how many months it will take for you to break even. Use the formula below:

MoNTHLY SAviNgS FRoM REFiNANCiNg: $100 a month

CLoSiNg CoSTS: $800 BREAk-EvEN PoiNT: 8 months

What steps to take now?

Shop around for a lender that you feel comfortable working with. the lender will need a variety of documents to start the process including but not limited to: employment, income and assets. once you find a lender you feel comfortable working with, you are ready to start the refinancing process.

How to determine if it is the right time to

your

fina

nces refinance?

BY KiRSTEn QUAM

KiRSTEn QUAM, MARKEtinG diRECtoR

Fox VALLEY SAVinGS BAnK

5001

1367

87

July 20-25, 2010www.fonddulaccountyfair.com

WEDNESDAY, July 21 • 8pm Neal McCoy

THURSDAY, July 22 • 8pm Tractor Pull

FRIDAY, July 23 • 8pm Billy Currington

SATURDAY, July 24 • Noon Lawn Mower Races • 8pm Ted Nugent

SUNDAY, July 25 • 10am Agriland Truck Pull • 2pm-6pm Demolition Derby

TUESDAY, July 20 • 6pm-8pm Pick’n Save Family Night:Seibel Family Musical Performance

WEDNESDAY, July 21 • 6pm-8pm & 9pm-11:45pm Senior Citizen & Military Day: Vic Ferrari

THURSDAY, July 22 • 6:30pm-8pm & 9:30pm-11:45pm Children’s Day: Johnny Wad

FRIDAY, July 23 • 6:30pm-8pm & 9:30pm-11:45pm Oil Can Harry

SATURDAY, July 24 • 1pm-5pm 2 of a Kind • 6pm-8pm & 9pm-11:45pm Back Home Boys

WEDNESDAY, July 21 • Noon-4pm The Downtowners • 6:45pm-8pm & 9:30pm-Midnight The 3rd Degree

THURSDAY, July 22 • 3pm-7pm 2 of a Kind • 8pm-11:30pm Cook & Belle

FRIDAY, July 23 • 6:45pm-8pm & 9:30pm-12am The Presidents

SATURDAY, July 24 • Noon-5pm Battle of the Bands • 5pm-6pm & 9:30pm-11:30pm Verona Grove

ON THE GROUNDS DAILY

Nick’s Kids ShowsBetty Trent Face Painting

Fay’s Fun N’ LearningUB The Band

Festival Foods Petting ZooPony RidesPig Races

TaDa The ClownTip Top Shows on the Midway!

Plus Holstein FuturityCream Puff Eating Contest

4-H Exhibits, Vendor Exhibits

& much more!

GR

AN

DST

AN

DS

OU

ND

STA

GE

LE

INIE

LO

DG

EE

NT

ER

TA

INM

EN

T S

CH

ED

ULE

y | YOU SUMMER Edition | JULY 7, 2010 | www.fdlreporter.com12

CoCoCoCoCoCoCoCoooCoCoCoCoCoCoCoCoCoCoCoooonsnsnsnsnsnsnsnsnsnsnsnsnsnnsnsnsnsnsnnnsnn ulululululululululuulululuuluululuuuuululultatatatatatatatatatatatatatatatatataaantntntntntntntntntnntntntntntnntntnttttttnn s s s s s s s ssssssss LaLaLaLaLaLaLaLaLaLaLaLaaLaLaLaLaLaLaLLaLaLabobobobobobobobobooboboboobobobobooooboboboborarararararararararararaaaaaaararatotototototototoototototootototototototootoooooooooooryryryryryryryryryryyryryyryryyy |||||||||||||||| FF F F F FF F FFF FFFF FFFFFFFononononononononononononononnononooooooono d d d d d d dd ddddd d ddddddd ddddddd dudududududududududududududududududuuu L LL L LL L LLLLLLLLLL LLLLLLLLLacacacacacacacacacacacacaacaaaacaaaaaaaac R R R R R RR RRRRRRRRR RRRRRegegegegegegegegegegegegegeegegeeegegge ioioioioioioioioioioiioioooionanananananananananananananaanaaaaaanan l l l l l lll lllll l ClClClClClClClClCCClClClClClC inininininininininininini iciciciciciciciccici ||||||||| S S S SSSSS SSSSSSSSS St.t.t.t.t.t.ttt.tttt A A A AAA AAAAAgngngngngnggngngngngnnng esesesesessesesesssseseses H H H H H H HHHHHHHososososososooososoo pipipipipipipipipipip tatatattatatatatatataaaaatatataal l l ll l lllll ||||||| S S S SS S SS SSSSt.t.t.tt.t.ttttt F F F FFFFFFFFrarararararaaararancncncncncnccisisisisisisiss H H H H HHHHHHHHomomomomomomomomooooooooo e ee e eeeeeee | | | |||||||| WaWaWaWaWaWaWaWaWWWW upupupupupuupununununuunnn M M M M MMMMememememememememe ororororrorrriaiaiaiaiaiaaaaaaial l l l ll lll HoHoHoHoHoHoHoHospspsppspspspspspitititititittitalalalaalaaaalaaaaaaa | | | | || A A A A A AAAAAggngngngngngnesesesesesessssssesiaiaiaiaiaiaiaiaaaiiaaiai n n n n nnnnn HeHeHeHeHeHeHeeeeeeHeeeeeeealalalalalala thththththhhhhththhhhhhhCaCaCaCaCaCaCaCaCaCarerererererererere EE EE E E EEEntntntntntntnnttererererereererere prprprprprprprrrrrprprrrpppp isisisisisisisisiisisiiisissssseseseseseseses ||||||| A A A A A A AAAAAAAAAAAgngngngngngngngngngngnggngngnggnesesesesesesessssiaiaaiaiaiaaiaiaiaiaaaaaaan nn n nnn HeHeHeHeHeHeHHeHHeHealalalalalaaalththththhthththththththhthCaCaCaCaCaCaCaCaCCaaCaCarererereeereereeeeeee ii i i i i iiiiiiis s s s ss ssssss SpSpSpSpSpSpSpSpSpSpSpSpSppSpSSponononononononononononnnononsososososososooooososoosososorerererererererererreereereeered d ddddd d dddddd ddd bybybybybybybybbybybybybybybybbyby t t tt tt tt t t t ttthehehehehehehehehehehhehhhh C C C C CC C CC CCConononononononononnonongrgrgrgrgrgrgrgrgrgrregegegegegegegegegegegegggegegggatatatatatatatatatatataata ioioioioioioioioioioioonnnn n n n n nnnn nn ofofofofofofofofofoofofofoff S S S S SSSSS S SS SSSSisisisisisissisisissteteeteteteteteteeteeeersrsrsrsrsrsrsrsssssrrsr o o o o ooo ooo ooof f f fff f f f f ffff ff StStStStStStStStStStStStSttSt.. .. . . . AgAgAgAgAgAgAgAgAgAgAgAgAAAAgAAAAAgneneneneneneneneneneeenenenenn s ss s s s s ss sssssss

5001

1340

46

you magazine

Documents