A Single Transcription Factor (PDD1) Determines Developmentand Yield of Winter Mushroom (Flammulina velutipes)

Taju Wu,a,b Chengcheng Hu,a,b Baogui Xie,c Long Zhang,d Shujie Yan,e Wei Wang,c Yongxin Tao,c Shaojie Lia

aState Key Laboratory of Mycology, Institute of Microbiology, Chinese Academy of Sciences, Beijing, ChinabUniversity of Chinese Academy of Sciences, Beijing, ChinacMycological Research Center, College of Life Sciences, Fujian Agriculture and Forestry University, Fuzhou, Fujian, ChinadShandong Jinniu Biotech Company Limited, Jinan, Shandong, ChinaeGT BIO-Technology (Beijing) Company Limited, Beijing, China

ABSTRACT Most of the edible mushrooms cannot be cultivated or have low yieldunder industrial conditions, partially due to the lack of knowledge on how basidi-oma (fruiting body) development is regulated. From winter mushroom (Flammulinavelutipes), one of the most popular industrially cultivated mushrooms, a transcriptionfactor, PDD1, with a high-mobility group (HMG)-box domain was identified based onits increased transcription during basidioma development. pdd1 knockdown by RNAinterference affected vegetative growth and dramatically impaired basidioma devel-opment. A strain with an 89.9% reduction in the level of pdd1 transcription failedto produce primordia, while overexpression of pdd1 promoted basidioma devel-opment. When the transcriptional level of pdd1 was increased to 5 times thebase level, the mushroom cultivation time was shortened by 9.8% and the yieldwas increased by at least 33%. RNA sequencing (RNA-seq) analysis revealed thatpdd1 knockdown downregulated 331 genes and upregulated 463 genes. PDD1positively regulated several genes related to fruiting, including 6 pheromonereceptor-encoding genes, 3 jacalin-related lectin-encoding genes, FVFD16, and 2FVFD16 homolog-encoding genes. PDD1 is a novel transcription factor with reg-ulatory function in basidioma development found in industrially cultivated mush-rooms. Since its orthologs are widely present in fungal species of the Basidiomy-cota phylum, PDD1 might have important application prospects in mushroombreeding.

IMPORTANCE Mushrooms are sources of food and medicine and provide abundantnutrients and bioactive compounds. However, most of the edible mushrooms can-not be cultivated commercially due to the limited understanding of basidioma de-velopment. From winter mushroom (Flammulina velutipes; also known as Enoki-take), one of the most commonly cultivated mushrooms, we identified a noveltranscription factor, PDD1, positively regulating basidioma development. PDD1increases expression during basidioma development. Artificially increasing its ex-pression promoted basidioma formation and dramatically increased mushroomyield, while reducing its expression dramatically impaired its development. In itsPDD1 overexpression mutants, mushroom number, height, yield, and biologicalefficiency were significantly increased. PDD1 regulates the expression of somegenes that are important in or related to basidioma development. PDD1 is thefirst identified transcription factor with defined functions in mushroom develop-ment among commercially cultivated mushroom species, and it might be usefulin mushroom breeding.

KEYWORDS sexual development, HMG-box, basidioma, Flammulina velutipes

Citation Wu T, Hu C, Xie B, Zhang L, Yan S,Wang W, Tao Y, Li S. 2019. A single transcriptionfactor (PDD1) determines development andyield of winter mushroom (Flammulinavelutipes). Appl Environ Microbiol 85:e01735-19.https://doi.org/10.1128/AEM.01735-19.

Editor Irina S. Druzhinina, Nanjing AgriculturalUniversity

Copyright © 2019 American Society forMicrobiology. All Rights Reserved.

Address correspondence to Shaojie Li,lisj@im.ac.cn.

Received 30 July 2019Accepted 9 October 2019

Accepted manuscript posted online 11October 2019Published

GENETICS AND MOLECULAR BIOLOGY

crossm

December 2019 Volume 85 Issue 24 e01735-19 aem.asm.org 1Applied and Environmental Microbiology

27 November 2019

on July 17, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

Basidiomata (fruiting bodies) of many fungi in the Basidiomycota phylum have longbeen used as foods due to their desirable taste and rich nutrient content. Some

species are also capable of producing secondary metabolites with special biologicalactivities, such as antitumor or immunomodulating activities, and are also medicinesources (1, 2). However, among about 2,300 edible fungal species, only 100 areindustrially cultivated (3, 4), mainly due to the lack of sufficient knowledge on therequirements of basidioma development.

The major understanding of mechanisms of basidioma development was obtainedfrom studies in two model species, Schizophyllum commune and Coprinopsis cinerea,from which several important transcription factors regulating basidioma developmentwere identified. Some transcription factors regulate early events of basidioma devel-opment (5, 6). For example, inactivation of S. commune c2h2, encoding a transcriptionfactor with a Cys2His2 zinc finger domain, resulted in the arrest of dikaryotic hyphae atthe aggregation stage (7). Several transcription factors, including hom2 (encoding atranscription factor with a homeodomain), bri1 (encoding a protein with a BrightDNA-binding domain), fst4 (encoding a zinc finger transcription factor), and theWC-1–WC-2 blue light receptor complex in S. commune, are required for the initiationof basidioma development, and their deletion resulted in the loss of basidiomaformation (7, 8). The late stages of basidioma development are regulated by severalother transcription factors. For example, deletion of fst3 (encoding a zinc fingertranscription factor), gat1 (encoding a transcription factors with a GATA-type zinc fingerdomain), or hom1 (encoding a transcription factor with a homeodomain) in S. communeincreased mushroom numbers but reduced the basidioma size (7, 8). All of the findingsdescribed above promote a certain degree of understanding of an elaborate regulatorynetwork in basidioma development.

However, the knowledge on mechanisms of basidioma development in nonmodelmushrooms is very limited, especially in commercially cultivated species, such asFlammulina velutipes, Lentinula edodes, Pleurotus spp., Auricularia spp., and Agaricusbisporus, which together supply around 85% of the world’s edible mushrooms (9).These cultivated mushrooms differ from the model species in phylogeny, cultureconditions, and hereditary properties (10–14). In addition, although homologs of thetranscription factors mentioned above are present in the commercially cultivatedmushroom species, on the basis of our analysis of published transcriptomic data (5, 6),most of their expression patterns are different from those of their homologs in the twomodel mushrooms, in which their expression levels correlate with the fruiting process.For example, the homologs of fst4 and bri1 in F. velutipes did not show transcriptionalincreases in primordia and mature basidiomata relative to the vegetative growth stage,as shown previously in S. commune (8). In S. commune, fst3, hom2, c2h2, and gat1showed increased levels of transcription in primordia and mature basidiomata com-pared to the vegetative growth stage (8), but genes encoding their homologs in F.velutipes exhibited decreased transcription in those stages (15, 16). This indicates thatdifferent transcriptional regulatory networks of basidioma development might exist inthe commercially cultivated mushrooms.

Winter mushroom (F. velutipes; also known as golden needle mushroom or Enoki-take) is one of the most widely industrially cultivated mushrooms in the world; it hasenormous economic benefits and produces secondary metabolites with health promo-tion functions (17–20). F. velutipes has a simple life cycle, with both vegetative growthand basidioma development stages as seen with other dikaryotic fungi of the Basidi-omycota phylum (13). Due to its convenient conditions for basidioma induction, theavailability of complete genome sequence and transcriptomic data at different devel-opmental stages, and its mature genetic manipulation methods (21–24), F. velutipes hasbeen regarded as a model for decoding the mechanisms of basidioma development incultivated mushrooms (21).

In this study, by screening F. velutipes transcriptomic data and following geneticapproaches, we identified the transcription factor PDD1, a high-mobility group (HMG)-box-containing protein, as a newly recognized regulator of basidioma development.

Wu et al. Applied and Environmental Microbiology

December 2019 Volume 85 Issue 24 e01735-19 aem.asm.org 2

on July 17, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

RESULTSpdd1 increases expression during basidioma development. To find transcription

factors that regulate basidioma development in F. velutipes, transcripts in mycelia at thevegetative growth stage, in primordia, in elongating basidiomata, and in maturebasidiomata were analyzed by RNA sequencing (RNA-seq) (15, 16). The transcriptionalprofile of a particular gene, namely, gene 3188, attracted our attention. We renamedgene 3188 pdd1 (primordia development defect 1) (GenBank accession no. MG264427)based on the phenotype of its knockdown mutants (see below). The transcriptionallevel of pdd1 in primordia was significantly higher than that in mycelia at the vegetativegrowth stage and continuously increased with basidioma development. This expressionpattern was confirmed by quantitative real-time PCR (qPCR) (Fig. 1). As shown in Fig. 1,pdd1 transcriptional levels in primordia, elongating basidiomata, and mature basidi-omata were 2-fold (P � 0.0027, n � 3), 4-fold (P � 0.0007, n � 3), and 5-fold (P � 0.0004,n � 3) that in mycelia at the vegetative growth stage, respectively. This transcriptionalprofile suggests that PDD1 might play a role in basidioma development.

Structure and phylogenetic analysis of the PDD1 protein. The coding sequenceof the pdd1 gene is 1,204 bp, containing an open reading frame of 1,155 bp, interruptedby one intron of 49 bp (see File S1 in the supplemental material) and encodes a proteinwith 384 amino acid residues (File S2). Domain prediction performed with SMART (25,26) showed that the PDD1 protein has only one functional domain, the HMG-boxDNA-binding domain (SM000398). A nuclear localization signal (NLS) was found inPDD1 based on cNLS Mapper analysis (27) (Fig. 2A). The existence of both the HMG-boxdomain and the NLS indicates that PDD1 is probably a transcription factor.

Homologs of PDD1 are widely present in Basidiomycota, including industrial mush-rooms (Pleurotus ostreatus, A. bisporus, L. edodes, Auricularia subglabra, and Sparassiscrispa), wild mushrooms (Ganoderma sinense and Laccaria bicolor), the model basidi-omycete species (C. cinerea and S. commune), the human fungal pathogen Cryptococcusneoformans, and the plant fungal pathogen Ustilago maydis. The conserved regions arelocated in the HMG-box domain (Fig. 2B).

A phylogenetic analysis was conducted with the HMG-box motif sequences of allHMG-box motif-containing proteins (a total of 204 proteins) in 10 fungal species,including 6 industrial mushrooms (F. velutipes, P. ostreatus, A. bisporus, L. edodes, A.subglabra, and S. crispa), 2 wild mushrooms (G. sinense and L. bicolor), and 2 modelmushrooms (C. cinerea and S. commune), representing 10 different families of Agarico-mycetes. The maximum-likelihood tree showed that all of the HMG-box proteins were

FIG 1 Transcript levels of pdd1 at different development stages in the wild type (F19). RNA was extractedfrom the vegetative mycelia growing in composted sawdust substrate, from primordia, from basidiomataat the elongation stage, and from the basidiomata at maturation stage. The transcript levels of pdd1 weremeasured by qPCR and normalized to the transcript level of the �-actin gene. The expression levelof pdd1 at each stage was calculated relative to the transcript level of pdd1 at the mycelial growthstage according to the 2�ΔΔCT method. Results shown are means of three biological replicates.Standard deviations are indicated with error bars. The significant levels were calculated by t test andare marked as follows: *, 0.01 � P � 0.05; **, 0.001 � P � 0.01; and ***, P � 0.001. Pprimordia � 0.0027,n � 3; Pelongation basidiomata � 0.0007, n � 3; Pmature basidiomata � 0.0004, n � 3.

PDD1 Controls Development and Yield of Winter Mushroom Applied and Environmental Microbiology

December 2019 Volume 85 Issue 24 e01735-19 aem.asm.org 3

on July 17, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

clearly separated into different clades (see Fig. S1 in the supplemental material). Allanalyzed fungal species had HMG-box proteins in the clade where PDD1 was located,but none of them were previously reported. Among the HMG-box proteins in Agari-comycetes, only C. cinerea Exp1 and Pcc1 were reported previously to be involved inbasidioma development (28–30). However, Exp1, Pcc1, and PDD1 were separated intothree different clades.

To show in simple terms the phylogenetic relationships among Exp1, Pcc1, andPDD1, a smaller phylogenetic tree containing only 29 proteins, including Exp1, Pcc1,and PDD1 and closely related homologs, was generated (Fig. 3). The maximum-likelihood tree showed that Exp1, Pcc1, and PDD1 were clearly separated into threedifferent clades. To easily distinguish them, we named three clades: the Exp1 clade,Pcc1 clade, and PDD1 clade. In F. velutipes, Exp1 and Pcc1 have their own orthologsencoded by gene 1942 and gene 4230, respectively. This analysis indicates that PDD1is a novel HMG-box protein and that its orthologs widely exist in the species ofAgaricomycetes.

As reported previously, HMG-box proteins are subdivided into the SOX-TCF_HMG-box, MATA_HMG-box, and HMGB-UBF_HMG-box superfamilies (31). HMG-box proteinsin the PDD1 clade and Pcc1 clade belong to the MATA_HMG-box superfamily whereasproteins in the Exp1 clade belong to the HMGB-UBF_HMG-box superfamily based onthe results of analysis performed with CDD (32).

Generation of mutants for pdd1 overexpression and knockdown. To reveal thefunction of pdd1 in F. velutipes, pdd1 overexpression vector pdd1-OE and pdd1 knock-down vector pdd1-RNAi (pdd1-RNA interference) were constructed (Fig. 4). Binaryvector pBHg-BCA1, the promoter of glyceraldehyde-3-phosphate dehydrogenase withthe first exon and intron (Pgpd) (33) and the terminator of trpC (TtrpC) (34, 35) wereused to construct pdd1-OE and pdd1-RNAi. The pdd1 overexpression vector wascompleted by introducing a copy of pdd1 flanked by Pgpd and TtrpC (Fig. 4A). The pdd1RNAi vector was constructed to produce a hairpin RNA to induce the degradation oftarget mRNA (36). It contains two 491-bp complementary regions separated by a 49-bpspacer fragment (the intron adjacent to the second exon of pdd1). The fragmentstarting at nucleotide 683 and extending to nucleotide 1173 in the second exon of pdd1was used as the sense sequence (Fig. 4B).

FIG 2 PDD1 domain organization and sequence conservation in the HMG-box domain regions among PDD1 orthologs. (A) Domainorganization of PDD1 protein. A HMG-box domain and a nuclear localization signal (NLS) were predicted in PDD1 protein by SMART (25,26) and cNLS Mapper (27), respectively. (B) Sequence alignment of the HMG-box domain regions in orthologs of PDD1 from different fungiof the Basidiomycota phylum. A. bisporus, Agaricus bisporus var. bisporus H97; A. subglabra, Auricularia subglabra TFB-10046 SS5; C. cinerea,Coprinopsis cinerea okayama7#130; C. neoformans, Cryptococcus neoformans var. neoformans JEC21; F. velutipes, Flammulina velutipes L11;G. sinense, Ganoderma sinense ZZ0214-1; L. bicolor, Laccaria bicolor S238N-H82; L. edodes, Lentinus edodes; P. ostreatus, Pleurotus ostreatusPC15; S. crispa, Sparassis crispa; S. commune, Schizophyllum commune H4-8; U. maydis, Ustilago maydis 521.

Wu et al. Applied and Environmental Microbiology

December 2019 Volume 85 Issue 24 e01735-19 aem.asm.org 4

on July 17, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

The vectors were introduced into a dikaryotic wild-type (WT) strain of F. velutipes.Three pdd1 overexpression mutants, pdd1OE#7, pdd1OE#31, and pdd1OE#38, were ob-tained, and their pdd1 transcript levels were found to have increased by 4-fold, 6-fold,and 5-fold, respectively, compared to the wild type (Ppdd1OE#7 � 0.0001, n � 3;Ppdd1OE#31 � 0.0004, n � 3; Ppdd1OE#38 � 0.0059, n � 3) (Fig. 4C). Three pdd1 knockdownmutants, pdd1RNAi#64, pdd1RNAi#148, and pdd1RNAi#170, were obtained in which pdd1transcript levels were decreased by 89.9%, 51.8%, and 30.2%, respectively, compared to thewild type (Ppdd1RNAi#64 � 0.00002, n � 3; Ppdd1RNAi#148 � 0.0014, n � 3; Ppdd1RNAi#170 �

0.0297, n � 3) (Fig. 4D). The six strains mentioned above were used in the studydescribed here.

PDD1 positively regulates vegetative growth. When grown on CYM medium(0.2% [wt/vol] yeast extract, 0.2% [wt/vol] tryptone, 1% [wt/vol] maltose, and 2%[wt/vol] glucose), none of the three pdd1 overexpression strains displayed significantdifferences from the wild-type strain in colony growth, mycelial density, or colony color(Fig. 5A). However, the mycelia in the colonies of pdd1 knockdown strains were sparserthan those in the colonies of the wild-type colonies. The colony growth rates ofknockdown strains were significantly lower than those of the wild-type strain (Fig. 5B).The growth rates of pdd1 knockdown strains were reduced by 30.9% � 6.5%,18.3% � 5.8%, and 10.4% � 3.7% in pdd1RNAi#64, pdd1RNAi#148, and pdd1RNAi#170, respec-tively, relative to the wild type (Ppdd1RNAi#64 � 0.00003, n � 6; Ppdd1RNAi#148 � 0.0016,n � 6; Ppdd1RNAi#170 � 0.0233, n � 6). The effects of pdd1 knockdown on colony growthwere correlated with the expression level of pdd1.

The effects of pdd1 overexpression or knockdown on the vegetative growth ofdifferent strains were also analyzed under a condition mimicking that used for F.velutipes industrial production. All strains were inoculated on the surface of thecomposted sawdust substrate (SM) contained in the culture vessels. Strains were grown

FIG 3 Phylogenic analysis of HMG-box-containing proteins in fungi of the Agaricomycetes class. The HMG-box motifsequences of HMG-box-containing proteins were extracted with CDD (32) and aligned with ClustalX1.83 (61). The maximum-likelihood tree was then constructed with model LG�G4 using IQ-TREE (62). Numbers next to the branches indicate bootstrapvalues from 1,000 replicates. A. bisporus, Agaricus bisporus var. bisporus H97; A. subglabra, Auricularia subglabra TFB-10046 SS5;C. cinerea, Coprinopsis cinerea okayama7#130; F. velutipes, Flammulina velutipes L11; G. sinense, Ganoderma sinense ZZ0214-1;L. bicolor, Laccaria bicolor S238N-H82; L. edodes, Lentinus edodes; P. ostreatus, Pleurotus ostreatus PC15; S. crispa, Sparassis crispa;S. commune, Schizophyllum commune H4-8. The solid triangle indicates F. velutipes PDD1 protein.

PDD1 Controls Development and Yield of Winter Mushroom Applied and Environmental Microbiology

December 2019 Volume 85 Issue 24 e01735-19 aem.asm.org 5

on July 17, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

at 25°C, and mycelia grew toward the bottom of the vessels. After 12 days, when themycelia of the wild type occupied 90% of the sawdust substrate, the mycelia of thepdd1 overexpression strains had already reached the bottom of the vessels, completelyoccupying the substrate (Fig. 6). However, the mycelia of pdd1RNAi#64 occupied onlytwo-thirds of the sawdust substrate. The mycelia of pdd1RNAi#64 took 7 days longer tocover the entire sawdust substrate than the mycelia of the wild type (Fig. 6). The resultsdescribed above together indicate that PDD1 positively regulates hyphal growth of F.velutipes.

PDD1 positively regulates basidioma development. Basidioma development wasobserved in the composted sawdust substrate. After 21 days of culture, the mycelialmats on the medium surface were scraped off to stimulate basidioma development.The primordia in the wild type appeared after 6 days of stimulation (on day 27 afterinoculation). Primordia appeared 1 day earlier in the pdd1 overexpression strains thanin the wild type, and more primordia were formed with the pdd1 overexpression strainsthan with the wild type. The optimal time for basidioma harvest in the wild type wasday 41, while the pdd1 overexpression strains took only 37 days to reach the same stage(Fig. 7). On day 41, basidiomata of the pdd1 overexpression strains were already agedand their stipes had turned brown, which did not appear at the early stage of basidiomadevelopment and which dramatically affects the commercial value. Thus, overexpres-sion of pdd1 could shorten the cultivation time by 9.8% (4 days).

FIG 4 Construction of mutants for pdd1 overexpression and knockdown. (A and B) Schematic represen-tations of pdd1 overexpression and knockdown constructs. The promoter of gpd and terminator of trpCused in the construction are shown with a white empty arrow and a red rectangle, respectively. The bluearrows represent the opening reading frame of pdd1 (A) and the sense and antisense sequence of thesecond exon of pdd1 (B). In the RNAi construction, the complemented sense and antisense sequence canform a hairpin. The loop of the hairpin is shown as a black line. (C and D) Transcript levels of pdd1 in thewild-type strain (C and D), pdd1 overexpression strains (C), and pdd1 knockdown strains (D). RNA wasextracted from the mycelia cultured on cellophane-covered CYM agar at 25°C for 7 days. Transcript levelsof pdd1 were measured by qPCR. The expression of pdd1 was normalized to the transcript level of the�-actin gene and calculated relative to the transcript level in the wild type according to the 2�ΔΔCT

method. Results shown are means of three biological replicates. Standard deviations are indicated witherror bars. The significant levels were calculated by t test and are marked as follows: *, 0.01 � P � 0.05;**, 0.001 � P � 0.01; and ***, P � 0.001. Ppdd1OE#7 � 0.0001, n � 3; Ppdd1OE#31 � 0.0004, n � 3; Ppdd1OE#38 �0.0059, n � 3; Ppdd1RNAi#64 � 0.00002, n � 3; Ppdd1RNAi#148 � 0.0014, n � 3; Ppdd1RNAi#170 � 0.0297, n � 3.

Wu et al. Applied and Environmental Microbiology

December 2019 Volume 85 Issue 24 e01735-19 aem.asm.org 6

on July 17, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

In contrast, the basidioma development in the pdd1 knockdown strains was dra-matically impaired. None of them had formed primordia by day 27 after inoculation, thetime at which the wild type had formed abundant primordia. On day 41, thepdd1RNAi#148 and pdd1RNAi#170 strains were seen to have produced only a few basidi-omata, and they were much smaller size than those produced by the wild type. Thepdd1RNAi#64 strain, which had the lowest level of pdd1 expression, had not formed anyprimordia even after 41 days of cultivation (Fig. 7).

FIG 5 Effects of pdd1 overexpression and knockdown on mycelial growth on agar plates. (A) Mycelialplugs (diameter [d] � 5 mm) of the wild-type (F19) strain, pdd1 overexpression strains, and pdd1knockdown strains were inoculated onto the center of CYM plates and cultured at 25°C for 7 days. Thecolony of each plate was then documented by photography. (B) Growth rates of the wild-type strain andpdd1 overexpression and knockdown mutants. The colony edge was marked every 24 h, and the growthrates of the wild-type strain, pdd1 overexpression strains, and pdd1 knockdown strains were calculated.Values shown are means of results from three biological replicates. Standard deviations (SD) are indicatedwith error bars. The significant levels were calculated by t test and are marked as follows: *,0.01 � P � 0.05; **, 0.001 � P � 0.01; and ***, P � 0.001. Ppdd1OE#7 � 0.7792, n � 6; Ppdd1OE#31 � 0.5783, n � 6;Ppdd1OE#38 � 0.2911, n � 6; Ppdd1RNAi#64 � 0.00003, n � 6; Ppdd1RNAi#148 � 0.0016, n � 6; Ppdd1RNAi#170 � 0.0233,n � 6.

FIG 6 Effects of pdd1 overexpression and knockdown on mycelial growth in composted sawdustsubstrate. Strains were inoculated into the culture vessels, each containing 150 � 5 g compostedsawdust substrate. Images of each strain were captured after 12 days of growth at 25°C. Strains includedthe wild type, pdd1 overexpression strains (pdd1OE#7, pdd1OE#31, and pdd1OE#38), and pdd1 knockdownstrains (pdd1RNAi#64, pdd1RNAi#148, and pdd1RNAi#170).

PDD1 Controls Development and Yield of Winter Mushroom Applied and Environmental Microbiology

December 2019 Volume 85 Issue 24 e01735-19 aem.asm.org 7

on July 17, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

The same experiment was independently repeated three times with six bottles usedfor each strain each time, and the results were consistent (see Table S1 in thesupplemental material). These results together indicate that PDD1 positively regulatesbasidioma development.

Overexpression of pdd1 increases yield. Basidiomata were harvested from thebottles of all the strains at the time that had been found to be optimal for the wild-typestrain (at day 41). As shown in Fig. 8A, all three pdd1 overexpression strains producedsignificantly more basidiomata than the wild type. For the first experiment, the averagenumber of basidiomata in the wild type was 67 per vessel, while the average basidiomanumbers in the pdd1OE#7, pdd1OE#31, and pdd1OE#38 strains were 75, 80, and 79 pervessel, respectively.

The stipe heights of the pdd1 overexpression strains (pdd1OE#7, pdd1OE#31, andpdd1OE#38) were also significantly increased compared to those of the wild type. For thefirst experiment, the average height of basidiomata in the wild type was 6.64 � 0.16 cm,while the average heights of basidiomata in the pdd1OE#7, pdd1OE#31, and pdd1OE#38

strains were 8.34 � 0.19 cm, 9.32 � 0.31 cm, and 8.41 � 0.16 cm, respectively (Fig. 8B).Consequently, the yield and biological efficiency (BE) were significantly increased in

these pdd1 overexpression strains relative to the wild type (Fig. 8C and D). As shown in

FIG 7 PDD1 positively regulates basidioma development in F. velutipes. Cultures from half a CYM plate growingeach strain were punched into mycelial plugs (diameter [d] � 60 mm). The plugs were inoculated into the culturevessels, each containing 150 � 5 g composted sawdust substrate. Images of basidioma development were cap-tured on days 27, 37, and 41 after inoculation. Strains included the wild type, pdd1 overexpression strains (pdd1OE#7,pdd1OE#31, and pdd1OE#38), and pdd1 knockdown strains (pdd1RNAi#64, pdd1RNAi#148, and pdd1RNAi#170).

Wu et al. Applied and Environmental Microbiology

December 2019 Volume 85 Issue 24 e01735-19 aem.asm.org 8

on July 17, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

Fig. 8C, the average yields of the wild-type, pdd1OE#7, pdd1OE#31, and pdd1OE#38 were23.58 � 0.87 g, 28.66 � 2.25 g, 38.28 � 1.72 g, and 29.62 � 2.19 g, respectively. Thehighest yield appeared in the stain with the highest level of pdd1 expression, i.e., thepdd1OE#31 strain, in which the yield of basidiomata had increased by 62.31% relative tothe wild type, with the highest biological efficiency of 73.61% � 3.30%.

The yield and biological efficiency increases in pdd1 overexpression strains wereconsistently seen in three independently repeated experiments (Table S2), amongwhich the yield was increased at least by 33% in the pdd1OE#31 strain.

PDD1 acts as a transcriptional regulator. In order to understand the regulatoryrole of PDD1, transcriptomic profiles of the wild type and the pdd1RNAi#64 strain (thepdd1 knockdown strain with the lowest level of pdd1 expression) were comparativelyanalyzed by RNA-seq. The mycelia were harvested from composted sawdust substrateon day 26, 1 day before primordium formation in the wild-type strain. The genes whichwere upregulated by more than 2-fold or downregulated by 50% in response to thepdd1 knockdown were defined as differentially regulated genes corresponding to thepdd1 knockdown. Based on these criteria, 331 genes were downregulated and 463genes were upregulated by the pdd1 knockdown (see Data Set S1 in the supplementalmaterial). Among the 794 differentially expressed genes, most were annotated as“hypothetical proteins” and their functions had not been previously investigated.However, some differentially expressed genes were associated with basidioma devel-

FIG 8 Effects of pdd1 overexpression on mushroom yield. Basidiomata were harvested on day 41 afterinoculation. To mimic the industrial production of F. velutipes, the basidiomata which grew out of thevessel were harvested and analyzed. (A) Average number of basidiomata. (B) Average stipe height. (C)Average yield. (D) Biological efficiency. Results shown are means of six biological replicates. Standarddeviations are indicated with error bars. The significant levels were calculated by t test and marked asfollows: *, 0.01 � P � 0.05; **, 0.001 � P � 0.01; and ***, P � 0.001. In average numbers of basidiomata,Ppdd1OE#7 � 9.0587E�06, n � 6; Ppdd1OE#31 � 2.09715E�06, n � 6; Ppdd1OE#38 � 1.48962E�05, n � 6. Inaverage stipe height of basidiomata, Ppdd1OE#7 � 1.31567E�08, n � 6; Ppdd1OE#31 � 4.16545E�09, n � 6;Ppdd1OE#38 � 3.61873E�09, n � 6. In average yield and biological efficiency, Ppdd1OE#7 � 0.000432355,n � 6; Ppdd1OE#31 � 4.10493E�09, n � 6; and Ppdd1OE#38 � 9.34623E�05, n � 6.

PDD1 Controls Development and Yield of Winter Mushroom Applied and Environmental Microbiology

December 2019 Volume 85 Issue 24 e01735-19 aem.asm.org 9

on July 17, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

opment based on previous reports (37–39). These genes can be divided into threegroups: jacalin-related lectin-encoding genes, putative pheromone receptor-encodinggenes, and genes encoding FVFD16 and FVFD16 homologs.

PDD1 positively regulates three jacalin-related lectin genes. The level of expres-sion of jacalin-related lectin-encoding gene Fv-JRL1 was reduced in response to thepdd1 knockdown. According to the results of a previous study (39), Fv-JRL1 positivelyregulates basidioma development; its transcriptional level was dramatically increased inthe primordial stage relative to its expression in the vegetative mycelia, and Fv-JRL1knockdown severely impaired basidioma development. We found that two genes, gene10415 and gene 10856, encoding Fv-JRL1 homologs, were also downregulated in thepdd1 knockdown (Data Set S1). Further qPCR analysis using the gene encoding �-actinas the reference gene was conducted to analyze their transcripts in mycelia after theinduction of basidioma development. The results showed that the transcriptional levelsof Fv-JRL1, gene 10415, and gene 10856 were significantly reduced in the pdd1knockdown strain compared to the wild type (Fig. 9A). The same RNA samples wereanalyzed by qPCR using a second reference gene, gpd (encoding glyceraldehyde-3-phosphate dehydrogenase), and the results were similar (Fig. S2).

PDD1 positively regulates six genes encoding pheromone receptors orpheromone-receptor-like proteins. Pheromone receptors are important regulators ofsexual development in fungi. The putative pheromone regulators belong to the STEsuperfamily of PR (pheromone receptors) encoded by the MAT-B locus, which, together

FIG 9 Transcriptional responses of basidioma development-related genes to pdd1 knockdown.Transcript levels of genes encoding (A) jacalin-related lectin (Fv-JRL1, gene 10415, and gene 10856),(B) putative pheromone regulators (FvSTE3.1, FvSTE3.5, FvSTE3.s3, FvSTE3.s4, FvSTE3.s5, and FvSTE3.s6), and(C) FVFD16 and its homologs (FVFD16, gene 2632, and gene 543) were determined in the wild type(F19) and pdd1 knockdown strain pdd1RNAi#64 by qPCR. The expression of indicated genes wasnormalized to the transcript level of the �-actin gene and calculated relative to the transcript levelof the wild type according to the 2�ΔΔCT method. Results shown represent means of results fromthree biological replicates. Standard deviations are indicated with error bars. The significant levelswere calculated by t test and marked as follows: *, 0.01 � P � 0.05; **, 0.001 � P � 0.01; and ***,P � 0.001. PFv-JRL1 � 0.00383817, n � 3; Pgene 10415 � 8.18691E�05, n � 3; Pgene 10856 � 0.002016353,n � 3; PFvSTE3.1 � 0.002060162, n � 3; PFvSTE3.5 � 0.007959895, n � 3; PFvSTE3.s3 � 0.002370431, n � 3;PFvSTE3.s4 � 0.001617543, n � 3; PFvSTE3.s5 � 0.002459571, n � 3; PFvSTE3.s6 � 0.000248924, n � 3; PFVFD16 �0.000222852, n � 3; Pgene 2632 � 0.00031644, n � 3; Pgene 543 � 0.000794393.

Wu et al. Applied and Environmental Microbiology

December 2019 Volume 85 Issue 24 e01735-19 aem.asm.org 10

on July 17, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

with the MAT-A locus, forms mating-type loci in basidiomycetes (40, 41). Mating typeloci regulate the formation of dikaryons and also determine basidioma initiation (42).

Six genes, encoding putative pheromone receptors, were downregulated in thepdd1 knockdown strain based on the RNA-seq analysis. FvSTE3.1 and FvSTE3.2 werepheromone receptors; the others (FvSTE3.s3, FvSTE3.s4, FvSTE3.s5, and FvSTE3.s6) werepheromone-receptor-like proteins (38). Further qPCR analysis performed using �-actinand gpd as the reference genes also showed that the transcriptional levels of six geneswere reduced in the pdd1 knockdown strain compared to the wild-type strain inmycelia after the induction of basidioma development (Fig. 9B; see also Fig. S2),indicating that these putative pheromone-receptor-encoding genes are regulated byPDD1.

PDD1 positively regulates FVFD16 and its two homologs. FVFD16 was reportedto be related to differentiation of basidioma and was named “F. velutipes fruiting bodydifferentiation” (37). FVFD16 and two FVFD16 homolog-encoding genes (gene 2632 andgene 543) were downregulated in response to pdd1 silencing, based on the RNA-seqdata (Data Set S1) and on further confirmation by qPCR, using �-actin and gpd as thereference genes, respectively (Fig. 9C; see also Fig. S2).

DISCUSSIONThe PDD1 gene could be an important reference gene for mushroom breeding.

Although some transcription factors with regulatory function in basidioma develop-ment have been found in studies of the two model species S. commune and C. cinerea,some of their orthologs in industrially cultivated mushrooms did not display expressionpatterns correlating with basidioma development, suggesting that fungi in the phylumBasidiomycota have diverse regulatory mechanisms in basidioma development. Here,from one of the most widely cultivated basidiomycete fungi, F. velutipes (9), weidentified the HMG-box-containing transcription factor PDD1 as a novel regulator ofbasidioma development on the basis of the following lines of evidence: (i) transcriptionof pdd1 was highly induced during the development of basidiomata; (ii) pdd1 overex-pression promoted the development of basidiomata and shortened the cultivationtime, while the basidioma development was dramatically impaired by pdd1 knock-down; and (iii) some genes, related to basidioma development, were positively regu-lated by PDD1. When the transcription level of pdd1 was increased 5-fold by geneoverexpression, the cultivation time was able to be shortened by 4 days (9.8%) and theyield could be increased by at least 33%. The yield increase should be mainly attrib-utable to the increases in the number and the height of basidiomata. Commercialcultivation of F. velutipes requires maintaining a lower temperature during basidiomadevelopment, and the cost for cooling the growth chambers is very high. The shortercultivation time will reduce the production cost. As the pdd1 overexpression straindevelops faster than the wild type and its harvesting time in this study was later thanits optimal time, the increase in yield should not be as high as the level in the data fromour experiment under the real commercial production conditions. Nevertheless, in-creases in the number and height of basidiomata should definitely increase yield andPDD1 could be an important reference gene for mushroom breeding.

PDD1 is a novel transcription factor in mushrooms. PDD1 is a transcription factorwith a HMG-box domain. HMG-box-domain-containing proteins are abundant in eu-karyotes (43). The members of this group of proteins are involved in diverse biologicalprocesses, such as sex determination (44, 45), cell differentiation (46, 47), and stressresponses (48, 49). Two HMG-box-containing proteins involved in mushroom basidi-oma development, Pcc1 and Exp1, have been found in C. cinerea (28–30). Our phylo-genetic analysis performed with amino acid sequences in the HMG-box motif demon-strated that PDD1 is not an ortholog of either Pcc1 or Exp1. Although both Pcc1 andPDD1 are members of the family of MATA_HMG-box proteins, they are distributed intotwo different clades. Thus, the orthologs of PDD1, Pcc1, and Exp1 cluster in threedifferent clades. Both Pcc1 and Exp1 have their own orthologs in F. velutipes, and thePDD1 ortholog is also present in C. cinerea (Fig. 3). In addition, Pcc1 and Exp1 differ

PDD1 Controls Development and Yield of Winter Mushroom Applied and Environmental Microbiology

December 2019 Volume 85 Issue 24 e01735-19 aem.asm.org 11

on July 17, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

from PDD1 in their expression patterns and in their regulated developmental stagesduring basidioma development (15, 16, 28, 30). Thus, they should play different roles inbasidioma development.

To date, only three PDD1 homologs have been previously reported in fungi of theBasidiomycota phylum, including Prf1 in U. maydis and Hgr1 and Hgr2 in C. neoformans(50, 51). PDD1 displays 30% amino acid identity with the first homolog, Prf1 (38%coverage), and they share 34.78% identity in their HMG-box domain regions (93%coverage) by protein BLAST (52). The other two homologs are Hgr1 and Hgr2 in C.neoformans (50). PDD1 displays 30.66% amino acid identity with the entire sequence ofHgr1 (58% coverage), and they share 37.5% identity in their HMG-box domain regions(100% coverage). PDD1 displays 30.92% amino acid identity with the entire sequenceof Hgr2 (55% coverage), and they share 34.72% identity in their HMG-box domainregions (100% coverage). Interestingly, these PDD1 homologs are all involved in sexualdevelopment. Prf1 is required for basal transcriptional responses to pheromones in U.maydis (53). Hgr1 and Hgr2 are required in filamentation and spore production in thesexual development of C. neoformans, respectively (50). Thus, although the level ofidentity between PDD1 and each of these known proteins is low, there might be somefunctional similarity.

Nevertheless, the roles of PDD1 homologs in basidioma development were notpreviously reported. Thus, PDD1 is a novel regulator in basidioma development in thephylum Basidiomycota.

PDD1 might play a more important role in basidioma development than otherHMG-box-containing proteins. In F. velutipes, there are 26 genes encoding HMG-box-containing proteins (see Data Set S2 in the supplemental material). Among thesepredicted HMG-box-containing proteins, only 8 have nuclear localization signals. Basedon our RNA-seq analysis, only four of them showed a dramatic transcriptional responseto the treatment inducing basidioma development, and pdd1 is the most highlyupregulated gene (15, 16). Therefore, PDD1 might be important for basidioma devel-opment in F. velutipes.

The regulatory mechanisms of PDD1 in basidioma development. This studyrevealed the mechanisms by which PDD1 regulates basidioma development. First,PDD1 likely controls basidioma development through regulating the expression ofgenes encoding jacalin-related lectins. In Sclerotium rolfsii, the interaction of lectin withthe cell wall-associated putative endogenous receptor promotes the aggregation ofmycelia to form sclerotial bodies (54). In F. velutipes, jacalin-related lectin-encodinggene Fv-JRL1 and the two corresponding homolog-encoding genes were upregulateddramatically at the primordium formation stage. Fv-JRL1 promotes hyphal growth andbasidioma development (39). Lectin-encoding genes have also been previously shownto be associated with basidioma development in several other fungi (55). Production oflectins might help the aggregation of mycelia for basidioma formation. The failure inprimordium formation in the pdd1 knockdown mutant pdd1RNAi#64 might have beendue to a reduction in lectin production. Second, PDD1 might exert its influence onbasidioma development through regulating a pheromone pathway. The response byspecific pheromone receptors to pheromone triggers the formation of dikaryons (56)and initiates the formation of basidiomata in fungi of the Basidiomycota phylum (57).Regulation of these genes suggests a role for PDD1 in the mating process. The PDD1homolog Prf1 in U. maydis regulates mating by activating the expression ofpheromone-inducible genes (51, 53, 58). Thus, PDD1 might play a role similar to thatplayed by Prf1 in the mating system through regulating the pheromone response.During basidioma development, their transcript levels were increased (15, 16), suggest-ing their involvement in basidioma formation, and PDD1 might control the basidiomadevelopment by regulating the expression of these genes. In addition, PDD1 mightpromote basidioma development by activating the expression of FVFD16 and itshomologs. FVFD16 has a transcriptional profile correlating with basidioma differentia-tion (37). The downregulated expression of FVFD16 and its homologs in response to

Wu et al. Applied and Environmental Microbiology

December 2019 Volume 85 Issue 24 e01735-19 aem.asm.org 12

on July 17, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

pdd1 knockdown suggests their involvement in PDD1-regulated mechanisms. In addi-tion to the genes described above, PDD1 also regulates many other genes withunknown function, which might also influence basidioma development.

MATERIALS AND METHODSStrains and media. Dikaryotic strain F19 and monokaryotic strain L11 of F. velutipes and binary

vector pBHg-BCA1 were provided by Fujian Edible Fungi Germplasm Resource Collection Center of China(15, 16). F. velutipes strains were routinely maintained on CYM medium (0.2% [wt/vol] yeast extract, 0.2%[wt/vol] tryptone, 1% [wt/vol] maltose, and 2% [wt/vol] glucose) at 25°C (59). The composted sawdustsubstrate, which contained 52.5% cottonseed hulls, 25% wheat bran, 15% sawdust, 5% corn flour, 2%gypsum, and 0.5% ground limestone, was adjusted to a total moisture content of 61% and used toproduce basidiomata (16). Escherichia coli DH5� was used for propagation of plasmids, and Agrobacte-rium tumefaciens AGL-1 was used for transferring the plasmids into F. velutipes.

Identification of pdd1 in F. velutipes. The sequence of the pdd1 gene was obtained from thegenome of F. velutipes monokaryotic strain L11 (GenBank accession no. MG264427; BioProject 191865).

Sequence alignments and phylogenetic analyses. The amino acid sequences of the HMG-boxcontained in F. velutipes were predicted from the genome of monokaryotic strain L11 (data not shown),and the other protein sequences were obtained from the NCBI database (60). The HMG-box motifsequences of HMG-box-containing proteins were extracted using CDD (32) and aligned using Clustal X1.83 (61). The maximum-likelihood tree was then constructed using IQ-TREE (62).

Plasmid construction and fungal transformation. Binary vector pBHg-BCA1 was used to constructthe pdd1 overexpression plasmid and the RNAi plasmid. Schematic representations of pdd1 overexpres-sion and RNAi constructs are shown in Fig. 4A and B, respectively. In both plasmids, the promoter ofglyceraldehyde-3-phosphate dehydrogenase-encoding gene gpd (Pgpd) and the terminator of indole-3-glycerol phosphate synthase-encoding gene trpC (TtrpC) were used to control expression of pdd1 orthe sense and antisense sequences of pdd1 (33–35).

For constructing the overexpression plasmid, Pgpd and TtrpC were first amplified by PCR with primerpairs Pgpd-F/R and TtrpC-F/R from the genomic DNA of strain L11 and plasmid pCSN44 (Fungal GeneticsStock Center, www.fgsc.net/; University of Kansas Medical Center), respectively. The open reading frameof pdd1 (1,204 bp) was then amplified by PCR with primers pdd1-F and pdd1-R from the genomic DNAof strain L11. These three fragments were inserted into pBHg-BCA1 by homologous recombination(ClonExpress MultiS one-step cloning kit; Vazyme, Nanjing, China). The obtained overexpression plasmidwas designated pdd1-OE.

To construct the pdd1 RNAi plasmid, Pgpd and TtrpC were first obtained as described above. Then a491-bp antisense sequence of pdd1 was amplified from F. velutipes L11 by PCR with primers pdd1-antisense-F and pdd1-antisense-R. The three fragments described above were inserted into pBHg-BCA1to form vector pre-pdd1-RNAi. After that, the sense sequence linked with the spacer (540 bp) wasamplified from F. velutipes L11 by PCR with primers pdd1-sense-F and pdd1-sense-R, digested usingBamHI (New England Biolabs, Beverly, MA, USA), and ligated into pre-pdd1-RNAi to form the finalpdd1-RNAi vector. This construct was used to generate a double-stranded RNA (hairpin), which wascomprised of two 491-bp complementary regions (sense sequence and antisense sequence) separatedby a 49-bp spacer fragment (the intron adjacent to the second exon of pdd1) to induce the degradationof target mRNA (36). The primers used in vector construction are shown in Table 1.

The two plasmids pdd1-OE and pdd1-RNAi were transformed into F. velutipes dikaryotic strain F19 viaA. tumefaciens-mediated transformation according to the previously reported protocol (59, 63), withminor modification. First, the A. tumefaciens strains containing pdd1-OE or pdd1-RNAi were coincubatedwith a F. velutipes mycelial pellet (FMP) in the inducing medium (59, 63) for 6 h at 25°C. The FMPs were

TABLE 1 Primers for plasmid construction

Primer Sequence (5= to 3=) Purpose

Pgpd-F CAGATCCCCCGAATTATTCGAGCTCGGTACAGTCGTG Amplification of Pgpd fragment used in pdd1 overexpressionand RNAi plasmidsPgpd-R AGAAAGAGTGGACCTGTAAAATGGTGAGCAAGAC

pdd1-F TTTACAGGTCCACTCTTTCTCAGCCTACTACGACCA Amplification of pdd1 fragment used in pdd1 overexpressionplasmidspdd1-R AAGTGGATCCTCAAAATGCAAGGCCACTACCT

TtrpC-F TGCATTTTGAGGATCCACTTAACGTTACTGAAATCA Amplification of TtrpC fragment used in pdd1overexpression and RNAi plasmidsTtrpC-R AATTAACGCCGAATTCATGCCTGCAGGTCGAGAAAG

pdd1-antisense-F CATTTTACAGGTCATGGGCCCATGTTCCAAGTCGGGTTTAAAGGC Amplification of pdd1 antisense fragment for theconstruction of pre-pdd1-RNAipdd1-antisense-R GAGGACTTACCGTCAAGAAAGAACCCACCGTTG

pdd1-sense-F TTTCTTGACGGTAAGTCCTCACTTCATCGTCTCGATG Amplification of pdd1 sense fragment linked with the spacerfor the construction of pdd1-RNAipdd1-sense-R CAGTAACGTTAAGTGGATCCATGTTCCAAGTCGGGTTTAAAGGC

Pgpd-detect-F AACCGCCATCTTCCACACTT Verification of the two entire constructions Pgpd-pdd1OE-TtrpC and Pgpd-pdd1RNAi-TtrpCTtrpC-detect-F AACACCATTTGTCTCAACTCCG

PDD1 Controls Development and Yield of Winter Mushroom Applied and Environmental Microbiology

December 2019 Volume 85 Issue 24 e01735-19 aem.asm.org 13

on July 17, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

obtained by cutting the mycelia grown on CYM media into small plugs with a hole punch (diame-ter � 5 mm). Second, after cocultivation, the treated FMPs were washed with the inducing medium threetimes to remove A. tumefaciens and then transferred onto CYM selection medium containing 12.5 �gml�1 hygromycin B and 300 mM cefotaxime. The plates were incubated at 25°C for 2 to 3 weeks untilcolonies of transformants formed. The transformants were then transferred onto CYM medium contain-ing 25 �g ml�1 hygromycin B eight times. The transformants were verified by PCR with primersPgpd-detect-F and TtrpC-detect-R. The primers used for transformant verification are shown in Table 1.

Total DNA extraction. DNA was extracted from F. velutipes mycelia, which were cultured oncellophane-covered CYM agar at 25°C for 7 days, using a modified CTAB (cetyltrimethylammoniumbromide) approach (64).

Measurement of hyphal growth rate. The mycelia plug (diameter � 5 mm), which was punchedfrom the wild-type strain or the pdd1 mutants, was inoculated onto the center of the CYM plates(diameter � 60 mm) and grown at 25°C. After 3 days of growth, the colony edge was marked as theorigin. The colony edge was then marked every 24 h in the following 4 days, and the hyphal growth ratewas calculated as the average colony extension per day. This experiment was repeated three timesindependently.

Basidioma cultivation and phenotypic analysis of mutants. The basidioma cultivation wasperformed according to previously reported methods (21, 65) with minor modification. The mycelialplugs (diameter � 5 mm), which were punched from the wild-type strain or the pdd1 mutants, wereinoculated on the CYM plates (diameter � 60 mm) and cultured at 25°C for 5 days. After 5 days, a colonyfrom half of a CYM plate was cut into small squares (side length � 5 mm) and inoculated into a culturevessel containing 150 � 5 g (wet weight) composted sawdust substrate. The vessels were incubated at25°C and 60% humidity in the dark. After 19 days, when the mycelia of all strains completely occupiedthe culture vessel, the mycelial mat on the surface of the medium was scraped by the use of a sterilizedscalpel. Basidioma development was then induced by shifting the cultivation condition to a lowertemperature (15°C), higher humidity (95%), and constant light exposure. This condition was maintaineduntil the basidiomata were harvested.

To mimic the industrial production of F. velutipes, basidiomata with stipes extending from the vesselwere harvested and their fresh weight was used to record the yield of each vessel. Biological efficiency(BE) was calculated for each strain using the following formula: percent BE � (weight of fresh basidi-omata/weight of dry substrate) � 100 (66, 67). All the results were obtained by measuring basidiomataharvested from six vessels for each strain, and the average values were then calculated. The experimentswere independently repeated three times.

RNA extraction. For RNA extraction from mycelia grown on agar plates, mycelial plugs (diame-ter � 5 mm) were inoculated on the center of cellophane-covered CYM agar plates and incubated at 25°Cfor 7 days in the dark. Mycelia were then collected for RNA extraction. Each strain was prepared in threebiological replicates. For RNA extraction from mycelia grown in composted sawdust substrate (SM), themycelia of each strain from 6 vessels were mixed for RNA extraction.

RNA extractions were performed following previously described methods (16). The harvested myceliawere freshly frozen in liquid nitrogen and ground into a fine powder. Total RNA extraction wasperformed according to the standard TRIzol protocol (Invitrogen, Carlsbad, CA, USA). The cDNAs weresynthesized from 2 �g total RNA using a cDNA synthesis kit (FastQuant RT kit [with gDNase]; Tiangen,China) according to the manufacturer’s protocol.

Gene expression analysis by qPCR. RNA extracts from three independent replicates were used forqPCR analysis. qPCR was performed on a CFX96 multicolor real-time PCR detection system (Bio-Rad,Hercules, CA) with SYBR green detection (Kapa SYBR FAST qPCR kits; Kapa Biosystems, Boston, MA, USA)according to the manufacturer’s instructions. Each cDNA sample was analyzed in triplicate, and theaverage threshold cycle (CT) value was calculated. The expression levels of genes were normalized tothe expression level of �-actin or gpd in F. velutipes. Relative expression levels were calculated usingthe 2�ΔΔCT threshold cycle calculation (68). The significance of the differences between two sampleswas evaluated by an unpaired two-tailed Student’s t test using GraphPad Prism 7.0, and a P valueof less than 0.05 was considered to represent significance. Gene-specific primers used for qPCR areshown in Table 2.

RNA sequencing. RNA was extracted on day 26, 1 day before primordium appearance for the wildtype, from mixed mycelia from six vessels containing composted sawdust substrate (SM) as the growthmedium.

The transcriptomic profiles of the wild-type (WT) strain and the pdd1 knockdown strain (pdd1RNAi#64)were comparatively analyzed by RNA sequencing (RNA-seq). The cDNA library was constructed using anRNA Library Prep kit for Illumina (NEB, USA) and was assessed by the use of an Agilent Bioanalyzer 2100system. The two samples (WT_SM and pdd1RNAi_64_SM) were sequenced using the BGIseq-500RSplatform (Beijing Genomics Institute, Wuhan, China).

After sequencing, each sample on average generated 24,081,093 clean reads after filtering low-quality ones, and these reads were mapped to the genome of strain L11 (GenBank accession no.APIA00000000; BioProject 191865) using HISAT (69) and Bowtie2 (70) tools. Gene expression levels wereestimated by the use of RNA-seq by expectation-maximization (RSEM), and the normalized number oftranscript fragments per kilobase per million (FPKM) mapped reads was calculated. The transcript levelof a gene was determined by calculating the FPKM, and those with a FPKM value of less than 5 in allsamples were regarded as low-expression-level genes and excluded from the study. GO (Gene Ontology;http://www.geneontology.org) and KEGG (Kyoto Encyclopedia of Genes and Genomes; https://www.genome.jp/kegg/) were used in the gene function annotation.

Wu et al. Applied and Environmental Microbiology

December 2019 Volume 85 Issue 24 e01735-19 aem.asm.org 14

on July 17, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

Genes with log2|fold change| levels of �1.0 and FDR (false-discovery-rate) values of �0.001 incomparisons between the wild-type strain and pdd1 knockdown mutant pdd1RNAi#64 were considered tobe differentially expressed. For confirming the RNA-seq data, the transcript levels of randomly selectedgenes in WT_SM and pdd1RNAi_64_SM were verified by qPCR on a CFX96 multicolor real-time PCRdetection system (Bio-Rad, Hercules, CA) and a SYBR green detection system (Kapa SYBR Fast qPCR kits;Kapa Biosystems, Boston, MA, USA), respectively, according to the manufacturer’s instructions.

SUPPLEMENTAL MATERIALSupplemental material for this article may be found at https://doi.org/10.1128/AEM

.01735-19.SUPPLEMENTAL FILE 1, PDF file, 0.8 MB.SUPPLEMENTAL FILE 2, XLSX file, 0.1 MB.

ACKNOWLEDGMENTSThis work was supported by a grant from the National Key Basic Research Program

of China (2014CB138302 to S.L.).We declare that we have no conflicts of interests in relation to the work described.

TABLE 2 Primers for qPCR

Primer Sequence (5= to 3=) TargetSize of thetarget (bp)

Q-FvActin-F CACCATGTTCCCTGGTATTG �-actin 106Q-FvActin-R CACCAATCCAGACAGAGTATTT

Q-Fvgpd-F CACGACAAGTTCGGTATTG gpd 142Q-Fvgpd-R CAGTCGAGGAAGGAATGA

Q-pdd1-F TCAGCAATGCGTCTGACACG pdd1 120Q-pdd1-R CGTTCATGTTCCAAGTCGGGT

Q-Fv-JRL1-F CTGACAAAGGCAGAGTAAC Fv-JRL1 142Q-Fv-JRL1-R CCTTGACGATGGAGATAGA

Q-gene10415-F TGTCATCAAAGAGTCGGATA Gene 10145 129Q-gene10415-R TTGACGAGGGAGAGAGA

Q-gene10856-F AGGGCTGTCATCAAAGAG Gene 10856 129Q-gene10856-R GAGAGAGAGAGAGGTGAGA

Q-FVFD16-F AGGTTGCTGCTGTTAGT FVFD16 103Q-FVFD16-R AACAGGAGGAGTGTGATG

Q-gene543-F GACATCGTCAAGAACATCAA Gene 543 122Q-gene543-R AATCCCGGAACCAAGAA

Q-gene2632-F CCTCCTGTTCAACCTGAT Gene 2632 104Q-gene2632-R TGACCGTAAGAAGAACCC

Q-FvSTE3.s4-F GCTGACATTGCCTTCAC FvSTE3.s4 134Q-FvSTE3.s4-R AGGGAAGCGGGAATAAG

Q-FvSTE3.1-F CCTTTGCTGCCCATTTAG FvSTE3.1 132Q-FvSTE3.1-R CCGATGCTGTGTATGAAAG

Q-FvSTE3.5-F AGATCTGGCGTGGTATTT FvSTE3.5 129Q-FvSTE3.5-R CCTTCCGGTAATTCTTCTTG

Q-FvSTE3.s6-F GCAAAGCCATCTACCAAG FvSTE3.s6 125Q-FvSTE3.s6-R GCCTGTGGAGAACTAAGA

Q-FvSTE3.s5-F CGTTCTCGTTTGCTGATG FvSTE3.s5 114Q-FvSTE3.s5-R TCGGATGAAGATGAGGTATG

Q-FvSTE3.s3-F GTCTTCGGTGGTTACAAAG FvSTE3.s3 135Q-FvSTE3.s3-R CTCGACACCTGTTTCTTAAC

PDD1 Controls Development and Yield of Winter Mushroom Applied and Environmental Microbiology

December 2019 Volume 85 Issue 24 e01735-19 aem.asm.org 15

on July 17, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

REFERENCES1. Wasser SP. 2017. Medicinal mushrooms in human clinical studies. Part I.

Anticancer, oncoimmunological, and immunomodulatory activities: areview. Int J Med Mushrooms 19:279 –317. https://doi.org/10.1615/IntJMedMushrooms.v19.i4.10.

2. Ren L, Perera C, Hemar Y. 2012. Antitumor activity of mushroompolysaccharides: a review. Food Funct 3:1118 –1130. https://doi.org/10.1039/c2fo10279j.

3. Boa E. 2004. Wild edible fungi: a global overview of their use andimportance to people. Food and Agriculture Organization of the UnitedNations, Rome, Italy.

4. Chang S-T, Miles PG. 2004. Mushrooms: cultivation, nutritional value,medicinal effect, and environmental impact, 2nd ed. CRC Press, BocaRaton, FL.

5. Morin E, Kohler A, Baker AR, Foulongne-Oriol M, Lombard V, Nagy LG,Ohm RA, Patyshakuliyeva A, Brun A, Aerts AL, Bailey AM, Billette C,Coutinho PM, Deakin G, Doddapaneni H, Floudas D, Grimwood J, HildénK, Kües U, LaButti KM, Lapidus A, Lindquist EA, Lucas SM, Murat C, RileyRW, Salamov AA, Schmutz J, Subramanian V, Wösten HAB, Xu J, East-wood DC, Foster GD, Sonnenberg ASM, Cullen D, de Vries RP, Lundell T,Hibbett DS, Henrissat B, Burton KS, Kerrigan RW, Challen MP, GrigorievIV, Martin F. 2013. Genome sequence of the button mushroom Agaricusbisporus reveals mechanisms governing adaptation to a humic-rich eco-logical niche. Proc Natl Acad Sci U S A 110:4146 – 4148. https://doi.org/10.1073/pnas.1206847109.

6. Wang M, Gu B, Huang J, Jiang S, Chen Y, Yin Y, Pan Y, Yu G, Li Y, WongBHC, Liang Y, Sun H. 2013. Transcriptome and proteome exploration toprovide a resource for the study of Agrocybe aegerita. PLoS One8:e56686. https://doi.org/10.1371/journal.pone.0056686.

7. Ohm RA, de Jong JF, de Bekker C, Wösten HAB, Lugones LG. 2011.Transcription factor genes of Schizophyllum commune involved in regu-lation of mushroom formation. Mol Microbiol 81:1433–1445. https://doi.org/10.1111/j.1365-2958.2011.07776.x.

8. Ohm RA, de Jong JF, Lugones LG, Aerts A, Kothe E, Stajich JE, de Vries RP,Record E, Levasseur A, Baker SE, Bartholomew KA, Coutinho PM, Erd-mann S, Fowler TJ, Gathman AC, Lombard V, Henrissat B, Knabe N, KüesU, Lilly WW, Lindquist E, Lucas S, Magnuson JK, Piumi F, Raudaskoski M,Salamov A, Schmutz J, Schwarze F, vanKuyk PA, Horton JS, Grigoriev IV,Wösten HAB. 2010. Genome sequence of the model mushroom Schizo-phyllum commune. Nat Biotechnol 28:957–963. https://doi.org/10.1038/nbt.1643.

9. Royse DJ, Baars J, Tan Q. 2017. Edible and medicinal mushrooms:technology and applications. John Wiley & Sons Ltd, Chichester, UnitedKingdom.

10. Matheny PB, Curtis JM, Hofstetter V, Aime MC, Moncalvo J-M, Ge Z-W,Yang Z-L, Slot JC, Ammirati JF, Baroni TJ, Bougher NL, Hughes KW, Lodge DJ,Kerrigan RW, Seidl MT, Aanen DK, DeNitis M, Daniele GM, Desjardin DE,Kropp BR, Norvell LL, Parker A, Vellinga EC, Vilgalys R, Hibbett DS. 2006.Major clades of Agaricales: a multilocus phylogenetic overview. Mycologia98:982–995. https://doi.org/10.1080/15572536.2006.11832627.

11. Chang S-T. 2008. Overview of mushroom cultivation and utilization asfunctional foods, p 1–33. In Cheung PCK (ed), Mushrooms as functionalfoods. Wiley and Sons, Inc, New York, NY.

12. Srivilai P, Loutchanwoot P. 2009. Coprinopsis cinerea as a model fungusto evaluate genes underlying sexual development in basidiomycetes.Pak J Biol Sci 12:821– 835. https://doi.org/10.3923/pjbs.2009.821.835.

13. Pelkmans JF, Lugones LG, Wösten HAB (ed). 2015. Fruiting body forma-tion in basidiomycetes. Springer Science & Business Media, Berlin, Ger-many.

14. Simchen G. 1966. Fruiting and growth rate among dikaryotic progeny ofsingle wild isolates of Schizophyllum commune. Genetics 53:1151–1165.

15. Liu F, Wang W, Chen B-Z, Xie B-G. 2015. Homocitrate synthase expres-sion and lysine content in fruiting body of different developmentalstages in Flammulina velutipes. Curr Microbiol 70:821– 828. https://doi.org/10.1007/s00284-015-0791-0.

16. Wang W, Liu F, Jiang Y, Wu G, Guo L, Chen R, Chen B, Lu Y, Dai Y, Xie B.2015. The multigene family of fungal laccases and their expression in thewhite rot basidiomycete Flammulina velutipes. Gene 563:142–149.https://doi.org/10.1016/j.gene.2015.03.020.

17. Wang Y, Bao L, Liu D, Yang X, Li S, Gao H, Yao X, Wen H, Liu H. 2012. Twonew sesquiterpenes and six norsesquiterpenes from the solid culture of

the edible mushroom Flammulina velutipes. Tetrahedron 68:3012–3018.https://doi.org/10.1016/j.tet.2012.02.021.

18. Wang Y, Bao L, Yang X, Li L, Li S, Gao H, Yao X, Wen H, Liu H. 2012.Bioactive sesquiterpenoids from the solid culture of the edible mush-room Flammulina velutipes growing on cooked rice. Food Chem 132:1346 –1353. https://doi.org/10.1016/j.foodchem.2011.11.117.

19. Wang Y, Bao L, Yang X, Guo H, Dai H, Gao H, Yao X, Zhang L, Liu H. 2012.New cuparene-type sesquiterpenes from Flammulina velutipes. HelvChim Acta 95:261–267. https://doi.org/10.1002/hlca.201100289.

20. Tao Q, Ma K, Yang Y, Wang K, Chen B, Huang Y, Han J, Bao L, Liu X, YangZ, Yin W, Liu H. 2016. Bioactive sesquiterpenes from the edible mush-room Flammulina velutipes and their biosynthetic pathway confirmed bygenome analysis and chemical evidence. J Org Chem 81:9867–9877.https://doi.org/10.1021/acs.joc.6b01971.

21. Park Y-J, Baek JH, Lee S, Kim C, Rhee H, Kim H, Seo J-S, Park H-R, YoonD-E, Nam J-Y, Kim H-I, Kim J-G, Yoon H, Kang H-W, Cho J-Y, Song E-S,Sung G-H, Yoo Y-B, Lee C-S, Lee B-M, Kong W-S. 2014. Whole genomeand global gene expression analyses of the model mushroom Flam-mulina velutipes reveal a high capacity for lignocellulose degradation.PLoS One 9:e93560. https://doi.org/10.1371/journal.pone.0093560.

22. Okamoto T, Yamada M, Sekiya S, Okuhara T, Taguchi G, Inatomi S,Shimosaka M. 2010. Agrobacterium tumefaciens-mediated transforma-tion of the vegetative dikaryotic mycelium of the cultivated mushroomFlammulina velutipes. Biosci Biotechnol Biochem 74:2327–2329. https://doi.org/10.1271/bbb.100398.

23. Kim JK, Park YJ, Kong WS, Kang HW. 2010. Highly efficientelectroporation-mediated transformation into edible mushroomFlammulina velutipes. Mycobiology 38:331–335. https://doi.org/10.4489/MYCO.2010.38.4.331.

24. Shi L, Chen D, Xu C, Ren A, Yu H, Zhao M. 2 May 2017, posting date.Highly-efficient liposome-mediated transformation system for the ba-sidiomycetous fungus Flammulina velutipes. J Gen Appl Microbiolhttps://doi.org/10.2323/jgam.2016.10.003.

25. Letunic I, Doerks T, Bork P. 2015. SMART: recent updates, new develop-ments and status in 2015. Nucleic Acids Res 43:D257–D260. https://doi.org/10.1093/nar/gku949.

26. Letunic I, Bork P. 2018. 20 years of the SMART protein domain annota-tion resource. Nucleic Acids Res 46:D493–D496. https://doi.org/10.1093/nar/gkx922.

27. Kosugi S, Hasebe M, Tomita M, Yanagaw H. 2009. Systematic identifica-tion of cell cycle-dependent yeast nucleocytoplasmic shuttling proteinsby prediction of composite motifs. Proc Natl Acad Sci U S A 106:10171–10176. https://doi.org/10.1073/pnas.0900604106.

28. Murata Y, Fujii M, Zolan ME, Kamada T. 1998. Molecular analysis of pcc1,a gene that leads to A-regulated sexual morphogenesis in Coprinuscinereus. Genetics 149:1753–1761.

29. Murata Y, Kamada T. 2009. Identification of new mutant alleles of pcc1in the homobasidiomycete Coprinopsis cinerea. Mycoscience 50:137–139. https://doi.org/10.1007/S10267-008-0454-0.

30. Muraguchi H, Fujita T, Kishibe Y, Konno K, Ueda N, Nakahori K, YanagiSO, Kamada T. 2008. The exp1 gene essential for pileus expansion andautolysis of the inky cap mushroom Coprinopsis cinerea (Coprinus ci-nereus) encodes an HMG protein. Fungal Genet Biol 45:890 – 896. https://doi.org/10.1016/j.fgb.2007.11.004.

31. Soullier S, Jay P, Poulat F, Vanacker J-M, Berta P, Laudet V. 1999.Diversification pattern of the HMG and SOX family members duringevolution. J Mol Evol 48:517–527. https://doi.org/10.1007/pl00006495.

32. Marchler-Bauer A, Bo Y, Han L, He J, Lanczycki JC, Lu S, Chitsaz F,Derbyshire MK, Geer RC, Gonzales NR, Gwadz M, Hurwitz DI, Lu F,Marchler GH, Song JS, Thanki N, Wang Z, Yamashita RA, Zhang D, ZhengC, Geer LY, Bryant SH. 2017. CDD/SPARCLE: functional classification ofproteins via subfamily domain architectures. Nucleic Acids Res 45:D200 –D203. https://doi.org/10.1093/nar/gkw1129.

33. Kuo C-Y, Chou S-Y, Huang C-T. 2004. Cloning of glyceraldehyde-3-phosphate dehydrogenase gene and use of the gpd promoter fortransformation in Flammulina velutipes. Appl Microbiol Biotechnol 65:593–599. https://doi.org/10.1007/s00253-004-1635-1.

34. Sekiya S, Yamada M, Shibata K, Okuhara T, Yoshida M, Inatomi S, TaguchiG, Shimosaka M. 2013. Characterization of a gene coding for a putativeadenosine deaminase-related growth factor by RNA interference in the

Wu et al. Applied and Environmental Microbiology

December 2019 Volume 85 Issue 24 e01735-19 aem.asm.org 16

on July 17, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

basidiomycete Flammulina velutipes. J Biosci Bioeng 115:360 –365.https://doi.org/10.1016/j.jbiosc.2012.10.020.

35. Kim S, Ha B-S, Ro H-S. 2015. Current technologies and related issuesfor mushroom transformation. Mycobiology 43:1– 8. https://doi.org/10.5941/MYCO.2015.43.1.1.

36. Hannon GJ. 2002. RNA interference. Nature 418:244 –251. https://doi.org/10.1038/418244a.

37. Kim D-Y, Azuma T-N. 1999. Cloning of a gene specifically expressedduring early stage of fruiting body formation in Flammulina velutipes.Korean J Mycol 27:187–190. http://www.koreascience.or.kr/article/JAKO199903040131785.page.

38. Wang W, Lian L, Xu P, Chou T, Mukhtar I, Osakina A, Waqas M, Chen B,Liu X, Liu F, Xie B, van Peer AF. 2016. Advances in understanding matingtype gene organization in the mushroom forming fungus Flammulinavelutipes. G3 (Bethesda) 6:3635–3645. https://doi.org/10.1534/g3.116.034637.

39. Lu YP, Chen RL, Long Y, Li X, Jiang YJ, Xie BG. 2016. A jacalin-relatedlectin regulated the formation of aerial mycelium and fruiting body inFlammulina velutipes. Int J Mol Sci 17:1884 –1810. https://doi.org/10.3390/ijms17121884.

40. Maia TM, Lopes ST, Almeida J, Rosa LH, Sampaio JP, Gonçalves P, CoelhoMA. 2015. Evolution of mating systems in basidiomycetes and thegenetic architecture underlying mating-type determination in theyeast Leucosporidium scottii. Genetics 201:75– 89. https://doi.org/10.1534/genetics.115.177717.

41. Kües U. 2015. From two to many: multiple mating types in Basidiomy-cetes. Fungal Biol Rev 29:126 –166. https://doi.org/10.1016/j.fbr.2015.11.001.

42. Raudaskoski M, Kothe E. 2010. Basidiomycete mating type genes andpheromone signaling. Eukaryot Cell 9:847– 859. https://doi.org/10.1128/EC.00319-09.

43. Bustin M. 2001. Revised nomenclature from high mobility group (HMG)chromosomal proteins. Trends Biochem Sci 26:152–153. https://doi.org/10.1016/s0968-0004(00)01777-1.

44. Jiang T, Hou C-C, She Z-Y, Yang W-X. 2013. The SOX gene family:function and regulation in testis determination and male fertility main-tenance. Mol Biol Rep 40:2187–2194. https://doi.org/10.1007/s11033-012-2279-3.

45. Bergstrom DE, Young M, Albrecht KH, Eicher EM. 2000. Related functionof mouse SOX3, SOX9, and SRY HMG domains assayed by male sexdetermination. Genesis 28:111–124. https://doi.org/10.1002/1526-968X(200011/12)28:3/4�111::AID-GENE40�3.0.CO;2-5.

46. Nemeth MJ, Curtis DJ, Kirby MR, Garrett-Beal LJ, Seidel NE, Cline AP, BodineDM. 2003. Hmgb3: an HMG-box family member expressed in primitivehematopoietic cells that inhibits myeloid and B-cell differentiation. Blood102:1298–1306. https://doi.org/10.1182/blood-2002-11-3541.

47. Koopman P. 2010. HMG domain superfamily of DNA-bendingproteins: HMG, UBF, TCF, LEF, SOX, SRY and related proteins. eLS.John Wiley & Sons Ltd, Chichester, United Kingdom. https://doi.org/10.1002/9780470015902.a0002325.pub2.

48. Kwak KJ, Kim JY, Kim YO, Kang H. 2007. Characterization of transgenicArabidopsis plants overexpressing high mobility group B proteins underhigh salinity, drought or cold stress. Plant Cell Physiol 48:221–231.https://doi.org/10.1093/pcp/pcl057.

49. Antosch M, Mortensen SA, Grasser KD. 2012. Plant proteins containinghigh mobility group box DNA-binding domains modulate different nu-clear processes. Plant Physiol 159:875– 883. https://doi.org/10.1104/pp.112.198283.

50. Mead ME. 2015. Unraveling the transcription network regulating sexualdevelopment in the human fungal pathogen Cryptococcus neoformans.PhD thesis. University of Wisconsin—Madison, Madison, WI.

51. Hartmann HA, Krüger J, Lottspeich F, Kahmann R. 1999. Environmentalsignals controlling sexual development of the corn smut fungus Ustilagomaydis through the transcriptional regulator Prf1. Plant Cell 11:1293–1305. https://doi.org/10.1105/tpc.11.7.1293.

52. Johnson M, Zaretskaya I, Raytselis Y, Merezhuk Y, McGinnis S, Madden

TL. 2008. NCBI BLAST: a better Web interface. Nucleic Acids Res 36:W5–W9. https://doi.org/10.1093/nar/gkn201.

53. Hartmann HA, Kahmann R, Bolker M. 1996. The pheromone responsefactor coordinates filamentous growth and pathogenicity in Ustilagomaydis. EMBO J 15:1632–1641. https://doi.org/10.1002/j.1460-2075.1996.tb00508.x.

54. Swamy BM, Bhat AG, Hegde GV, Naik RS, Kulkarni S, Inamdar SR. 2004.Immunolocalization and functional role of Sclerotium rolfsii lectin indevelopment of fungus by interaction with its endogenous receptor.Glycobiology 14:951–957. https://doi.org/10.1093/glycob/cwh130.

55. Luan R, Liang Y, Chen Y, Liu H, Jiang S, Che T, Wong B, Sun H. 2010.Opposing developmental functions of Agrocybe aegerita galectin (AAL)during mycelia differentiation. Fungal Biol 114:599 – 608. https://doi.org/10.1016/j.funbio.2010.05.001.

56. Fowler TJ, Mitton MF, Rees EI, Raper CA. 2004. Crossing the boundarybetween the B� and B� mating-type loci in Schizophyllum commune.Fungal Genet Biol 41:89 –101. https://doi.org/10.1016/j.fgb.2003.08.009.

57. Kothe E. 2001. Mating-type genes for basidiomycete strain improvementin mushroom farming. Appl Microbiol Biotechnol 56:602– 612. https://doi.org/10.1007/s002530100763.

58. Brefort T, Müller P, Kahmann R. 2005. The high-mobility-group domaintranscription factor Rop1 is a direct regulator of prf1 in Ustilago maydis.Eukaryot Cell 4:379 –391. https://doi.org/10.1128/EC.4.2.379-391.2005.

59. Lin Y-J, Huang L-H, Huang C-T. 2013. Enhancement of heterologousgene expression in Flammulina velutipes using polycistronic vectorscontaining a viral 2A cleavage sequence. PLoS One 8:e59099. https://doi.org/10.1371/journal.pone.0059099.

60. NCBI Resource Coordinators. 2017. Database resources of the NationalCenter for Biotechnology Information. Nucleic Acids Res 45:D12–D17.https://doi.org/10.1093/nar/gkw1071.

61. Chenna R, Sugawara H, Koike T, Lopez R, Gibson TJ, Higgins DG, Thomp-son JD. 2003. Multiple sequence alignment with the Clustal series ofprograms. Nucleic Acids Res 31:3497–3500. https://doi.org/10.1093/nar/gkg500.

62. Trifinopoulos J, Nguyen L-T, Haeseler A, Minh BQ. 2016. W-IQ-TREE: a fastonline phylogenetic tool for maximum likelihood analysis. Nucleic AcidsRes 44:W232–W235. https://doi.org/10.1093/nar/gkw256.

63. Chen X, Stone M, Schlagnhaufer C, Romaine CP. 2000. A fruiting bodytissue method for efficient Agrobacterium-mediated transformation ofAgaricus bisporus. Appl Environ Microbiol 66:4510 – 4513. https://doi.org/10.1128/aem.66.10.4510-4513.2000.

64. van Peer AF, Park S-Y, Shin P-G, Jang K-Y, Yoo Y-B, Park Y-J, Lee B-M,Sung G-H, James TY, Kong W-S. 20 July 2011, posting date. Comparativegenomics of the mating-type loci of the mushroom Flammulina velutipesreveals widespread synteny and recent inversions. PLoS One https://doi.org/10.1371/journal.pone.0022249.

65. Kuo C-Y, Chou S-Y, Hseu R-S, Huang C-T. 2010. Heterologous expressionof EGFP in Enoki mushroom Flammulina velutipes. Bot Stud 51:303–309.https://ejournal.sinica.edu.tw/bbas/content/2010/3/Bot513-03.pdf.

66. Harith N, Abdullah N, Sabaratnam V. 2014. Cultivation of Flammulinavelutipes mushroom using various agro-residues as a fruiting substrate.Pesq Agropec Bras 49:181–188. https://doi.org/10.1590/S0100-204X2014000300004.

67. Xie C, Gong W, Yan L, Zhu Z, Hu Z, Peng Y. 2017. Biodegradation oframie stalk by Flammulina velutipes: mushroom production and sub-strate utilization. AMB Express 7:171. https://doi.org/10.1186/s13568-017-0480-4.

68. Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression datausing real-time quantitative PCR and the 2�CT method. Methods25:402– 408. https://doi.org/10.1006/meth.2001.1262.

69. Kim D, Langmead B, Salzberg SL. 2015. HISAT: a fast spliced aligner withlow memory requirements. Nat Methods 12:357–360. https://doi.org/10.1038/nmeth.3317.

70. Langmead B, Trapnell C, Pop M, Salzberg SL. 2009. Ultrafast andmemory-efficient alignment of short DNA sequences to the humangenome. Genome Biol 10:R25–R34. https://doi.org/10.1186/gb-2009-10-3-r25.

PDD1 Controls Development and Yield of Winter Mushroom Applied and Environmental Microbiology

December 2019 Volume 85 Issue 24 e01735-19 aem.asm.org 17

on July 17, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from