Hereditary non-polyposis colorectalcancer (HNPCC) is a common auto-

somal dominant condition characterizedby early onset colorectal cancer as well asother tumour types at different anatomical

sites1. HNPCC tumours often display ahigh level of genomic instability, charac-terized by changes in repeat numbers ofsimple repetitive sequences (microsatelliteinstability, MSI), which reflects the mal-

function of the DNA mismatch repairmachinery2,3. Accordingly, HNPCC wasshown to be caused by germline mutationsin the DNA mismatch repair genes (MMR)MSH2, MLH1, PMS1, PMS2 and MSH6(refs 3–6). So far, more than 220 predispos-ing mutations have been identified, most inMSH2 and MLH1 and in families comply-ing with the clinical Amsterdam criteria3,7,8

(AMS+). Many HNPCC families, how-ever, do not fully comply with these crite-ria, and in most cases the causativemutations are unknown.

Familial endometrial cancerin female carriers ofMSH6 germline mutations

142 nature genetics • volume 23 • october 1999

gressive muscular dystrophy. This mousewill become a useful animal model forstudying the pathomechanisms of dysfer-lin deficiency and, moreover, for applyingtherapeutic rescue strategies. Consideringthat the SJL mouse has been widely usedas a model for different human diseases,and for experimental research on muscleregeneration and transplantation formore than 30 years, it is not without ironythat the SJL mouse is now found to have agenetically determined degenerative mus-cle disease of its own. Experimentalresults obtained with SJL mice before theidentification of the deleted SJL-Dysfallele will have to be reevaluated, and ourresults will have implications beyondLGMD2B and MM myopathies.

AcknowledgementsWe thank G. Schaden for technical assistance andJ.A. Encinas for providing information onpolymorphic DNA markers. This work was

supported by the Verein zur Erforschung derMuskelerkrankungen bei Kindern and grant SFBNr. 006-F613 from the Austrian Science ResearchFund (R.E.B.), by the Muscular DystrophyCampaign, the Association Francaise contre lesMyopathies, the Medical Research Council ofGreat Britain, Action Research and a grant-in-aidof the BMBF through the German HumanGenome Projekt (A.R.).

Reginald E. Bittner1, Louise V.B. Anderson2,Elke Burkhardt3, Rumaisa Bashir4,Elizabeth Vafiadaki4, Silva Ivanova1,Thomas Raffelsberger1, Isabel Maerk1,Harald Höger5, Martin Jung3,Mohsen Karbasiyan7, Maria Storch6,8,Hans Lassmann6, Jennifer A. Moss2,Keith Davison2, Ruth Harrison4,Kate M.D. Bushby4 & André Reis3,7

1Institute of Anatomy, Neuromuscular ResearchDepartment, University of Vienna,Waehringerstrasse 13, A-1090 Vienna, Austria.2Neurobiology Department, University MedicalSchool, Newcastle Upon Tyne, UK.3Mikrosatellitenzentrum, Max-Delbrueck-Centre, D-13092 Berlin, Germany. 4School of

Fig. 2 Dysferlin expression in normal and SJLmouse muscle and identification of the deletedDysfsjl allele. a, Muscle samples on a singleimmunoblot. The blots were labelled with amonoclonal antibody to dysferlin (1/300 NCL-hamlet11). The dysferlin band at 230 kD is indi-cated (arrow). Mouse tissues containendogenous immunoglobulin and the lowermolecular mass bands at ∼ 50 kD and 25 kD corre-spond to secondary antibody reactivity withimmunoglobulin heavy and light chains in themouse muscle samples. Lane 1, human skeletalmuscle labelled with different antibodies to gen-erate molecular size markers. Lane 11, skeletalmuscle from a BALB/c mouse with no primaryantibody label, just the secondary antibody usedfor all the lanes. Lanes 2–10 were labelled with aprimary antibody to dysferlin. Lane 2, Dmdmdx

skeletal muscle (dystrophin deficient); 3,Lama2dy/dy skeletal muscle (laminin A2 deficient);4, SJL heart; 5, SJL skeletal muscle; 6, BALB/cheart; 7, BALB/c skeletal muscle; 8, SJL heart; 9,SJL skeletal muscle; 10, human skeletal muscle. Samples from three different SJL mice are shown in lanes 4/5, 8 and 9. Lanes 1 and 11 were reassembled with therest of the blot after the different labelling protocols outlined above. Bottom, corresponding myosin heavy chain (MHC) bands from the Coomassie blue-stainedgel. Densitometric estimates of dysferlin/myosin OD values were: lane 2, 0.106; 3, 0.171; 4, 0.015; 5, 0.026; 6, 0.129; 7, 0.25; 8, 0.028; 9, 0.029; 10, 0.165. Thus, onthis blot, the average dysferlin/myosin OD value for the SJL tissues (0.024) was only 15% of the average value for the dysferlin-competent animals and human(0.164). b, Mouse Dysf cDNA was amplified using the primers 5´–GCCCAGGGACCCCAGGAGTG–3´ and 5´–AGTCTGCCAGCCTCTATCTC–3´, which amplify across thelast C2 domain of dysferlin. In comparison with control (lane 1), which produces a 500-bp fragment, a 329-bp fragment is amplified using cDNA from the SJLmouse, indicating the 171-bp deletion in Dysfsjl (lane 2). This deletion was not detected in a series of mouse strains, including BALB/c, C3H, C57BL/6 and B6C3FE.Lane 3 represents a 1-kb DNA ladder.

Biochemistry and Genetics, University ofNewcastle upon Tyne, UK. 5Research Instituteof Laboratory Animal Breeding, A-2325Himberg, Austria. 6Institute of Brain Research,University of Vienna, A-1090 Vienna, Austria.7Institute of Human Genetics, Charité,Humboldt University, D-13353 Berlin, Germany8Department of Neurology, University of Graz,Austria. Correspondence should be addressedto R.E.B. (e-mail: reginald.bittner@univie.ac.at).

1. Inbred Strains in Biomedical Research (ed. Festing,M.F.W.) 255 (Oxford University Press, New York,1979).

2. Bernard, C.C. & Carnegie, P.R. J. Immunol. 114,1537–2537 (1975).

3. Rosenberg, N.L., Ringel, S.P. & Kotzin, B.L. Clin. Exp.Immunol. 68, 117–129 (1987).

4. Grounds, M.D. & McGeachie, J.K. Cell Tissue Res.255, 385–391 (1989).

5. Hohlfeld, R., Müller, W. & Toyka, K.V. Muscle Nerve11, 184–185 (1988).

6. Weller, A.H., Magliato, S.A., Bell, K.P. & Rosenberg,N.L. Muscle Nerve 20, 72–82 (1997).

7. Bashir, R. et al. Hum. Mol. Genet. 3, 455–457 (1994).8. Bejaoui, K. et al. Neurology 45, 768–772 (1995).9. Liu, J. et al. Nature Genet. 20, 31–36 (1998).10. Bashir, R. et al. Nature Genet. 20, 37–42 (1998).11. Anderson, L.V.B. et al. Hum. Mol. Genet. 8, 855–861

(1999).12. Weiler, T. et al. Hum. Mol. Genet. 8, 871–877 (1999).13. Yasunaga, S. et al. Nature Genet. 21, 363–369 (1999).

a b

correspondence © 1999 Nature America Inc. • http://genetics.nature.com©

199

9 N

atu

re A

mer

ica

Inc.

• h

ttp

://g

enet

ics.

nat

ure

.co

m

correspondence

nature genetics • volume 23 • october 1999 143

Previously, we determined the preva-lence of pathogenic mutations at MSH2and MLH1 among 287 kindreds, of which133 were AMS+ and 154 showed familialclustering of cancers reminiscent ofHNPCC. Approximately one-half ofAMS+ families revealed a predisposing

mutation, whereas only 7% of AMS– fam-ilies had a mutation in either gene8–10.Here we analyse MSH6 by denaturing gra-dient gel electrophoresis (DGGE) in theremaining 214 kindreds, 71 AMS+ and143 AMS–, in which no MSH2 or MLH1mutations were found. We identified 9 dif-

ferent MSH6 pathogenic germline muta-tions in 10 kindreds (Table 1). Thesemutations were scattered along the codingsequence of MSH6 and predict the trunca-tion of its protein product. We found 7 of10 MSH6 mutations in atypical HNPCCfamilies not fulfilling the Amsterdam cri-

Table 1 • Truncating mutations at MSH6 in HNPCC

Family ACIa ACIIa Nucleotide change Nature of the mutation Tumour spectrumb

NL-44 + + TCA→TGA Ser156STOP C45; C48; C55; C52; C53; Bla74,P71NLB-498 + + TCA→TGA Ser156STOP C33; C45; C62, Uro73; C69; C70; E; ENL-34 + + CGA→TGA Arg248STOP C26; C58,59; C61NLB-176 – – 594delT FS, 609STOP E57; E60; Ov50; E53; E50; E55,R55; Uro; C60NL-74 – – CAA→TAA Gln731STOP C46; C49; C51; C48; Oes48NLB-281 – – 891delTT (TCT→C) FS, 898STOP C32; C42; C55,C55,C55; Br58N-867 – – 1085delC FS, 1092STOP C54,E56; E51; E57; E49; Br51,E53; Br50c

D-111 – + 1172insA FS, 1172STOP C44,Br63,C66; E56; E58; E53N-686 – + cagGAA→ccgGAA splice acceptor site intron 8 E50; E56; E56; E58NL-22 – + Cggta→Cagta splice donor site exon 9 C43,E53,C59; E57; E47; E45c; C69

aACI and ACII denote the old and new Amsterdam criteria, respectively7,15. According to ACI, a family should comply with the following: (i) at least three relatives in atleast two successive generations should have colorectal cancer, and one of them should be a first-degree relative of the other two; (ii) one colorectal cancer should bediagnosed before age 50; and (iii) familial adenomatous polyposis should be excluded. The ACII are comparable to ACI, but extracolonic tumours such as those of theendometrium, the small bowel and the ureter are included and may substitute colorectal tumours in ACI. bBla, bladder tumour; Br, breast tumour; C, colon tumour; E,endometrial tumour; Oes, oesophageal tumour; Ov, ovarian tumour; R, rectal tumour; Uro, urothelial tumour; P, adenomatous polyp. The numbers indicate age atdiagnosis (in years), and when underlined, indicate that the corresponding patient tested positive for the mutation. cPatient who tested negative for the mutation.

Table 2 • Microsatellite analysis in tumours of four kindreds with truncating MSH6 mutations

Family NLB-176 N-867 N-686 NA-22Individual III-3 IV-1 IV-2 IV-5 IV-6 IV-11 IV-11 III-1 III-1 III-2 II-2 II-4 II-5 II-1 II-3 II-6Tumour typea Uro E E Ov E R E R E E E E E E E E

microsatellite markersmononucleotide BAT25b + + – + – + – + + – – – + – + –

BAT26b ns + + + – + + + + + + – + – + –BAT40 + ns + + + + + + + + + + + + + –TGFBR2 (A)10 + – – – – + – + – – – – – – – –MSH3 (A)8 + – – – – + – + – – – – – – – –MSH6 (C)8 + + + + + + + + + + + + + + + +BAX (G)8 – + – – + – – – – – – + – – – –

dinucleotide D2S123b + – – – – – – + – – – – – – ns nsD5S346b – – – – – + – + – + – – – – – –D17S250b + – – – – + – – – – – – – – – –D1S158 + – – – + + – + – – – – – – – –D3S1611 ns – – – – ns – – – – – – – ns – –D3S1029 + – – – – ns – – – – – – – ns – nsD7S522 ns – – – – ns – – – – – – – – – nsD8S133 ns – – – – ns – – – – – – – – – –NEFL – – – – – ns – – – – – – – ns – –D10S197 + – – – – ns – – – – – – – ns – –D11S901 + – – – – + – – – – – – – – – –D11S35 ns – – – – + – – – – – – – ns – –D11S968 – ns – – – + – + – – – – – ns – –D13S153 + – – – – + – – – – – – – – – –D13S175 + – + – – ns – – – – – – – – – –TP53 ns – – – – – – + – – – – – – + –D17S588 – – – – – ns – – – – – – – ns – –D18S58 ns – – – – – – – – – – – – – – –D18S61 + – – – – + – – – – – – – – – ns

trinucleotide FABP2 – – – – – + – – – – – – – – – nsDRPLA ns – – – – ns – – – – – – – – – –D4S243 ns – – – – + – – – – – – – ns – –D17S1288 ns – – – – ns – – – – – – – ns – –

tetranucleotide D3S1768 – – – – – – – – – – – – – – ns –D3S2456 – – – – – + – – – – – – – – – –D4S1629 – – – – – + – – – – – – – – ns –D6S1279 ns – – – – + – – – – – – – – – –D8S1130 + ns – – – + – – – – – – – – – –D11S1998 – – – – – + – – – – – – – ns ns –D13S321 – – – – – ns – + – + – – – ns ns –D15S1232 + – – – – + – + – – – – – – – –D16S752 + – – – – ns – – – – – – – – – –D17S1537 ns – – – – ns – – – – – – – – – –

MSI according to NCIb,11 high high low high stab high low high high high low stab high stab high stabMSI according to NCIc,11 high low low low low high low high low low low low low low low low

aE, endometrial tumour; Ov, ovarian tumour; R, rectal tumour; Uro, urothelial tumour. bReference panel recently recommended by NCI for MSI analysis11: if two or more of these markers display instability, the tumour

is classified MSI-high; if only one marker is unstable, the tumour is classified as MSI-low; if no instability is observed, the tumour is classified MSS. cThe same NCI panel can be implemented with additional markers. In this

case a tumour is classified as MSI-high if >30% of the markers show instability; if <30% of the markers are unstable the tumour is classified as MSI-low. ns, corresponding microsatellite marker was not scored.

© 1999 Nature America Inc. • http://genetics.nature.com©

199

9 N

atu

re A

mer

ica

Inc.

• h

ttp

://g

enet

ics.

nat

ure

.co

m

The heterodimeric CBF transcriptionfactor genes (CBFA2 (also known as

AML1) and CBFB) are the most commontranslocation targets in human acute

myeloid leukaemia (AML), accounting for30% of AML cases1. Approximately one-half are attributable to a chromosome 16inversion, inv(16)(p13; q22), found con-

sistently and recurrently in AML subtypeM4Eo. This inversion disrupts CBFB andMYH11, a gene encoding the smoothmuscle myosin heavy chain, creating thefusion gene CBFB-MYH11 (ref. 2). Wepreviously generated a Cbfb-MYH11 allelein mouse embryonic stem (ES) cells by theknock-in approach3. F1 heterozygousembryos (Cbfb+/Cbfb-MYH11) failed to gene-rate definitive haematopoiesis and died atapproximately embryonic day 12.5(ref. 3). This phenotype is similar to thosefound in Cbfb–/– and Cbfa2–/– embryos4–6,suggesting that Cbfb-MYH11 abrogates

The fusion gene Cbfb-MYH11blocks myeloid differentiationand predisposes mice to acutemyelomonocytic leukaemia

144 nature genetics • volume 23 • october 1999

correspondence

teria (7/154, 4.5%). These kindreds displaya very high frequency of atypical hyper-plastic lesions and carcinomas of theendometrium: 73% in female MSH6mutation carriers compared with 29% inMSH2 and 31% in MLH1. Moreover,delayed age of cancer onset and incom-plete penetrance were characteristic clini-cal features of the MSH6 mutation carriers(see Table 3 and Fig. 1, http://genetics.nature.com/supplementary_info/).

We investigated MSI in 16 endometrial,ovarian, rectal and urothelial tumours from4 families using 40 microsatellite markers(Table 2). According to the recently estab-lished MSI criteria for colorectaltumours11, 9 of 16 tumours displayed aMSI-high phenotype, 3 were MSI-low and4 were microsatellite stable (MSS). MSStumours, however, did show instability of atleast one mononucleotide marker. In fact,all tumours analysed showed instability ofthe MSH6 (C8) repeat, which is likely torepresent a preferential target for somaticinactivation. Length variations of theMSH6 (C8) tract thus provide a strong indi-cation to search for MSH6 germline muta-tions in kindreds without mutations inMSH2 or MLH1. In general, MSI wasmainly observed at mononucleotiderepeats, as expected from the biologicalfunction of the MSH6 product in humanDNA mismatch repair12,13. Only the rectaland urothelial carcinomas displayed abroader MSI phenotype, affecting mono-,di-, tri- and tetra-nucleotide repeat mark-ers at a level comparable with that observedin colorectal tumours with MSH2 or MLH1mutations (Table 2). Our data provide indi-rect evidence for a difference between thetumorigenic pathways in endometrial andcolorectal cancer. The TGFBR2 (A)10 intra-genic repeat showed instability in carcino-mas of the rectum and urothelium,although it was not altered among theendometrial and ovarian tumours(Table 2). In the endometrium, MSH6inactivation may select for a differenttumour-suppressor gene, thus triggering

uterine tumorigenesis equivalent to the lossof MSH2 or MLH1, leading to instability atthe TGFBR2 intragenic (A)10 repeat in col-orectal tumorigenesis14.

In addition to the truncating mutations,we detected 6 missense MSH6 mutationsof unknown significance in 11 families, ofwhich 7 were AMS– families (see Table 4,http://genetics.nature.com/supplementary_info/). The clinical features of these fami-lies differ from those found in familieswith MSH6 truncating mutations. Col-orectal cancer was the most frequenttumour type among families with mis-sense substitutions (29/33 cancers),whereas of 64 tumours found in familieswith MSH6 truncating mutations, 31 werecolorectal and 22 endometrial.

Our results indicate that tumours of theendometrium represent the most commonclinical manifestation of HNPCC amongfemale MSH6 mutation carriers and thatcolorectal cancer cannot be considered anobligatory requisite to define HNPCC. Inour total HNPCC cohort, the selection ofwhich was exclusively based on clinical fea-tures and not on the MSI status of the cor-responding tumours, MMR genemutations were found in 49% of the AMS+families and in 12% of the kindreds notcomplying with the criteria. Recently, theInternational Collaborative Group onHNPCC implemented the Amsterdam cri-teria by including extracolonic tumourtypes commonly observed in HNPCC(ref. 15). Of 83 mutation-positive familiesin our total cohort, 73 fulfil the modifiedAmsterdam criteria, thus confirming theirvalidity for the selection of HNPCC fami-lies to be analysed for mutations in MMRgenes. In view of our findings, MSH6 muta-tion analysis is recommended, particularlyin those cases with an excess of endometrialtumours and where MSI is preferentiallyobserved at mononucleotide repeats.

Juul Wijnen1, Wiljo de Leeuw2,Hans Vasen3, Heleen van der Klift1,Pål Møller4, Astrid Stormorken4,

Hanne Meijers-Heijboer5, Dick Lindhout5,Fred Menko6, Sandra Vossen7,Gabriela Möslein7, Carli Tops8,Annette Bröcker-Vriends8, Ying Wu9,Robert Hofstra9, Rolf Sijmons9, Cees Cornelisse2, Hans Morreau2

& Riccardo Fodde1

1MGC-Department of Human and ClinicalGenetics; 2Department of Pathology, LeidenUniversity Medical Center (LUMC); and3Foundation for the Detection of HereditaryTumors and Department of Gastroenterology,LUMC, Leiden, The Netherlands. 4Unit of MedicalGenetics, The Norwegian Radium Hospital, Oslo,Norway. 5MGC-Department of Clinical Genetics,Erasmus University, Rotterdam, The Netherlands.6Department of Clinical Genetics, Free UniversityHospital, Amsterdam, The Netherlands.7Department of Surgery, Heinrich HeineUniversity, Düsseldorf, Germany. 8Clinical GeneticsCenter Leiden, LUMC, Leiden, The Netherlands.9Department of Medical Genetics, University ofGroningen, Groningen, The Netherlands.Correspondence should be addressed to R.F. (e-mail: fodde@ruly46.medfac.leidenuniv.nl).

AcknowledgementsWe thank G.-J. van Ommen and N. de Wind fordiscussions; I. van Leeuwen-Cornelisse for collectingblood samples; and clinicians J. Apold, H. Brunner,G. Griffioen, J. Kleibeuker, F. Nagengast, J. Post,C. Schaap and B. Taal. This study has beensupported by grants from the Dutch Cancer Societyand Praeventiefonds, and by a grant (118571/320)from the Norges Forskningsraad to P.M.

1. Lynch, H.T. et al. Gastroenterology 104, 1535–1549(1993).

2. Ionov, Y. et al. Nature 363, 558–561 (1993).3. Peltomäki, P. et al. Gastroenterology 113,

1146–1158 (1997).4. Akiyama, Y. et al. Cancer Res. 57, 3920–3923 (1997).5. Miyaki, M. et al. Nature Genet. 17, 271–272 (1997).6. Wu, Y. et al. Am. J. Hum. Genet. (in press).7. Vasen, H.F.A. et al. Dis. Colon Rectum 34, 424–425

(1991).8. Wijnen, J.T. et al. Am. J. Hum. Genet. 61, 329–335

(1997).9. Wijnen, J.T. et al. N. Engl. J. Med. 339, 511–518

(1998).10. Wijnen, J.T. et al. Nature Genet. 20, 326–328 (1998).11. Boland, C.R. et al. Cancer Res. 58, 5248–5257 (1998).12. Drummond, J.T. et al. Science 268, 1909–1912

(1995).13. Genschel, J. et al. J. Biol. Chem. 273, 19895–19901

(1998).14. Lu, S. et al. Biochem. Biophys. Res. Commun. 216,

452–457 (1995).15. Vasen, H.F.A. et al. Gasteroenterology 116,

1453–1456 (1999).

© 1999 Nature America Inc. • http://genetics.nature.com©

199

9 N

atu

re A

mer

ica

Inc.

• h

ttp

://g

enet

ics.

nat

ure

.co

m