ziziphus spina-christi leaf extract attenuates mercury chloride...
TRANSCRIPT
RESEARCH ARTICLE
Ziziphus spina-christi leaf extract attenuates mercurychloride-induced testicular dysfunction in rats
Rafa S. Almeer1 & Gadah Albasher1 & Rami B. Kassab2& Shaimaa R. Ibrahim3
& Fatimah Alotibi4 & Saud Alarifi1 &
Daoud Ali1 & Saad Alkahtani1 & Ahmed E. Abdel Moneim2
Received: 8 August 2019 /Accepted: 2 December 2019# Springer-Verlag GmbH Germany, part of Springer Nature 2019
AbstractMercury (Hg) is a heavy metal toxicant, causing several adverse reactions to animals and humans including reproductivedysfunction. The potential protective role of Ziziphus spina-christi leaf extract (ZSCLE) against testicular impairments associatedwithmercury chloride (HgCl2) exposure in rats was investigated in the current study. Four experimental groups were employed asfollows (n = 7): group I served as control, group II was gavaged with ZSCLE (300 mg/kg), group III was administered withHgCl2 (0.4 mg/kg), and group IV was preadministered with ZSCLE 1 h before HgCl2. All groups were treated daily for 28 days.The exposure to HgCl2 caused a marked increase in Hg concentration in the testicular tissue, which was accompanied with adecrease in testis index. A reproductive impairment was recorded following HgCl2 exposure as verified through the decrease inlevels of testosterone, luteinizing, and follicle-stimulating hormones. HgCl2 was found to enhance the development of oxidativedamage in the testicular tissue as presented by the imbalance between pro-oxidants and antioxidant molecules. In addition,excessive release of tumor necrosis factor-α and interleukin-1β was recorded in response to HgCl2 intoxication. Furthermore, adisturbance in the apoptotic proteins in favor of the pro-apoptotic proteins was also observed following HgCl2 intoxication.However, ZSCLE administration along with HgCl2 abolished significantly the molecular, biochemical, and histopathologicalalterations induced by HgCl2 intoxication. Our findings suggest that ZSCLE could be used to mitigate reproductive dysfunctionassociated with HgCl2 exposure.
Keywords Ziziphus spina-christi . Mercury . Testis . Oxidative stress . Inflammation . Apoptosis
Responsible editor: Philippe Garrigues
* Rafa S. [email protected]
Gadah [email protected]
Rami B. [email protected]
Shaimaa R. [email protected]
Fatimah [email protected]
Saud [email protected]
Daoud [email protected]
Saad [email protected]
Ahmed E. Abdel [email protected]
1 College of Science, Department of Zoology, King Saud University,Riyadh, Saudi Arabia
2 Faculty of Science, Department of Zoology and Entomology,Helwan University, Cairo, Egypt
3 Molecular Drug Evaluation Department, National Organization forDrug Control and Research (NODCAR), Giza, Egypt
4 College of Science, Department of Botany and Microbiology, KingSaud University, Riyadh, Saudi Arabia
Environmental Science and Pollution Researchhttps://doi.org/10.1007/s11356-019-07237-w
AbbreviationsCAT CatalaseFSH Follicle-stimulating hormoneGPx Glutathione peroxidaseGR Glutathione reductaseGSH GlutathioneHg MercuryHgCl2 Mercury chlorideIL-1β Interleukin-1βLPO Lipid peroxidationLH Luteinizing hormoneMDA MalondialdehydeNO Nitric oxideRNS Reactive nitrogen speciesROS Reactive oxygen speciesSOD Superoxide dismutaseTNF-α Tumor necrosis factor-αZSCLE Ziziphus spina-christi leaf extract
Background
Mercury (Hg) is a toxic divalent heavy metals, and itbecame a part from the environment due to the intensiveanthropogenic activities. Humans are exposed to Hgthrough the contaminated food, water and air, and phar-maceutical products such as vaccines and dental amalgamfillings (Abarikwu et al. 2017). Unintentional and occu-pational exposure to both inorganic mercury (mercuricchloride (HgCl2)) and organic mercury (methyl mercury(MeHg)) may induce various organ damage in humansand domestic animals (Kalender et al. 2013).
HgCl2 is the most toxic form of Hg because it easilyproduces organomercury complexes with proteins(Boujbiha et al. 2009). The exposure to HgCl2 has beenstrongly associated with the pathophysiology of neurotox-icity (Moneim 2015), nephrotoxicity (Hazelhoff et al.2018) , hematotoxic i ty (Alabi e t a l . 2017) , andgenotoxicity (Boujbiha et al. 2012). In addition, previousreports verified the testicular impairments followingHgCl2 in male rats (Abarikwu et al. 2017). HgCl2 wasfound to disturb spermatogenesis, decreased sperm countand their morphology, and induced androgen deficiency.Oxidative damage, inflammation, and the programmedcell death have been suggested to play a fundamental rolein Hg-induced testicular dysfunctions (El-Desoky et al.2013).
Medicinal plants represent the main raw materials in theproduction and development of the pharmaceutical productsworldwide (Mathur and Hoskins 2017). Ziziphus spina-christi(ZSC), known also as Sidr and Nabk, is a tropical cultivatedtree belonging to Rhamnaceae family, growing also in themiddle east region including Egypt and in particular in
Upper Egypt and Sinai (Almeer et al. 2018a). Phytochemicalscreening showed that ZSC is rich with flavonoids, essentialoils, tannins, phytosterols, triterpenoid, vitamin C, glycoside,saponins, glycoside, and alkaloids (Kadioglu et al. 2016;Shahat et al. 2001).
Different parts of Ziziphus species have been used in thefolk medicine for the treatment of different diseases, such asdigestive problems, liver complaints, weakness, skin infec-tions, urinary disorders, diabetes, fever, obesity, diarrhea,and insomnia (Almeer et al. 2018b). For example, Bedouinsmade a powder from the charred thorns and used it as anantidote to snake bites. Furthermore, leaves are usually usedfor treatment of eye diseases, ulcers, bronchitis, wounds, ul-cers, and skin disorders, while the seeds are used for a longtime in Egypt and other Arabian countries to halt nausea,vomiting, and as a sedative agent (Kadioglu et al. 2016).Fruits have been shown to treat dysentery, respiratory, urinary,and digestive disorders (Ads et al. 2018). Experimental studieshave shown that ZSC has different pharmacological and bio-logical activities including antidiarrheal (Almeer et al. 2018a),antibacterial (Dkhil et al. 2018b), antihyperglycemic (Bhatiaand Mishra 2010), antioxidant (Almeer et al. 2018a), anti-inflammatory (Dkhil et al. 2018c), antiallergic (Naik et al.2013), and anti-influenza activities (Hong et al. 2015).Hence, the current report was designed to shed light on thepotential protective role of Ziziphus spina-christi leaf extract(ZSCLE) on HgCl2-induced testicular damage in rats.
Methods
Preparation of Ziziphus spina-christi leaf extract
Z. spina-christi leaves were collected from a public garden inthe Riyadh, KSA. The leaves were identified by an experttaxonomist from the Botany Department, College ofScience, King Saud University, KSA. ZSCLE was preparedas described previously by our group and other (Almeer et al.2018b; Dkhil et al. 2018a). Briefly, Z. spina-christi leaveswere cleaned of dust under running tap water and then air-dried in the shade. The dried ZSC leaves were finely pow-dered and immersed in 80% (v/v) methanol at 4 °C for 72 h.The extract was filtered, and the supernatant was evaporatedunder reduced pressure to a semi-dry state by using a rotaryevaporator at 45 °C and then dissolved in distilled water. Theobtained extract was designated as ZSCLE and stored at −20 °C until further analysis.
Animals and experimental design
Twenty-eight maleWistar rats, 9–10weeks old, were obtainedfrom the Vacsera (Cairo, Egypt), weighing 120–150 g. Theanimals were housed under controlled laboratory conditions
Environ Sci Pollut Res
with a 12 h light/dark cycle and a temperature (22 ± 2.5 °C)and fed on standard rodent diet pellets and water ad libitum.All experiments were approved by the Committee of ResearchEthics for Laboratory Animal Care, Department of Zoology,Faculty of Science, Helwan University (approval no.HU2018/Z/011). To study the protective effect of theZSCLE against mercury-induced toxicity in testis of rats, theanimals were divided into four randomly groups (n = 7). Thefirst group (control group) is orally administered with normalsaline solution (0.9% NaCl) for 28 days, and the second group(ZSCLE group) is orally treated with ZSCLE at a dose of300 mg/kg for 28 days based on our previous study (Almeeret al. 2018a). The third group (HgCl2 group) is orally admin-istered with 0.4 mg/kg HgCl2 (CAS number 7487-94-7;Sigma-Aldrich, St. Louis, MO, USA) dissolved in 0.9% nor-mal saline solution for 28 days and the fourth group (ZSCLE+HgCl2 group) is preadministrated orally by ZSCLE(300 mg/kg); after 1 h, the rats were orally administratedHgCl2 as the animals in group three. The dose of HgCl2 waspreviously documented to yield no observable signs of toxic-ity (Dkhil et al. 2014). The rats were sacrificed by cervicaldislocation with an overdose of pentobarbital (300 mg/kg i.p.)after 24-h treatment. Blood samples were collected and setaside to stand for half an hour and then centrifuged at3000 rpm for 15 min at 4 °C to separate serum which wasstored at − 20 °C for the different biochemical measurements.The testis were quickly removed and homogenized in 10 mMphosphate buffer (pH 7.4). The homogenates were centrifugedfor 10min (3000×g) at 4 °C, and the supernatant was collectedand stored at − 20 °C for further analysis.
Determination of mercury concentration in testis
Mercury concentration in the testis tissue was analyzed byusing a Perkin Elmer 3100 atomic absorption spectrophotom-eter (Boston, MA, USA) (Baxter and Frech 1989). Briefly, a0.2 g of wet testis tissue was digested in a clean tube with 2 mlof concentrated nitric acid for 6 h in oven at 100 °C.Subsequently, three drops of 1-octanol was added to preventunnecessary foam during analysis and the sample was dilutedto 25ml with deionized distilled H2O. Then, a suitable volumeof sample was injected into a graphite furnace at 253.7 nm andanalyzed in duplicate. Mercury concentrations were estimatedfrom the standard curve based on wet testis tissue basis inμg g−1 wet tissue.
Testis index estimation
The testis was weighted by using a sensitive weighing balance(Radwag, Model AS 60/220.R2, Torunska, Radom, Poland),from which the testis index was determined by using the fol-lowing formula:
Testis index TIð Þ ¼ Left testis weight LTð ÞBody weight
� 100
Biochemical analysis
Evaluation of serum follicle-stimulating hormone,luteinizing hormone, and testosterone levels
The hormonal analyses in serum were performed according tothe commercial radio-amino assay (RIA) kits purchased fromNanjing Jiancheng Technology Co. Ltd. (Nanjing, Jiangsu,China).
Oxidant/antioxidant status analysis
Lipid peroxidation was evaluated according to the methoddescribed by Ohkawa et al. (1979). Nitric oxide (NO) levelwas determined by using the Griess reagent (Green et al.1982). The content of reduced glutathione in the testis homog-enates was determined according to the method reported byEllman (1959). Superoxide dismutase (SOD) activity was cal-culated according to the method of Nishikimi et al. (1972).Catalase (CAT) activity was determined by measuring thedecomposition rate of H2O2 at 240 nm, according to the de-scribed method by Aebi (1984), whereas the activities of bothglutathione peroxidase (GPx) and glutathione reductase (GR)were assayed using the methods of Paglia and Valentine(1967) and De Vega et al. (2002), respectively.
Pro-inflammation cytokines and apoptosis biomarkerassays
Testisticular homogenates were assayed to determine the levelof pro-inflammatory cytokines namely tumor necrosisfactor-α (TNF-α; R&D Systems, catalog number RTA00,sensitivity < 0.5 pg/ml) and interleukin-1β (IL-1β; ThermoFisher Scientific; catalog number ERIL1B, sensitivity 80 pg/ml) in addition to the apoptosis biomarkers such as Bcl-2(Cusabio; catalog number CSB-E08854r, sensitivity0.078 ng/ml), Bax (BioVision, Inc.; catalog number E4513,sensitivity < 0.188 ng/ml), and caspase-3 (Sigma-Aldrich; cat-alog number CASP3C-1KT). All the assay steps and the cal-culation of eachmarker concentration were performed accord-ing to manufacturer’s instructions.
Real-time PCR
Total RNA was extracted using Qiazol reagent (Qiagen,Germantown,MD, USA) from testis tissue. Reverse transcrip-tion of cDNA synthesis was performed by RevertAid™ H
Environ Sci Pollut Res
Minus Reverse Transcriptase (Fermentas, Thermo FisherScientific Inc., Canada) according to the manufacturer’s pro-tocol. For gene expression analysis, the quantitative real-timePCR was carried out in a 20 μl reaction mixture usingQuantiFast SYBR Green RT-PCR kit (Qiagen, Hilden,Germany). Primers forward and reverse were synthesized byJena Bioscience (Jena, Germany) and are listed in Table 1.Two duplicates for each sample were performed usingViiA™ 7 System (Thermo Fisher Scientific, CA, USA). ThePCR cycling condition was set as follows: initial denaturationat 95 °C for 10 min, followed by 40 cycles of denaturation at94 °C for 15 s and annealing at 60 °C for 60 s, extension at72 °C for 90 s, and then held for a final extension at 72 °C for10 min. The fold changes in gene expression between testedand the control were analyzed using ΔΔCt method (Livak andSchmittgen 2001). Gene expression levels were normalized toglyceraldehyde-3-phosphate dehydrogenase (Gapdh) geneexpression.
Histological procedures
One testis from each rat was sliced into small pieces and thenfixed in 4% formaldehyde/PBS for 24 h. Samples weredehydrated then embedded in paraffin, and finally sectionedto 5-μm thickness. Specimens were stained with hematoxylinand eosin dyes to examine any pathological changes under aNikon Eclipse E200-LED (Tokyo, Japan) microscope with×400 magnification.
Statistical analysis
Results were expressed as the mean ± standard deviation(SD) of seven rats. The ANOVA and Duncan’s post hocmultiple tests were used to assess the statistical signifi-cance. p values < 0.05 were considered statisticallysignificant.
Table 1 Primer sequences of genes analyzed in real-time PCR
Name Forward primer (5′–3′) Reverse primer (5′–3′)
Gapdh AGTGCCAGCCTCGTCTCATA GATGGTGATGGGTTTCCCGTSod2 AGCTGCACCACAGCAAGCAC TCCACCACCCTTAGGGCTCACat TCCGGGATCTTTTTAACGCCATTG TCGAGCACGGTAGGGACAGTTCACGpx1 CGGTTTCCCGTGCAATCAGT ACACCGGGGACCAAATGATGGsr TGGCACTTGCGTGAATGTTG CGAATGTTGCATAGCCGTGGNfe2l2 TTGTAGATGACCATGAGTCGC ACTTCCAGGGGCACTGTCTANos2 GTTCCTCAGGCTTGGGTCTT TGGGGGAACACAGTAATGGCIl1β GACTTCACCATGGAACCCGT GGAGACTGCCCATTCTCGACTnf GGCTTTCGGAACTCACTGGA CCCGTAGGGCGATTACAGTCBcl2 ACTCTTCAGGGATGGGGTGA TGACATCTCCCTGTTGACGCBax GGGCCTTTTTGCTACAGGGT TTCTTGGTGGATGCGTCCTGCasp3 GAGCTTGGAACGCGAAGAAA TAACCGGGTGCGGTAGAGTA
The abbreviations of the genes are as follows: Gapdh, glyceraldehyde-3-phosphate dehydrogenase; Sod2, superoxide dismutase 2;Cat, catalase;Gpx1, glutathioneperoxidase 1; Gsr, glutathione reductase; Nfe2l2, nuclear factor erythroid 2-related factor 2; Nos2, inducible nitric oxide synthase; Il1β, interleukin 1 beta; Tnf,tumor necrosis factor; Bcl2: B cell lymphoma 2; Bax, Bcl-2-like protein 4; Casp3, caspase-3
Fig. 2 The protective effects of Ziziphus spina-christi leaf extract(ZSCLE) at a dose 300 mg/kg on the testis index upon mercury chloride(HgCl2, 0.4 mg/kg) exposition. Data are expressed as the mean ± SD (n =7). ap < 0.05 vs. the control rats; bp < 0.05 vs. the HgCl2-treated rats usingDuncan’s post hoc test
Fig. 1 The protective effects of Ziziphus spina-christi leaf extract(ZSCLE) at a dose 300 mg/kg on the mercury deposition in testiculartissue upon mercury chloride (HgCl2, 0.4 mg/kg) exposition. Data areexpressed as the mean ± SD (n = 7). ap < 0.05 vs. the control rats; bp <0.05 vs. the HgCl2-treated rats using Duncan’s post hoc test
Environ Sci Pollut Res
Results
Effect of ZSCLE on Hg accumulation and the testicularweight following HgCl2 exposure
Rats treated with HgCl2 for 28 days at a dose 0.4 mg/kgshowed a significant increase (p < 0.05) in Hg concentra-tion in testicular tissue compared to the control group(Fig. 1). The accumulation of Hg in the testicular tissuewas accompanied with a decrease in the testis weightcompared to the control group (Fig. 2). Moreover,HgCl2 decreased significantly the levels of testosterone,LH and FSH compared to the control group (Fig. 3). Onthe other hand, ZSCLE administration 1 h after HgCl2exposure was found to reverse the negative impact causedby Hg as indicated by decreasing Hg accumulation, ele-vating the testis weight and increased the hormonal levelswhen compared to HgCl2 exposed rats.
Effect of ZSCLE on redox status in the testicular tissuefollowing HgCl2 exposure
The results in Fig. 4 revealed that HgCl2 provoked oxida-tive damage in the testicular tissue through increasinglevels of LPO and NO, whereas the content of GSH andthe activities of CAT, SOD, GR, and GPx and their geneexpression were decreased significantly (p < 0.05) as
compared to the control group. ZSCLE supplementationalong with HgCl2 abolished the oxidative reactions asevidenced by decreasing the pro-oxidants and stimulatingthe activities of the antioxidants molecules. Constant withthe biochemical findings, qRT-PCR findings exhibited asignificant downregulation of Nfe2l2 mRNA expressionfollowing HgCl2 exposure as compared to their expres-sion in the control group. On the other hand, ZSCLEsignificantly upregulated Nfe2l2 mRNA expression in re-sponse to HgCl2 intoxication, indicating its potent antiox-idant properties against HgCl2-induced oxidative stress inthe testicular tissue (Figs. 4 and 5).
Effect of ZSCLE on the productionof pro-inflammatory cytokines in the testicular tissuefollowing HgCl2 exposure
In the present study, the protein level and mRNA expres-sion of IL-1β, TNF-α, and Nos2 were found to be in-creased significantly in HgCl2-treated group when com-pared to the control group, reflecting the development ofinflammation and immune response in the testicular tissuein response to HgCl2 exposure. In contrast, ZSCLEshowed anti-inflammatory activity through suppressingthe protein level of IL-1β, TNF-α, and Nos2 mRNA ex-pressions as compared to HgCl2-administered group(Fig. 6).
Fig. 3 The protective effects of Ziziphus spina-christi leaf extract(ZSCLE) at a dose 300 mg/kg on serum level of testosterone, luteinizinghormone (LH), and follicle-stimulating hormone (FSH) upon mercury
chloride (HgCl2, 0.4 mg/kg) exposition. Data are expressed as the mean± SD (n = 7). ap < 0.05 vs. the control rats; bp < 0.05 vs. the HgCl2-treatedrats using Duncan’s post hoc test
Fig. 4 The protective role of Ziziphus spina-christi leaf extract (ZSCLE)at a dose 300 mg/kg on oxidative stress indices in testicular tissue uponmercury chloride (HgCl2, 0.4 mg/kg) exposition. Data are expressed as
the mean ± SD (n = 7). ap < 0.05 vs. the control rats; bp < 0.05 vs. theHgCl2-treated rats using Duncan’s post hoc test
Environ Sci Pollut Res
Effect of ZSCLE on the apoptotic markersin the testicular tissue following HgCl2 exposure
One-way ANOVA showed that the treatment with inor-ganic mercury decreased significantly the protein leveland mRNA expression of Bcl-2 and increased Bax andcaspase-3 in the testicular tissue as compared to the con-trol group. Meanwhile, ZSCLE supplementation alongwith HgCl2 exhibited antiapoptotic activity through up-regulat ing the antiapoptotic protein (Bcl-2) and
downregulating the pro-apoptotic (Bax and caspase-3) ascompared to HgCl2-treated group (Fig. 7).
Effect of ZSCLE on histopathological deformationsin the testicular tissue following HgCl2 exposure
In Fig. 8, testicular tissue of control and ZSCLE-treated ratsshowed normal testis architecture including normal seminifer-ous tubule structure with normal stages of the spermatogeniccells (Fig. 8a and b, respectively). In Hg group, testis tissue
Fig. 5 The protective effects of Ziziphus spina-christi leaf extract(ZSCLE) at a dose 300 mg/kg on the antioxidant enzymes and theirmRNA expression along with Nfe2l2 gene expression in testicular tissueupon mercury chloride (HgCl2, 0.4 mg/kg) exposure. Data are expressed
as the mean ± SD (n = 7). ap < 0.05 vs. the control rats; bp < 0.05 vs. theHgCl2-treated rats using Duncan’s post hoc test. mRNA expression wasreferenced to the Gapdh
Environ Sci Pollut Res
revealed a decline in spermatozoa, disorganization, and de-generation of some spermatogenic cells and vacuolated areawithin the seminiferous tubules (Fig. 8c). Pretreatment of ratswith ZSCLE protected testicular tissue of rats intoxicated withHg as evidenced by the normal architecture of testicular sem-iniferous tubules (Fig. 8d).
Discussion
The extensive increase in the industrial activities is associatedstrongly with the accumulation of heavy metals in the envi-ronment and subsequently in the biological systems and henceproducing serious adverse reactions including reproductiveimpairments in humans and animals even at low exposure(Martinez et al. 2017). In order to evaluate the efficacy ofZSCLE to protect against HgCl2-induced reproductive dys-function, the testis index, hormonal alterations, oxidative re-actions, inflammation, and programmed cell death in the tes-ticular tissue were investigated.
Our findings showed an increase in the deposition of Hg inthe testicular tissue accompanied with a significant decrease inthe testis index. Moreover, HgCl2 administration decreasedthe serum levels of testosterone, LH and FSH. Testis has beenclassified among the target organs for Hg accumulation (El-Desoky et al. 2013; Martinez et al. 2017). It has been reportedthat Hg causes renal damage which may affect its clearanceand increase its accumulation in different body organs (Orrand Bridges 2017). Inorganic mercury administration at low
concentration was found to promote the decrease of the rela-tive weight of testis, epididymis, vas deferens, and seminalvesicle (Martinez et al. 2017). In addition, the testicular de-generation and cellular deformations in the seminiferous tu-bules and Leydig cells following HgCl2 exposure may explainthe decreased testis index (El-Desoky et al. 2013;Mohammadi et al. 2008). The decreased food intake mayfurther clarify the decline in testis index (Almeer et al.2018c). LH and FSH stimulate the synthesis and secretion oftestosterone and sperm cell maturation, respectively(Albasher et al. 2019). The alteration in testosterone, LH,and FSH in response to inorganic mercury has been recorded(Boujbiha et al. 2009; El-Desoky et al. 2013). The authorsexplained this change through the overproduction of free rad-icals and the disturbance in the neuroendocrine axis.
Antioxidant molecules have been suggested to prevent ordecrease the deleterious effects induced by heavy metals (Al-Brakati et al. 2019; Al Omairi et al. 2018). Previous reportsdemonstrated that antioxidants including polyphenols are ableto enhance the clearance of Hg and decrease its accumulation(Hussain et al. 1999; Perron and Brumaghim 2009; Tan et al.2018). ZSCLE supplementation decreased significantly thedeposition of Hg in the testicular tissue and reversed theweight loss induced by HgCl2; this effect might be due to itshigh polyphenolic content. ZSCLE protection was also ex-tended to increase the levels of testosterone, LH, and FSH,which may reflect the improvement in the testicular functionfollowing Hg exposure. In general, natural product intake maypossibly have a positive effect on semen parameters, probably
Fig. 6 Effects of Ziziphus spina-christi leaf extract (ZSCLE) at a dose300 mg/kg on levels of protein and mRNA expression of tumor necrosisfactor-α and interleukin 1-β, inducible nitric oxide synthase in testiculartissue upon the exposure to mercury chloride (HgCl2, 0.4 mg/kg). Data
are expressed as the mean ± SD (n = 7). ap < 0.05 vs. the control rats;bp < 0.05 vs. the HgCl2-treated rats using Duncan’s post hoc test. mRNAexpression was referenced to the Gapdh
Environ Sci Pollut Res
by protecting semen from reactive oxygen species (ROS),reducing oxidative stress, and enhancing basic sperm bio-markers. This improvement can be recognized by stimulationof testosterone biosynthesis, FSH and LH production, andimprovement of androgen profile (Darbandi et al. 2018).
Oxidative stress has been proposed to play an essential rolein Hg-induced reproductive dysfunction (Martinez et al.2014). In the current investigation, HgCl2 administration dis-turbed the balance between the antioxidants and pro-oxidantsleading to the induction of oxidative insult in the testiculartissue as represented by the enhancement of lipid peroxidation
and nitric oxide production. This was coupled with the deple-tion and inactivation of GSH, GPx, GR, SOD, and CAT, andtheir gene expression, along with the downregulation of Nrf2mRNA expression. The exposure to HgCl2 is correlated sig-nificantly with overproduction of ROS which interact anddeplete thiol-containing molecules including GSH (Hansenet al. 2006). The generated ROS including hydrogen perox-ides provoke the peroxidation of mitochondrial membranelipids leading to the loss of membrane integrity and finallyto the cell death (Mailloux 2018). The administration ofHgCl2 was found to increase nitric oxide production
Fig. 7 Effects of Ziziphus spina-christi leaf extract (ZSCLE) at a dose300 mg/kg on levels of protein and mRNA expression of Bcl-2, Bax, andcaspase-3 in testicular tissue upon mercury chloride (HgCl2, 0.4 mg/kg)
exposure. Data are expressed as the mean ± SD (n = 7). ap < 0.05 vs. thecontrol rats; bp < 0.05 vs. the HgCl2-treated rats using Duncan’s post hoctest. mRNA expression was referenced to the Gapdh
Environ Sci Pollut Res
(Othman et al. 2014; Teixeira et al. 2018). Nitric oxide is abiological molecule that regulates blood pressure, neurotrans-mission and immune response (Abdelfattah et al. 2019). Thisincrease may be due to the overexpression of iNOS whichrepresents the rate-limiting enzyme in nitric oxide biosynthe-sis. The increased nitric oxide interacts with superoxide anionsdeveloping peroxynitrite radicals which further induce celltoxicity and death (Ferrer-Sueta and Radi 2009). Several reportslinked between the exposure to Hg and deactivation of antioxi-dant and detoxifying enzymes (Abarikwu et al. 2017; El-Desokyet al. 2013). Antioxidant enzymes are responsible for the removalof superoxide, hydrogen peroxide, and lipid hydroperoxides, andtheir deactivation in the testicular tissue is associated with severalcellular impairments (Almeer et al. 2018c).
In addition, HgCl2 intoxication was reported to downregu-late Nrf2 (Liu et al. 2018). Nrf2 is controlling the cellularantioxidant defense system against oxidative damage throughenhancing the expression of antioxidant, xenobiotic detoxify-ing enzymes, and their transporter systems (Unoki et al.2018). Therefore, the downregulation of Nfe2l2 mRNA ex-pression in the current study may explain the decreased anti-oxidant capacity in the testicular tissue following HgCl2exposure.
Interestingly, ZSCLE supplementation attenuated the oxi-dative insult produced by HgCl2 via decreasing the lipid per-oxidation and nitric oxide production, along with increasingand activating the enzymatic and nonenzymatic antioxidantsin the testicular tissue. We suggest that the antioxidant activityof ZSCLE is due to its ability to upregulate the mRNA
expression of Nfe2l2 which subsequently and their gene ex-pressions activate the antioxidant enzymes in response toHgCl2 intoxication. Our previous studies showed thatZSCLE inhibited oxidative reactions in different organs inseptic model through decreasing the levels of pro-oxidantsand enhancing protein and mRNA expression of the antioxi-dant molecules (Dkhil et al. 2018b). Moreover, ZSCLE wasfound to restore the oxidant-antioxidant homeostasis in hepa-tocellular carcinoma model in rats (El-Din et al. 2019).ZSCLE contains many polyphenols and flavonoid molecules,such as spinosin, catechin derivatives, gallic acid, ellagic acid,chlorogenic acid, caffeic acid, rutin, quercitrin derivativesapigenin, syringic acid, and kaempferol as mentioned byDkhil et al. (2018b) which all of these molecules work togeth-er to enhance the antioxidant defense system.
Oxidative stress has been suggested to promote inflam-matory and immune responses in Hg-induced toxicity(Jiang et al. 2018). Therefore, antioxidants may protectagainst Hg-induced inflammation. In the current investi-gation, HgCl2 administration increased markedly the pro-tein level and mRNA expression of IL-1β and TNF-α inthe testicular tissue. However, ZSCLE supplementationexhibited anti-inflammatory activity and inhibited the in-creased pro-inflammatory cytokines in response to HgCl2exposure. IL-1β and TNF-α are prototypic pro-inflammatory cytokines and have been implicated as maineffectors of the functional consequences of inflammationassociated with different disorders (Yin et al. 2019).Mercury was found to induce inflammation in the
Fig. 8 Photomicrographs of the testicular tissue following the treatmentof Ziziphus spina-christi leaf extract (ZSCLE, 300 mg/kg) 1 h before theexposure to mercury chloride (HgCl2). (a) Control, (b) ZSCLE, (c)HgCl2, and d ZSCLE+HgCl2. Testicular tissue of control and ZSCLE-treated rats showed normal testis architecture including normal seminif-erous tubule structure with normal stages of the spermatogenic cells,
whereas Hg group testis tissue revealed that decline in spermatozoa, dis-organization (red arrow), and degeneration of some spermatogenic cells(blue star) and vacuolated area within the seminiferous tubules (blackstar). However, pretreatment of rats with ZSCLE protected testicular tis-sue of rats intoxicated with Hg as evidenced by the normal appearancearchitecture of testicular seminiferous tubules, scale bar = 100 nm
Environ Sci Pollut Res
hepato-renal tissue as represented by increasing the secre-tion of IL-1β and TNF-α which has been explained bythe activation of nuclear factor kappa B (NF-κB) (Li et al.2018). Previous report showed that ZSCLE decreased theproduction of the pro-inflammatory cytokines and down-regulated their gene expression through inhibiting NF-κBin septic mice, and this effect has been attributed to itsantioxidant properties (Dkhil et al. 2018b).
Exposure to heavy metals including mercury has beenlinked with the development of cell death (Tan et al.2018). Our findings revealed that HgCl2 administrationfor 28 days triggered pro-apoptotic activity via increasingthe expression of Bax and caspase-3 and decreasing theexpression of Bcl-2 in the testicular tissue. Bax andcaspases-3 are pro-apoptotic proteins; their overexpres-sion is associated with cell death (Yousef et al. 2019),while Bcl2 prevents the induction of apoptosis not onlyin malignant cells but also in normal cellular lineages(Opferman and Kothari 2018). We suggest that this effectcould be due to its quench ROS produced by Hg intoxi-cation. Venkatesan and Sadiq (2017) demonstrated thatmercury chloride administration upregulated the expres-sion of the pro-apoptotic proteins and downregulated theantiapoptotic protein due to the overproduction of freeradicals. However, ZSCLE inhibited the apoptotic eventsproduced by HgCl2 in the testicular tissue. These findingsare in line with previous reports (Dkhil et al. 2018b); theauthors showed the ability of ZSCLE to inhibit the celldeath through upregulating Bcl-2 and downregulating Baxand caspase-3 in septic mice.
Conclusion
The current experiment showed that mercury chloride in-toxication for 28 days caused a disturbance in the testic-ular function. This effect was clear through increasing itsaccumulation, testis index loss, hormonal alterations, in-duction of oxidative reactions, enhancing inflammatoryand immune responses and triggering the apoptotic path-way. However, ZSCLE supplementation along with mer-cury chloride attenuated significantly the alterations in thetesticular tissue, suggesting that ZSCLE could be used tominimize Hg-induced testicular dysfunction.
Acknowledgments The authors would like to extend their sincere appre-ciation to the Research Supporting Project number: RSP-2019/96, KingSaud University, Riyadh, Saudi Arabia, for supporting the study.
Compliance with ethical standards
Competing interests The authors declare that they have no competinginterests.
References
Abarikwu SO, Benjamin S, Ebah SG, Obilor G, Agbam G (2017) Oraladministration of Moringa oleifera oil but not coconut oil preventsmercury-induced testicular toxicity in rats. Andrologia:49. https://doi.org/10.1111/and.12597
Abdelfattah MS, Elmallah MIY, Ebrahim HY, Almeer RS, EltananyRMA, Abdel Moneim AE (2019) Prodigiosins from a marinesponge-associated actinomycete attenuate HCl/ethanol-induced gas-tric lesion via antioxidant and anti-inflammatory mechanisms. PLoSOne 14:e0216737
Ads DE, Rajendrasozhan S, Hassan S, Sharawy S, Humaidi J (2018)Phytochemical screening of different organic crude extracts fromthe stem bark of Ziziphus spina-christi (L.). 29. https://doi.org/10.4066/biomedicalresearch.29-17-1668
Aebi H (1984) Catalase in vitro. Methods Enzymol 105:121–126Albasher G, Albrahim T, Alsultan N, Alfaraj S, Alharthi MS, Kassab RB,
Abdel Moneim AE (2019) Red beetroot extract mitigateschlorpyrifos-induced reprotoxicity associated with oxidative stress,inflammation, and apoptosis in rats. Environ Sci Pollut Res. https://doi.org/10.1007/s11356-019-07009-6
Al Omairi NE, Radwan OK, Alzahrani YA, Kassab RB (2018)Neuroprotective efficiency of Mangifera indica leaves extract oncadmium-induced cortical damage in rats. Metab Brain Dis.https://doi.org/10.1007/s11011-018-0222-6
Alabi OA, Esan BE, Sorungbe AA (2017) Genetic, Reproductive andhematological toxicity induced in mice exposed to leachates frompetrol, diesel and kerosene dispensing sites. J Health Pollut 7:58–70.https://doi.org/10.5696/2156-9614-7.16.58
Al-Brakati AY, Kassab RB, Lokman MS, Elmahallawy EK, Amin HK,Abdel MoneimAE (2019) Role of thymoquinone and ebselen in theprevention of sodium arsenite-induced nephrotoxicity in female rats.Hum Exp Toxicol 38:482–493. https://doi.org/10.1177/0960327118818246
Almeer RS, El-KhadragyMF, Abdelhabib S, Abdel Moneim AE (2018a)Ziziphus spina-christi leaf extract ameliorates schistosomiasis livergranuloma, fibrosis, and oxidative stress through downregulation offibrinogenic signaling in mice. PLoS One 13:e0204923. https://doi.org/10.1371/journal.pone.0204923
Almeer RS, Mahmoud SM, Amin HK, Abdel Moneim AE (2018b)Ziziphus spina-christi fruit extract suppresses oxidative stress andp38 MAPK expression in ulcerative colitis in rats via induction ofNrf2 and HO-1 expression. Food Chem Toxicol. https://doi.org/10.1016/j.fct.2018.03.002
Almeer RS et al (2018c) Royal jelly abrogates cadmium-induced oxida-tive challenge in mouse testes: involvement of the Nrf2 pathway. IntJ Mol Sci 19. https://doi.org/10.3390/ijms19123979
Baxter DC, FrechW (1989) Determination of mercury by atomic absorp-tion spectrometry using a platinum-lined graphite furnace for in situpreconcentration. Anal Chim Acta 225:175–183. https://doi.org/10.1016/S0003-2670(00)84605-X
Bhatia A,Mishra T (2010) Hypoglycemic activity of Ziziphus mauritianaaqueous ethanol seed extract in alloxan-induced diabetic mice.Pha rm B io l 48 : 604–610 . h t t p s : / / d o i . o rg / 10 . 3109 /13880200903218935
Boujbiha MA, Hamden K, Guermazi F, Bouslama A, Omezzine A,Kammoun A, El Feki A (2009) Testicular toxicity in mercuric chlo-ride treated rats: association with oxidative stress. Reprod Toxicol28:81–89. https://doi.org/10.1016/j.reprotox.2009.03.011
Boujbiha MA et al (2012) Hematotoxicity and genotoxicity of mercuricchloride following subchronic exposure through drinking water inmale rats. Biol Trace Elem Res 148:76–82. https://doi.org/10.1007/s12011-012-9342-8
Darbandi M, Darbandi S, Agarwal A, Sengupta P, Durairajanayagam D,Henkel R, Sadeghi MR (2018) Reactive oxygen species and male
Environ Sci Pollut Res
reproductive hormones. Reprod Biol Endocrinol 16:87. https://doi.org/10.1186/s12958-018-0406-2
De Vega L, Fernandez RP, Mateo MC, Bustamante JB, Herrero AM,Munguira EB (2002) Glutathione determination and a study of theactivity of glutathione-peroxidase, glutathione-transferase, andglutathione-reductase in renal transplants. Ren Fail 24:421–432
Dkhil MA, Al-Quraishy S, Diab MM, Othman MS, Aref AM, AbdelMoneim AE (2014) The potential protective role of Physalisperuviana L. fruit in cadmium-induced hepatotoxicity and nephro-toxicity. Food Chem Toxicol 74:98–106
Dkhil MA, Al-Quraishy S, Abdel Moneim AE (2018a) Ziziphus spina-christi leaf extract pretreatment inhibits liver and spleen injury in amouse model of sepsis via antioxidant and anti-inflammatory ef-fects. Inflammopharmacology. https://doi.org/10.1007/s10787-017-0439-8
Dkhil MA, Al-Quraishy S, Moneim AEA (2018b) Ziziphus spina-christi leaf extract pretreatment inhibits liver and spleen injury ina mouse model of sepsis via anti-oxidant and anti-inflammatoryeffects. Inflammopharmacology. https://doi.org/10.1007/s10787-017-0439-8
Dkhil MA, Kassab RB, Al-Quraishy S, Abdel-DaimMM, Zrieq R, AbdelMoneim AE (2018c) Ziziphus spina-christi (L.) leaf extract allevi-ates myocardial and renal dysfunction associated with sepsis inmice. Biomed Pharmacother 102:64–75. https://doi.org/10.1016/j.biopha.2018.03.032
El-Desoky GE, Bashandy SA, Alhazza IM, Al-Othman ZA, Aboul-SoudMA, Yusuf K (2013) Improvement of mercuric chloride-inducedtestis injuries and sperm quality deteriorations by Spirulina platensisin rats. PLoS One 8:e59177. https://doi.org/10.1371/journal.pone.0059177
El-Din MS, Taha AM, Sayed AA, Salem AM (2019) Ziziphus spina-christi leaves methanolic extract alleviates diethylnitrosamine-induced hepatocellular carcinoma in rats. Biochem Cell Biol.https://doi.org/10.1139/bcb-2018-0318
Ellman GL (1959) Tissue sulfhydryl groups. Arch Biochem Biophys 82:70–77
Ferrer-Sueta G, Radi R (2009) Chemical biology of peroxynitrite: kinet-ics, diffusion, and radicals. ACS Chem Biol 4:161–177. https://doi.org/10.1021/cb800279q
Green LC, Wagner DA, Glogowski J, Skipper PL, Wishnok JS,Tannenbaum SR (1982) Analysis of nitrate, nitrite, and[15N]nitrate in biological fluids. Anal Biochem 126:131–138
Hansen JM, Zhang H, Jones DP (2006) Differential oxidation ofthioredoxin-1, thioredoxin-2, and glutathione by metal ions. FreeRadic Biol Med 40:138–145. https://doi.org/10.1016/j.freeradbiomed.2005.09.023
Hazelhoff MH, Bulacio RP, Chevalier A, Torres AM (2018) Renal ex-pression of organic anion transporters is modified after mercuricchloride exposure: gender-related differences. Toxicol Lett 295:390–396
Hong EH, Song JH, Kang KB, Sung SH, Ko HJ, Yang H (2015) Anti-influenza activity of Betulinic acid from Zizyphus jujuba on influ-enza a/PR/8 virus. Biomol Ther (Seoul) 23:345–349. https://doi.org/10.4062/biomolther.2015.019
Hussain S, Atkinson A, Thompson SJ, Khan AT (1999) Accumulation ofmercury and its effect on antioxidant enzymes in brain, liver, andkidneys of mice. J Environ Sci Health B 34:645–660. https://doi.org/10.1080/03601239909373219
Jiang X et al (2018) Lactobacillus brevis 23017 relieves mercury toxicityin the colon by modulation of oxidative stress and inflammationthrough the interplay of MAPK and NF-kappaB signaling cascades.Front Microbiol 9:2425. https://doi.org/10.3389/fmicb.2018.02425
Kadioglu O et al (2016) Evaluating ancient Egyptian prescriptions today:anti-inflammatory activity of Ziziphus spina-christi. Phytomedicine23:293–306. https://doi.org/10.1016/j.phymed.2016.01.004
Kalender S, Uzun FG, Demir F, Uzunhisarcıklı M, Aslanturk A (2013)Mercuric chloride-induced testicular toxicity in rats and the protec-tive role of sodium selenite and vitamin E. Food Chem Toxicol 55:456–462. https://doi.org/10.1016/j.fct.2013.01.024
Li A et al (2018) Hepatorenal protective effects of medicinal herbs inAn-Gong-Niu-HuangWan (AGNH) against cinnabar- and realgar-induced oxidative stress and inflammatory damage in mice. FoodChem Toxicol 119:445–456. https://doi.org/10.1016/j.fct.2017.11.054
Liu B et al (2018) Protective effects of dietary luteolin against mercuricchloride-induced lung injury inmice: involvement of AKT/Nrf2 andNF-kappaB pathways. Food Chem Toxicol 113:296–302. https://doi.org/10.1016/j.fct.2018.02.003
Livak KJ, Schmittgen TD (2001) Analysis of relative gene expressiondata using real-time quantitative PCR and the 2(−delta delta C(T))method. Methods 25:402–408. https://doi.org/10.1006/meth.2001.1262
Mailloux RJ (2018) Mitochondrial antioxidants and the maintenance ofcellular hydrogen peroxide levels. Oxidative Med Cell Longev2018:7857251. https://doi.org/10.1155/2018/7857251
Martinez CS et al (2014) 60-Day chronic exposure to low concentrationsof HgCl2 impairs sperm quality: hormonal imbalance and oxidativestress as potential routes for reproductive dysfunction in rats. PLoSOne 9:e111202. https://doi.org/10.1371/journal.pone.0111202
Martinez CS et al (2017) Reproductive dysfunction after mercury expo-sure at low levels: evidence for a role of glutathione peroxidase(GPx) 1 and GPx4 in male rats. Reprod Fertil Dev 29:1803–1812.https://doi.org/10.1071/RD16310
Mathur S, Hoskins C (2017) Drug development: lessons from nature.Biomed Rep 6:612–614. https://doi.org/10.3892/br.2017.909
Mohammadi S, Movahedin M, Mowla S (2008) Antioxidant effects ofselenium on sperm parameters and testicular structure in young andaged mice. J Reprod Infert 9:229–238
Moneim AE (2015) Mercury-induced neurotoxicity and neuroprotectiveeffects of berberine. Neural Regen Res 10:881–882. https://doi.org/10.4103/1673-5374.158336
Naik SR, Bhagat S, Shah PD, Tare AA, Ingawale D, Wadekar RR (2013)Evaluation of anti-allergic and anti-anaphylactic activity of ethanolicextract of Zizyphus jujuba fruits in rodents. Rev Bras 23:811–818.https://doi.org/10.1590/S0102-695X2013000500014
Nishikimi M, Appaji N, Yagi K (1972) The occurrence of superoxideanion in the reaction of reduced phenazine methosulfate and molec-ular oxygen. Biochem Biophys Res Commun 46:849–854
Ohkawa H, Ohishi N, Yagi K (1979) Assay for lipid peroxides inanimal tissues by thiobarbituric acid reaction. Anal Biochem95:351–358
Opferman JT, Kothari A (2018) Anti-apoptotic BCL-2 family members indevelopment. Cell Death Differ 25:37–45
Orr SE, Bridges CC (2017) Chronic kidney disease and exposure tonephrotoxic metals. Int J Mol Sci 18. https://doi.org/10.3390/ijms18051039
Othman MS, Safwat G, Aboulkhair M, Abdel Moneim AE (2014) Thepotential effect of berberine in mercury-induced hepatorenal toxicityin albino rats. Food Chem Toxicol 69:175–181. https://doi.org/10.1016/j.fct.2014.04.012
Paglia DE, Valentine WN (1967) Studies on the quantitative and qualita-tive characterization of erythrocyte glutathione peroxidase. J LabClin Med 70:158–169
Perron NR, Brumaghim JL (2009) A review of the antioxidant mecha-nisms of polyphenol compounds related to iron binding. CellBiochem Biophys 53:75–100. https://doi.org/10.1007/s12013-009-9043-x
Shahat AA, Pieters L, Apers S, Nazeif NM, Abdel-Azim NS, Berghe DV,Vlietinck AJ (2001) Chemical and biological investigations onZizyphus spina-christi L. Phytother Res 15:593–597
Environ Sci Pollut Res
Tan X et al (2018) Dietary luteolin protects against HgCl2-inducedrenal injury via activation of Nrf2-mediated signaling in rat. JInorg Biochem 179:24–31. https://doi.org/10.1016/j.jinorgbio.2017.11.010
Teixeira FB, de Oliveira ACA, Leão LKR, Fagundes NCF, FernandesRM, Fernandes LMP, da Silva MCF, Amado LL, Sagica FES, deOliveira EHC, Crespo-Lopez ME, Maia CSF, Lima RR (2018)Exposure to inorganic mercury causes oxidative stress, cell death,and functional deficits in the motor cortex. Front Mol Neurosci 11:125. https://doi.org/10.3389/fnmol.2018.00125
Unoki T, Akiyama M, Kumagai Y, Goncalves FM, Farina M, da RochaJBT, Aschner M (2018) Molecular pathways associated withmethylmercury-induced Nrf2 modulation. Front Genet 9:373.https://doi.org/10.3389/fgene.2018.00373
Venkatesan RS, Sadiq AM (2017) Effect of morin-5′-sulfonic acid sodi-um salt on the expression of apoptosis related proteins caspase 3,
Bax and Bcl 2 due to the mercury induced oxidative stress in albinorats. Biomed Pharmacother 85:202–208. https://doi.org/10.1016/j.biopha.2016.09.090
Yin M et al (2019) Oleuropein suppresses oxidative, inflammatory, andapoptotic responses following glycerol-induced acute kidney injuryin rats. Life Sci 232:116634
Yousef AS, Fahad AA, Abdel Moneim AE, Metwally DM, El-KhadragyMF, Kassab RB (2019) The neuroprotective role of coenzyme Q10against lead acetate-induced neurotoxicity is mediated by antioxi-dant, anti-inflammatory and anti-apoptotic activities. Int J EnvironRes Public Health 16. https://doi.org/10.3390/ijerph16162895
Publisher’s note Springer Nature remains neutral with regard to jurisdic-tional claims in published maps and institutional affiliations.
Environ Sci Pollut Res