1 running title: slnap2 regulates leaf senescence in tomato 2 … · 2018-05-14 · 178 in the...

1

Running title: SlNAP2 regulates leaf senescence in tomato 1 2

Correspondence to: 3

Salma Balazadeh; email: [email protected] 4

Max Planck Institute of Molecular Plant Physiology, Am Mühlenberg 1, 14476 Potsdam-5

Golm, Germany 6

7

Research Area: Signaling and Response 8

9

10

11

12

13

14

15

16

17

18

19

20

21

22

23

24

25

26

27

28

29

30

31

32

Plant Physiology Preview. Published on May 14, 2018, as DOI:10.1104/pp.18.00292

Copyright 2018 by the American Society of Plant Biologists

https://plantphysiol.orgDownloaded on November 19, 2020. - Published by Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.







https://plantphysiol.org







2

The NAC Transcription Factor SlNAP2 Regulates Leaf Senescence and Fruit Yield in 33 Tomato 34

35

Xuemin Ma1,2, Youjun Zhang1, Veronika Turečková3, Gang-Ping Xue4, Alisdair R. Fernie1,5, 36

Bernd Mueller-Roeber1,2,5, Salma Balazadeh1.* 37

38 1Max Planck Institute of Molecular Plant Physiology, Am Mühlenberg 1, 14476 Potsdam-39

Golm, Germany; 2University of Potsdam, Institute of Biochemistry and Biology, Karl-40

Liebknecht-Straße 24-25, Haus 20, 14476 Potsdam-Golm, Germany; 3Laboratory of Growth 41

Regulators, Centre of the Region Haná for Biotechnological and Agricultural Research, 42

Palacký University & Institute of Experimental Botany, Czech Academy of Sciences, 78371 43

Olomouc, Czech Republic; 4CSIRO Plant Industry, St. Lucia QLD 4067, Australia. 5Center 44

of Plant Systems Biology and Biotechnology, Ruski Blvd. 139, 4000 Plovdiv, Bulgaria. 45

46

47

ORCID IDs: 0000-0002-1410-464X (B.M.-R.); 0000-0002-5789-4071 (S.B.). 48

49

One-sentence summary: 50

The abscisic acid-activated NAC transcription factor SlNAP2 controls leaf senescence and 51

fruit yield in tomato. 52

53

Author Contributions: 54

S.B. and B.M.-R. conceived this study. S.B. designed the research and supervised the work. 55

X.M. conducted the experiments. V.T. performed the ABA measurements. G.-P.X. 56

performed the binding site selection assays. Y.Z. and A.R.F. performed primary metabolite 57

profiling. S.B. wrote the manuscript with contributions from X.M. and B.M.-R. All authors 58

read and commented on the manuscript. 59

60

Keywords: 61

Senescence, transcription factor, NAC, SlNAP, tomato, ABA 62

63

Email addresses: 64

XM: [email protected] 65



3

YZ: [email protected] 66

VT: [email protected] 67

GPX: [email protected] 68

ARF: [email protected] 69

BMR: [email protected] 70

SB: [email protected] 71

72



4

Financial sources: 73

This work was supported by the Deutsche Forschungsgemeinschaft (FOR 948; BA4769/1-2) 74

and the Max Planck Institute of Molecular Plant Physiology. X.M. received a fellowship from 75

the China Scholarship Council (CSC). 76

77 *Corresponding author: 78

Salma Balazadeh; email: [email protected]



5

ABSTRACT 80

Leaf senescence is an essential physiological process in plants that supports the recycling of 81

nitrogen and other nutrients to support the growth of developing organs, including young 82

leaves, seeds and fruits. Thus, the regulation of senescence is crucial for evolutionary success 83

in wild populations and for increasing yield in crops. Here we describe the influence of a 84

NAC transcription factor, SlNAP2 (Solanum lycopersicum NAC-like, activated by 85

apetala3/pistillata) , that controls both leaf senescence and fruit yield in tomato (Solanum 86

lycopersicum). SlNAP2 expression increases during age-dependent and dark-induced leaf 87

senescence. We demonstrate that SlNAP2 activates SlSAG113 (Solanum lycopersicum 88

SENESCENCE-ASSOCIATED GENE 113), a homolog of Arabidopsis thaliana SAG113, 89

chlorophyll degradation genes such as SlSGR1 (Solanum lycopersicum senescence-inducible 90

chloroplast stay-green protein 1) and SlPAO (Solanum lycopersicum pheide a oxygenase), 91

and other downstream targets by directly binding to their promoters, thereby promoting leaf 92

senescence. Furthermore, SlNAP2 directly controls the expression of genes important for 93

abscisic acid (ABA) biosynthesis Solanum lycopersicum 9-cis-epoxycarotenoid dioxygenase 94

1 (SlNCED1), transport Solanum lycopersicum ABC transporter G family member 40 95

(SlABCG40) and degradation Solanum lycopersicum ABA 8′-hydroxylase (SlCYP707A2), 96

indicating that SlNAP2 has a complex role in establishing ABA homeostasis during leaf 97

senescence. Inhibiting SlNAP2 expression in transgenic tomato plants impedes leaf 98

senescence but enhances fruit yield and sugar content likely due to prolonged leaf 99

photosynthesis in aging tomato plants. Our data indicate that SlNAP2 has a central role in 100

controlling leaf senescence and fruit yield in tomato. 101

102

103

INTRODUCTION 104

105

Leaf senescence represents the final stage of leaf development, which is an important part of 106

a deciduous plant’s life cycle. The process is genetically programmed and involves a series of 107

orderly changes that lead to degradation of macromolecules (e.g., proteins) and the 108

mobilization of nutrients to actively growing organs such as young leaves, developing seeds 109

and fruits. The timing of leaf senescence is a major determinant of crop yield and quality. If 110

senescence occurs early (i.e., premature senescence), the plant’s overall capacity to assimilate 111

CO2 can be reduced (Wingler et al., 2006). Conversely, if senescence is late, then 112

senescence-dependent nutrient recycling is inhibited (Himelblau and Amasino, 2001), which 113



6

is important for reproductive success. Thus, plasticity in the timing of leaf senescence and the 114

delicate balance between the onset and extent of leaf senescence are essential for ecological 115

success and crop yield. 116

Leaves undergo massive changes in gene expression throughout senescence (Buchanan-117

Wollaston et al., 2005; Balazadeh et al., 2008; Breeze et al., 2011). These expression changes 118

are precisely altered to produce a genomic expression program that is customized for the 119

timing, progression and/or magnitude of leaf senescence in response to different 120

environmental conditions. Therefore, fine-tuning the expression of senescence-related 121

transcriptional regulators is a powerful strategy to manipulate senescence for agronomic 122

purposes, including increased biomass and improved crop yield and production traits. 123

In the last decade, senescence regulatory transcription factors, particularly those from the 124

NAC family, have been identified. NAC proteins (NAM, ATAF1/2 and CUC2) represent one 125

of the largest plant-specific transcription factor (TF) families with 117 members in 126

Arabidopsis thaliana, 151 in rice (Oryza sativa), and 101 in tomato (Solanum lycopersicum) 127

(Nuruzzaman et al., 2010; Ooka et al., 2003; Tweneboah and Oh, 2017). NAC proteins 128

harbor a highly conserved N-terminal domain that serves as a DNA binding domain (DBD) 129

and a variable C-terminal domain which is essential for transcriptional regulation. Several 130

members of the NAC TF family have been reported to be functionally involved in the 131

regulation of leaf senescence in Arabidopsis and other plant species including wheat (Uauy et 132

al., 2006; Zhao et al., 2015), cotton (Fan et al., 2015), and rice (Zhou et al., 2013; Mao et al., 133

2017). For example, Arabidopsis AtNAP (ANAC029) (Guo and Gan, 2006) and ORE1 134

(ANAC092) (Kim et al., 2009; Balazadeh et al., 2010) have been identified as central positive 135

regulators of leaf senescence. The micro-RNA miR164 suppresses accumulation of ORE1 136

transcripts in young leaves, whereas the transcription factor ETHYLENE-INSENSITIVE3 137

(EIN3) negatively regulates miR164 expression in an age-dependent manner resulting in 138

decreased expression of miR164 and an increased expression of ORE1 in aging leaves (Kim 139

et al., 2009). It has been demonstrated that ORE1 controls a complex regulatory circuitry 140

which involves direct transcriptional activation of several genes involved in chlorophyll 141

catabolism, ethylene biosynthesis, and senescence activation. Additionally, the ORE1 protein 142

physically interacts with the chloroplast maintenance G2-like transcription factors GLK1 and 143

GLK2, which hinders their transcriptional activity and contributes to the progression of leaf 144

senescence (Rauf et al., 2013; Lira et al., 2017). 145

The NAC factor AtNAP has been reported to integrate abscisic acid (ABA) signaling and leaf 146

senescence in different plant species (Guo and Gan, 2006; Zhang and Gan, 2012; Liang et al., 147



7

2014; Fan et al., 2015). Leaf and silique senescence are delayed in atnap null mutants, but 148

promoted in AtNAP inducible overexpression lines of Arabidopsis (Guo and Gan, 2006; Kou 149

et al., 2012). AtNAP binds to the promoter of a Golgi-localized protein phosphatase 2C 150

(PP2C) family gene, SAG113, and activates its expression. Induction of SAG113 inhibits 151

stomatal closure and thereby promotes water loss and accelerates leaf senescence, whereas 152

knocking-out the gene delays developmental senescence (Zhang and Gan, 2012). Similarly in 153

rice, OsNAP/PS1 (a functional ortholog of AtNAP) mediates ABA-induced leaf senescence 154

by direct transcriptional activation of several chlorophyll degradation and senescence-155

associated genes (SAGs) including SGR, NYC1, NYC3, RCCR1, Osh36, OsI57, and Osh69. 156

Overexpression of OsNAP promotes leaf senescence, but knocking down this gene causes a 157

marked delay in senescence. Impeded leaf senescence in OsNAP RNAi lines occurs 158

concomitantly with a slower decrease in the rate of photosynthesis, and ultimately an 159

increased grain yield compared to wild-type plants (Liang et al., 2014). Recently, the cotton 160

(Gossypium hirsutum) putative ortholog of AtNAP, GhNAP, was identified as a positive 161

regulator of ABA-mediated leaf senescence. Reduction in GhNAP expression resulted in 162

delayed senescence and improved cotton yield and fiber quality (Fan et al., 2015). 163

Tomato (Solanum lycopersicum) is one of the most popular fleshy fruit-bearing crops 164

worldwide. The tomato genome has been sequenced (Tomato Genome Consortium, 2012) 165

and tomato has been used extensively as a model crop for studies of fruit development and 166

physiology. By contrast, very few studies have been conducted on the regulation of leaf 167

senescence and its possible impact on tomato fruit yield and quality. Recently, the closest 168

tomato putative orthologs of Arabidopsis ORE1 (i.e., SlORE1S02 SlORE1S03 and 169

SlORE1S06) were identified and functionally characterized for their roles in regulating 170

tomato leaf senescence (Lira et al., 2017). Like Arabidopsis ORE1, SlORE1s expression is 171

regulated by miR164 in an age-dependent manner, and at the protein level SlORE1s interact 172

with SlGLKs (Lira et al., 2017). Reduced expression of SlORE1s in RNAi lines led to 173

delayed leaf senescence, extended carbon assimilation, and reduced expression of senescence 174

marker genes. Prolonged photosynthetic activity in SlORE1s RNAi lines, compared with 175

wild-type plants, resulted in a significant increase in the supply of photoassimilates to fruits 176

and enhanced fruit yield. 177

In the current study, we report that an ABA-activated NAC transcription factor named 178

SlNAP2 (the tomato putative ortholog of AtNAP from Arabidopsis and OsNAP from rice) 179

plays a central role in regulating leaf senescence. Furthermore, we characterize the influence 180

of SlNAP2 on fruit quality and yield. SlNAP2 is revealed to be a positive regulator of leaf 181



8

senescence and the senescence regulatory module controlled by SlNAP2 is shown to be 182

highly conserved between tomato and other plant species whose NAP-control mechanisms 183

have been elaborated. SlNAP2 directly controls the expression of the senescence-associated 184

gene SlSAG113 (a homologue of Arabidopsis SAG113) and chlorophyll degradation-related 185

genes SlSGR1 and SlPAO. Intriguingly, we also observed that SlNAP2 directly regulates the 186

expression of both ABA biosynthesis (SlNCED1) and ABA degradation (SlCYP707A2) 187

genes, suggesting the existence of a ´self-regulation´ mechanism by which SlNAP2 tunes its 188

dynamic expression in leaves. Transgenic lines with reduced expression of SlNAP2 exhibit a 189

significant delay in leaf senescence, along with an increase in fruit yield and fruit sugar 190

content. Our research further emphasizes the importance of the regulation of leaf senescence 191

for achieving increased fleshy fruit yield and sugar content. 192

193

194



9

RESULTS 195

196

SlNAP2 is Induced During Senescence 197 SlNAP2 (Solyc04g005610.2.1) and SlNAP1 (Solyc05g007770.2.1) are closely related 198

(~72.7% identity at the amino acid level) NAC transcription factors (TFs) in Solanum 199

lycopersicum (Fig. 1A). Phylogenetic analysis revealed that SlNAP1 and SlNAP2 are 200

homologous to ANAC029/AtNAP (Arabidopsis thaliana NAC-like, activated by 201

Apetala3/Pistillata, At1g69490), which is a well-known senescence regulatory NAC TF (Guo 202

and Gan, 2006) (Fig. 1B). 203

To examine the expression patterns of SlNAP1 and SlNAP2 in S. lycopersicum, we harvested 204

various organs including roots, stem, flowers, leaves at different developmental stages (young 205

leaves, YL; mature leaves, ML; early senescent leaves, SL; and late senescent leaves, LS), 206

and fruits (immature green, IMG; mature green, MG; breaker and ripe red), and then 207

analyzed transcriptional changes using reverse-transcription quantitative PCR (RT-208

qPCR). SlNAP1 and SlNAP2 transcripts were detected in all organs examined (Figure 1C and 209

Supplemental Figure S1A). However, both genes were significantly induced during leaf 210

senescence and fruit ripening. 211

Accordingly, histochemical analysis of transgenic SlNAP2pro:GUS tomato plants, expressing 212

the β-GLUCURONIDASE (GUS) reporter under the control of the 1.5-kb SlNAP2 promoter, 213

revealed elevated GUS activity (indicating enhanced promoter activity) in older parts of the 214

leaves. This was consistent with the results of the RT-qPCR-based expression analyses 215

(Supplemental Fig. S1B). Furthermore, expression analysis by RT-qPCR indicated that both 216

SlNAP1 and SlNAP2 transcript levels increased in leaves during dark-induced senescence 217

(Supplemental Fig. S1C). 218

219

SlNAP2 Promotes Leaf Senescence 220

To elucidate the possible involvement of SlNAP2 in the regulation of leaf senescence, we 221

first generated transgenic tomato lines (cv. Moneymaker) constitutively expressing SlNAP2 222

under the control of the Cauliflower Mosaic Virus (CaMV) 35S promoter. Two lines 223

(hereafter called OX-L2 and OX-L10) were selected for further analysis (Supplemental Fig. 224

S2A). Overexpression of SlNAP2 in tomato plants triggered accelerated leaf senescence (Fig. 225

2A). The two OX lines exhibited a significantly higher number of yellow leaves compared to 226

the wild type (WT) 12 weeks after sowing (Fig. 2B). Consequently, the chlorophyll content 227



10

of the third true leaf decreased faster in OX lines than in WT during a period of 6 weeks (Fig. 228

2C). 229

To further analyze the early senescence phenotype of SlNAP2-OX lines at the molecular 230

level, we checked the expression of senescence-associated genes (SAGs). To this end, we 231

selected the following three SAGs: SlSAG12 (Solyc02g076910), a homolog of Arabidopsis 232

SAG12; SlSAG113 (Solyc05G052980), a homolog of Arabidopsis SAG113 and a direct 233

downstream target gene of AtNAP (Zhang and Gan, 2012); and SlSGR1 (Solyc08g080090), 234

which encodes a stay-green protein involved in the degradation of chlorophyll during leaf 235

senescence. We observed that all three genes were transcriptionally induced during natural 236

and dark-induced senescence as well as upon treatment with ABA in wild-type plants 237

(Supplemental Fig. S3A-C). In accordance with an early senescence phenotype of SlNAP2-238

OX plants, expression of all three SAGs was significantly higher in the third true leaf of 12-239

week-old SlNAP2-OX lines compared to wild type (Fig. 2D). 240

Next, we generated estradiol-inducible SlNAP2 overexpression lines (SlNAP2-IOE) 241

(Supplemental Fig. S2B) and checked the expression by RT-qPCR of SlSAG12, SlSAG113 242

and SlSGR1 after a 6 hour estradiol (ESTR) induction of SlNAP2 expression. The expression 243

of all three SAGs was up-regulated in SlNAP2-IOE plants following ESTR treatment 244

compared to the mock treatment (Fig. 2E). These observations support a role for SlNAP2 in 245

the regulation of developmental leaf senescence by direct or indirect regulation of 246

senescence-associated genes. 247

248

Knock-down of SlNAP2 Delays Developmental Leaf Senescence 249

To further investigate the function of SlNAP2 in controlling senescence, transgenic knock-250

down lines with reduced expression of SlNAP2 were generated using RNA interference 251

(RNAi) (Supplemental Fig. S2C). Two lines with reduced expression of SlNAP2 were 252

selected for further analysis (KD-L2 exhibiting a ~4-fold reduction and KD-L14 with a ~32-253

fold reduction). Expression of SlNAP1, the putative ortholog of SlNAP2, was unaltered in 254

these lines, indicating target gene specificity with RNAi (Supplemental Fig. S2D). 255

Considering the high sequence similarity between SlNAP1 and SlNAP2, and the possibility 256

of functional redundancy, we also created SlNAP1 and SlNAP2 double knock-down lines 257

(dKD) using artificial microRNA (amiRNA) technology. Specifically, a 21-bp sequence 258

identical in SlNAP1 and SlNAP2 was selected for generating the amiRNA construct 259

(Supplemental Fig. S2C and S2E). In general, the analysis of senescence phenotypes 260

revealed that knocking down SlNAP2 alone (KD) or in combination with SlNAP1 (dKD) 261



11

resulted in a significant delay of leaf senescence as measured by the number of yellow leaves, 262

the rate of chlorophyll loss, and the expression of senescence marker genes (Fig. 3 and see 263

next chapters). However, the observed delay in senescence was slightly more pronounced in 264

dKD plants indicating a partial functional redundancy of the two proteins. 265

We also analysed the levels of primary metabolites in fully expanded fifth leaves of 8-week-266

old SlNAP2 transgenic and wild-type plants. Overall, more significant changes among the 267

genotypes were observed with amino acids (Fig. 3D; Supplemental Table S1). The levels of 268

aromatic amino acids (AAAs: Trp, Tyr and Phe) were greater in mature leaves of SlNAP2-OX 269

plants, but lower in leaves of SlNAP2-KD and dKD plants. An increase in AAA levels was 270

reported previously for dark-induced and nitrate limitation-induced senescence as well as 271

natural senescence (Gibon et al., 2006; Fahnenstich et al., 2007; Araújo et al., 2010; Araújo et 272

al., 2011; Watanabe et al., 2013). By contrast, the levels of branched chain amino acids 273

(BCAAs; Ile and Val) were significantly lower in mature leaves of SlNAP2-OX plants. The 274

level of proline, a stress-induced osmoprotectant, was higher in SlNAP2-KD, but significantly 275

lower in SlNAP2-OX compared with wild-type plants. Glu and Asp were lower in mature 276

leaves of SlNAP2-OX plants, and greater in SlNAP2-KD and dKD lines. Conversely, the level 277

of Gln (the major amino acid translocated in the phloem sap during developmental 278

senescence; Guo et al., 2004; Diaz et al., 2005) was higher in SlNAP2-OX but significantly 279

lower in SlNAP2-KD plants. Gamma-aminobutyric acid (GABA) was significantly higher in 280

SlNAP2-OX and lower in SlNAP2-dKD than in WT. Accumulation of GABA is known to be 281

associated with senescence (Ansari et al., 2005; Ansari et al., 2014). 282

Among tricarboxylic acid (TCA) cycle intermediates, malic acid and fumaric acid 283

accumulated in SlNAP2 mutants. Accumulation of these metabolites was reported to be 284

associated with older parts of the leaves (Watanabe et al., 2013). These results reveal that 285

SlNAP2-OK and KD plants have varying mature leaf metabolite profiles that reflect their 286

altered senescence phenotypes. Thus, SlNAP2 plays an important role as a positive regulator 287

of leaf senescence in tomato. 288

289

SlNAP2 Is Involved in Dark-Induced Senescence 290

Darkness is widely used as a tool to induce senescence. Several reports indicate that 291

darkening of leaves share many physiological and molecular alterations with developmental 292

senescence, including a decline in photosynthesis and chlorophyll content, leaf yellowing, 293

and enhanced expression of SAGs (Weaver et al., 1998; Buchanan-Wollaston et al., 2005; 294

Van der Graaff et al., 2006; Parlitz et al., 2011). To test the involvement of SlNAP2 in dark-295



12

induced senescence, young leaves (collected from the upper part of tomato stems) from 10-296

week-old WT and SlNAP2 transgenic lines were subjected to darkness for a period of up to 297

14 days. SlNAP2-OX plants displayed an early leaf yellowing phenotype under darkness, 298

while the leaves of KD-L2 and dKD-L4 remained greener compared to the WT under the 299

same condition (Fig. 4A). Dark-induced early leaf yellowing of OX-L2 was accompanied by 300

a dramatic reduction in chlorophyll content (~70%), while chlorophyll loss was significantly 301

less in WT (~45%), KD-L2 (~20%) and dKD-L4 (~14%) leaves (Fig. 4B). Accordingly, the 302

expression of senescence marker genes such as SlSAG12, SlSAG113 and SlAGT1 303

(Solyc10G076250), as well as of genes involved in chlorophyll degradation such as SlSGR1, 304

SlPPH (Solyc01g088090), SlPAO (Solyc11g066440) and SlNYC1 (Solyc07g024000), was 305

significantly elevated in OX-L2, but reduced in KD-L2 and dKD-L4 lines compared with WT 306

under dark incubation (Fig. 4C). These data suggest that SlNAP2 acts as a positive regulator 307

of both natural and dark-induced leaf senescence by directly or indirectly controlling 308

senescence-associated chlorophyll degradation. 309

310

Involvement of SlNAP2 in ABA-mediated Leaf Senescence 311

Abscisic acid (ABA) is an important hormone involved in the regulation of plant growth and 312

development, including leaf senescence. An increase in endogenous ABA levels during 313

senescence has been reported in several plant species, including Avena sativa (oat; Gepstein 314

and Thimann, 1980), rice (Philosoph-Hadas et al., 1993), Zea mays (maize; He et al., 2005), 315

and Arabidopsis (Yang et al., 2014; Balazadeh et al., 2014). Furthermore, it is known that 316

ABA promotes leaf senescence (Gepstein and Thimann, 1980; Quiles et al., 1995; Yang et 317

al., 2003; Lee et al., 2011; Zhao et al., 2016), the exogenous application of ABA can 318

accelerate chlorophyll degradation (Quiles et al., 1995; Gao et al., 2016), and ABA-deficient 319

mutants display delayed senescence in both rice (Mao et al., 2017) and Arabidopsis (Pourtau 320

et al., 2004). 321

Transcript levels of SlNAP2 began to increase (~3-fold change) 2 hours after ABA treatment 322

of wild-type seedlings, with additional increases at later time points (e.g., ~6-fold changes 323

at 8 hours) (Fig. 5A). Conversely, SlNAP2 expression was significantly reduced in tomato 324

mutants deficient in ABA biosynthesis, such as sitiens (sit) and notabilis (not), further 325

confirming that SlNAP2 is an ABA-activated transcription factor (Fig. 5B). To examine the 326

possible role of SlNAP2 in regulating ABA-induced leaf senescence, we analysed the 327

phenotype of SlNAP2 transgenic plants upon application of exogenous ABA. Specifically, 328

detached leaves from WT and SlNAP2 transgenic plants were exposed to ABA (40 µM), and 329



13

compared to control (mock) treatments that lacked ABA. When wild-type leaves were treated 330

with ABA, senescence symptoms were induced such as leaf yellowing, chlorophyll loss and 331

enhanced expression of senescence marker genes (Fig. 5C-E). Interestingly, ABA-induced 332

early senescence was more pronounced in leaves of SlNAP2 overexpressors than WT, while 333

SlNAP2 knock-down lines (KD-L2 and dKD-L4) exhibited stay-green phenotypes upon ABA 334

treatment (Fig. 5C-E). Activation of SlNAP2 by ABA and the altered senescence phenotype 335

of SlNAP2 transgenic lines upon treatment with ABA implicate SlNAP2 as a regulator of 336

ABA-dependent leaf senescence. 337

338

Identification of the Consensus Target Sequence of SlNAP1 and SlNAP2 339

TFs bind to cis-regulatory elements in promoters of target genes to control their expression. 340

Knowledge of the binding sites favours the identification of TF target genes and helps gain 341

insight into its regulatory functions. Previous work has identified high-affinity binding 342

sequences of TaNAC69 from wheat using an in vitro binding site selection assay employing 343

the CELD-fusion method (Xue et al., 2006). SlNAP1 and SlNAP2 are homologs of 344

TaNAC69, suggesting they have overlapping DNA-binding specificities. To identify the 345

target sequences of SlNAP1 and SlNAP2, we analysed the binding activity of both TFs on 12 346

randomly selected oligonucleotides with TaNAC69 binding motifs, including SO1 which is 347

considered a high-affinity binding sequence of TaNAC69 (Xue et al., 2006). SlNAP1 and 348

SlNAP2 are capable of binding to TaNAC69-selected motifs containing the YACG (or 349

CGTR) core sequence and share similar binding sequence specificities to that of TaNAC69, 350

with SO1 as the highest-affinity binding motif (Supplemental Fig. S4A). 351

To assess the specificity of binding, nucleotide mutation (substitution, insertion or deletion) 352

experiments were performed on the basis of SO1 (SO1m1–SO1m18) and SO48 (SO48m1 353

and SO48m2) motifs. Our analysis revealed that mutation of nucleotides in the core motifs 354

(oligonucleotides SO1m3, 4, 8, 9 and SO48m1) led to a dramatic reduction or abolishment of 355

SlNAP1 binding. A significant drop in the binding affinity was noticed upon reducing the 356

distance between the two core motifs from 5 to 4 bp (oligonucleotide SO1m1), or increasing 357

it to 7 bp (oligonucleotide SO1m2) (Supplemental Fig. S4A, B). Based on these results, we 358

conclude that CGT[AG](5N)NACG[ACT][AC][AT][ACG][ACT] and 359

CACG[ACT][AC][AT][AGT][CT] are high-affinity binding sites of SlNAP1. SlNAP2 360

appears to be more tolerant to the nucleotide mutations of SO1 (which contains two core 361

motifs) than SlNAP1 (Supplemental Fig. S4B). However, the mutation in the single core 362

motif of SO48 (SO48m1) led to almost complete abolishment of its binding activity. To 363



14

further demonstrate binding of SlNAP2 to the TaNAC69 motif, an electrophoretic mobility 364

shift assay (EMSA) was performed. This experiment revealed that SlNAP2 strongly binds to 365

SO1 (Supplemental Fig. S4C). 366

367

Direct Transcriptional Regulation of SAGs and ABA-related Genes by SlNAP2 368

To further elucidate the senescence control function of SlNAP2 at the molecular level, we 369

conducted an RT-qPCR analysis to evaluate the expression of 22 senescence-related genes in 370

SlNAP2-IOE plants, including known SAGs, genes involved in chlorophyll degradation, and 371

ABA-associated genes (Supplemental Fig. S2B). Our data revealed that the majority of 372

genes (15 out of 22; SlSAG12, SlSAG15, SlSAG113, SlSGR1, SlAGT1, SlSGR1, SlNYC1, 373

SlPAO, SlNCED1, SlABA3, SITIENS, SlAAO3, SlCYP707A2, SlCYP707A4, SlABCG40) were 374

induced (log2 fold change > 1) 6 hours after estradiol treatment in SlNAP2-IOE plants 375

compared to mock-treated controls (Fig. 6A), suggesting their early and positive regulation 376

by SlNAP2. Expression of all genes examined except one (SlPPH) was down-regulated in 377

KD-L2 and dKD-L4. We then searched for the presence of SlNAP2 binding sites (perfect 378

match) within 1-kb promoters of SlNAP2 early responsive genes to identify potential direct 379

target genes of the NAC TF. Twelve genes (SlSAG12, SlSAG15, SlSAG113, SlSGR1, SlPAO, 380

SlNCED1, SlABA3, SITIENS, SlAAO3, SlCYP707A2, SlCYP707A4, SlABCG40) harbor 381

SlNAP2 binding sites (perfect match) within their promoters. To test if SlNAP2 interacts with 382

the promoters of early responsive genes in vivo, we generated transgenic lines expressing 383

SlNAP2-GFP fusion protein under the control of the CaMV 35S promoter. As expected for a 384

transcription factor, SlNAP2-GFP fusion protein was located in nuclei, as visualized by 385

fluorescence microscopy of epidermal cells of transgenic tomato leaves (Fig. 6B). Using 386

SlNAP2-GFP lines, we performed chromatin immuno-precipitation coupled with RT-qPCR 387

(ChIP-qPCR) and confirmed direct binding of SlNAP2 to the promoters of SlSAG113, 388

SlSGR1, SlPAO, SlNCED1, SlCYP707A2 and SlABCG40 in vivo (Fig. 6C, E). Furthermore, 389

employing EMSAs, direct physical interaction of SlNAP2 with the promoters of all six genes 390

was confirmed (Fig. 6D, F). SlNCED1 encodes 9-cis-epoxycarotenoid dioxygenase, a key 391

enzyme in ABA biosynthesis, and SlCYP707A2 encodes ABA 8′-hydroxylase, a key enzyme 392

in the oxidative catabolism of ABA in tomato (Ji et al., 2014). Positive regulation of both 393

genes by SlNAP2 reveals a complex role for this TF for the regulation of ABA homeostasis. 394

Next, we determined ABA levels in SlNAP2 transgenic lines and WT plants. Suppression of 395

SlNAP2 results in higher ABA accumulation in 3-week-old plants, suggesting its role as an 396

inhibitor of ABA accumulation and subsequently its own accumulation at this stage (Fig. 397



15

6G). No change in ABA levels was detected in 8-week-old SlNAP2 KD lines and WT plants 398

(Supplemental Fig. S5). 399

400

SlNAP2 Knock-down Enhances Fruit Yield and Sugar Content 401

To test the influence of altered leaf senescence (triggered by manipulating SlNAP2 402

expression) on fruit yield, we measured various yield-associated parameters. SlNAP2-OX 403

plants started producing flowers around one week earlier than WT plants (Supplemental Fig. 404

S6A). The number of fruits per plant significantly increased in SlNAP2-KD plants compared 405

to WT, while fruit number decreased in SlNAP2 overexpressors (Supplemental Fig. S6B). 406

Notably, we did not observe a significant difference between genotypes for the 407

mean time span between anthesis and the fruit breaker stage (Supplemental Fig. S6D). 408

Furthermore, fruit size was almost indistinguishable between SlNAP2-KD and WT plants, but 409

was significantly reduced in SlNAP2 overexpressors (Supplemental Fig. S6C). 410

Sweetness, which results from enhanced soluble sugar content, is one of the most important 411

traits of tomato fruits. During senescence, sugars are translocated from older leaves (source) 412

to developing fruits (sinks). To test the effect of altered senescence in SlNAP2 transgenics on 413

fruit sweetness, we measured Brix values and soluble sugar content in fruits of different 414

developmental stages. SlNAP2 KD and dKD plants synthesized higher contents of soluble 415

solids in ripe fruits as demonstrated by Brix units (Fig. 7A). The levels of sugars (fructose, 416

sucrose and glucose) were also significantly higher in SlNAP2 KD and dKD lines, particularly 417

at the breaker stage (Fig. 7B-D). Collectively, our data clearly indicate an association of 418

SlNAP2 deficiency with delayed aging and improved fruit yield and metabolism. 419

420

421



16

DISCUSSION 422

The main biological role of senescence is nutrient recycling, which is essential for plant 423

survival, crop yield and the shelf life of leafy vegetables. Although several studies have 424

demonstrated a connection between leaf senescence and productivity with regard to biomass 425

production and seed/grain yield (reviewed in Gregersen, 2013), research that has examined the 426

effects of leaf senescence on fleshy fruit production and its nutritional quality is limited. 427

Recently, Lira et al. (2017) demonstrated that a simultaneous suppression of all three homologs 428

of ORE1 in tomato (SlORE1S02, SlORE1S03, and SlORE1S06) resulted in a remarkable delay 429

of leaf senescence, increased fruit yield, and enhanced levels of sugars in the ripe fruits. 430

Furthermore, in apple (Malus sp.), overexpression of the YTH-domain-containing RNA-431

binding proteins MhYTP1 and MhYTP2 promoted leaf senescence and accelerated fruit 432

ripening (Wang et al., 2017). 433

In the current study, we demonstrate the senescence-regulatory function of SlNAP2, a member 434

of the NAC family of transcription factors (TFs) in tomato, and show that the manipulation of 435

leaf senescence by this TF is effective for improving fleshy fruit yield. SlNAP2 is expressed at 436

all stages of leaf and fruit development; however, its expression is significantly induced in 437

senescing leaves and ripe fruits. Similar to its homologs in Arabidopsis, rice and cotton, 438

expression of SlNAP2 is rapidly induced by ABA (one of the main hormones that initiates 439

leaf senescence), indicating conservation of the upstream regulatory pathways that control the 440

ABA-mediated induction of NAP genes across monocot and eudicot plant species (Zhang and 441

Gan, 2012; Liang et al., 2014; Fan et al., 2015). 442

Transgenic plants with enhanced expression of SlNAP2 exhibit early leaf senescence during 443

typical age-dependent senescence as well as during senescence induced by darkness (Fig. 2 444

and 4), as measured by reduced chlorophyll content and enhanced expression of senescence 445

marker genes. In contrast, reduced expression of SlNAP2 in knock-down plants results in a 446

substantial delay of natural and dark-induced senescence. The delayed senescence was more 447

pronounced in transgenic lines with reduced expression of both SlNAP2 and its closely related 448

homolog SlNAP1, revealing partially redundant and additive functions of the two genes in the 449

regulation of leaf senescence in tomato. 450

During senescence, a drastic change occurs in leaf metabolism, which is mainly due to the 451

degradation of metabolites and the subsequent mobilization of nutrients toward developing 452

organs. Metabolomic profiles of fully expanded fifth leaves (from 8-week-old plants) revealed 453

a clear metabolic shift between SlNAP2 overexpression and knock-down lines corresponding 454

to the contrasting senescence phenotypes (Fig. 3). Among amino acids, the levels of aromatic 455



17

amino acids (particularly Trp and Phe) and Gln were greater in SlNAP2-OX plants, but 456

significantly lower in leaves of SlNAP2-KD and dKD plants. Induction of AAAs, and more 457

specifically tryptophan, during senescence has been shown in several species such as rice 458

(Kang et al., 2009), Arabidopsis (Watanabe et al., 2013; Chrobok et al., 2016), tomato (Araújo 459

et al., 2012), and tobacco (Li et al., 2016). Gln is a major source of remobilizable N during 460

senescence and its synthesis is induced by glutamine synthetase 1 (GS1) activity in senescent 461

leaves (Tabushi et al., 2007; Park et al., 2010). Indeed, the transcript level of SlGS1 462

significantly decreased in SlNAP2 KD and dKD plants in accordance with the dramatic 463

reduction in the level of Gln in those lines (Supplemental Fig. S7). The majority of other 464

amino acids, including branched chain amino acids (Ile and Val), Gly, Ser, Lys, Asp and Glu, 465

were downregulated in SlNAP2-OX, but upregulated in KD plants. In fact, such a metabolic 466

pattern can be explained in part by enhanced expression of SlGDH (encoding glutamate 467

dehydrogenase) in SlNAP2-OX plants and its significant reduction in the KD lines 468

(Supplemental Fig. S7). It has been shown that SlGDH activity increases during senescence 469

which is essential for deamination of glutamate and subsequent catabolism of several amino 470

acids (Masclaux et al., 2000; Masclaux-Daubresse et al., 2006; Miyashita and Good, 2008). 471

In addition to age- and dark-induced senescence, ABA-induced senescence was also 472

significantly impeded in SlNAP2-suppressed plants suggesting an important role of SlNAP2 in 473

ABA-induced leaf senescence. Previous reports demonstrated a functionally conserved role for 474

NAP in the regulation of age- and ABA-induced leaf senescence in different eudicot and 475

monocot species such as Arabidopsis (AtNAP), rice (OsNAP), and cotton (GhNAP) (Guo and 476

Gan, 2006; Zhang and Gan, 2012; Zhou et al., 2013, Liang et al., 2014; Fan et al., 2015). 477

Reports on downstream regulatory pathways indicate that AtNAP and OsNAP negatively 478

regulate ABA signalling and biosynthesis pathways in Arabidopsis and rice, respectively. In 479

Arabidopsis, AtNAP directly and positively regulates expression of SAG113, a Golgi-localized 480

protein phosphatase 2C (PP2C). Hence, it negatively regulates the ABA-induced promotion of 481

stomatal closure, consequently leading to water loss and triggering leaf senescence (Zhang and 482

Gan, 2012). In rice, OsNAP suppresses ABA biosynthesis genes including OsNCED1, 483

OsNCED3 and OsNCED4, thereby controlling ABA synthesis via a feedback mechanism 484

(Liang et al., 2014). 485

To unravel the molecular mechanism through which SlNAP2 regulates leaf senescence and 486

gain insight into the level of conservation of regulatory networks controlled by SlNAP2 in 487

tomato and its homologs in other species, we performed RT-qPCR-based expression profiling 488

of senescence-associated genes, chlorophyll degradation genes, and ABA biosynthesis and 489



18

signaling genes in wild-type plants, SlNAP2 inducible overexpression lines (shortly after 490

SlNAP2 induction by estradiol) and SlNAP2 knock-down lines. Our data revealed that most 491

genes were transcriptionally enhanced after induction of SlNAP2 in estradiol-inducible 492

overexpression plants but reduced in KD and dKD lines. Of the differentially expressed genes 493

(Fig. 6), SlSAG113, SlSGR1, SlPAO, SlNCED1, SlCYP707A2 and SlABCG40 contained 494

bipartite SlNAP2 binding sites within their 1-kb 5´ upstream regulatory regions (promoters), 495

revealing potential direct targets of SlNAP2. The direct interaction between SlNAP2 and the 496

promoters of all six genes was confirmed in vivo by ChIP-qPCR, and in vitro by EMSA (Fig. 497

6). SlSAG113 is a homolog of Arabidopsis SAG113, a direct downstream target gene of 498

AtNAP. SlSGR1 and SlPAO are crucial to chlorophyll degradation in tomato leaves and 499

fruits, and the sgr mutation in tomato results in a stay-green phenotype (Akhtar et al., 1999: 500

Hu et al., 2011; Guyer et al., 2014). Interestingly in rice, OsNAP directly targets the 501

promoters of genes involved in chlorophyll degradation such as SGR, NYC1, NYC3 (PPH) 502

and RCCR, besides other senescence-associated genes (SAGs), and enhances their expression 503

(Liang et al., 2014). SlNAP2 shares high amino acid sequence similarity in the NAC domain 504

with AtNAP (~92, 2%) and OsNAP (~79, 2%) explaining the similar target gene profiles. 505

Intriguingly, SlNAP2 directly promotes the expression of both SlNCED1 and SlCYP707A2, 506

key tomato genes involved in ABA synthesis and catabolism, respectively. It has been shown 507

that the level of ABA in fruits is mainly regulated by SlNCED1 and SlCYP707A2 at the 508

transcriptional levels (Ji et al., 2014). However, functional properties of the enzymes in 509

leaves with respect to regulation of ABA levels and the consequent impact on leaf senescence 510

remain to be investigated. A positive regulation of both genes by SlNAP2 reflects a more 511

complex regulation of ABA homeostasis in tomato leaves. ABA levels were significantly 512

higher in SlNAP2 KD and dKD plants at the early stages of development, while ABA levels 513

were not altered by SlNAP2 at the later stages. This result suggests the existence of a ´self-514

regulation´ mechanism by which SlNAP2 tunes its dynamic expression during leaf 515

development (Fig. 6G). Similarly, a feedback mechanism in ABA-OsNAP1 regulation was 516

previously reported in rice, where ABA amounts were greater in non-senescent leaves of 517

OsNAP RNAi plants than in those of the wild type (Liang et al., 2014). Together, the direct 518

regulation of SlSAG113 and chlorophyll degradation genes (such as SlSGR1 and SlPAO) by 519

SINAP2, as well as SINAP2’s tight link to ABA signaling demonstrate that the regulation of 520

leaf senescence by SlNAP2 is an evolutionarily conserved pathway for senescence control in 521

eudicots and monocots. 522



19

Leaf senescence can significantly impact crop production by remobilization of 523

photoassimilates from older vegetative tissues to sink organs. To examine the influence of 524

altered leaf senescence mediated by a modification of SlNAP2 on tomato productivity, we 525

analysed different yield-related traits, such as the number and quality of fruits, and the timing 526

of ripening. Importantly, delayed senescence in SlNAP2 knock-down plants was concomitant 527

with an increased number of fruits per plant, while fruit size and speed of fruit ripening were 528

not affected (Supplemental Fig. S6). Furthermore, SlNAP2 KD and dKD plants accumulated 529

higher levels of soluble sugars such as fructose, glucose and sucrose at breaker and ripe fruit 530

stages, and brix units were significantly higher in dKD than wild-type plants (Fig. 7). 531

Delayed senescence in OsNAP and GhNAP RNAi lines was also reported to be associated 532

with increased yield in rice and cotton, respectively (Liang et al., 2014; Fan et al., 2015). 533

However, it cannot be excluded that the enhanced fruit number and nutritional quality 534

observed in SlNAP2 KD lines may result from a combinatorial effect of SlNAP2 in altering 535

senescence in leaves and modifying the physiology in fruits. 536

We conclude that SlNAP2 regulates leaf senescence and subsequently fruit yield through a 537

gene regulatory network that combines several target genes including senescence-associated 538

marker genes, chlorophyll degradation genes and ABA homeostasis-related genes (Fig. 8). 539

The regulation of leaf senescence by SlNAP2 and its positive effect on yield are considerably 540

conserved across species. Manipulation of leaf senescence through a modification of 541

regulatory factors that initiate and control senescence is a powerful strategy to improve 542

agricultural plant productivity, including the production of fleshy fruits. 543

544

545

MATERIALS AND METHODS 546

547

General 548

Tomato putative orthologs of Arabidopsis genes were identified using the PLAZA 3.0 549

database (http://bioinformatics.psb.ugent.be/plaza/; Proost et al., 2015). Genes were 550

annotated using the PLAZA 3.0 and Sol Genomics (https://solgenomics.net/) databases, and 551

using information extracted from the literature. Oligonucleotide sequences are listed in 552

Supplemental Table S2. RT-qPCR primers were designed using QuantPrime 553

(www.quantprime.de; Arvidsson et al., 2008) and some primers were designed based on 554

literature data, as indicated. Chemicals and reagents were obtained from Invitrogen, Sigma-555



20

Aldrich and Fluka. Molecular biological kits were obtained from Qiagen and Macherey-556

Nagel. 557

558

Plant Material and Growth Conditions 559

Solanum lycopersicum L. cv. Moneymaker wild type (WT) was used as control in this study. 560

Seeds were germinated on full-strength Murashige–Skoog (MS) medium containing 2% 561

(w/v) sucrose, and 3-week-old seedlings were transferred to a mixture of potting soil and 562

quartz sand (2:1, v/v). Plants were grown in a growth chamber at 500 μmol photons m-2 s-1 563

and 25°C under a 14/10-h light/dark regime in individual pots (18 cm diameter). 564

565

DNA Constructs 566

Primer sequences are listed in Supplemental Table S2. Amplified fragments generated by 567

PCR were sequenced by Eurofins MWG Operon (Ebersberg, Germany). Constructs were 568

transformed into tomato cv. Moneymaker via Agrobacterium tumefaciens GV2260-mediated 569

transformation. For SlNAP2pro:GUS lines, the 1.5-kb SlNAP2 promoter was amplified from 570

WT genomic DNA and introduced upstream of the GUS coding sequence in plasmid 571

pKGWFS7,0 (Karimi et al., 2002). For the generation of SlNAP2-KD plants, an 88-bp 572

fragment from the 3´ end of the SlNAP2 coding sequence was amplified from WT cDNA and 573

cloned into the GATEWAY-compatible entry vector pDONR221 (Invitrogen). The fragment 574

was then cloned into the pK7GWIWG2 RNAi vector (Karimi et al., 2002) in sense and 575

antisense orientations, flanking an intervening intron, by GATEWAY cloning (Invitrogen). 576

To generate SlNAP1/SlNAP2 double knock-down (dKD) plants, an amiRNA construct was 577

engineered by replacing the original miR319a/miR319a* sequence in plasmid pRS300 578

(Schwab et al., 2006) with a 21-bp sequence (TAATTCCCAGGGATCGAACTT) identical in 579

SlNAP1 and SlNAP2. The amiRNA was designed using Web MicroRNA Designer 3 580

(http://wmd3.weigelworld.org/cgi-bin/webapp.cgi), and subsequently inserted downstream of 581

the CaMV 35S promoter in the pK7WG2 binary vector (Karimi et al., 2002) via GATEWAY 582

cloning. For 35S:SlNAP2-GFP, the full-length SlNAP2 open reading frame was amplified 583

without its stop codon. The PCR product was cloned into the pENTR/D-TOPO vector using 584

the pENTR Directional TOPO Cloning kit (Invitrogen). The sequence-verified entry clone 585

was then transferred to the pK7FWG2 vector (Karimi et al., 2002) by LR recombination 586

(Invitrogen). For SlNAP2-IOE, the SlNAP2 coding sequence was cloned into the pER10-587

GATEWAY-compatible vector (Zuo et al., 2000). For SlNAP1- and SlNAP2-CELD, the 588



21

DBP-CELD fusion vector pTacLCELD6XHis was used (Xue, 2005). SlNAP1 and SlNAP2 589

full coding sequences (without stop codons) were amplified by PCR with a sense primer 590

(including an NheI restriction site) and an antisense primer (including a BamHI restriction 591

site) (Supplemental Table S2). The amplified DNA fragments were first inserted into 592

pCR2.1 (ThermoFischer Scientific) and then inserted N-terminal of CELD using the NheI 593

and BamHI cloning sites of pTacLCELD6XHis to create an in-frame fusion. 594

595

Treatments 596

For estradiol induction, 3-week-old SlNAP2-IOE seedlings were incubated in sterile water 597

containing 15 μM estradiol (control treatment: 0.15% [v/v] ethanol). The seedlings were kept 598

on a rotary shaker for 6 hours and then immediately frozen in liquid nitrogen. For ABA 599

treatment, 3-week-old tomato seedlings were incubated in sterile water containing 40 μM 600

ABA. The seedlings were kept on a rotary shaker for 2, 4, 8 or 16 hours and then harvested in 601

liquid nitrogen. For dark-induced leaf senescence experiments, detached young leaves from 602

10-week-old WT and SlNAP2 transgenic plants were placed on moist filter papers in Petri 603

dishes with the adaxial side facing upwards. The plates were kept in darkness at 22°C for two 604

weeks. Filter papers were changed every five days. Gene expression levels were determined 605

by RT-qPCR. 606

607

Gene Expression Analysis 608

Total RNA extraction was done using Trizol reagent (Life Technologies). Synthesis of 609

complementary DNA and RT-qPCR using SYBR Green were performed as described 610

(Balazadeh et al., 2008). PCR was performed using an ABI PRISM 7900HT sequence 611

detection system (Applied Biosystems). GAPDH (Solyc04g009030) served as reference gene 612

for data analysis. Statistical significance was determined using Student’s t-test. 613

614

DNA-Binding Site Selection 615

In vitro binding site selection was performed using the CELD-fusion method with the 616

pTacSlNAP1-LCELD6XHis and pTacSlNAP2-LCELD6XHis constructs, employing biotin-617

labeled double-stranded oligonucleotides (Xue, 2005). The DNA binding activity of SlNAP1-618

CELD and SlNAP2-CELD was measured using methylumbelliferyl β-D-cellobioside as a 619

substrate (Xue, 2002). DNA binding assays with a biotin-labeled single-stranded 620



22

oligonucleotide or a biotin-labeled double-stranded oligonucleotide without a target binding 621

site were used as controls. 622

623

Electrophoretic Mobility Shift Assay 624

SlNAP2-CELD fusion protein was extracted from Escherichia coli Rosetta (DE3) competent 625

cells. 5´-DY682-labelled 40-bp oligonucleotides representing fragments of the SlSAG113 (5’-626

TCTTCTCATTGGCCCACGTAAATTCAAATCAATAAAATCT-3’), SlSGR1 (5’-627

ATCGATCGAGCTCCAATACGAATATCGGAATAAGAAAAAA-3’), SlPAO (5’-628

CATTGTTCATAACTTGCACGCAAATCCTTCTTCTTCTTCT-3’), SlNCED1 (5’-629

CAATTTCTTTTATATGTCTACGTAATTATTTAAAAAGAAT-3’), SlCYP707A2 (5’-630

TTGTTGTTTTTTCATTACGTATTTGAAATTCGCGTTAGAG-3’) and SlABCG40 (5’- 631

TTTTTGTGTGTTTGATACGTAATTAAATATAAATAAAAAA-3’) promoters were 632

purchased from Eurofins MWG Operon and annealed with their sequence-complementary 633

oligonucleotides to form DNA probes. Annealing was performed by heating the primers to 634

99°C, followed by slow cooling to room temperature. The binding reaction was performed at 635

room temperature for 20 min. EMSA reactions were performed using the Odyssey Infrared 636

EMSA kit (LI-COR Biosciences, Bad Homburg, Germany) as described in the manual. 637

DNA-protein complexes were separated on 6% agarose retardation gels, while DY682 signal 638

was detected using the Odyssey Infrared Imaging System (LI-COR Biosciences). 639

640

Chromatin Immunoprecipitation (ChIP) 641

ChIP-qPCR was performed from leaves of mature 35S:SlNAP2-GFP plants, and wild type 642

(WT) served as control. ChIP was performed as described (Kaufmann et al., 2010) using anti-643

GFP antibody to immunoprecipitate protein-DNA complexes. qPCR primers were designed 644

to flank the SlNAP2-binding sites within the promoter regions of SlSAG12, SlSAG113, 645

SlSGR1, SlPAO, SlNCED1, SlCYP707A2 and SlABCG40. Primers annealing to a promoter 646

region of Solyc04g009030 lacking a SlNAP2 binding site were used as a negative control. 647

Primers used for qPCR are listed in Supplemental Table S2. 648

649

Chlorophyll Measurements 650

Chlorophyll content was determined using a SPAD analyser (N-tester; Hydro Agri). 651

652

Metabolite Measurements 653



23

Metabolite profiling of tomato mature green leaves and fruits at three developmental stages 654

was carried out by gas chromatography–mass spectrometry (ChromaTOF software, Pegasus 655

driver 1.61; LECO) as described previously (Lisec et al., 2006). The chromatograms and 656

mass spectra were evaluated using TagFinder software (Luedemann et al., 2012). Metabolite 657

identification was manually checked by the mass spectral and retention index collection of 658

the Golm Metabolome Database (Kopka et al., 2004). Peak heights of the mass fragments 659

were normalized on the basis of the fresh weight of the sample and the added amount of an 660

internal standard (ribitol). Statistical differences between groups were analyzed by Student’s 661

t-tests on the raw data. Results were determined to be statistically different at a probability 662

level of P < 0.05. Relative metabolite levels were obtained as the ratio between the lines and 663

the mean value of the respective wild type. 664

665

ABA Measurement 666

Plant tissue (approximately 20 mg fresh weight of each sample) was ground using 3-mm 667

tungsten carbide beads (Retsch, Haan, Germany) with a MM 301 vibration mill at a 668

frequency of 27.0 Hz for 3 min (Retsch). Internal standard containing deuterium-labelled 669

standard (20 pmol of (+)-3´,5´,5´,7´,7´,7´-2H6-ABA) and 1 mL ice-cold methanol/water/acetic 670

acid (10/89/1, v/v) were added to each of the samples. After 1 h of shaking in the dark at 4°C, 671

the homogenates were centrifuged (20,000 x g, 10 min, 4°C) after extraction, and the pellets 672

were then re-extracted in 0.5 mL extraction solvent for 30 min. The combined extracts were 673

purified by solid-phase extraction on Oasis HLB cartridges (60 mg, 3 mL, Waters, Milford, 674

MA, USA), evaporated to dryness in a Speed-Vac (UniEquip), and analysed by UPLC-ESI (-675

/+)-MS/MS (Turečková et al., 2009). 676

677

Brix Determination 678

Brix was determined as the concentration of total soluble solids (TSS), using a digital 679

refractometer (Krüss Optronic, Germany), on six ripe red fruit samples per genotype. 680

681

Accession Numbers 682

Sequence data from this article can be found in the GenBank/EMBL data libraries under 683

accession numbers SlNAP1 (NP_001316452.1); SlNAP2 (XM_004236996.2); SlSAG12 684

(XP_004233054); SlSAG113 (XP_004239911.1); SlSGR1 (NP_001234723.1); SlPAO 685

(NP_001234535.2); SlNCED1 (NP_001234455); SlCYP707A2 (XP_004244436.1); 686

SlABCG40 (XP_004247842.1); SlGDH1 (NP_001292722); SlGS1 (XP_004248690). 687



24

XXX. 688

689

Supplemental Data 690

Supplemental Figure 1. Expression of SlNAP1 and SlNAP2. 691

Supplemental Figure 2. Expression of SlNAP2 in overexpression and knock-down lines. 692

Supplemental Figure 3. Expression of senescence marker genes. 693

Supplemental Figure 4. Identification of the binding sequences of SlNAP1 and SlNAP2. 694

Supplemental Figure 5. ABA content. 695

Supplemental Figure 6. Effect of SlNAP2 on fruit yield. 696

Supplemental Figure 7. Expression of SlGDH1 and SlGS1. 697

698

699

Supplemental Table 1. 700

Supplemental Table 1. Relative metabolite content of fully expanded leaves of 8-week-old 701

SlNAP2 transgenic and WT pants. 702

Supplemental Table 2. Oligonucleotide sequences. 703

704

ACKNOWLEDGMENTS 705

We thank Dr. Karin Koehl and her team (Max Planck Institute of Molecular Plant Physiology) 706

for plant care. We thank the University of Potsdam and the Max Planck Institute of Molecular 707

Plant Physiology for supporting our research. 708

709

Figure legends 710

711

Figure 1. SlNAP1 and SlNAP2 are up-regulated during leaf senescence. 712

A, Protein sequence alignment of AtNAP, SlNAP1, and SlNAP2. Amino acids identical in all 713

three proteins are highlighted with a black background, while conservative substitutions are 714

shown with a grey background. Asterisks indicate the stop codons. B, Phylogenetic analysis 715

of NAC proteins. The phylogenetic tree was constructed by MEGA 5.05 software using the 716

Neighbor–Joining method with the following parameters: bootstrap analysis of 1,000 717

replicates, Poisson model and pairwise deletion. SlNAP1, SlNAP2, NAC-NOR and SlNAC3 718

are senescence-induced tomato TFs of the NAP family, while all other TFs are from 719

Arabidopsis. Gene codes are: ATAF1, At1g01720; ATAF2, At5g08790; AtNAC2, 720

At5g39610; AtNAM, At1g52880; AtNAP, At1g69490; CUC2, At5g53950; NAC-NOR, 721



25

Solyc10g006880; SlNAP1, Solyc05g007770; SlNAP2, Solyc04g005610; SlNAC3, 722

Solyc07g063420. The numbers at the nodes indicate the bootstrap values. The bar at the 723

bottom indicates the relative divergence of the sequences examined. C, The left panel shows 724

representative images of Solanum lycopersicum cv. Moneymaker leaves at different 725

developmental stages; young leaves (YL), mature leaves (ML), senescent leaves (SL), and 726

late senescent leaves (LS). The right panel denotes the expression levels of SlNAP1 and 727

SlNAP2 in such leaves, determined by RT-qPCR. The Y axis indicates expression level (40 - 728

dCt). Values are expressed as the difference between an arbitrary value of 40 and dCt, so that 729

high 40 - dCt values indicate high gene expression levels. Data are means of three biological 730

replicates ± SD. Asterisks indicate significant difference from young leaves (Student’s t-test; 731

**: P ≤ 0.01). 732

733

Figure 2. Overexpression of SlNAP2 leads to early developmental leaf senescence. 734

A, Phenotype of WT, OX-L2, and OX-L10 plants. Upper panel: 12-week-old plants; lower 735

panel: phenotypes of the third true leaf of 10-week-old plants (leaves were individually 736

photographed and compiled for comparison). B, Ratio of yellow to all leaves in 12-week-old 737

WT, OX-L2, and OX-L10 plants. Leaves were counted as yellow if chlorophyll content had 738

declined by more than 50% compared to those leaves in 8-week-old plants. Data are means ± 739

SD (n = 5). C, Chlorophyll loss of the third true leaf (counted from the bottom of the stem) of 740

WT, OX-L2, OX-L10 plants 8, 10, 12 and 14 weeks after sowing (8W - 14W). Chlorophyll 741

content was measured using a SPAD analyser and compared to the content in each genotype 742

at time point 8W (set to 1). Data are means ± SD of three biological replicates. Significant 743

difference from the wild type is denoted by one asterisk (Student’s t-test; P ≤ 0.05) or two 744

asterisks (P ≤ 0.01). Red asterisks indicate a significant difference between OX-L2 and WT, 745

and blue asterisks indicate a significant difference between OX-L10 and WT. D, Expression 746

of senescence marker genes (SlSAG12, SlSAG113 and SlSGR1) in lower positioned leaves of 747

12-week-old WT, OX-L2, and OX-L10 plants, analysed by RT-qPCR. Data are means ± SD 748

of three biological replicates. E, Expression of senescence marker genes in SlNAP2-IOE 749

plants after 6 h estradiol (ESTR) induction of SlNAP2 expression, compared to expression in 750

mock-treated plants. Data are means ± SD of three biological replicates. Values at the Y axes 751

in (D) and (E) represent the difference between an arbitrary value of 40 and dCt, so that high 752

40 - dCt values indicate high gene expression level. Asterisks in panels B, D and E indicate 753

significant difference from WT (Student’s t-test; *: P ≤ 0.05, **: P ≤ 0.01). 754

755



26

Figure 3. Knocking down SlNAP2 delays developmental leaf senescence. 756

A, Phenotype of SlNAP2 knock-down (KD-L2) and SlNAP2/SlNAP1 double knock-down 757

(dKD-L4) plants. Upper panel: 12-week-old plants; lower panel: phenotypes of the third true 758

leaf of 10-week-old plants. The WT plant shown is the same as in Figure 2A (as 759

overexpressor and knock-down lines, together with WT plants, were grown side by side in 760

the same experiment; plants and leaves were individually photographed and compiled for 761

comparison). B, Ratio of yellow to all leaves in 12-week-old plants. Leaves were counted as 762

yellow if chlorophyll content had declined by more than 50% compared to those leaves in 8-763

week-old plants. Asterisks indicate significant difference from wild-type plants (Student’s t-764

test; **: P ≤ 0.01) (n = 5). C, Chlorophyll loss of the third true leaf (counted from the bottom 765

of the stem) of WT, KD-L2, and dKD-L4 plants 8, 10, 12 and 14 weeks after sowing (8W – 766

14W). Chlorophyll content was measured using a SPAD analyser and compared to the 767

content in each genotype at time point 8W (set to 1). Data are means ± SD of three biological 768

replicates. Significant difference from wild type is denoted by one asterisk (Student’s t-test; P 769

≤ 0.05) or two asterisks (P ≤0.01). Red asterisks indicate a significant difference between 770

dKD-L4 and WT, and blue asterisks indicate a significant difference between KD-L2 and 771

WT. D, Metabolite contents of SlNAP2 transgenic lines compared to wild-type plants. The 772

fifth fully expanded leaves were harvested from 8-week-old WT, OX-L2, KD-L2 and dKD-L4 773

plants. Metabolite content was analyzed using GC-MS (n = 4). Log2 fold change (FCh) 774

values of the relative metabolite contents are presented here. Asterisks indicate significant 775

difference from wild type (Student’s t-test; *: P ≤ 0.05, **: P ≤ 0.01). 776

777

Figure 4. SlNAP2 accelerates dark-induced senescence. 778

A, Young detached leaves of 10-week-old WT and SlNAP2-transgenic lines before (day 0) 779

and after 14 days of dark treatment. Leaves were detached from the top part of the stem. 780

Leaves in each panel were individually photographed and compiled for presentation. B, 781

Chlorophyll content of control and dark-treated leaves, determined using a SPAD analyser. 782

Data are means of leaves from three plants ± SD. Asterisks indicate significant differences 783

from wild-type plants (Student’s t test; **: P ≤ 0.01). C, Expression of SAGs (SlSAG12, 784

SlSAG113, SlAGT1 and SlSAG15), chlorophyll degradation genes (SlSGR1, SlPPH, SlPAO 785

and SlNYC1) in control and dark-treated leaves of WT and SlNAP2 transgenic lines. The Y 786

axis indicates expression level (40-dCt). Data are means ± SD of three biological replicates. 787

Asterisks indicate significant difference from wild-type plant (Student’s t-test; *: P ≤ 0.05, 788

**: P ≤ 0.01). 789



27

790

Figure 5. SlNAP2 regulates ABA-induced leaf senescence. 791

A, Elevated expression of SlNAP2 after ABA treatment. Three-week-old wild-type seedlings 792

were treated with ABA (40 µM) for 2, 4, 8 and 16 h. Data are means ± SD of three biological 793

replicates. Asterisks indicate significant differences from mock-treated plants (Student’s t-794

test; *: P ≤ 0.05). B, Reduced expression of SlNAP2 in ABA-deficient mutants, sitiens (sit) 795

and notabilis (not). Data are means ± SD of three biological replicates. Asterisks indicate 796

significant difference from WT (Student’s t-test; *: P ≤ 0.05; **: P ≤ 0.01). C, Phenotype of 797

detached leaves from 10-week-old WT and SlNAP2-transgenic plants before (0 d) and after 798

treatment with 40 µM ABA for 9 days (9 d). Young leaves from the top of the stem were used 799

and individually photographed. D, Chlorophyll content of control and ABA-treated leaves, 800

determined using a SPAD analyser. Data are means ± SD from six leaves of three different 801

plants. Asterisks indicate significant difference from respective mock-treated leaves 802

(Student’s t-test; **: P ≤ 0.01). E, RT-qPCR analysis of SlSAG12, SlSAG113 and SlSGR1 803

expression in control and ABA-treated leaves. The Y axis indicates expression level (40 - 804

dCt). Asterisks indicate significant difference from wild type (Student’s t-test; **: P ≤ 0.01). 805

806

Figure 6. Direct regulation of SAGs and ABA-related genes by SlNAP2. 807

A, Heat map showing the fold change (FCh; log2 basis) of the expression ratio of SAGs, 808

chlorophyll degradation as well as ABA biosynthesis and signalling genes in the following 809

samples: 3-week-old SlNAP2-IOE seedlings (line IOE-L5) treated with estradiol (15 µM) for 810

6 h compared to ethanol (0.15%, v/v) treated seedlings (mock); KD-L2 and dKD-L4 lines, 811

compared to WT. Blue, downregulated; red, upregulated (as indicated by the color bar). Data 812

represent means of three biological replicates. Asterisks indicate significant difference from 813

mock-treated and/or WT plants (Student’s t-test; *: P ≤ 0.05, **: P ≤ 0.01). Genes shown in 814

bold are direct targets of SlNAP2 (see panels C – F). B, Subcellular localization of SlNAP2-815

GFP fusion protein in epidermal cells of transgenic tomato leaves, visualized by fluorescence 816

microscopy. Top, bright field; bottom, GFP fluorescence (green) under bright field. Scale bar, 817

10 µm. C, ChIP-qPCR shows enrichment of SlSAG113, SlSGR1 and SlPAO (but not 818

SlSAG12) promoter regions containing the SlNAP2 binding site. Mature leaves (no. 3 - 5) 819

harvested from 8-week-old SlNAP2-GPF plants were used for the ChIP experiment. Values 820

were normalized to the values for Solyc04g009030 (promoter lacking a SlNAP2 binding site). 821

Data are means ± SD of two independent biological replicates, each performed with three 822

technical replicates. D, EMSA showing binding of purified SlNAP2-CELD protein to the 5´-823



28

DY682-labelled 40-bp-long promoter fragments of SlSAG113, SlSGR1 and SlPAO, containing 824

the SlNAP2 binding sites. Lane 1, labelled promoter fragment only; lane 2, labelled promoter 825

fragment plus SlNAP2-CELD protein, showing the retardation band (´bound probe´); lane 3, 826

labelled promoter fragment, SlNAP2-CELD protein plus 100-fold molar access of non-827

labelled promoter (competitor). E, ChIP-qPCR. Mature leaves of 8-week-old SlNAP2-GPF 828

plants were harvested for the ChIP experiment. qPCR was performed to quantify the 829

enrichment of SlNCED1, SlCYP70A2 and SlABCG40 promoter regions. Values were 830

normalized to the values for Solyc04g009030 (promoter lacking a SlNAP2 binding site). 831

Data are means ± SD of two biological replicates, each performed in two technical replicates. 832

F, EMSA showing binding of purified SlNAP2-CELD protein to 5´-DY682-labelled 40-bp-833

long promoter fragments of SlNCED1, SlCYP707A2 and SlABCG40, containing the SlNAP2 834

binding sites. For description of lanes, see legend to panel D. G, ABA content. Three-week-835

old WT, KD-L2 and dKD-L4 plants were harvested and ABA content was determined using 836

UPLC-ESI-MS/MS. ABA content is shown as means ± SD of three biological replicates. 837

Asterisks indicate significant difference from the wild type (Student’s t-test; *: P ≤ 0.05). FW, 838

fresh weight. 839

840

Figure 7. Fruit Brix value and soluble sugar content. 841

A, The content of total soluble solids (TSS) of ripe red fruits was determined using a digital 842

refractometer. Values represent the means ± SD of six biological replicates (Student’s t-test; 843

*: P ≤ 0.05). The contents of fructose (B), sucrose (C) and glucose (D) in the pericarps of 844

SlNAP2 transgenic and WT fruits at different developmental stages, analyzed by GC-MS (n = 845

4). Relative metabolite levels were obtained by normalizing the intensity value of each 846

metabolite to the ribitol internal standard. Asterisks indicate significant difference from the 847

wild type (Student’s t-test; *: P ≤ 0.05, **: P ≤ 0.01). MG: mature green fruits. 848

849

Figure 8. Model of SlNAP2 action in tomato. 850

During age-dependent and dark-induced senescence, ABA accumulates in leaves which leads 851

to an activation of SlNAP2 expression; enhanced expression of SlNAP2 during leaf aging may 852

also be triggered without the involvement of ABA. SlNAP2 activates SlSAG113, chlorophyll 853

degradation genes such as SlSGR1 and SlPAO, and other downstream targets by directly 854

binding to their promoters, thereby promoting leaf senescence. SlNAP2 also directly 855

regulates the expression of ABA biosynthesis (SlNCED1), transport (SlABCG40) and 856

degradation (SlCYP707A2) genes, indicating a complex role in establishing ABA 857



29

homeostasis. Inhibition of SlNAP2 leads to delayed leaf senescence and enhanced fruit yield 858

and sugar content, likely due to prolonged leaf photosynthesis, although a direct effect of 859

SlNAP2 on fruit development is possible. Arrow-ending lines, positive regulation; T-ending 860

lines, negative regulation. The dashed line indicates a possible, but not yet experimentally 861

confirmed interaction between senescing leaves and developing fruits. 862

863

864



C

Figure 1.

A

B

YL ML SL LS

AtNAPSlNAP1SlNAP2

AtNAPSlNAP1SlNAP2

AtNAPSlNAP1SlNAP2

AtNAPSlNAP1SlNAP2

20

25

30

35

40

45

SlNAP1 SlNAP2

Expr

essi

on le

vel (

40-d

Ct) YL ML SL LS

**

****

**

797980

159159160

238233236

269283276

NAC-NOR

0.10100

100

100

100100

99

79

SlNAP1SlNAP2AtNAP

AtNAM

SlNAC3ATAF1

ATAF2AtNAC2

CUC2

Figure 1. SlNAP1 and SlNAP2 are up-regulated during leaf senescence.A, Protein sequence alignment of AtNAP, SlNAP1, and SlNAP2. Amino acids identical in all three proteins are highlighted with ablack background, while conservative substitutions are shown with a grey background. Asterisks indicate the stop codons. B,Phylogenetic analysis of NAC proteins. The phylogenetic tree was constructed by MEGA 5.05 software using the Neighbor–Joining method with the following parameters: bootstrap analysis of 1,000 replicates, Poisson model and pairwise deletion.SlNAP1, SlNAP2, NAC-NOR and SlNAC3 are senescence-induced tomato TFs of the NAP family, while all other TFs are fromArabidopsis. Gene codes are: ATAF1, At1g01720; ATAF2, At5g08790; AtNAC2, At5g39610; AtNAM, At1g52880; AtNAP,At1g69490; CUC2, At5g53950; NAC-NOR, Solyc10g006880; SlNAP1, Solyc05g007770; SlNAP2, Solyc04g005610; SlNAC3,Solyc07g063420 . The numbers at the nodes indicate the bootstrap values. The bar at the bottom indicates the relativedivergence of the sequences examined. C , The left panel shows representative images of Solanum lycopersicumcv. Moneymaker leaves at different developmental stages; young leaves (YL), mature leaves (ML), senescent leaves (SL), andlate senescent leaves (LS). The right panel denotes the expression levels of SlNAP1 and SlNAP2 in such leaves, determined byRT-qPCR. The Y axis indicates expression level (40 - dCt). Values are expressed as the difference between an arbitrary value of40 and dCt, so that high 40 - dCt values indicate high gene expression levels. Data are means of three biological replicates±SD. Asterisks indicate significant difference from young leaves (Student’s t-test; **: P ≤ 0.01).



Figure 2

A

C

WT OX-L2 OX-L10

D

0

0,2

0,4

0,6

0,8

1

1,2

8W 10W 12W 14W

WTOX-L2OX-L10

25

30

35

40

45

50

SlSAG12 SlSAG113 SlSGR1

Expr

essi

on le

vel (

40-d

Ct)

WT OX-L2 OX-L10

** ** ****

WT

WT

B

05

10152025303540

WT OX-L2 OX-L10

**

WT

Yello

w le

af ra

tio (%

)(y

ello

w le

aves

/tota

l lea

fno.

)

*

Chl

orop

hyll

cont

ent

(com

pare

dto

8W)

15

20

25

30

35

40

SlSAG12 SlSAG113 SlSGR1

Expr

essi

on le

vel (

40-d

Ct)

Mock

Est

*

** **E

*

**

****

*

ESTR

0.2

0.4

0.6

0.8

1

0.2

Figure 2. Overexpression of SlNAP2 leads to early developmental leaf senescence.A, Phenotype of WT, OX-L2, and OX-L10 plants. Upper panel: 12-week-old plants; lower panel: phenotypes of the third trueleaf of 10-week-old plants (leaves were individually photographed and compiled for comparison). B , Ratio of yellow to allleaves in 12-week-old WT, OX-L2, and OX-L10 plants. Leaves were counted as yellow if chlorophyll content had declined bymore than 50% compared to those leaves in 8-week-old plants. Data are means± SD (n = 5). C, Chlorophyll loss of the thirdtrue leaf (counted from the bottom of the stem) of WT, OX-L2, OX-L10 plants 8, 10, 12 and 14 weeks after sowing (8W -14W). Chlorophyll content was measured using a SPAD analyser and compared to the content in each genotype at timepoint 8W (set to 1). Data are means± SD of three biological replicates. Significant difference from the wild type is denotedby one asterisk (Student’s t-test; P ≤ 0.05) or two asterisks (P ≤ 0.01). Red asterisks indicate a significant difference betweenOX-L2 and WT, and blue asterisks indicate a significant difference between OX-L10 and WT. D, Expression of senescencemarker genes (SlSAG12, SlSAG113 and SlSGR1) in lower positioned leaves of 12-week-old WT, OX-L2, and OX-L10 plants,analysed by RT-qPCR. Data are means ± SD of three biological replicates. E, Expression of senescence marker genes inSlNAP2-IOE plants after 6 h estradiol (ESTR) induction of SlNAP2 expression, compared to expression in mock-treated plants.Data are means± SD of three biological replicates. Values at the Y axes in (D) and (E) represent the difference between anarbitrary value of 40 and dCt, so that high 40 - dCt values indicate high gene expression level. Asterisks in panels B, D and Eindicate significant difference fromWT (Student’s t-test; *: P ≤ 0.05, **: P ≤ 0.01).



Figure 3

A

C

BWT KD-L2 dKD-L4

5th

0

5

10

15

20

25

30

35

WT KD-L2 dKD-L4Ye

llow

leaf

ratio

(%)

(yel

low

leav

es /

tota

l lea

fno.

)

** **

WT

D

TrpPheTyrIleValThrGlySerLysProAspGluGlnAla

*

***

**

* **

** *

**

OX-L2 KD-L2 dKD-L4

GABACitric acidMalic acidSuccinic acidFumaric acidAconitic acidPhosphoric acidSaccharic acidGlyceric acid

OX-L2 KD-L2 dKD-L4

RhamnoseXyloseFructoseSucroseGlucoseMannoseSorboseRiboseXylose

OX-L2 KD-L2 dKD-L4

* *

** *

*

Log2 FCh-0.6 0 0.6

* *

*

0

0,2

0,4

0,6

0,8

1

1,2

8W 10W 12W 14W

Chl

orop

hyll

cont

ent

(com

pare

dto

8W)

WTKD-L2dKD-L4

WT

**

*

***

**

0.2

0.4

0.6

0.8

1

1.2

Figure 3. Knocking down SlNAP2 delays developmental leaf senescence.A, Phenotype of SlNAP2 knock-down (KD-L2) and SlNAP2/SlNAP1 double knock-down (dKD-L4) plants. Upper panel: 12-week-oldplants; lower panel: phenotypes of the third true leaf of 10-week-old plants. The WT plant shown is the same as in Figure 2A (asoverexpressor and knock-down lines, together with WT plants, were grown side by side in the same experiment; plants andleaves were individually photographed and compiled for comparison). B, Ratio of yellow to all leaves in 12-week-old plants.Leaves were counted as yellow if chlorophyll content had declined by more than 50% compared to those leaves in 8-week-oldplants. Asterisks indicate significant difference from wild-type plants (Student’s t-test; **: P ≤ 0.01) (n = 5). C, Chlorophyll loss ofthe third true leaf (counted from the bottom of the stem) of WT, KD-L2, and dKD-L4 plants 8, 10, 12 and 14 weeks after sowing(8W – 14W). Chlorophyll content was measured using a SPAD analyser and compared to the content in each genotype at timepoint 8W (set to 1). Data are means± SD of three biological replicates. Significant difference from wild type is denoted by oneasterisk (Student’s t-test; P ≤ 0.05) or two asterisks (P ≤0.01). Red asterisks indicate a significant difference between dKD-L4 andWT, and blue asterisks indicate a significant difference between KD-L2 and WT. D, Metabolite contents of SlNAP2 transgeniclines compared to wild-type plants. The fifth fully expanded leaves were harvested from 8-week-old WT, OX-L2, KD-L2 and dKD-L4 plants. Metabolite content was analyzed using GC-MS (n = 4). Log2 fold change (FCh) values of the relative metabolitecontents are presented here. Asterisks indicate significant difference from wild type (Student’s t-test; *: P ≤ 0.05, **: P ≤ 0.01).



Figure 4

15

25

35

45

55

Control Dark

SlPPH

AB

14

0

KD-L2 dKD-L4OX-L2 WT

WT

01020304050607080

Control Dark

Chl

orop

hyll

cont

ent

(SPA

D v

alue

)

OX-L2 WTKD-L2 dKD-L4

**

** **

WT

Day

s in

dar

knes

s

15

25

35

45

55

Control Dark

SlSAG113 ***

15

25

35

45

55

Control Dark

SlAGT1

****SlSAG113

Day 0 Day 14

Day 0 Day 14Day 0 Day 14

15

25

35

45

55

Control Dark

**

SlSAG15

Day 0 Day 14

*****

Day 0 Day 1415

25

35

45

55

Control Dark

****

SlSGR1

Day 0 Day 14

Expr

essi

on le

vel

(40-

dCt)

SIPPH

15

25

35

45

55

Control Dark

**

Day 0 Day 14

SIPAO

15

25

35

45

55

Control Dark

** *

SlNYC1

Day 0 Day 14

SINYC1

C

15

25

35

45

55

Control Dark

*

* *

SlSAG12

Day 0 Day 14

Expr

essi

on le

vel

(40-

dCt)

OX-L2WTKD-L2dKD-L4

Figure 4 . SlNAP2 accelerates dark-induced senescence.A, Young detached leaves of 10-week-old WT and SlNAP2-transgenic lines before (day 0) and after 14 days of dark treatment.Leaves were detached from the top part of the stem. Leaves in each panel were individually photographed and compiled forpresentation. B, Chlorophyll content of control and dark-treated leaves, determined using a SPAD analyser. Data are means ofleaves from three plants± SD. Asterisks indicate significant differences from wild-type plants (Student’s t test; **: P ≤ 0.01). C,Expression of SAGs (SlSAG12, SlSAG113, SlAGT1 and SlSAG15), chlorophyll degradation genes (SlSGR1, SlPPH, SlPAO and SlNYC1)in control and dark-treated leaves of WT and SlNAP2 transgenic lines. The Y axis indicates expression level (40-dCt). Data aremeans± SD of three biological replicates. Asterisks indicate significant difference from wild-type plant (Student’s t-test; *: P ≤0.05, **: P ≤ 0.01). https://plantphysiol.orgDownloaded on November 19, 2020. - Published by

Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.


Figure 5

E

20

25

30

35

40

0 DAT 9 DAT

OX-L2WTKD-L2DKD-L4

**

SlSAG12

25

30

35

40

45

0 DAT 9 DAT

**

25

30

35

40

0 DAT 9 DAT

**SlSAG113 SlSGR1

0

10

20

30

40

50

60

70

Chl

orop

hyll

cont

ent

(SPA

D v

alue

)

Mock 0DATMock 9DATABA 9DAT

****

OX-L2 WT KD-L2 dKD-L4

0d9d,Mock9d,ABA

D

9d, ABA

0d

9d, Mock

OX-L2 WT KD-L2 dKD-L4C

Expr

essi

on le

vel

(40-

dCt)

A B

25

30

35

40

45

2h 4h 8h 16h

Mock ABA

* * *

Expr

essi

on le

vel

(40-

dCt)

WT sitiens notabilis25

30

35 ***

Expr

essi

on le

vel (

40-d

Ct)



Figure 5. SlNAP2 regulates ABA-induced leaf senescence.A, Elevated expression of SlNAP2 after ABA treatment. Three-week-old wild-type seedlings were treated with ABA (40 µM)for 2, 4, 8 and 16 h. Data are means± SD of three biological replicates. Asterisks indicate significant differences from mock-treated plants (Student’s t-test; *: P ≤ 0.05). B, Reduced expression of SlNAP2 in ABA-deficient mutants, sitiens (sit) andnotabilis (not). Data are means ± SD of three biological replicates. Asterisks indicate significant difference from WT(Student’s t-test; *: P ≤ 0.05; **: P ≤ 0.01). C , Phenotype of detached leaves from 10-week-old WT and SlNAP2-transgenicplants before (0 d) and after treatment with 40 µM ABA for 9 days (9 d). Young leaves from the top of the stem were usedand individually photographed. D, Chlorophyll content of control and ABA-treated leaves, determined using a SPAD analyser.Data are means± SD from six leaves of three different plants. Asterisks indicate significant difference from respective mock-treated leaves (Student’s t-test; **: P ≤ 0.01). E, RT-qPCR analysis of SlSAG12, SlSAG113 and SlSGR1 expression in control andABA-treated leaves. The Y axis indicates expression level (40 - dCt). Asterisks indicate significant difference from wild type(Student’s t-test; **: P ≤ 0.01).



Figure 6

Fold

enric

hmen

t(lo

g2)

C

boundprobes

freeprobes

B D

-2.0 0.0 +2.0

AFo

lden

richm

ent(

log2

)

E

-1-0,5

00,5

11,5

22,5

3

SlSAG12 SISAG113 SISGR1 SIPAO

SlSAG12SlSAG15SlSAG113

SlSGR1SlAGT1

SlNYC1SlPPHSlPAOSlNCED1

SlABA1SlABA3SlTIENSSlAAO3SlCYP707A1SlCYP707A2

SlCYP707A4SlABCG40SlABI3

SlNCED2SlNCED3SlNCED4

SlCYP707A3

IOE-L5 KD-L2 dKD-L4

*

******** *

* ** **

********

* ***

*

SAGs

Chlorophylldegradation

ABA-associated genes

00,5

11,5

22,5

3

SlNCED1 SICYP707A2 SIABCG40

SlSAG113 SlSGR1 SlPAO

1 2 3 1 2 3 1 2 3

Brig

ht fi

eld

Mer

ged

(GFP

fluo

resc

ence

/br

ight

field

)

0

50

100

150

200

250

WT KD-L2 dKD-L4

**

G

** Log2 FCh

F 1 2 3 1 2 3 1 2 3

SlNCED1 SlCYP707A2 SlABCG40

boundprobes

freeprobes

WT

ABA

(pm

ol/g

FW)

2.5

-1-0.5

0.51

1.52

0

3

2.5

0.51

1.52

3

0



Figure6.DirectregulationofSAGs andABA-relatedgenesbySlNAP2.A, Heat map showing the fold change (FCh; log2 basis) of the expression ratio of SAGs, chlorophyll degradation as well as ABAbiosynthesis and signalling genes in the following samples: 3-week-old SlNAP2-IOE seedlings (line IOE-L5) treated withestradiol (15 µM) for 6 h compared to ethanol (0.15%, v/v)-treated seedlings (mock); KD-L2 and dKD-L4 lines, compared toWT. Blue, downregulated; red, upregulated (as indicated by the colour bar). Data represent means of three biologicalreplicates. Asterisks indicate significant difference from mock-treated and/or WT plants (Student’s t-test; *: P ≤ 0.05, **: P ≤0.01). Genes shown in bold are direct targets of SlNAP2 (see panels C – F). B, Subcellular localization of SlNAP2-GFP fusionprotein in epidermal cells of transgenic tomato leaves, visualized by fluorescence microscopy. Top, bright field; bottom, GFPfluorescence (green) under bright field. Scale bar, 10 µm. C, ChIP-qPCR shows enrichment of SlSAG113, SlSGR1 and SlPAO (butnot SlSAG12) promoter regions containing the SlNAP2 binding site. Mature leaves (no. 3 - 5) harvested from 8-week-oldSlNAP2-GPF plants were used for the ChIP experiment. Values were normalized to the values for Solyc04g009030 (promoterlacking a SlNAP2 binding site). Data are means ± SD of two independent biological replicates, each performed with threetechnical replicates. D, EMSA showing binding of purified SlNAP2-CELD protein to the 5´-DY682-labelled 40-bp-long promoterfragments of SlSAG113, SlSGR1 and SlPAO, containing the SlNAP2 binding sites. Lane 1, labelled promoter fragment only; lane2, labelled promoter fragment plus SlNAP2-CELD protein, showing the retardation band (´bound probe´); lane 3, labelledpromoter fragment, SlNAP2-CELD protein plus 100-fold molar access of non-labelled promoter (competitor). E, ChIP-qPCR.Mature leaves of 8-week-old SlNAP2-GPF plants were harvested for the ChIP experiment. qPCR was performed to quantifythe enrichment of SlNCED1, SlCYP70A2 and SlABCG40 promoter regions. Values were normalized to the values forSolyc04g009030 (promoter lacking a SlNAP2 binding site). Data are means ± SD of two biological replicates, each performedin two technical replicates. F, EMSA showing binding of purified SlNAP2-CELD protein to 5´-DY682-labelled 40-bp-longpromoter fragments of SlNCED1, SlCYP707A2 and SlABCG40, containing the SlNAP2 binding sites. For description of lanes, seelegend to panel D. G, ABA content. Three-week-old WT, KD-L2 and dKD-L4 plants were harvested and ABA content wasdetermined using UPLC-ESI-MS/MS. ABA content is shown as means ± SD of three biological replicates. Asterisks indicatesignificant difference from the wild type (Student’s t-test; *: P ≤ 0.05). FW, fresh weight.



Figure 7

0

1

2

3

4

5

6

7

8

Met

abol

ite/ri

bito

l

00,5

11,5

22,5

33,5

4

Met

abol

ite/ri

bito

l

MG Breaker Ripe red

*


Total soluble solidsA

C

B

DGlucose

0

0,5

1

1,5

2

2,5

Met

abol

ite/ri

bito

l OX-L2WTKD-L2dKD-L4

******

Sucrose

****

*

** **

Fructose

MG Breaker Ripe red MG Breaker Ripe red


00,5

11,5

22,5

33,5

44,5

Brix

inde

x

**

**

0.5

1

1.5

2

2.5

0.5

1.5

2.53

4

1

2

3.5

4.5

Figure 7. Fruit Brix value and soluble sugar content.A, The content of total soluble solids (TSS) of ripe red fruits was determined using a digital refractometer. Values representthe means ± SD of six biological replicates (Student’s t-test; *: P ≤ 0.05). The contents of fructose (B), sucrose (C) and glucose(D) in the pericarps of SlNAP2 transgenic and WT fruits at different developmental stages, analyzed by GC-MS (n = 4). Relativemetabolite levels were obtained by normalizing the intensity value of each metabolite to the ribitol internal standard.Asterisks indicate significant difference from the wild type (Student’s t-test; *: P ≤ 0.05, **: P ≤ 0.01). MG: mature greenfruits.

1

0.5

1.5

2.53

4

2

3.5

1



Figure 8

SlNAP2

SlSGR1SlPAO

Leafsenescence

ABASlNCED1SlABCG40

SlSAG113

Developmentalleafaging/darkness

Chlorophylldegradation

SlCYP707A2

Othertargets

Yield/sugars

?

Fruits

Leaves

SlNAP2

Figure 8. Model of SlNAP2 action in tomato.During age-dependent and dark-induced senescence, ABA accumulates in leaves which leads to an activation of SlNAP2expression; enhanced expression of SlNAP2 during leaf aging may also be triggered without the involvement of ABA. SlNAP2activates SlSAG113, chlorophyll degradation genes such as SlSGR1 and SlPAO, and other downstream targets by directly bindingto their promoters, thereby promoting leaf senescence. SlNAP2 also directly regulates the expression of ABA biosynthesis(SlNCED1), transport (SlABCG40) and degradation (SlCYP707A2) genes, indicating a complex role in establishing ABA homeostasis.Inhibition of SlNAP2 leads to delayed leaf senescence and enhanced fruit yield and sugar content, likely due to prolonged leafphotosynthesis, although a direct effect of SlNAP2 on fruit development is possible. Arrow-ending lines, positive regulation; T-ending lines, negative regulation . The dashed line indicates a possible, but not yet experimentally confirmed interaction betweensenescing leaves and developing fruits.

Parsed CitationsAkhtar MS, Goldschmidt EE, John I, Rodoni S, Matile P, Grierson D (1999) Altered patterns of senescence and ripening in gf, a stay-green mutant of tomato (Lycopersicon esculentum Mill.). J Exp Bot 50: 1115-1122

Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Ansari MI, Hasan S, Jalil SU (2014) Leaf senescence and GABA shunt. Bioinformation 10: 734-736Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Ansari MI, Lee RH, Chen SCG (2005) A novel senescence-associated gene encoding gamma-aminobutyric acid (GABA): pyruvatetransaminase is upregulated during rice leaf senescence. Physiol Plantarum 123: 1-8


Araujo WL, Ishizaki K, Nunes-Nesi A, Larson TR, Tohge T, Krahnert I, Witt S, Obata T, Schauer N, Graham IA, Leaver CJ, Fernie AR(2010) Identification of the 2-hydroxyglutarate and isovaleryl-CoA dehydrogenases as alternative electron donors linking lysinecatabolism to the electron transport chain of Arabidopsis mitochondria. Plant Cell 22: 1549-1563


Araujo WL, Tohge T, Ishizaki K, Leaver CJ, Fernie AR (2011) Protein degradation - an alternative respiratory substrate for stressedplants. Trends Plant Sci 16: 489-498


Araujo WL, Tohge T, Osorio S, Lohse M, Balbo I, Krahnert I, Sienkiewicz-Porzucek A, Usadel B, Nunes-Nesi A, Fernie AR (2012)Antisense inhibition of the 2-oxoglutarate dehydrogenase complex in tomato demonstrates its importance for plant respiration andduring leaf senescence and fruit maturation. Plant Cell 24: 2328-2351


Balazadeh S, Riano-Pachon DM, Mueller-Roeber B (2008) Transcription factors regulating leaf senescence in Arabidopsis thaliana.Plant Biology 10: 63-75


Balazadeh S, Schildhauer J, Araujo WL, Munne-Bosch S, Fernie AR, Proost S, Humbeck K, Mueller-Roeber B (2014) Reversal ofsenescence by N resupply to N-starved Arabidopsis thaliana: transcriptomic and metabolomic consequences. J Exp Bot 65: 3975-3992


Balazadeh S, Siddiqui H, Allu AD, Matallana-Ramirez LP, Caldana C, Mehrnia M, Zanor MI, Kohler B, Mueller-Roeber B (2010) A generegulatory network controlled by the NAC transcription factor ANAC092/AtNAC2/ORE1 during salt-promoted senescence. Plant J 62:250-264


Breeze E, Harrison E, McHattie S, Hughes L, Hickman R, Hill C, Kiddle S, Kim YS, Penfold CA, Jenkins D, Zhang CJ, Morris K, JennerC, Jackson S, Thomas B, Tabrett A, Legaie R, Moore JD, Wild DL, Ott S, Rand D, Beynon J, Denby K, Mead A, Buchanan-Wollaston V(2011) High-resolution temporal profiling of transcripts during Arabidopsis leaf senescence reveals a distinct chronology of processesand regulation. Plant Cell 23: 873-894


Buchanan-Wollaston V, Page T, Harrison E, Breeze E, Lim PO, Nam HG, Lin JF, Wu SH, Swidzinski J, Ishizaki K, Leaver CJ (2005)Comparative transcriptome analysis reveals significant differences in gene expression and signalling pathways betweendevelopmental and dark/starvation-induced senescence in Arabidopsis. Plant J 42: 567-585


Chrobok D, Law SR, Brouwer B, Linden P, Ziolkowska A, Liebsch D, Narsai R, Szal B, Moritz T, Rouhier N, Whelan J, Gardestrom P,

http://www.ncbi.nlm.nih.gov/pubmed?term=Akhtar MS%2C Goldschmidt EE%2C John I%2C Rodoni S%2C Matile P%2C Grierson D %281999%29 Altered patterns of senescence and ripening in gf%2C a stay%2Dgreen mutant of tomato %28Lycopersicon esculentum Mill%2E%29%2E J Exp Bot 50%3A 1115%2D1122&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Akhtar MS, Goldschmidt EE, John I, Rodoni S, Matile P, Grierson D (1999) Altered patterns of senescence and ripening in gf, a stay-green mutant of tomato (Lycopersicon esculentum Mill.). J Exp Bot 50: 1115-1122

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Akhtar&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Altered patterns of senescence and ripening in gf, a stay-green mutant of tomato (Lycopersicon esculentum Mill&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Altered patterns of senescence and ripening in gf, a stay-green mutant of tomato (Lycopersicon esculentum Mill&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Akhtar&as_ylo=1999&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Ansari MI%2C Hasan S%2C Jalil SU %282014%29 Leaf senescence and GABA shunt%2E Bioinformation 10%3A 734%2D736&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Ansari MI, Hasan S, Jalil SU (2014) Leaf senescence and GABA shunt. Bioinformation 10: 734-736

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Ansari&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Leaf senescence and GABA shunt&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Leaf senescence and GABA shunt&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Ansari&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Ansari MI%2C Lee RH%2C Chen SCG %282005%29 A novel senescence%2Dassociated gene encoding gamma%2Daminobutyric acid %28GABA%29%3A pyruvate transaminase is upregulated during rice leaf senescence%2E Physiol Plantarum 123%3A 1%2D8&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Ansari MI, Lee RH, Chen SCG (2005) A novel senescence-associated gene encoding gamma-aminobutyric acid (GABA): pyruvate transaminase is upregulated during rice leaf senescence. Physiol Plantarum 123: 1-8

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Ansari&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=A novel senescence-associated gene encoding gamma-aminobutyric acid (GABA): pyruvate transaminase is upregulated during rice leaf senescence&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=A novel senescence-associated gene encoding gamma-aminobutyric acid (GABA): pyruvate transaminase is upregulated during rice leaf senescence&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Ansari&as_ylo=2005&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Araujo WL%2C Ishizaki K%2C Nunes%2DNesi A%2C Larson TR%2C Tohge T%2C Krahnert I%2C Witt S%2C Obata T%2C Schauer N%2C Graham IA%2C Leaver CJ%2C Fernie AR %282010%29 Identification of the 2%2Dhydroxyglutarate and isovaleryl%2DCoA dehydrogenases as alternative electron donors linking lysine catabolism to the electron transport chain of Arabidopsis mitochondria%2E Plant Cell 22%3A 1549%2D1563&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Araujo WL, Ishizaki K, Nunes-Nesi A, Larson TR, Tohge T, Krahnert I, Witt S, Obata T, Schauer N, Graham IA, Leaver CJ, Fernie AR (2010) Identification of the 2-hydroxyglutarate and isovaleryl-CoA dehydrogenases as alternative electron donors linking lysine catabolism to the electron transport chain of Arabidopsis mitochondria. Plant Cell 22: 1549-1563

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Araujo&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Identification of the 2-hydroxyglutarate and isovaleryl-CoA dehydrogenases as alternative electron donors linking lysine catabolism to the electron transport chain of Arabidopsis mitochondria&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Identification of the 2-hydroxyglutarate and isovaleryl-CoA dehydrogenases as alternative electron donors linking lysine catabolism to the electron transport chain of Arabidopsis mitochondria&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Araujo&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Araujo WL%2C Tohge T%2C Ishizaki K%2C Leaver CJ%2C Fernie AR %282011%29 Protein degradation %2D an alternative respiratory substrate for stressed plants%2E Trends Plant Sci 16%3A 489%2D498&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Araujo WL, Tohge T, Ishizaki K, Leaver CJ, Fernie AR (2011) Protein degradation - an alternative respiratory substrate for stressed plants. Trends Plant Sci 16: 489-498


http://scholar.google.com/scholar?as_q=Protein degradation - an alternative respiratory substrate for stressed plants&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Protein degradation - an alternative respiratory substrate for stressed plants&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Araujo&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Araujo WL%2C Tohge T%2C Osorio S%2C Lohse M%2C Balbo I%2C Krahnert I%2C Sienkiewicz%2DPorzucek A%2C Usadel B%2C Nunes%2DNesi A%2C Fernie AR %282012%29 Antisense inhibition of the 2%2Doxoglutarate dehydrogenase complex in tomato demonstrates its importance for plant respiration and during leaf senescence and fruit maturation%2E Plant Cell 24%3A 2328%2D2351&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Araujo WL, Tohge T, Osorio S, Lohse M, Balbo I, Krahnert I, Sienkiewicz-Porzucek A, Usadel B, Nunes-Nesi A, Fernie AR (2012) Antisense inhibition of the 2-oxoglutarate dehydrogenase complex in tomato demonstrates its importance for plant respiration and during leaf senescence and fruit maturation. Plant Cell 24: 2328-2351


http://scholar.google.com/scholar?as_q=Antisense inhibition of the 2-oxoglutarate dehydrogenase complex in tomato demonstrates its importance for plant respiration and during leaf senescence and fruit maturation&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Antisense inhibition of the 2-oxoglutarate dehydrogenase complex in tomato demonstrates its importance for plant respiration and during leaf senescence and fruit maturation&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Araujo&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Balazadeh S%2C Riano%2DPachon DM%2C Mueller%2DRoeber B %282008%29 Transcription factors regulating leaf senescence in Arabidopsis thaliana%2E Plant Biology 10%3A 63%2D75&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Balazadeh S, Riano-Pachon DM, Mueller-Roeber B (2008) Transcription factors regulating leaf senescence in Arabidopsis thaliana. Plant Biology 10: 63-75

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Balazadeh&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Transcription factors regulating leaf senescence in Arabidopsis thaliana&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Transcription factors regulating leaf senescence in Arabidopsis thaliana&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Balazadeh&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Balazadeh S%2C Schildhauer J%2C Araujo WL%2C Munne%2DBosch S%2C Fernie AR%2C Proost S%2C Humbeck K%2C Mueller%2DRoeber B %282014%29 Reversal of senescence by N resupply to N%2Dstarved Arabidopsis thaliana%3A transcriptomic and metabolomic consequences%2E J Exp Bot 65%3A 3975%2D3992&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Balazadeh S, Schildhauer J, Araujo WL, Munne-Bosch S, Fernie AR, Proost S, Humbeck K, Mueller-Roeber B (2014) Reversal of senescence by N resupply to N-starved Arabidopsis thaliana: transcriptomic and metabolomic consequences. J Exp Bot 65: 3975-3992


http://scholar.google.com/scholar?as_q=Reversal of senescence by N resupply to N-starved Arabidopsis thaliana: transcriptomic and metabolomic consequences&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Reversal of senescence by N resupply to N-starved Arabidopsis thaliana: transcriptomic and metabolomic consequences&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Balazadeh&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Balazadeh S%2C Siddiqui H%2C Allu AD%2C Matallana%2DRamirez LP%2C Caldana C%2C Mehrnia M%2C Zanor MI%2C Kohler B%2C Mueller%2DRoeber B %282010%29 A gene regulatory network controlled by the NAC transcription factor ANAC092%2FAtNAC2%2FORE1 during salt%2Dpromoted senescence%2E Plant J 62%3A 250%2D264&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Balazadeh S, Siddiqui H, Allu AD, Matallana-Ramirez LP, Caldana C, Mehrnia M, Zanor MI, Kohler B, Mueller-Roeber B (2010) A gene regulatory network controlled by the NAC transcription factor ANAC092/AtNAC2/ORE1 during salt-promoted senescence. Plant J 62: 250-264


http://scholar.google.com/scholar?as_q=A gene regulatory network controlled by the NAC transcription factor ANAC092/AtNAC2/ORE1 during salt-promoted senescence&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=A gene regulatory network controlled by the NAC transcription factor ANAC092/AtNAC2/ORE1 during salt-promoted senescence&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Balazadeh&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Breeze E%2C Harrison E%2C McHattie S%2C Hughes L%2C Hickman R%2C Hill C%2C Kiddle S%2C Kim YS%2C Penfold CA%2C Jenkins D%2C Zhang CJ%2C Morris K%2C Jenner C%2C Jackson S%2C Thomas B%2C Tabrett A%2C Legaie R%2C Moore JD%2C Wild DL%2C Ott S%2C Rand D%2C Beynon J%2C Denby K%2C Mead A%2C Buchanan%2DWollaston V %282011%29 High%2Dresolution temporal profiling of transcripts during Arabidopsis leaf senescence reveals a distinct chronology of processes and regulation%2E Plant Cell 23%3A 873%2D894&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Breeze E, Harrison E, McHattie S, Hughes L, Hickman R, Hill C, Kiddle S, Kim YS, Penfold CA, Jenkins D, Zhang CJ, Morris K, Jenner C, Jackson S, Thomas B, Tabrett A, Legaie R, Moore JD, Wild DL, Ott S, Rand D, Beynon J, Denby K, Mead A, Buchanan-Wollaston V (2011) High-resolution temporal profiling of transcripts during Arabidopsis leaf senescence reveals a distinct chronology of processes and regulation. Plant Cell 23: 873-894

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Breeze&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=High-resolution temporal profiling of transcripts during Arabidopsis leaf senescence reveals a distinct chronology of processes and regulation&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=High-resolution temporal profiling of transcripts during Arabidopsis leaf senescence reveals a distinct chronology of processes and regulation&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Breeze&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Buchanan%2DWollaston V%2C Page T%2C Harrison E%2C Breeze E%2C Lim PO%2C Nam HG%2C Lin JF%2C Wu SH%2C Swidzinski J%2C Ishizaki K%2C Leaver CJ %282005%29 Comparative transcriptome analysis reveals significant differences in gene expression and signalling pathways between developmental and dark%2Fstarvation%2Dinduced senescence in Arabidopsis%2E Plant J 42%3A 567%2D585&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Buchanan-Wollaston V, Page T, Harrison E, Breeze E, Lim PO, Nam HG, Lin JF, Wu SH, Swidzinski J, Ishizaki K, Leaver CJ (2005) Comparative transcriptome analysis reveals significant differences in gene expression and signalling pathways between developmental and dark/starvation-induced senescence in Arabidopsis. Plant J 42: 567-585

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Buchanan-Wollaston&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Comparative transcriptome analysis reveals significant differences in gene expression and signalling pathways between developmental and dark/starvation-induced senescence in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Comparative transcriptome analysis reveals significant differences in gene expression and signalling pathways between developmental and dark/starvation-induced senescence in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Buchanan-Wollaston&as_ylo=2005&as_allsubj=all&hl=en&c2coff=1

Keech O (2016) Dissecting the metabolic role of mitochondria during developmental leaf senescence. Plant Physiol 172: 2132-2153Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Diaz C, Purdy S, Christ A, Morot-Gaudry JF, Wingler A, Masclaux-Daubresse CL (2005) Characterization of markers to determine theextent and variability of leaf senescence in Arabidopsis. A metabolic profiling approach. Plant Physiol 138: 898-908


Fahnenstich H, Saigo M, Niessen M, Zanor MI, Andreo CS, Fernie AR, Drincovich MF, Flugge UI, Maurino VG (2007) Alteration oforganic acid metabolism in Arabidopsis overexpressing the maize C(4)NADP-malic enzyme causes accelerated senescence duringextended darkness. Plant Physiol 145: 640-652


Fan K, Bibi N, Gan SS, Li F, Yuan SN, Ni M, Wang M, Shen H, Wang XD (2015) A novel NAP member GhNAP is involved in leafsenescence in Gossypium hirsutum. J Exp Bot 66: 4669-4682


Gao S, Gao J, Zhu XY, Song Y, Li ZP, Ren GD, Zhou X, Kuai BK (2016) ABF2, ABF3, and ABF4 promote ABA-Mediated chlorophylldegradation and leaf senescence by transcriptional activation of chlorophyll catabolic genes and senescence-associated genes inArabidopsis. Mol Plant 9: 1272-1285


Gepstein S, Thimann KV (1980) Changes in the abscisic-acid content of oat leaves during senescence. Proc Natl Acad Sci USA 77:2050-2053


Gibon Y, Usadel B, Blaesing OE, Kamlage B, Hoehne M, Trethewey R, Stitt M (2006) Integration of metabolite with transcript andenzyme activity profiling during diurnal cycles in Arabidopsis rosettes. Genome Biol 7: R76


Gregersen PL, Culetic A, Boschian L, Krupinska K (2013) Plant senescence and crop productivity. Plant Mol Biol 82: 603-622Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Guo Y, Gan S-S (2006) AtNAP, a NAC family transcription factor, has an important role in leaf senescence. Plant J 46: 601-612Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Guyer L, Hofstetter SS, Christ B, Lira BS, Rossi M, Hortensteiner S (2014) Different mechanisms are responsible for chlorophylldephytylation during fruit ripening and leaf senescence in tomato. Plant Physiol 166: 44-56


He P, Osaki M, Takebe M, Shinano T, Wasaki J (2005) Endogenous hormones and expression of senescence-related genes in differentsenescent types of maize. J Exp Bot 56: 1117-1128


Himelblau E, Amasino RM (2001) Nutrients mobilized from leaves of Arabidopsis thaliana during leaf senescence. J Plant Physiol 158:1317-1323


Hu ZL, Deng L, Yan B, Pan Y, Luo M, Chen XQ, Hu TZ, Chen GP (2011) Silencing of the LeSGR1 gene in tomato inhibits chlorophylldegradation and exhibits a stay-green phenotype. Biol Plantarum 55: 27-34

Pubmed: Author and TitleCrossRef: Author and Title

http://www.ncbi.nlm.nih.gov/pubmed?term=Chrobok D%2C Law SR%2C Brouwer B%2C Linden P%2C Ziolkowska A%2C Liebsch D%2C Narsai R%2C Szal B%2C Moritz T%2C Rouhier N%2C Whelan J%2C Gardestrom P%2C Keech O %282016%29 Dissecting the metabolic role of mitochondria during developmental leaf senescence%2E Plant Physiol 172%3A 2132%2D2153&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Chrobok D, Law SR, Brouwer B, Linden P, Ziolkowska A, Liebsch D, Narsai R, Szal B, Moritz T, Rouhier N, Whelan J, Gardestrom P, Keech O (2016) Dissecting the metabolic role of mitochondria during developmental leaf senescence. Plant Physiol 172: 2132-2153

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Chrobok&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Dissecting the metabolic role of mitochondria during developmental leaf senescence&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Dissecting the metabolic role of mitochondria during developmental leaf senescence&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Chrobok&as_ylo=2016&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Diaz C%2C Purdy S%2C Christ A%2C Morot%2DGaudry JF%2C Wingler A%2C Masclaux%2DDaubresse CL %282005%29 Characterization of markers to determine the extent and variability of leaf senescence in Arabidopsis%2E A metabolic profiling approach%2E Plant Physiol 138%3A 898%2D908&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Diaz C, Purdy S, Christ A, Morot-Gaudry JF, Wingler A, Masclaux-Daubresse CL (2005) Characterization of markers to determine the extent and variability of leaf senescence in Arabidopsis. A metabolic profiling approach. Plant Physiol 138: 898-908

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Diaz&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Characterization of markers to determine the extent and variability of leaf senescence in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Characterization of markers to determine the extent and variability of leaf senescence in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Diaz&as_ylo=2005&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Fahnenstich H%2C Saigo M%2C Niessen M%2C Zanor MI%2C Andreo CS%2C Fernie AR%2C Drincovich MF%2C Flugge UI%2C Maurino VG %282007%29 Alteration of organic acid metabolism in Arabidopsis overexpressing the maize C%284%29NADP%2Dmalic enzyme causes accelerated senescence during extended darkness%2E Plant Physiol 145%3A 640%2D652&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Fahnenstich H, Saigo M, Niessen M, Zanor MI, Andreo CS, Fernie AR, Drincovich MF, Flugge UI, Maurino VG (2007) Alteration of organic acid metabolism in Arabidopsis overexpressing the maize C(4)NADP-malic enzyme causes accelerated senescence during extended darkness. Plant Physiol 145: 640-652

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Fahnenstich&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Alteration of organic acid metabolism in Arabidopsis overexpressing the maize C(4)NADP-malic enzyme causes accelerated senescence during extended darkness&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Alteration of organic acid metabolism in Arabidopsis overexpressing the maize C(4)NADP-malic enzyme causes accelerated senescence during extended darkness&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Fahnenstich&as_ylo=2007&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Fan K%2C Bibi N%2C Gan SS%2C Li F%2C Yuan SN%2C Ni M%2C Wang M%2C Shen H%2C Wang XD %282015%29 A novel NAP member GhNAP is involved in leaf senescence in Gossypium hirsutum%2E J Exp Bot 66%3A 4669%2D4682&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Fan K, Bibi N, Gan SS, Li F, Yuan SN, Ni M, Wang M, Shen H, Wang XD (2015) A novel NAP member GhNAP is involved in leaf senescence in Gossypium hirsutum. J Exp Bot 66: 4669-4682

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Fan&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=A novel NAP member GhNAP is involved in leaf senescence in Gossypium hirsutum&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=A novel NAP member GhNAP is involved in leaf senescence in Gossypium hirsutum&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Fan&as_ylo=2015&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Gao S%2C Gao J%2C Zhu XY%2C Song Y%2C Li ZP%2C Ren GD%2C Zhou X%2C Kuai BK %282016%29 ABF2%2C ABF3%2C and ABF4 promote ABA%2DMediated chlorophyll degradation and leaf senescence by transcriptional activation of chlorophyll catabolic genes and senescence%2Dassociated genes in Arabidopsis%2E Mol Plant 9%3A 1272%2D1285&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Gao S, Gao J, Zhu XY, Song Y, Li ZP, Ren GD, Zhou X, Kuai BK (2016) ABF2, ABF3, and ABF4 promote ABA-Mediated chlorophyll degradation and leaf senescence by transcriptional activation of chlorophyll catabolic genes and senescence-associated genes in Arabidopsis. Mol Plant 9: 1272-1285

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Gao&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Gao&as_ylo=2016&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Gepstein S%2C Thimann KV %281980%29 Changes in the abscisic%2Dacid content of oat leaves during senescence%2E Proc Natl Acad Sci USA 77%3A 2050%2D2053&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Gepstein S, Thimann KV (1980) Changes in the abscisic-acid content of oat leaves during senescence. Proc Natl Acad Sci USA 77: 2050-2053

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Gepstein&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Changes in the abscisic-acid content of oat leaves during senescence&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Changes in the abscisic-acid content of oat leaves during senescence&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Gepstein&as_ylo=1980&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Gibon Y%2C Usadel B%2C Blaesing OE%2C Kamlage B%2C Hoehne M%2C Trethewey R%2C Stitt M %282006%29 Integration of metabolite with transcript and enzyme activity profiling during diurnal cycles in Arabidopsis rosettes%2E Genome Biol 7%3A R76&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Gibon Y, Usadel B, Blaesing OE, Kamlage B, Hoehne M, Trethewey R, Stitt M (2006) Integration of metabolite with transcript and enzyme activity profiling during diurnal cycles in Arabidopsis rosettes. Genome Biol 7: R76

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Gibon&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Integration of metabolite with transcript and enzyme activity profiling during diurnal cycles in Arabidopsis rosettes.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Integration of metabolite with transcript and enzyme activity profiling during diurnal cycles in Arabidopsis rosettes.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Gibon&as_ylo=2006&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Gregersen PL%2C Culetic A%2C Boschian L%2C Krupinska K %282013%29 Plant senescence and crop productivity%2E Plant Mol Biol 82%3A 603%2D622&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Gregersen PL, Culetic A, Boschian L, Krupinska K (2013) Plant senescence and crop productivity. Plant Mol Biol 82: 603-622

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Gregersen&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Plant senescence and crop productivity&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Plant senescence and crop productivity&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Gregersen&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Guo Y%2C Gan S%2DS %282006%29 AtNAP%2C a NAC family transcription factor%2C has an important role in leaf senescence%2E Plant J 46%3A 601%2D612&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Guo Y, Gan S-S (2006) AtNAP, a NAC family transcription factor, has an important role in leaf senescence. Plant J 46: 601-612

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Guo&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=AtNAP, a NAC family transcription factor, has an important role in leaf senescence&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=AtNAP, a NAC family transcription factor, has an important role in leaf senescence&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Guo&as_ylo=2006&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Guyer L%2C Hofstetter SS%2C Christ B%2C Lira BS%2C Rossi M%2C Hortensteiner S %282014%29 Different mechanisms are responsible for chlorophyll dephytylation during fruit ripening and leaf senescence in tomato%2E Plant Physiol 166%3A 44%2D56&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Guyer L, Hofstetter SS, Christ B, Lira BS, Rossi M, Hortensteiner S (2014) Different mechanisms are responsible for chlorophyll dephytylation during fruit ripening and leaf senescence in tomato. Plant Physiol 166: 44-56

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Guyer&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Different mechanisms are responsible for chlorophyll dephytylation during fruit ripening and leaf senescence in tomato&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Different mechanisms are responsible for chlorophyll dephytylation during fruit ripening and leaf senescence in tomato&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Guyer&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=He P%2C Osaki M%2C Takebe M%2C Shinano T%2C Wasaki J %282005%29 Endogenous hormones and expression of senescence%2Drelated genes in different senescent types of maize%2E J Exp Bot 56%3A 1117%2D1128&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=He P, Osaki M, Takebe M, Shinano T, Wasaki J (2005) Endogenous hormones and expression of senescence-related genes in different senescent types of maize. J Exp Bot 56: 1117-1128

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=He&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Endogenous hormones and expression of senescence-related genes in different senescent types of maize&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Endogenous hormones and expression of senescence-related genes in different senescent types of maize&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=He&as_ylo=2005&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Himelblau E%2C Amasino RM %282001%29 Nutrients mobilized from leaves of Arabidopsis thaliana during leaf senescence%2E J Plant Physiol 158%3A 1317%2D1323&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Himelblau E, Amasino RM (2001) Nutrients mobilized from leaves of Arabidopsis thaliana during leaf senescence. J Plant Physiol 158: 1317-1323

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Himelblau&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Nutrients mobilized from leaves of Arabidopsis thaliana during leaf senescence&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Nutrients mobilized from leaves of Arabidopsis thaliana during leaf senescence&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Himelblau&as_ylo=2001&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Hu ZL%2C Deng L%2C Yan B%2C Pan Y%2C Luo M%2C Chen XQ%2C Hu TZ%2C Chen GP %282011%29 Silencing of the LeSGR1 gene in tomato inhibits chlorophyll degradation and exhibits a stay%2Dgreen phenotype%2E Biol Plantarum 55%3A 27%2D34&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Hu ZL, Deng L, Yan B, Pan Y, Luo M, Chen XQ, Hu TZ, Chen GP (2011) Silencing of the LeSGR1 gene in tomato inhibits chlorophyll degradation and exhibits a stay-green phenotype. Biol Plantarum 55: 27-34

Google Scholar: Author Only Title Only Author and Title

Ji K, Kai W, Zhao B, Sun Y, Yuan B, Dai S, Li Q, Chen P, Wang Y, Pei Y, Wang H, Guo Y, Leng P (2014) SlNCED1 and SlCYP707A2: keygenes involved in ABA metabolism during tomato fruit ripening. J Exp Bot 65: 5243-5255


Kang K, Kim YS, Park S, Back K (2009) Senescence-induced serotonin biosynthesis and its role in delaying senescence in rice leaves.Plant Physiol 150: 1380-1393


Karimi M, Inzé D, Depicker A (2002) GATEWAY vectors for Agrobacterium-mediated plant transformation. Trends Plant Sci 7: 193-195Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Kaufmann K, Muiño JM, Østerås M, Farinelli L, Krajewski P, Angenent GC (2010) Chromatin immunoprecipitation (ChIP) of planttranscription factors followed by sequencing (ChIP-SEQ) or hybridization to whole genome arrays (ChIP-CHIP). Nat Protoc 5: 457-472


Kim JH, Woo HR, Kim J, Lim PO, Lee IC, Choi SH, Hwang D, Nam HG (2009) Trifurcate feed-forward regulation of age-dependent celldeath involving miR164 in Arabidopsis. Science 323: 1053-1057


Kopka J, Schauer N, Krueger S, Birkemeyer C, Usadel B, Bergmuller E, Dormann P, Weckwerth W, Gibon Y, Stitt M, Willmitzer L,Fernie AR, Steinhauser D (2005) [email protected]: the Golm Metabolome Database. Bioinformatics 21: 1635-1638


Kou XH, Watkins CB, Gan SS (2012) Arabidopsis AtNAP regulates fruit senescence. J Exp Bot 63: 6139-6147Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Lee IC, Hong SW, Whang SS, Lim PO, Nam HG, Koo JC (2011) Age-dependent action of an ABA-inducible receptor kinase, RPK1, as apositive regulator of senescence in Arabidopsis leaves. Plant Cell Physiol 52: 651-662


Li L, Zhao J, Zhao Y, Lu X, Zhou Z, Zhao C, Xu G (2016) Comprehensive investigation of tobacco leaves during natural earlysenescence via multi-platform metabolomics analyses. Sci Rep 6: 37976


Liang CZ, Wang YQ, Zhu YN, Tang JY, Hu B, Liu LC, Ou SJ, Wu HK, Sun XH, Chu JF, Chu CC (2014) OsNAP connects abscisic acid andleaf senescence by fine-tuning abscisic acid biosynthesis and directly targeting senescence-associated genes in rice. Proc Natl AcadSci USA 111: 10013-10018


Lira BS, Gramegna G, Trench BA, Alves FRR, Silva EM, Silva GFF, Thirumalaikumar VP, Lupi ACD, Demarco D, Purgatto E, NogueiraFTS, Balazadeh S, Freschi L, Rossi M (2017) Manipulation of a senescence-associated gene improves fleshy fruit yield. Plant Physiol175: 77-91


Lisec J, Schauer N, Kopka J, Willmitzer L, Fernie AR (2006) Gas chromatography mass spectrometry-based metabolite profiling inplants. Nat Protoc 1: 387-396


Luedemann A, von Malotky L, Erban A, Kopka J (2012) TagFinder: preprocessing software for the fingerprinting and the profiling of gas

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Hu&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Silencing of the LeSGR1 gene in tomato inhibits chlorophyll degradation and exhibits a stay-green phenotype&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Silencing of the LeSGR1 gene in tomato inhibits chlorophyll degradation and exhibits a stay-green phenotype&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Hu&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Ji K%2C Kai W%2C Zhao B%2C Sun Y%2C Yuan B%2C Dai S%2C Li Q%2C Chen P%2C Wang Y%2C Pei Y%2C Wang H%2C Guo Y%2C Leng P %282014%29 SlNCED1 and SlCYP707A2%3A key genes involved in ABA metabolism during tomato fruit ripening%2E J Exp Bot 65%3A 5243%2D5255&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Ji K, Kai W, Zhao B, Sun Y, Yuan B, Dai S, Li Q, Chen P, Wang Y, Pei Y, Wang H, Guo Y, Leng P (2014) SlNCED1 and SlCYP707A2: key genes involved in ABA metabolism during tomato fruit ripening. J Exp Bot 65: 5243-5255

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Ji&hl=en&c2coff=1


http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Ji&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Kang K%2C Kim YS%2C Park S%2C Back K %282009%29 Senescence%2Dinduced serotonin biosynthesis and its role in delaying senescence in rice leaves%2E Plant Physiol 150%3A 1380%2D1393&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Kang K, Kim YS, Park S, Back K (2009) Senescence-induced serotonin biosynthesis and its role in delaying senescence in rice leaves. Plant Physiol 150: 1380-1393

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Kang&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Senescence-induced serotonin biosynthesis and its role in delaying senescence in rice leaves&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Senescence-induced serotonin biosynthesis and its role in delaying senescence in rice leaves&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Kang&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Karimi M%2C Inz� D%2C Depicker A %282002%29 GATEWAY vectors for Agrobacterium%2Dmediated plant transformation%2E Trends Plant Sci 7%3A 193%2D195&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Karimi M, Inz� D, Depicker A (2002) GATEWAY vectors for Agrobacterium-mediated plant transformation. Trends Plant Sci 7: 193-195

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Karimi&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=GATEWAY vectors for Agrobacterium-mediated plant transformation&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=GATEWAY vectors for Agrobacterium-mediated plant transformation&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Karimi&as_ylo=2002&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Kaufmann K%2C Mui�o JM%2C �ster�s M%2C Farinelli L%2C Krajewski P%2C Angenent GC %282010%29 Chromatin immunoprecipitation %28ChIP%29 of plant transcription factors followed by sequencing %28ChIP%2DSEQ%29 or hybridization to whole genome arrays %28ChIP%2DCHIP%29%2E Nat Protoc 5%3A 457%2D472&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Kaufmann K, Mui�o JM, �ster�s M, Farinelli L, Krajewski P, Angenent GC (2010) Chromatin immunoprecipitation (ChIP) of plant transcription factors followed by sequencing (ChIP-SEQ) or hybridization to whole genome arrays (ChIP-CHIP). Nat Protoc 5: 457-472

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Kaufmann&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Chromatin immunoprecipitation (ChIP) of plant transcription factors followed by sequencing (ChIP-SEQ) or hybridization to whole genome arrays (ChIP-CHIP)&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Chromatin immunoprecipitation (ChIP) of plant transcription factors followed by sequencing (ChIP-SEQ) or hybridization to whole genome arrays (ChIP-CHIP)&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Kaufmann&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Kim JH%2C Woo HR%2C Kim J%2C Lim PO%2C Lee IC%2C Choi SH%2C Hwang D%2C Nam HG %282009%29 Trifurcate feed%2Dforward regulation of age%2Ddependent cell death involving miR164 in Arabidopsis%2E Science 323%3A 1053%2D1057&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Kim JH, Woo HR, Kim J, Lim PO, Lee IC, Choi SH, Hwang D, Nam HG (2009) Trifurcate feed-forward regulation of age-dependent cell death involving miR164 in Arabidopsis. Science 323: 1053-1057

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Kim&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Trifurcate feed-forward regulation of age-dependent cell death involving miR164 in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Trifurcate feed-forward regulation of age-dependent cell death involving miR164 in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Kim&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Kopka J%2C Schauer N%2C Krueger S%2C Birkemeyer C%2C Usadel B%2C Bergmuller E%2C Dormann P%2C Weckwerth W%2C Gibon Y%2C Stitt M%2C Willmitzer L%2C Fernie AR%2C Steinhauser D %282005%29 GMD%40CSB%2EDB%3A the Golm Metabolome Database%2E Bioinformatics 21%3A 1635%2D1638&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Kopka J, Schauer N, Krueger S, Birkemeyer C, Usadel B, Bergmuller E, Dormann P, Weckwerth W, Gibon Y, Stitt M, Willmitzer L, Fernie AR, Steinhauser D (2005) [email protected]: the Golm Metabolome Database. Bioinformatics 21: 1635-1638

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Kopka&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=GMD@CSB&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=GMD@CSB&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Kopka&as_ylo=2005&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Kou XH%2C Watkins CB%2C Gan SS %282012%29 Arabidopsis AtNAP regulates fruit senescence%2E J Exp Bot 63%3A 6139%2D6147&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Kou XH, Watkins CB, Gan SS (2012) Arabidopsis AtNAP regulates fruit senescence. J Exp Bot 63: 6139-6147

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Kou&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Arabidopsis AtNAP regulates fruit senescence&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Arabidopsis AtNAP regulates fruit senescence&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Kou&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Lee IC%2C Hong SW%2C Whang SS%2C Lim PO%2C Nam HG%2C Koo JC %282011%29 Age%2Ddependent action of an ABA%2Dinducible receptor kinase%2C RPK1%2C as a positive regulator of senescence in Arabidopsis leaves%2E Plant Cell Physiol 52%3A 651%2D662&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Lee IC, Hong SW, Whang SS, Lim PO, Nam HG, Koo JC (2011) Age-dependent action of an ABA-inducible receptor kinase, RPK1, as a positive regulator of senescence in Arabidopsis leaves. Plant Cell Physiol 52: 651-662

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Lee&hl=en&c2coff=1


http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Lee&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Li L%2C Zhao J%2C Zhao Y%2C Lu X%2C Zhou Z%2C Zhao C%2C Xu G %282016%29 Comprehensive investigation of tobacco leaves during natural early senescence via multi%2Dplatform metabolomics analyses%2E Sci Rep 6%3A 37976&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Li L, Zhao J, Zhao Y, Lu X, Zhou Z, Zhao C, Xu G (2016) Comprehensive investigation of tobacco leaves during natural early senescence via multi-platform metabolomics analyses. Sci Rep 6: 37976

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Li&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Comprehensive investigation of tobacco leaves during natural early senescence via multi-platform metabolomics analyses.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Comprehensive investigation of tobacco leaves during natural early senescence via multi-platform metabolomics analyses.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Li&as_ylo=2016&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Liang CZ%2C Wang YQ%2C Zhu YN%2C Tang JY%2C Hu B%2C Liu LC%2C Ou SJ%2C Wu HK%2C Sun XH%2C Chu JF%2C Chu CC %282014%29 OsNAP connects abscisic acid and leaf senescence by fine%2Dtuning abscisic acid biosynthesis and directly targeting senescence%2Dassociated genes in rice%2E Proc Natl Acad Sci USA 111%3A 10013%2D10018&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Liang CZ, Wang YQ, Zhu YN, Tang JY, Hu B, Liu LC, Ou SJ, Wu HK, Sun XH, Chu JF, Chu CC (2014) OsNAP connects abscisic acid and leaf senescence by fine-tuning abscisic acid biosynthesis and directly targeting senescence-associated genes in rice. Proc Natl Acad Sci USA 111: 10013-10018

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Liang&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=OsNAP connects abscisic acid and leaf senescence by fine-tuning abscisic acid biosynthesis and directly targeting senescence-associated genes in rice&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=OsNAP connects abscisic acid and leaf senescence by fine-tuning abscisic acid biosynthesis and directly targeting senescence-associated genes in rice&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Liang&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Lira BS%2C Gramegna G%2C Trench BA%2C Alves FRR%2C Silva EM%2C Silva GFF%2C Thirumalaikumar VP%2C Lupi ACD%2C Demarco D%2C Purgatto E%2C Nogueira FTS%2C Balazadeh S%2C Freschi L%2C Rossi M %282017%29 Manipulation of a senescence%2Dassociated gene improves fleshy fruit yield%2E Plant Physiol 175%3A 77%2D91&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Lira BS, Gramegna G, Trench BA, Alves FRR, Silva EM, Silva GFF, Thirumalaikumar VP, Lupi ACD, Demarco D, Purgatto E, Nogueira FTS, Balazadeh S, Freschi L, Rossi M (2017) Manipulation of a senescence-associated gene improves fleshy fruit yield. Plant Physiol 175: 77-91

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Lira&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Manipulation of a senescence-associated gene improves fleshy fruit yield&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Manipulation of a senescence-associated gene improves fleshy fruit yield&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Lira&as_ylo=2017&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Lisec J%2C Schauer N%2C Kopka J%2C Willmitzer L%2C Fernie AR %282006%29 Gas chromatography mass spectrometry%2Dbased metabolite profiling in plants%2E Nat Protoc 1%3A 387%2D396&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Lisec J, Schauer N, Kopka J, Willmitzer L, Fernie AR (2006) Gas chromatography mass spectrometry-based metabolite profiling in plants. Nat Protoc 1: 387-396

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Lisec&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Gas chromatography mass spectrometry-based metabolite profiling in plants&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Gas chromatography mass spectrometry-based metabolite profiling in plants&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Lisec&as_ylo=2006&as_allsubj=all&hl=en&c2coff=1

chromatography-mass spectrometry based metabolome analyses. Methods Mol Biol 860: 255-286Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Mao CJ, Lu SC, Lv B, Zhang B, Shen JB, He JM, Luo LQ, Xi DD, Chen X, Ming F (2017) A rice NAC transcription factor promotes leafsenescence via ABA biosynthesis. Plant Physiol 174: 1747-1763


Masclaux C, Valadier MH, Brugiere N, Morot-Gaudry JF, Hirel B (2000) Characterization of the sink/source transition in tobacco(Nicotiana tabacum L.) shoots in relation to nitrogen management and leaf senescence. Planta 211: 510-518


Masclaux-Daubresse C, Reisdorf-Cren M, Pageau K, Lelandais M, Grandjean O, Kronenberger J, Valadier MH, Feraud M, Jouglet T,Suzuki A (2006) Glutamine synthetase-glutamate synthase pathway and glutamate dehydrogenase play distinct roles in the sink-sourcenitrogen cycle in tobacco (Nicotiana tabacum L.). Plant Physiol 140: 444-456


Miyashita Y, Good AG (2008) NAD(H)-dependent glutamate dehydrogenase is essential for the survival of Arabidopsis thaliana duringdark-induced carbon starvation. J Exp Bot 59: 667-680


Nuruzzaman M, Manimekalai R, Sharoni AM, Satoh K, Kondoh H, Ooka H, Kikuchi S (2010) Genome-wide analysis of NAC transcriptionfactor family in rice. Gene 465: 30-44


Ooka H, Satoh K, Doi K, Nagata T, Otomo Y, Murakami K, Matsubara K, Osato N, Kawai J, Carninci P, Hayashizaki Y, Suzuki K, KojimaK, Takahara Y, Yamamoto K, Kikuchi S (2003) Comprehensive analysis of NAC family genes in Oryza sativa and Arabidopsis thaliana.DNA Res 10: 239-247


Park S, Lee K, Kang K, Kim YS, Lee S, Kweon SJ, Back K (2010) Tryptophan boost caused by senescence occurred independently ofcytoplasmic glutamine synthetase. Biosci Biotech Bioch 74: 2352-2354


Parlitz S, Kunze R, Mueller-Roeber B, Balazadeh S (2011) Regulation of photosynthesis and transcription factor expression by leafshading and re-illumination in Arabidopsis thaliana leaves. J Plant Physiol 168: 1311-1319


Philosoph-Hadas S, Hadas E, Aharoni N (1993) Characterization and use in ELISA of a new monoclonal-antibody for quantitation ofabscisic acid in senescing rice leaves. Plant Growth Reg12: 71-78


Pourtau N, Mares M, Purdy S, Quentin N, Ruel A, Wingler A (2004) Interactions of abscisic acid and sugar signalling in the regulation ofleaf senescence. Planta 219: 765-772


Proost S, Van Bel M, Vaneechoutte D, Van de Peer Y, Inzé D, Mueller-Roeber B, Vandepoele K (2015) PLAZA 3.0: an access point forplant comparative genomics. Nucleic Acids Res 43: D974-D981


Quiles MJ, Garcia C, Cuello J (1995) Differential effects of abscisic acid and methyl jasmonate on endoproteinases in senescing barleyleaves. Plant Growth Reg 16: 197-204

http://www.ncbi.nlm.nih.gov/pubmed?term=Luedemann A%2C von Malotky L%2C Erban A%2C Kopka J %282012%29 TagFinder%3A preprocessing software for the fingerprinting and the profiling of gas chromatography%2Dmass spectrometry based metabolome analyses%2E Methods Mol Biol 860%3A 255%2D286&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Luedemann A, von Malotky L, Erban A, Kopka J (2012) TagFinder: preprocessing software for the fingerprinting and the profiling of gas chromatography-mass spectrometry based metabolome analyses. Methods Mol Biol 860: 255-286

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Luedemann&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=TagFinder: preprocessing software for the fingerprinting and the profiling of gas chromatography-mass spectrometry based metabolome analyses&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=TagFinder: preprocessing software for the fingerprinting and the profiling of gas chromatography-mass spectrometry based metabolome analyses&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Luedemann&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Mao CJ%2C Lu SC%2C Lv B%2C Zhang B%2C Shen JB%2C He JM%2C Luo LQ%2C Xi DD%2C Chen X%2C Ming F %282017%29 A rice NAC transcription factor promotes leaf senescence via ABA biosynthesis%2E Plant Physiol 174%3A 1747%2D1763&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Mao CJ, Lu SC, Lv B, Zhang B, Shen JB, He JM, Luo LQ, Xi DD, Chen X, Ming F (2017) A rice NAC transcription factor promotes leaf senescence via ABA biosynthesis. Plant Physiol 174: 1747-1763

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Mao&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=A rice NAC transcription factor promotes leaf senescence via ABA biosynthesis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=A rice NAC transcription factor promotes leaf senescence via ABA biosynthesis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Mao&as_ylo=2017&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Masclaux C%2C Valadier MH%2C Brugiere N%2C Morot%2DGaudry JF%2C Hirel B %282000%29 Characterization of the sink%2Fsource transition in tobacco %28Nicotiana tabacum L%2E%29 shoots in relation to nitrogen management and leaf senescence%2E Planta 211%3A 510%2D518&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Masclaux C, Valadier MH, Brugiere N, Morot-Gaudry JF, Hirel B (2000) Characterization of the sink/source transition in tobacco (Nicotiana tabacum L.) shoots in relation to nitrogen management and leaf senescence. Planta 211: 510-518

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Masclaux&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Characterization of the sink/source transition in tobacco (Nicotiana tabacum L&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Characterization of the sink/source transition in tobacco (Nicotiana tabacum L&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Masclaux&as_ylo=2000&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Masclaux%2DDaubresse C%2C Reisdorf%2DCren M%2C Pageau K%2C Lelandais M%2C Grandjean O%2C Kronenberger J%2C Valadier MH%2C Feraud M%2C Jouglet T%2C Suzuki A %282006%29 Glutamine synthetase%2Dglutamate synthase pathway and glutamate dehydrogenase play distinct roles in the sink%2Dsource nitrogen cycle in tobacco %28Nicotiana tabacum L%2E%29%2E Plant Physiol 140%3A 444%2D456&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Masclaux-Daubresse C, Reisdorf-Cren M, Pageau K, Lelandais M, Grandjean O, Kronenberger J, Valadier MH, Feraud M, Jouglet T, Suzuki A (2006) Glutamine synthetase-glutamate synthase pathway and glutamate dehydrogenase play distinct roles in the sink-source nitrogen cycle in tobacco (Nicotiana tabacum L.). Plant Physiol 140: 444-456

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Masclaux-Daubresse&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Glutamine synthetase-glutamate synthase pathway and glutamate dehydrogenase play distinct roles in the sink-source nitrogen cycle in tobacco (Nicotiana tabacum L&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Glutamine synthetase-glutamate synthase pathway and glutamate dehydrogenase play distinct roles in the sink-source nitrogen cycle in tobacco (Nicotiana tabacum L&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Masclaux-Daubresse&as_ylo=2006&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Miyashita Y%2C Good AG %282008%29 NAD%28H%29%2Ddependent glutamate dehydrogenase is essential for the survival of Arabidopsis thaliana during dark%2Dinduced carbon starvation%2E J Exp Bot 59%3A 667%2D680&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Miyashita Y, Good AG (2008) NAD(H)-dependent glutamate dehydrogenase is essential for the survival of Arabidopsis thaliana during dark-induced carbon starvation. J Exp Bot 59: 667-680

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Miyashita&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=NAD(H)-dependent glutamate dehydrogenase is essential for the survival of Arabidopsis thaliana during dark-induced carbon starvation&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=NAD(H)-dependent glutamate dehydrogenase is essential for the survival of Arabidopsis thaliana during dark-induced carbon starvation&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Miyashita&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Nuruzzaman M%2C Manimekalai R%2C Sharoni AM%2C Satoh K%2C Kondoh H%2C Ooka H%2C Kikuchi S %282010%29 Genome%2Dwide analysis of NAC transcription factor family in rice%2E Gene 465%3A 30%2D44&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Nuruzzaman M, Manimekalai R, Sharoni AM, Satoh K, Kondoh H, Ooka H, Kikuchi S (2010) Genome-wide analysis of NAC transcription factor family in rice. Gene 465: 30-44

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Nuruzzaman&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Genome-wide analysis of NAC transcription factor family in rice&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Genome-wide analysis of NAC transcription factor family in rice&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Nuruzzaman&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Ooka H%2C Satoh K%2C Doi K%2C Nagata T%2C Otomo Y%2C Murakami K%2C Matsubara K%2C Osato N%2C Kawai J%2C Carninci P%2C Hayashizaki Y%2C Suzuki K%2C Kojima K%2C Takahara Y%2C Yamamoto K%2C Kikuchi S %282003%29 Comprehensive analysis of NAC family genes in Oryza sativa and Arabidopsis thaliana%2E DNA Res 10%3A 239%2D247&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Ooka H, Satoh K, Doi K, Nagata T, Otomo Y, Murakami K, Matsubara K, Osato N, Kawai J, Carninci P, Hayashizaki Y, Suzuki K, Kojima K, Takahara Y, Yamamoto K, Kikuchi S (2003) Comprehensive analysis of NAC family genes in Oryza sativa and Arabidopsis thaliana. DNA Res 10: 239-247

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Ooka&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Comprehensive analysis of NAC family genes in Oryza sativa and Arabidopsis thaliana&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Comprehensive analysis of NAC family genes in Oryza sativa and Arabidopsis thaliana&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Ooka&as_ylo=2003&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Park S%2C Lee K%2C Kang K%2C Kim YS%2C Lee S%2C Kweon SJ%2C Back K %282010%29 Tryptophan boost caused by senescence occurred independently of cytoplasmic glutamine synthetase%2E Biosci Biotech Bioch 74%3A 2352%2D2354&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Park S, Lee K, Kang K, Kim YS, Lee S, Kweon SJ, Back K (2010) Tryptophan boost caused by senescence occurred independently of cytoplasmic glutamine synthetase. Biosci Biotech Bioch 74: 2352-2354

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Park&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Tryptophan boost caused by senescence occurred independently of cytoplasmic glutamine synthetase&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Tryptophan boost caused by senescence occurred independently of cytoplasmic glutamine synthetase&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Park&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Parlitz S%2C Kunze R%2C Mueller%2DRoeber B%2C Balazadeh S %282011%29 Regulation of photosynthesis and transcription factor expression by leaf shading and re%2Dillumination in Arabidopsis thaliana leaves%2E J Plant Physiol 168%3A 1311%2D1319&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Parlitz S, Kunze R, Mueller-Roeber B, Balazadeh S (2011) Regulation of photosynthesis and transcription factor expression by leaf shading and re-illumination in Arabidopsis thaliana leaves. J Plant Physiol 168: 1311-1319

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Parlitz&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Regulation of photosynthesis and transcription factor expression by leaf shading and re-illumination in Arabidopsis thaliana leaves&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Regulation of photosynthesis and transcription factor expression by leaf shading and re-illumination in Arabidopsis thaliana leaves&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Parlitz&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Philosoph%2DHadas S%2C Hadas E%2C Aharoni N %281993%29 Characterization and use in ELISA of a new monoclonal%2Dantibody for quantitation of abscisic acid in senescing rice leaves%2E Plant Growth Reg12%3A 71%2D78&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Philosoph-Hadas S, Hadas E, Aharoni N (1993) Characterization and use in ELISA of a new monoclonal-antibody for quantitation of abscisic acid in senescing rice leaves. Plant Growth Reg12: 71-78

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Philosoph-Hadas&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Characterization and use in ELISA of a new monoclonal-antibody for quantitation of abscisic acid in senescing rice leaves&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Characterization and use in ELISA of a new monoclonal-antibody for quantitation of abscisic acid in senescing rice leaves&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Philosoph-Hadas&as_ylo=1993&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Pourtau N%2C Mares M%2C Purdy S%2C Quentin N%2C Ruel A%2C Wingler A %282004%29 Interactions of abscisic acid and sugar signalling in the regulation of leaf senescence%2E Planta 219%3A 765%2D772&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Pourtau N, Mares M, Purdy S, Quentin N, Ruel A, Wingler A (2004) Interactions of abscisic acid and sugar signalling in the regulation of leaf senescence. Planta 219: 765-772

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Pourtau&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Interactions of abscisic acid and sugar signalling in the regulation of leaf senescence&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Interactions of abscisic acid and sugar signalling in the regulation of leaf senescence&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Pourtau&as_ylo=2004&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Proost S%2C Van Bel M%2C Vaneechoutte D%2C Van de Peer Y%2C Inz� D%2C Mueller%2DRoeber B%2C Vandepoele K %282015%29 PLAZA 3%2E0%3A an access point for plant comparative genomics%2E Nucleic Acids Res 43%3A D974%2DD981&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Proost S, Van Bel M, Vaneechoutte D, Van de Peer Y, Inz� D, Mueller-Roeber B, Vandepoele K (2015) PLAZA 3.0: an access point for plant comparative genomics. Nucleic Acids Res 43: D974-D981

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Proost&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=PLAZA 3&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=PLAZA 3&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Proost&as_ylo=2015&as_allsubj=all&hl=en&c2coff=1


Rauf M, Arif M, Dortay H, Matallana-Ramirez LP, Waters MT, Nam HG, Lim PO, Mueller-Roeber B, Balazadeh S (2013) ORE1 balancesleaf senescence against maintenance by antagonizing G2-like-mediated transcription. EMBO Rep 14: 382-388


Schwab R, Ossowski S, Riester M, Warthmann N, Weigel D (2006) Highly specific gene silencing by artificial microRNAs in Arabidopsis.Plant Cell 18: 1121-1133


Tabuchi M, Abiko T, Yamaya T (2007) Assimilation of ammonium ions and reutilization of nitrogen in rice (Oryza sativa L.). J Exp Bot 58:2319-2327


Tureckova V, Novak O, Strnad M (2009) Profiling ABA metabolites in Nicotiana tabacum L. leaves by ultra-performance liquidchromatography-electrospray tandem mass spectrometry. Talanta 80: 390-399


Uauy C, Distelfeld A, Fahima T, Blechl A, Dubcovsky J (2006) A NAC gene regulating senescence improves grain protein, zinc, and ironcontent in wheat. Science 314: 1298-1301


Van der Graaff E, Schwacke R, Schneider A, Desimone M, Flugge UI, Kunze R (2006) Transcription analysis of Arabidopsis membranetransporters and hormone pathways during developmental and induced leaf senescence. Plant Physiol 141: 776-792


Wang N, Guo TL, Wang P, Sun X, Shao Y, Liang BW, Jia X, Gong XQ, Ma FW (2017) Functional analysis of apple MhYTP1 and MhYTP2genes in leaf senescence and fruit ripening. Sci Hortic 221: 23-32


Watanabe M, Balazadeh S, Tohge T, Erban A, Giavalisco P, Kopka J, Mueller-Roeber B, Fernie AR, Hoefgen R (2013) Comprehensivedissection of spatiotemporal metabolic shifts in primary, secondary, and lipid metabolism during developmental senescence inArabidopsis. Plant Physiol 162: 1290-1310


Weaver LM, Gan SS, Quirino B, Amasino RM (1998) A comparison of the expression patterns of several senescence-associated genesin response to stress and hormone treatment. Plant Mol Biol 37: 455-469


Wingler A, Purdy S, MacLean JA, Pourtau N (2006) The role of sugars in integrating environmental signals during the regulation of leafsenescence. J Exp Bot 57: 391-399


Xue GP (2002) Characterisation of the DNA-binding profile of barley HvCBF1 using an enzymatic method for rapid, quantitative andhigh-throughput analysis of the DNA-binding activity. Nucleic Acids Res 30: e77


Xue GP, Bower NI, McIntyre CL, Riding GA, Kazan K, Shorter R (2006) TaNAC69 from the NAC superfamily of transcription factors isup-regulated by abiotic stresses in wheat and recognises two consensus DNA-binding sequences. Funct Plant Biol 33: 43-57


http://www.ncbi.nlm.nih.gov/pubmed?term=Quiles MJ%2C Garcia C%2C Cuello J %281995%29 Differential effects of abscisic acid and methyl jasmonate on endoproteinases in senescing barley leaves%2E Plant Growth Reg 16%3A 197%2D204&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Quiles MJ, Garcia C, Cuello J (1995) Differential effects of abscisic acid and methyl jasmonate on endoproteinases in senescing barley leaves. Plant Growth Reg 16: 197-204

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Quiles&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Differential effects of abscisic acid and methyl jasmonate on endoproteinases in senescing barley leaves&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Differential effects of abscisic acid and methyl jasmonate on endoproteinases in senescing barley leaves&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Quiles&as_ylo=1995&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Rauf M%2C Arif M%2C Dortay H%2C Matallana%2DRamirez LP%2C Waters MT%2C Nam HG%2C Lim PO%2C Mueller%2DRoeber B%2C Balazadeh S %282013%29 ORE1 balances leaf senescence against maintenance by antagonizing G2%2Dlike%2Dmediated transcription%2E EMBO Rep 14%3A 382%2D388&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Rauf M, Arif M, Dortay H, Matallana-Ramirez LP, Waters MT, Nam HG, Lim PO, Mueller-Roeber B, Balazadeh S (2013) ORE1 balances leaf senescence against maintenance by antagonizing G2-like-mediated transcription. EMBO Rep 14: 382-388

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Rauf&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=ORE1 balances leaf senescence against maintenance by antagonizing G2-like-mediated transcription&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=ORE1 balances leaf senescence against maintenance by antagonizing G2-like-mediated transcription&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Rauf&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Schwab R%2C Ossowski S%2C Riester M%2C Warthmann N%2C Weigel D %282006%29 Highly specific gene silencing by artificial microRNAs in Arabidopsis%2E Plant Cell 18%3A 1121%2D1133&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Schwab R, Ossowski S, Riester M, Warthmann N, Weigel D (2006) Highly specific gene silencing by artificial microRNAs in Arabidopsis. Plant Cell 18: 1121-1133

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Schwab&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Highly specific gene silencing by artificial microRNAs in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Highly specific gene silencing by artificial microRNAs in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Schwab&as_ylo=2006&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Tabuchi M%2C Abiko T%2C Yamaya T %282007%29 Assimilation of ammonium ions and reutilization of nitrogen in rice %28Oryza sativa L%2E%29%2E J Exp Bot 58%3A 2319%2D2327&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Tabuchi M, Abiko T, Yamaya T (2007) Assimilation of ammonium ions and reutilization of nitrogen in rice (Oryza sativa L.). J Exp Bot 58: 2319-2327

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Tabuchi&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Assimilation of ammonium ions and reutilization of nitrogen in rice (Oryza sativa L&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Assimilation of ammonium ions and reutilization of nitrogen in rice (Oryza sativa L&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Tabuchi&as_ylo=2007&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Tureckova V%2C Novak O%2C Strnad M %282009%29 Profiling ABA metabolites in Nicotiana tabacum L%2E leaves by ultra%2Dperformance liquid chromatography%2Delectrospray tandem mass spectrometry%2E Talanta 80%3A 390%2D399&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Tureckova V, Novak O, Strnad M (2009) Profiling ABA metabolites in Nicotiana tabacum L. leaves by ultra-performance liquid chromatography-electrospray tandem mass spectrometry. Talanta 80: 390-399

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Tureckova&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Profiling ABA metabolites in Nicotiana tabacum L&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Profiling ABA metabolites in Nicotiana tabacum L&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Tureckova&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Uauy C%2C Distelfeld A%2C Fahima T%2C Blechl A%2C Dubcovsky J %282006%29 A NAC gene regulating senescence improves grain protein%2C zinc%2C and iron content in wheat%2E Science 314%3A 1298%2D1301&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Uauy C, Distelfeld A, Fahima T, Blechl A, Dubcovsky J (2006) A NAC gene regulating senescence improves grain protein, zinc, and iron content in wheat. Science 314: 1298-1301

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Uauy&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=A NAC gene regulating senescence improves grain protein, zinc, and iron content in wheat&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=A NAC gene regulating senescence improves grain protein, zinc, and iron content in wheat&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Uauy&as_ylo=2006&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Van der Graaff E%2C Schwacke R%2C Schneider A%2C Desimone M%2C Flugge UI%2C Kunze R %282006%29 Transcription analysis of Arabidopsis membrane transporters and hormone pathways during developmental and induced leaf senescence%2E Plant Physiol 141%3A 776%2D792&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Van der Graaff E, Schwacke R, Schneider A, Desimone M, Flugge UI, Kunze R (2006) Transcription analysis of Arabidopsis membrane transporters and hormone pathways during developmental and induced leaf senescence. Plant Physiol 141: 776-792

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Van&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Transcription analysis of Arabidopsis membrane transporters and hormone pathways during developmental and induced leaf senescence&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Transcription analysis of Arabidopsis membrane transporters and hormone pathways during developmental and induced leaf senescence&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Van&as_ylo=2006&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Wang N%2C Guo TL%2C Wang P%2C Sun X%2C Shao Y%2C Liang BW%2C Jia X%2C Gong XQ%2C Ma FW %282017%29 Functional analysis of apple MhYTP1 and MhYTP2 genes in leaf senescence and fruit ripening%2E Sci Hortic 221%3A 23%2D32&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Wang N, Guo TL, Wang P, Sun X, Shao Y, Liang BW, Jia X, Gong XQ, Ma FW (2017) Functional analysis of apple MhYTP1 and MhYTP2 genes in leaf senescence and fruit ripening. Sci Hortic 221: 23-32

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Wang&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Functional analysis of apple MhYTP1 and MhYTP2 genes in leaf senescence and fruit ripening&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Functional analysis of apple MhYTP1 and MhYTP2 genes in leaf senescence and fruit ripening&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Wang&as_ylo=2017&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Watanabe M%2C Balazadeh S%2C Tohge T%2C Erban A%2C Giavalisco P%2C Kopka J%2C Mueller%2DRoeber B%2C Fernie AR%2C Hoefgen R %282013%29 Comprehensive dissection of spatiotemporal metabolic shifts in primary%2C secondary%2C and lipid metabolism during developmental senescence in Arabidopsis%2E Plant Physiol 162%3A 1290%2D1310&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Watanabe M, Balazadeh S, Tohge T, Erban A, Giavalisco P, Kopka J, Mueller-Roeber B, Fernie AR, Hoefgen R (2013) Comprehensive dissection of spatiotemporal metabolic shifts in primary, secondary, and lipid metabolism during developmental senescence in Arabidopsis. Plant Physiol 162: 1290-1310

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Watanabe&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Comprehensive dissection of spatiotemporal metabolic shifts in primary, secondary, and lipid metabolism during developmental senescence in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Comprehensive dissection of spatiotemporal metabolic shifts in primary, secondary, and lipid metabolism during developmental senescence in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Watanabe&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Weaver LM%2C Gan SS%2C Quirino B%2C Amasino RM %281998%29 A comparison of the expression patterns of several senescence%2Dassociated genes in response to stress and hormone treatment%2E Plant Mol Biol 37%3A 455%2D469&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Weaver LM, Gan SS, Quirino B, Amasino RM (1998) A comparison of the expression patterns of several senescence-associated genes in response to stress and hormone treatment. Plant Mol Biol 37: 455-469

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Weaver&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=A comparison of the expression patterns of several senescence-associated genes in response to stress and hormone treatment&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=A comparison of the expression patterns of several senescence-associated genes in response to stress and hormone treatment&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Weaver&as_ylo=1998&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Wingler A%2C Purdy S%2C MacLean JA%2C Pourtau N %282006%29 The role of sugars in integrating environmental signals during the regulation of leaf senescence%2E J Exp Bot 57%3A 391%2D399&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Wingler A, Purdy S, MacLean JA, Pourtau N (2006) The role of sugars in integrating environmental signals during the regulation of leaf senescence. J Exp Bot 57: 391-399

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Wingler&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The role of sugars in integrating environmental signals during the regulation of leaf senescence&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The role of sugars in integrating environmental signals during the regulation of leaf senescence&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Wingler&as_ylo=2006&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Xue GP %282002%29 Characterisation of the DNA%2Dbinding profile of barley HvCBF1 using an enzymatic method for rapid%2C quantitative and high%2Dthroughput analysis of the DNA%2Dbinding activity%2E Nucleic Acids Res 30%3A e77&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Xue GP (2002) Characterisation of the DNA-binding profile of barley HvCBF1 using an enzymatic method for rapid, quantitative and high-throughput analysis of the DNA-binding activity. Nucleic Acids Res 30: e77

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Xue&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Characterisation of the DNA-binding profile of barley HvCBF1 using an enzymatic method for rapid, quantitative and high-throughput analysis of the DNA-binding activity.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Characterisation of the DNA-binding profile of barley HvCBF1 using an enzymatic method for rapid, quantitative and high-throughput analysis of the DNA-binding activity.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Xue&as_ylo=2002&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Xue GP%2C Bower NI%2C McIntyre CL%2C Riding GA%2C Kazan K%2C Shorter R %282006%29 TaNAC69 from the NAC superfamily of transcription factors is up%2Dregulated by abiotic stresses in wheat and recognises two consensus DNA%2Dbinding sequences%2E Funct Plant Biol 33%3A 43%2D57&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Xue GP, Bower NI, McIntyre CL, Riding GA, Kazan K, Shorter R (2006) TaNAC69 from the NAC superfamily of transcription factors is up-regulated by abiotic stresses in wheat and recognises two consensus DNA-binding sequences. Funct Plant Biol 33: 43-57

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Xue&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=TaNAC69 from the NAC superfamily of transcription factors is up-regulated by abiotic stresses in wheat and recognises two consensus DNA-binding sequences&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=TaNAC69 from the NAC superfamily of transcription factors is up-regulated by abiotic stresses in wheat and recognises two consensus DNA-binding sequences&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Xue&as_ylo=2006&as_allsubj=all&hl=en&c2coff=1

Google Scholar: Author Only Title Only Author and Title

Yang JC, Zhang JH, Wang ZQ, Zhu QS, Liu LJ (2003) Involvement of abscisic acid and cytokinins in the senescence and remobilizationof carbon reserves in wheat subjected to water stress during grain filling. Plant Cell Environ 26: 1621-1631


Yang JD, Worley E, Udvardi M (2014) A NAP-AAO3 regulatory module promotes chlorophyll degradation via ABA biosynthesis inArabidopsis leaves. Plant Cell 26: 4862-4874


Zhang KW, Gan SS (2012) An abscisic acid-AtNAP transcription factor-SAG113 protein phosphatase 2C regulatory chain for controllingdehydration in senescing Arabidopsis leaves. Plant Physiol 158: 961-969


Zhao D, Derkx AP, Liu DC, Buchner P, Hawkesford MJ (2015) Overexpression of a NAC transcription factor delays leaf senescence andincreases grain nitrogen concentration in wheat. Plant Biol 17: 904-913


Zhao Y, Chan ZL, Gao JH, Xing L, Cao MJ, Yu CM, Hu YL, You J, Shi HT, Zhu YF, Gong YH, Mu ZX, Wang HQ, Deng X, Wang PC,Bressan RA, Zhu JK (2016) ABA receptor PYL9 promotes drought resistance and leaf senescence. Proc Natl Acad Sci USA 113: 1949-1954


Zhou Y, Huang WF, Liu L, Chen TY, Zhou F, Lin YJ (2013) Identification and functional characterization of a rice NAC gene involved inthe regulation of leaf senescence. BMC Plant Biol 13


Zuo J, Niu QW, Chua NH (2000) Technical advance: An estrogen receptor-based transactivator XVE mediates highly inducible geneexpression in transgenic plants. Plant J 24: 265-273


http://www.ncbi.nlm.nih.gov/pubmed?term=Yang JC%2C Zhang JH%2C Wang ZQ%2C Zhu QS%2C Liu LJ %282003%29 Involvement of abscisic acid and cytokinins in the senescence and remobilization of carbon reserves in wheat subjected to water stress during grain filling%2E Plant Cell Environ 26%3A 1621%2D1631&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Yang JC, Zhang JH, Wang ZQ, Zhu QS, Liu LJ (2003) Involvement of abscisic acid and cytokinins in the senescence and remobilization of carbon reserves in wheat subjected to water stress during grain filling. Plant Cell Environ 26: 1621-1631

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Yang&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Involvement of abscisic acid and cytokinins in the senescence and remobilization of carbon reserves in wheat subjected to water stress during grain filling&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Involvement of abscisic acid and cytokinins in the senescence and remobilization of carbon reserves in wheat subjected to water stress during grain filling&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Yang&as_ylo=2003&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Yang JD%2C Worley E%2C Udvardi M %282014%29 A NAP%2DAAO3 regulatory module promotes chlorophyll degradation via ABA biosynthesis in Arabidopsis leaves%2E Plant Cell 26%3A 4862%2D4874&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Yang JD, Worley E, Udvardi M (2014) A NAP-AAO3 regulatory module promotes chlorophyll degradation via ABA biosynthesis in Arabidopsis leaves. Plant Cell 26: 4862-4874

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Yang&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=A NAP-AAO3 regulatory module promotes chlorophyll degradation via ABA biosynthesis in Arabidopsis leaves&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=A NAP-AAO3 regulatory module promotes chlorophyll degradation via ABA biosynthesis in Arabidopsis leaves&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Yang&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Zhang KW%2C Gan SS %282012%29 An abscisic acid%2DAtNAP transcription factor%2DSAG113 protein phosphatase 2C regulatory chain for controlling dehydration in senescing Arabidopsis leaves%2E Plant Physiol 158%3A 961%2D969&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Zhang KW, Gan SS (2012) An abscisic acid-AtNAP transcription factor-SAG113 protein phosphatase 2C regulatory chain for controlling dehydration in senescing Arabidopsis leaves. Plant Physiol 158: 961-969

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Zhang&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=An abscisic acid-AtNAP transcription factor-SAG113 protein phosphatase 2C regulatory chain for controlling dehydration in senescing Arabidopsis leaves&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=An abscisic acid-AtNAP transcription factor-SAG113 protein phosphatase 2C regulatory chain for controlling dehydration in senescing Arabidopsis leaves&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Zhang&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Zhao D%2C Derkx AP%2C Liu DC%2C Buchner P%2C Hawkesford MJ %282015%29 Overexpression of a NAC transcription factor delays leaf senescence and increases grain nitrogen concentration in wheat%2E Plant Biol 17%3A 904%2D913&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Zhao D, Derkx AP, Liu DC, Buchner P, Hawkesford MJ (2015) Overexpression of a NAC transcription factor delays leaf senescence and increases grain nitrogen concentration in wheat. Plant Biol 17: 904-913

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Zhao&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Overexpression of a NAC transcription factor delays leaf senescence and increases grain nitrogen concentration in wheat&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Overexpression of a NAC transcription factor delays leaf senescence and increases grain nitrogen concentration in wheat&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Zhao&as_ylo=2015&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Zhao Y%2C Chan ZL%2C Gao JH%2C Xing L%2C Cao MJ%2C Yu CM%2C Hu YL%2C You J%2C Shi HT%2C Zhu YF%2C Gong YH%2C Mu ZX%2C Wang HQ%2C Deng X%2C Wang PC%2C Bressan RA%2C Zhu JK %282016%29 ABA receptor PYL9 promotes drought resistance and leaf senescence%2E Proc Natl Acad Sci USA 113%3A 1949%2D1954&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Zhao Y, Chan ZL, Gao JH, Xing L, Cao MJ, Yu CM, Hu YL, You J, Shi HT, Zhu YF, Gong YH, Mu ZX, Wang HQ, Deng X, Wang PC, Bressan RA, Zhu JK (2016) ABA receptor PYL9 promotes drought resistance and leaf senescence. Proc Natl Acad Sci USA 113: 1949-1954

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Zhao&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=ABA receptor PYL9 promotes drought resistance and leaf senescence&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=ABA receptor PYL9 promotes drought resistance and leaf senescence&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Zhao&as_ylo=2016&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Zhou Y%2C Huang WF%2C Liu L%2C Chen TY%2C Zhou F%2C Lin YJ %282013%29 Identification and functional characterization of a rice NAC gene involved in the regulation of leaf senescence%2E BMC Plant Biol 13&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Zhou Y, Huang WF, Liu L, Chen TY, Zhou F, Lin YJ (2013) Identification and functional characterization of a rice NAC gene involved in the regulation of leaf senescence. BMC Plant Biol 13

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Zhou&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Identification and functional characterization of a rice NAC gene involved in the regulation of leaf senescence.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Identification and functional characterization of a rice NAC gene involved in the regulation of leaf senescence.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Zhou&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Zuo J%2C Niu QW%2C Chua NH %282000%29 Technical advance%3A An estrogen receptor%2Dbased transactivator XVE mediates highly inducible gene expression in transgenic plants%2E Plant J 24%3A 265%2D273&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Zuo J, Niu QW, Chua NH (2000) Technical advance: An estrogen receptor-based transactivator XVE mediates highly inducible gene expression in transgenic plants. Plant J 24: 265-273

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Zuo&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Technical advance: An estrogen receptor-based transactivator XVE mediates highly inducible gene expression in transgenic plants&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Technical advance: An estrogen receptor-based transactivator XVE mediates highly inducible gene expression in transgenic plants&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Zuo&as_ylo=2000&as_allsubj=all&hl=en&c2coff=1

1 running title: slnap2 regulates leaf senescence in tomato 2 … · 2018-05-14 · 178 in the...

Documents