1. Copy the following DNA molecule:

* ATTAGCTAGGACGA*TAATCGATC CTGC T

2. Compare replication and transcription. Consider:Purpose, monomers, process, location, time (when)

Transcribe the upper (template) strand into RNA.

3. Which molecule must be more stable (lasts longer before it breaks down), RNA or DNA? Explain.

(Guidance: Base your answer on the function of each molecule)

Transcription NebraskaTranscription Stolaf

07.25.11 J1-cont.

Preparing for a GIST: Translation

List the information that answers to:

What?Where?

What for?How?

p.243

Include the information in a 20-word GIST!

How many monomer types in nucleic acids?

How many monomer types in proteins?

How many combinations possible for a 3 letter RNA sequence? Explain.

Watch the video clip of transcription.

1) What is the product of this process? How does it appear in the video?

2) Write at least two details of the process that you have noticed: how does it work?

3) What should happen in the next step?

Translation Power notes:Use Green Biology Book

1) An average protein is made of 100 amino acids, how many nucleotides long is an average mRNA?

2) How many different codons (AAA, AAC, AAG….UUU) can possibly exist? Explain.

3) What is the importance of “Start” and “Stop” codons?

07.25.11 J2

Protein and Words - game

Watch the video clip of translation.

1) What is the product of this process? How does it appear in the video?

2) Write at least FIVE LINES: how does it work?

3) What are the two ‘languages’, before and after translation?

J 11.16.12

Gene (DNA)transfer RNA

messenger RNAribosomal RNA

1. Put these molecules in order along the process of making a protein.2. What is the function of each one in the process?(What would not work if it is not there?)

Amino acids

new Protein

J 11.26.12

Protein Synthesis Simulation:A. On the back of your ‘board’:1. Copy the DNA (‘gene’).2. Write the mRNA sequence.3. Divide (commas) into codons.4. List tRNA anti-codons.5. List words = Sentence?!B. Answer questions, reflect.C. If you feel like it – solve another riddle!

Transcription Translation Lewport

RNA Transcription - from promoter to terminator

ClassZone - Translation Tutorial

Translation and Transcription MOVIEs

ATCTACGTAG T TACTCCTAGATGCATCAATGAGG

Template Strand

Non-Template Strand

DNA

1. Transcribe the template strand into mRNA.2. Divide into 3-letter codons3. Write the anti-codons.4. List the resulting order of amino acids

JOURNAL 11.28.12

The mRNA can be of any length between 300 to 1,500 nucleotides (more than the actual coding sequence). 1. Think - How will the ribosome

‘know’ where to start the translation of the protein?

2. What do you expect the ribosome to do when it ‘hits’ a stop codon?

The Genetic Code

Amino acids

mRNA codons

Regulation of Genes: Videoclips

Transcription Translation Lewport

RNA Transcription - from promoter to terminator

Transcription interactive (matching bases)

All of the cells in our body contain exactly the same DNA set. So, how is it possible that cells of the liver differ from muscle cells (or other)?

Explain according to what you know so far about gene expression.

2010-20111) Complete the first riddle. Do NOT forget to mark the steps!2) If you have time – solve more

riddles for practice. 3) OR:Create a DNA sequence that will

encode for a short message written in one-letter abbreviations of amino-acids.