1. copy the following dna molecule: *attagctaggacga* taatcgatc ctgc t 2. compare replication and...
TRANSCRIPT
1. Copy the following DNA molecule:
* ATTAGCTAGGACGA*TAATCGATC CTGC T
2. Compare replication and transcription. Consider:Purpose, monomers, process, location, time (when)
Transcribe the upper (template) strand into RNA.
3. Which molecule must be more stable (lasts longer before it breaks down), RNA or DNA? Explain.
(Guidance: Base your answer on the function of each molecule)
Transcription NebraskaTranscription Stolaf
07.25.11 J1-cont.
Preparing for a GIST: Translation
List the information that answers to:
What?Where?
What for?How?
p.243
Include the information in a 20-word GIST!
How many monomer types in nucleic acids?
How many monomer types in proteins?
How many combinations possible for a 3 letter RNA sequence? Explain.
Watch the video clip of transcription.
1) What is the product of this process? How does it appear in the video?
2) Write at least two details of the process that you have noticed: how does it work?
3) What should happen in the next step?
1) An average protein is made of 100 amino acids, how many nucleotides long is an average mRNA?
2) How many different codons (AAA, AAC, AAG….UUU) can possibly exist? Explain.
3) What is the importance of “Start” and “Stop” codons?
07.25.11 J2
Watch the video clip of translation.
1) What is the product of this process? How does it appear in the video?
2) Write at least FIVE LINES: how does it work?
3) What are the two ‘languages’, before and after translation?
J 11.16.12
Gene (DNA)transfer RNA
messenger RNAribosomal RNA
1. Put these molecules in order along the process of making a protein.2. What is the function of each one in the process?(What would not work if it is not there?)
Amino acids
new Protein
J 11.26.12
Protein Synthesis Simulation:A. On the back of your ‘board’:1. Copy the DNA (‘gene’).2. Write the mRNA sequence.3. Divide (commas) into codons.4. List tRNA anti-codons.5. List words = Sentence?!B. Answer questions, reflect.C. If you feel like it – solve another riddle!
Transcription Translation Lewport
RNA Transcription - from promoter to terminator
ClassZone - Translation Tutorial
Translation and Transcription MOVIEs
ATCTACGTAG T TACTCCTAGATGCATCAATGAGG
Template Strand
Non-Template Strand
DNA
1. Transcribe the template strand into mRNA.2. Divide into 3-letter codons3. Write the anti-codons.4. List the resulting order of amino acids
The mRNA can be of any length between 300 to 1,500 nucleotides (more than the actual coding sequence). 1. Think - How will the ribosome
‘know’ where to start the translation of the protein?
2. What do you expect the ribosome to do when it ‘hits’ a stop codon?
Transcription Translation Lewport
RNA Transcription - from promoter to terminator
Transcription interactive (matching bases)
All of the cells in our body contain exactly the same DNA set. So, how is it possible that cells of the liver differ from muscle cells (or other)?
Explain according to what you know so far about gene expression.