agaricus bisporus infected with nosema ceranae
TRANSCRIPT
insects
Article
Effects of Agaricus bisporus Mushroom Extract on Honey BeesInfected with Nosema ceranae
Uros Glavinic 1,* , Milan Rajkovic 1, Jovana Vunduk 2,3 , Branislav Vejnovic 1, Jevrosima Stevanovic 1 ,Ivanka Milenkovic 3 and Zoran Stanimirovic 1
�����������������
Citation: Glavinic, U.; Rajkovic, M.;
Vunduk, J.; Vejnovic, B.; Stevanovic, J.;
Milenkovic, I.; Stanimirovic, Z. Effects
of Agaricus bisporus Mushroom
Extract on Honey Bees Infected with
Nosema ceranae. Insects 2021, 12, 915.
https://doi.org/10.3390/
insects12100915
Academic Editors: Ivana Tlak Gajger
and Franco Mutinelli
Received: 30 August 2021
Accepted: 20 September 2021
Published: 7 October 2021
Publisher’s Note: MDPI stays neutral
with regard to jurisdictional claims in
published maps and institutional affil-
iations.
Copyright: © 2021 by the authors.
Licensee MDPI, Basel, Switzerland.
This article is an open access article
distributed under the terms and
conditions of the Creative Commons
Attribution (CC BY) license (https://
creativecommons.org/licenses/by/
4.0/).
1 Faculty of Veterinary Medicine, University of Belgrade, Bulevar Oslobodjenja 18, 11000 Belgrade, Serbia;[email protected] (M.R.); [email protected] (B.V.); [email protected] (J.S.);[email protected] (Z.S.)
2 Faculty of Agriculture, Institute for Food Technology and Biochemistry, University of Belgrade, Nemanjina 6,11080 Belgrade, Serbia; [email protected]
3 Ekofungi Ltd., Padinska Skela bb, 11000 Belgrade, Serbia; [email protected]* Correspondence: [email protected]
Simple Summary: Nosema ceranae affects honey bee (Apis mellifera L.) causing nosemosis disease thatoften induces serious problems in apiculture. Antibiotic fumagillin is the only licenced treatmentagainst nosemosis, but its effectiveness is questioned and its usage associated with risk of beemortality and appearance of residues in bee products. In search for alternative treatment for thecontrol of nosemosis, water crude extract of Agaricus bisporus was tested on bees in laboratory (cage)experiments. Bee survival and food consumption were monitored together with Nosema infectionlevel and expression of five genes (abaecin, hymenoptaecin, defensin, apidaecin, and vitellogenin)were evaluated in bees sampled on days 7 and 15. Apart from the gene for defensin, the expression ofall tested genes was up-regulated in bees supplemented with A. bisporus extract. Both anti-Nosema andimmune protective effects of A. bisporus extract were observed when supplementation started at themoment of N. ceranae infection or preventively (before or simultaneously with the Nosema infection).
Abstract: Agaricus bisporus water crude extract was tested on honey bees for the first time. Thefirst part of the cage experiment was set for selecting one concentration of the A. bisporus extract.Concentration of 200 µg/g was further tested in the second part of the experiment where bee survivaland food consumption were monitored together with Nosema infection level and expression of fivegenes (abaecin, hymenoptaecin, defensin, apidaecin, and vitellogenin) that were evaluated in beessampled on days 7 and 15. Survival rate of Nosema-infected bees was significantly greater in groupsfed with A. bisporus-enriched syrup compared to those fed with a pure sucrose syrup. Besides,the anti-Nosema effect of A. bisporus extract was greatest when applied from the third day whichcoincides with the time of infection with N. ceranae. Daily food consumption did not differ betweenthe groups indicating good acceptability and palatability of the extract. A. bisporus extract showed astimulative effect on four out of five monitored genes. Both anti-Nosema and nutrigenomic effects ofA. bisporus extract were observed when supplementation started at the moment of N. ceranae infectionor preventively (before or simultaneously with the infection).
Keywords: honey bee; Nosema ceranae; mushroom extract; Agaricus bisporus; immune-related geneexpression
1. Introduction
The honey bee (Apis mellifera L. (Hymenoptera: Apidae)) is a pollinator importantfor agricultural production [1] and providing essential macro- and micronutrients [2].Considerable colony losses in the United States and Europe have significant negativeeconomic and environmental consequences, and can be caused by many factors, most
Insects 2021, 12, 915. https://doi.org/10.3390/insects12100915 https://www.mdpi.com/journal/insects
Insects 2021, 12, 915 2 of 14
often pathogens and parasites, environmental pollution, nutritional stress, and inadequatebeekeeping management [3–5].
One of the most common diseases of honey bees is nosemosis caused by microsporidiaof the genus Nosema [3] with three species that may affect A. mellifera: N. ceranae, N. apis,and N. neummani. Currently, N. ceranae is one of the most widespread microsporidiumcausing infections in honey bees [6] with the different symptoms compared with thoseinduced with N. apis [7]. N. ceranae is primarily a pathogen of honey bee midgut. However,this endoparasite or its DNA was also found in other tissues [8–10] and hemolymph [11].Pathological changes in the epithelial cells of the midgut lead to digestive and metabolicdisorders causing malnutrition in adult bees [12], diarrhea, decreased honey production,and increased mortality in winter bees [13]. There are reports that N. ceranae induceschanges in the carbohydrate metabolism [14–17], which may increase nutritional andenergetic stress [3,15–20]. Infection with N. ceranae compromises immunity [21] and inducesoxidative stress in bees [5], especially in combination with pesticides [22,23]. It has also beenshown that infection of bees with Nosema spp. can reduce the effectiveness of acaricidesused for the control of honey bee mite Varroa destructor [24]. In addition to bee diseases,many problems in beekeeping are caused by chemical substances used in the control ofbee pathogens due to the many side effects on adult worker bees (increased mortality,shortened lifespan, down-regulation of immune-related genes, induction of toxic stress andup-regulation of detoxification-related genes, decreased worker mobility, learning, memoryand trophallaxis, increased Nosema ceranae infection rate), bee brood (increased egg, larvaland pupal mortality, reduced brood survival and brood area, delayed larval development,delayed adult emergence), reproduction (reduced drone production, longevity and weight,decreased number and viability of drone sperm, increased queen mortality, failure inqueen’s development, reduced queen mating success, queen pupal weight, queen adultweight, queen cell acceptance), consequently leading to weakening of bee colonies andincrease in susceptibility to diseases even if used at recommended doses (reviewed in [25]).
The control of nosemosis includes a wide range of beekeeping practices [3] and appli-cation of chemicals, such as fumagillin, an antibiotic derived from the fungus Aspergillusfumigatus [26,27]. Although fumagillin use is prohibited in most of European countries dueto risk of its commercial formulations (Fumagilin-B, Fumidil-B,) to leave residues in beeproducts [28–30], to affect food safety [31,32], and to increase bee mortality [30], however,it is still licensed in the United States [33], Canada [34], and Argentina [35]. Moreover, itseffectiveness has been questioned [28], imposing a constant effort of scientists to discoveralternative substances, which would be effective against Nosema spp. Among many naturalcompounds tested [5,36–47], some of them showed promising anti-Nosema effects suchas algae and fungus extracts [5,22,36–39], chitosan and peptidoglycan [40], naringenin,sulforaphane and carvacrol [41], probiotics [42,46], natural substances from Brassicaceaedefatted seed meals [43], and natural-based commercial formulations [5,44,47,48]. Dietwith the addition of plant-based, amino acid and vitamin supplements, led to reduction ofN. ceranae spore number [5,48], immunostimulation, and reduction of oxidative stress inN. ceranae-infected bees [5], and consequently to the improved condition of bees. Interestin mushrooms has been increasing among researchers due to their nutritional and medic-inal properties; mushrooms of the genus Agaricus contain numerous biologically-activesubstances (such as glucans, mannan, lentinan, schizophyllan, scleroglucan) with certainantitumor, antidiabetic, and immunostimulatory effects [49–56]. Stevanovic et al. [38]observed a favorable effect of A. blazei extract on the strength parameters of bee coloniesin a field experiment, while Glavinic et al. [5] revealed the positive effect of A. blazei ex-tract in laboratory experiment. The extract stimulated the expression of genes importantfor immunity, reducing oxidative stress caused by N. ceranae and consequently reducingN. ceranae infection. Beneficial effects on honey bees were observed for other mushroomspecies, too; extracts derived from the mycelia of Fomes fomentarius, Ganoderma applanatum,G. Resinaceum, and Trametes versicolor demonstrated strong anti-viral efficacy against two
Insects 2021, 12, 915 3 of 14
bee viruses (deformed wing virus—DWV) and Lake Sinai virus—LSV) in both laboratoryand field trials [57].
Having in mind the described positive effects of A. blazei on honey bees and itspotential in Nosema control, we decided to assess the effect of A. bisporus extract on beesurvival, Nosema infection, and the expression of genes important for bee immunity in alaboratory experiment. A. bisporus is the most cultivated mushroom species among Westerncountries which makes this research and its application in beekeeping more cost-effectivecompared to the research and application of A. blazei.
2. Materials and Methods2.1. Agaricus bisporus Extract Preparation
Water extract of the commercially-cultivated white button mushroom (Agaricus bis-porus, strain A15) was prepared according to the procedure described by Klaus et al. [58].In summary, dry powdered fruit bodies of mushrooms were extracted with distilled waterat 121 ◦C, 1.2 bar, for 60 min. After being filtered, the liquid part was evaporated up to1/3 of its volume and precipitated with 96% ethanol overnight. The material was thencentrifuged, dried at 40 ◦C, powdered, and kept in the refrigerator (RK6333W, Gorenje,Velenje, Slovenia) before analysis.
2.2. Bees and the Design of Cage Experiment
During April 2020, frames containing areas with sealed brood were taken from threehoney bee colonies at the experimental apiary of the Faculty of Veterinary Medicine,University of Belgrade. The frames were placed in net bags (to prevent the dissipation ofhatched bees) and kept overnight in a preset incubator (Inkubatori, Pozarevac, Serbia) atthe temperature 34 ± 1 ◦C and humidity 66 ± 1%. The next morning, the newly emergedworker bees were collected from the frames and transferred to experimental cages (60 beesper experimental cage: 10 bees were sampled for the RNA extraction, 20 for Nosema sporecounting and the remaining 30 bees served for monitoring the survival) and each groupcomprised three cages (replicates). Cages were specifically designed by Glavinic et al. [21]for this experiment. Briefly, a plastic jar was punched to allow entry of air, placed with thelid down, and equipped with a plastic strainer inserted in the center of the lid allowingbees to take the syrup from the small petri dish placed below. The whole experiment wasrepeated, and the results were merged into a single dataset.
2.3. The Selection of an Appropriate Extract Concentration
To determine the optimal concentration of the extract, only the survival of bees wasmonitored in the first part of the experiment. Newly emerged bees were divided into fourexperimental groups. The control group (C group) received pure sucrose syrup (50% w/v).The remaining three groups (Table 1) received sucrose syrup (50% w/v) supplementedwith A. bisporus extract at concentrations of 100 µg/g (Abs-100 group), 200 µg/g (Abs-200group) and 400 µg/g (Abs-400 group). The experiment lasted 15 days. The dead bees werecounted and removed from the cages on a daily basis.
Table 1. Experimental design.
GROUP 1 Day of Starting theTreatment 2
N. ceranae InfectionDay 2 Sampling Day 2
NI – – 7 15I – 3 7 15
Abs 1 – 7 15I-Abs1 1 3 7 15I-Abs3 3 3 7 15I-Abs6 6 3 7 15
1 Bees were non-infected (NI) or infected with N. ceranae (I) and treated with A. bisporus extract (Abs). 2 Days afterbee emergence.
Insects 2021, 12, 915 4 of 14
2.4. Effects of A. bisporus Extract on Nosema Infection
In the second part of the cage experiment, the effect of A. bisporus extract at a concen-tration of 200 µg/g was evaluated. Six groups were established and all were fed with 50%(w/v) sucrose syrup. There were two control groups: non-infected (NI) and infected withN. ceranae (I). The remaining four experimental groups received sucrose syrup enrichedwith A. bisporus extract either from the first day (in group Abs, those are non-infected andin Nosema-infected, group I-Abs1), or from the third or sixth day (groups I-Abs3 and I-Abs6,respectively, both Nosema-infected (Table 1)).
2.5. Inoculum Preparation, Experimental Infection, and Bee Sampling
Inoculum preparation and experimental infection of bees were performed accordingto the previously described methodology [5,21]. Briefly, the inoculum was prepared bycrushing the abdomens of N. ceranae-infected bees in distilled water. Number of sporeswere determined according to Cantwell [59]. Freshly-prepared spore suspension with99% viability, assessed with 4% trypan blue (Sigma–Aldrich, Steinheim, Germany), mixedwith 50% sucrose (Centrohem, Stara Pazova, Serbia) solution was used to obtain 1 × 106
spores/mL final concentration. Bees in the infected control group (I) and treated groups(I-Abs1, I-Abs3, and I-Abs6) were infected with N. ceranae spores on day 3 [5]. From eachcage, on days 7 and 15, bees were sampled for counting Nosema spores and gene expressionanalysis (Table 1). The remaining bees from the cage were used to determine the survivalrate. Dead bees were removed from the cage and counted daily. During the experiment,syrup consumption was measured by weighing the food before and after the bees had beenfed for 24 h [60]. According to these data, average consumption/bee/day was calculated.
2.6. Nosema Spore Counting
On the day of sampling (day 7 and day 15), 10 bees were taken from each cage. Theabdomen of each bee was placed in a 1.5 mL tube and macerated in 1 mL of distilled waterin Tissue Lyser II (QIAGEN, Hilden, Germany) for 1 min at 25 Hz. The number of N. ceranaespores was determined using a hemocytometer described in Cantwell [59] and OIE [61],and used also in our previous studies [5,21–23].
2.7. RNA Extraction and cDNA Synthesis
The total RNA was extracted with Quick-RNA MiniPrep Kit (Zymo Research, Irvine,CA, USA). A single bee was placed in a 1.5 mL tube with 500 µL of Genomic Lysis Buffer.Homogenization was performed in a TissueLyser II (QIAGEN, Germany) for 1 min at25 Hz using a 3 mm tungsten carbide bead (Qiagen, Hilden, Germany). Other extractionsteps were performed according to the manufacturer’s instructions. In-column DNasetreatment (treatment with DNase I Reaction Mix) was applied for all samples during theextraction process with the aim to remove contaminating DNA. cDNA was immediatelygenerated from extracted RNA using the RevertAid™ First Strand cDNA Synthesis Kit(Thermo Fisher Scientific, Vilnius, Lithuania).
2.8. Real-Time Quantitative PCR
SYBR green method was used for real-time PCR (qPCR) amplification in a 20 µL reac-tion mixture with “FastGene® IC Green 2 x qPCR Universal Mix” (Nippon Genetics, Düren,Germany) according to instructions of the manufacturer and modifications described byGlavinic et al. [5]. A specific primer pair was used for each gene (Table 2). The qPCRreactions were performed in a Rotor-Gene Q 5 plex (Qiagen, Valencia, CA, USA). Geneexpression level of abaecin, hymenoptaecin, defensin, apidaecin, and vitellogenin wasdetermined using the 2−∆∆CT method described in Galvinic et al. [5] while β-actin wasused as an internal control for normalization of each gene expression.
Insects 2021, 12, 915 5 of 14
Table 2. Primer used for qPCR analysis.
Primer Sequence 5′–3′ Reference
Beta actin-F TTGTATGCCAACACTGTCCTTT[62]Beta actin-R TGGCGCGATGATCTTAATTT
Abaecin-F CAGCATTCGCATACGTACCA[63]Abaecin-R GACCAGGAAACGTTGGAAAC
Hymenopt-F CTCTTCTGTGCCGTTGCATA[63]Hymenopt-R GCGTCTCCTGTCATTCCATT
Defensin-F TGCGCTGCTAACTGTCTCAG[63]Defensin-R AATGGCACTTAACCGAAACG
ApidNT-F TTTTGCCTTAGCAATTCTTGTTG[62]ApidNT-R GTAGGTCGAGTAGGCGGATCT
VgMC-F AGTTCCGACCGACGACGA[62]VgMC-R TTCCCTCCCACGGAGTCC
3. Statistical Methods
The survival of bees was monitored by the number of dead bees per day in eachexperimental group. The data on the survival distribution obtained in the Kaplan–Meiersurvival estimator were compared in the log-rank test. The results for N. ceranae sporesand gene expression were tested for normality by using Shapiro–Wilk’s test. Due to thenormal distribution of data (Shapiro–Wilk’s test, p > 0.05), groups were compared in two-way ANOVA with repeated measures in one factor, followed by Tukey’s test within andSidak’s test between groups over time. The levels of significance below 0.05 (p < 0.05) wereconsidered significant. The analyses were done using GraphPad Prism 7.0 (GraphPadSoftware, San Diego, CA, USA).
4. Results4.1. Bee Survival and Food Consumption
In the first part of the experiment, which was conducted to determine the optimalconcentration of the extract for further investigation, no significant differences in beesurvival (p > 0.05) were detected between all groups (Figure 1). The lowest number of deadbees was in the group treated with 200 µg/g of A. bisporus extract (Abs-200). Consequently,this concentration was used in the second part of the experiment.
Insects 2021, 12, 915 5 of 15
USA). Gene expression level of abaecin, hymenoptaecin, defensin, apidaecin, and vitellogenin was determined using the 2−ΔΔCT method described in Galvinic et al. [5] while β-actin was used as an internal control for normalization of each gene expression.
Table 2. Primer used for qPCR analysis.
Primer Sequence 5′–3′ Reference Beta actin-F TTGTATGCCAACACTGTCCTTT
[62] Beta actin-R TGGCGCGATGATCTTAATTT Abaecin-F CAGCATTCGCATACGTACCA
[63] Abaecin-R GACCAGGAAACGTTGGAAAC
Hymenopt-F CTCTTCTGTGCCGTTGCATA [63]
Hymenopt-R GCGTCTCCTGTCATTCCATT Defensin-F TGCGCTGCTAACTGTCTCAG
[63] Defensin-R AATGGCACTTAACCGAAACG ApidNT-F TTTTGCCTTAGCAATTCTTGTTG
[62] ApidNT-R GTAGGTCGAGTAGGCGGATCT VgMC-F AGTTCCGACCGACGACGA
[62] VgMC-R TTCCCTCCCACGGAGTCC
3. Statistical Methods The survival of bees was monitored by the number of dead bees per day in each
experimental group. The data on the survival distribution obtained in the Kaplan–Meier survival estimator were compared in the log-rank test. The results for N. ceranae spores and gene expression were tested for normality by using Shapiro–Wilk’s test. Due to the normal distribution of data (Shapiro–Wilk’s test, p > 0.05), groups were compared in two-way ANOVA with repeated measures in one factor, followed by Tukey’s test within and Sidak’s test between groups over time. The levels of significance below 0.05 (p < 0.05) were considered significant. The analyses were done using GraphPad Prism 7.0 (GraphPad Software, San Diego, CA, USA).
4. Results 4.1. Bee Survival and Food Consumption
In the first part of the experiment, which was conducted to determine the optimal concentration of the extract for further investigation, no significant differences in bee survival (p > 0.05) were detected between all groups (Figure 1). The lowest number of dead bees was in the group treated with 200 µg/g of A. bisporus extract (Abs-200). Consequently, this concentration was used in the second part of the experiment.
Figure 1. Survival of bees treated with A. bisporus extract: 100 µg/g (Abs-100), 200 µg/g (Abs-200), 400 µg/g (Abs-400), and control (C) group.
Figure 1. Survival of bees treated with A. bisporus extract: 100 µg/g (Abs-100), 200 µg/g (Abs-200), 400 µg/g (Abs-400), andcontrol (C) group.
The number of dead bees in the second part of the experiment (Figure 2) was signifi-cantly higher in the infected control group (I) compared to NI (p = 0.009), Abs (p = 0.003),I-Abs1 (p = 0.036), I-Abs3 (p = 0.018), and not significantly different (p = 0.185) in compar-ison with group I-Abs6 (log-rank test). The survival of bees in the non-infected control
Insects 2021, 12, 915 6 of 14
group (NI) did not differ statistically compared to the groups of Abs (p = 0.714), I-Abs1(p = 0.552), I-Abs3 (p = 0.760), and I-Abs6 (p = 0.173).
Insects 2021, 12, 915 6 of 15
The number of dead bees in the second part of the experiment (Figure 2) was significantly higher in the infected control group (I) compared to NI (p = 0.009), Abs (p = 0.003), I-Abs1 (p = 0.036), I-Abs3 (p = 0.018), and not significantly different (p = 0.185) in comparison with group I-Abs6 (log-rank test). The survival of bees in the non-infected control group (NI) did not differ statistically compared to the groups of Abs (p = 0.714), I-Abs1 (p = 0.552), I-Abs3 (p = 0.760), and I-Abs6 (p = 0.173).
Figure 2. Survival of bees infected with N. ceranae (I), non-infected but treated with A. bisporus extract (Abs), bees infected with N. ceranae and treated with A. bisporus extract from day 1 (group I-Abs1), day 3 (I-Abs3), and day 6 (I-Abs6), as well as bees from the control non-infected (NI) group.
There were no differences in daily food consumption between the control group and all treatment groups. Mean consumption across all groups was 121.63 mg/bee/day (Figure S1).
4.2. Quantification of N. ceranae Spores In samples of bees from the control non-infected group (NI) and non-infected but
treated with A. bisporus extract (Abs), no spores of N. ceranae were detected at any time of sampling. By comparing the number of spores in groups infected with N. ceranae on the 7th and 15th day of sampling, Shidak’s multiple comparison test showed a significantly higher (p < 0.001) number of spores on day 15 compared to day 7. In bee samples from day 7 of the experiment, the Tukey test revealed no significant differences in the number of spores among all groups (p > 0.05). In contrast, on day 15 (Figure 3), the number of spores was significantly higher in group I compared to all other groups (p < 0.001). The lowest number of spores was detected in group I-Abs3, significantly lower than in groups I and I-Abs6 (p < 0.001) and I-Abs1 (p < 0.05).
Figure 2. Survival of bees infected with N. ceranae (I), non-infected but treated with A. bisporus extract (Abs), bees infectedwith N. ceranae and treated with A. bisporus extract from day 1 (group I-Abs1), day 3 (I-Abs3), and day 6 (I-Abs6), as well asbees from the control non-infected (NI) group.
There were no differences in daily food consumption between the control groupand all treatment groups. Mean consumption across all groups was 121.63 mg/bee/day(Figure S1).
4.2. Quantification of N. ceranae Spores
In samples of bees from the control non-infected group (NI) and non-infected buttreated with A. bisporus extract (Abs), no spores of N. ceranae were detected at any time ofsampling. By comparing the number of spores in groups infected with N. ceranae on the 7thand 15th day of sampling, Shidak’s multiple comparison test showed a significantly higher(p < 0.001) number of spores on day 15 compared to day 7. In bee samples from day 7 ofthe experiment, the Tukey test revealed no significant differences in the number of sporesamong all groups (p > 0.05). In contrast, on day 15 (Figure 3), the number of spores wassignificantly higher in group I compared to all other groups (p < 0.001). The lowest numberof spores was detected in group I-Abs3, significantly lower than in groups I and I-Abs6(p < 0.001) and I-Abs1 (p < 0.05).
Insects 2021, 12, 915 7 of 15
Figure 3. Number of N. ceranae spores in infected group (I) and groups of bees infected with N. ceranae and treated with A. bisporus extract from day 1 (I-Abs1), day 3 (I-Abs3), and day 6 (I-Abs6). * p < 0.05.
4.3. Gene Expression Analyses On day 7, the highest expression levels for the majority of monitored genes were in
groups Abs and I-Abs6, in contrast to the infected control (I) group where the lowest gene expression was detected (Figure 4). However, the most important and most significant changes in expression levels were obtained on day 15 (Figures 4 and 5). According to the Tukey test, abaecin expression levels (Figure 5A) were significantly lower in group I compared to all other groups (p < 0.001), but also in group I-Abs6 compared to I-Abs1 (p < 0.05). Gene expression for hymenoptaecin (Figure 5B), on day 15 of the experiment, was significantly lower in group I (p < 0.001) compared to all other groups. However, pairwise comparisons of all treated groups revealed that the expression of the hymenoptaecin gene was significantly higher in the I-Abs1 group compared to I-Abs3 (p < 0.001) and I-Abs6 (p < 0.01). The expression of apidaecin (Figure 5C) and vitellogenin (Figure 5D) was also found to be lower in the control infected group (I) compared to all other groups (p < 0.01). The expression of the gene for apidaecin did not differ among the groups treated with A. bisporus extract, while the level for vitellogenin was higher (p < 0.01) in the group I-Abs3 compared to the groups I-Abs1 and Abs. Regarding gene expression for defensin, although the lowest level was in the group I (Figure 5E), the Tukey test showed no significant differences between the experimental groups.
Figure 3. Number of N. ceranae spores in infected group (I) and groups of bees infected with N. ceranaeand treated with A. bisporus extract from day 1 (I-Abs1), day 3 (I-Abs3), and day 6 (I-Abs6). * p < 0.05.
Insects 2021, 12, 915 7 of 14
4.3. Gene Expression Analyses
On day 7, the highest expression levels for the majority of monitored genes were ingroups Abs and I-Abs6, in contrast to the infected control (I) group where the lowest geneexpression was detected (Figure 4). However, the most important and most significantchanges in expression levels were obtained on day 15 (Figures 4 and 5). According tothe Tukey test, abaecin expression levels (Figure 5A) were significantly lower in group Icompared to all other groups (p < 0.001), but also in group I-Abs6 compared to I-Abs1(p < 0.05). Gene expression for hymenoptaecin (Figure 5B), on day 15 of the experiment, wassignificantly lower in group I (p < 0.001) compared to all other groups. However, pairwisecomparisons of all treated groups revealed that the expression of the hymenoptaecin genewas significantly higher in the I-Abs1 group compared to I-Abs3 (p < 0.001) and I-Abs6(p < 0.01). The expression of apidaecin (Figure 5C) and vitellogenin (Figure 5D) was alsofound to be lower in the control infected group (I) compared to all other groups (p < 0.01).The expression of the gene for apidaecin did not differ among the groups treated withA. bisporus extract, while the level for vitellogenin was higher (p < 0.01) in the group I-Abs3compared to the groups I-Abs1 and Abs. Regarding gene expression for defensin, althoughthe lowest level was in the group I (Figure 5E), the Tukey test showed no significantdifferences between the experimental groups.
Insects 2021, 12, 915 8 of 15
Figure 4. Heatmap of immune−related genes (means of Log2 of relative expression ratios for abaecin, hymenoptaecin, defensin, apidaecin and vitellogenin) at different time points in experimental groups. N. ceranae infected control (I), group treated with extract (Abs), and groups infected and treated with A. bisporus extract from day 1 (I-Abs1), day 3 (I-Abs3), and day 6 (I-Abs6). Range log2 value of relative expression ratio is given in the legend on the right indicating up- or down-regulation of the expression. Group names are indicated in Table 1.
Figure 4. Heatmap of immune−related genes (means of Log2 of relative expression ratios for abaecin,hymenoptaecin, defensin, apidaecin and vitellogenin) at different time points in experimental groups.N. ceranae infected control (I), group treated with extract (Abs), and groups infected and treatedwith A. bisporus extract from day 1 (I-Abs1), day 3 (I-Abs3), and day 6 (I-Abs6). Range log2 value ofrelative expression ratio is given in the legend on the right indicating up- or down-regulation of theexpression. Group names are indicated in Table 1.
Insects 2021, 12, 915 8 of 14
Insects 2021, 12, 915 8 of 15
Figure 4. Heatmap of immune−related genes (means of Log2 of relative expression ratios for abaecin, hymenoptaecin, defensin, apidaecin and vitellogenin) at different time points in experimental groups. N. ceranae infected control (I), group treated with extract (Abs), and groups infected and treated with A. bisporus extract from day 1 (I-Abs1), day 3 (I-Abs3), and day 6 (I-Abs6). Range log2 value of relative expression ratio is given in the legend on the right indicating up- or down-regulation of the expression. Group names are indicated in Table 1.
Insects 2021, 12, 915 9 of 15
Figure 5. Gene expression levels for abaecin (A), hymenoptaecin (B), apidaecin (C), vitellogenin (D), and defensin (E) in bees infected with N. cerane (I), non−infected but treated with A. bisporus extract (Abs), as well as bees infected with N. cerane and treated with A. bisporus extract from day 1 (I-Abs1), day 3 (I-Abs3) and day 6 (I-Abs6) of the experiment. * p < 0.05.
5. Discussion Nosemosis is a common and widespread disease that negatively affects adult bees
[37]. Infection with N. ceranae is especially dangerous due to its implied role in colony losses [3]. There is a relatively small number of safe preparations used as alternatives to fumagillin in nosemosis control. Thus, there is a constant effort of scientists to discover new natural substances with beneficial effects in the control of this disease [5,36–47].
This is the first study in which A. bisporus extract was tested on honey bees. In the first part of the experiment, none of the tested concentrations of A. bisporus extract (100, 200, and 400 µg/g) increased bee mortality compared to control. This has been expected, bearing in mind already reported beneficial effects of other Agaricus spp. extracts on bees [5,38] as well as of other natural-based dietary supplements [21,48,64–67]. Despite the absence of significant differences among groups, the lowest number of dead bees was in the group fed with 200 µg/g of A. bisporus extract. This result, along with the economic aspect (optimal ratio between the extract amount and the benefit), led us to choose this concentration for further testing. In this experiment, a significantly lower survival rate in the group of infected bees (I) compared to the non-infected group (Figure 2) suggests undoubted fatal effects of N. ceranae infection, which is consistent with previous studies [5,21,68,69]. However, feeding bees with the addition of A. bisporus extract starting from day 1 and 3 at a concentration of 200 µg/g significantly increased the survival rate of infected bees compared to infected bees (group I) fed without the addition of mushroom extract (Figure 2). This result is in accordance with our previous findings where an extract
Figure 5. Gene expression levels for abaecin (A), hymenoptaecin (B), apidaecin (C), vitellogenin (D), and defensin (E) inbees infected with N. cerane (I), non−infected but treated with A. bisporus extract (Abs), as well as bees infected with N. ceraneand treated with A. bisporus extract from day 1 (I-Abs1), day 3 (I-Abs3) and day 6 (I-Abs6) of the experiment. * p < 0.05.
5. Discussion
Nosemosis is a common and widespread disease that negatively affects adult bees [37].Infection with N. ceranae is especially dangerous due to its implied role in colony losses [3].There is a relatively small number of safe preparations used as alternatives to fumagillinin nosemosis control. Thus, there is a constant effort of scientists to discover new naturalsubstances with beneficial effects in the control of this disease [5,36–47].
This is the first study in which A. bisporus extract was tested on honey bees. In thefirst part of the experiment, none of the tested concentrations of A. bisporus extract (100,200, and 400 µg/g) increased bee mortality compared to control. This has been expected,bearing in mind already reported beneficial effects of other Agaricus spp. extracts on
Insects 2021, 12, 915 9 of 14
bees [5,38] as well as of other natural-based dietary supplements [21,48,64–67]. Despitethe absence of significant differences among groups, the lowest number of dead beeswas in the group fed with 200 µg/g of A. bisporus extract. This result, along with theeconomic aspect (optimal ratio between the extract amount and the benefit), led us tochoose this concentration for further testing. In this experiment, a significantly lowersurvival rate in the group of infected bees (I) compared to the non-infected group (Figure 2)suggests undoubted fatal effects of N. ceranae infection, which is consistent with previousstudies [5,21,68,69]. However, feeding bees with the addition of A. bisporus extract startingfrom day 1 and 3 at a concentration of 200 µg/g significantly increased the survivalrate of infected bees compared to infected bees (group I) fed without the addition ofmushroom extract (Figure 2). This result is in accordance with our previous findingswhere an extract of related fungus A. blazei induced better bee survival [5]. In a fieldexperiment, Stevanovic et al. [38] revealed the beneficial impact of A. blazei extract on thestrength of honey bee colonies. However, when the extract was applied to infected beesstarting from day 6, it did not contribute significantly to mortality decrease compared togroup I (Figure 2). This finding indicates a better protective-preventive effect (applicationbefore or at the moment of infection) compared to the effect obtained by post-infectionapplication. Having in mind that the main action of medicinal mushroom metabolitesis immunomodulation [70], this result was expected. In addition, the extract used inthis study was rich in polysaccharides (more than 68%) which are the most reportedimmunomodulatory compounds from mushrooms [71,72]. The absence of significantdifferences in bee mortality between the control non-infected group (NI) and all groupsthat received A. bisporus extract in the diet (Abs, I-Abs1, I-Abs3, and I-Abs6) is an additionalconfirmation of the extract’s positive effects on bee survival regardless of the applicationperiod, similarly as previously reported for A. blazei extract [5], plant extracts (Aristoteliachilensis, Ugni molinae, Gevuina avellan), and propolis [73].
The level of nosema infection was monitored by counting spores on days 7 and 15of the experiment. The presence of spores in infected groups, and its absence in non-infected groups (NI and Abs) suggest that there was no cross-contamination between theexperimental groups, and the design of the cage [21] is adequate for such research. Thisconfirms that the experiment has been performed accurately and in line with COLOSSBEEBOOK recommendations [74]. A significantly higher number of spores was detectedon day 15 compared to day 7 in all infected groups. Analysis of the number of spores inthe samples collected on day 7 did not reveal significant difference among infected groups.This finding was expected since the infection was still in the initial stage [75]. In contrast,on day 15, a significantly higher number of spores was in group I (Figure 3) compared toall other groups that received the extract. Comparing groups infected with the Nosema andtreated with A. bisporus extract (I-Abs1, I-Abs3, and I-Abs6), the lowest spore number wasdetected in the group I-Abs3 (Figure 3). Thus, we can conclude that the extract of whitebutton mushroom has a noticeable anti-Nosema effect. Moreover, this effect is the highestwhen applied to start from the third day which coincides with the time of infection withN. ceranae. Such effects have already been demonstrated for A. blazei [5], algae extract alsorich in polysaccharides [37], and other supplements [21,73]. Hayman et al. [76] explainedmicrosporidia reduction by inhibition of adhesion to the target cells. Vunduk et al. [77] alsoshowed that mushroom extract exhibits antiadhesion and biofilm formation effect againstfoodborne bacteria. The extract’s more beneficial effect in groups IAbs-1 and I-Abs3 couldbe explained by the absence of infected epithelial cells with N. ceranae [75], which gives abetter opportunity for more efficient action (adhesion inhibition) of the extract.
Infection with N. ceranae suppressed most of the immune-related genes examinedin this study (Figures 4 and 5), which is in line with previous reports of the immunosup-pressive effect of this endoparasite [5,21,78–80]. The expression level of all genes, exceptdefensin, was significantly lower in group I compared to all other experimental groups(Figures 4 and 5). This result is not surprising considering the amount of N. ceranae sporesdetected at the end of the experiment (highest spore load in group I—Figure 3) but also
Insects 2021, 12, 915 10 of 14
the bee mortality (highest number of dead bees in group I—Figure 2). The gene expres-sion levels in all the groups supplemented with A. bisporus extract (Abs, I-Abs1, I-Abs3,and I-Abs6) indicate its stimulatory effect on the expression of all monitored immunegenes except defensin (Figures 4 and 5). This finding is consistent with the previous studydemonstrating the stimulating effect of A. blazei on honey bee immunity [5,39]. Higherlevels of immune-related gene expression in infected and treated groups compared tothe infected control group (I) indicate the immunoprotective and immunomodulatingeffect of A. bisporus extract. Moreover, higher gene expression levels (Figures 4 and 5) ininfected and treated groups, and lower spore loads in those groups (Figure 3) revealedan inverse correlation between spore loads and levels of immune-related gene expression.Gene expression levels on day 15 compared to day 7 were significantly higher for all testedgenes in group I-Abs3 (except the one for defensin); significantly higher for all tested genesin group I-Abs1 (except those for defensin and apidaecin); significantly higher only forvitellogenin gene in I-Abs6 group (Figure 4), and significantly lower for all tested genesin the infected control group (I). Greater stimulation of gene expression in group I-Abs1and I-Abs3 compared to I-Abs6 indicates better efficacy of the extract before and at themoment of infection with N. ceranae. A better protective effect is expected as the extract isrich in polysaccharides [5,36–38], while the anti-Nosema effect is more typical for antibioticssuch as fumagillin [5,29,30,33–35]. Moreover, we used crude water extract which, besidespolysaccharides (almost 70%), contains proteins (5.31%) and phenolic compounds (2.7%) aswell [71,81]. These metabolites express different modes of action. Proteins are often boundto polysaccharides and cumulative immunomodulatory effect can be expected. Phenolics,as fungal secondary metabolites, mainly act as antioxidants, and can be important in theearly stage of infection development [82].
6. Conclusions
This is the first study of the effects of A. bisporus extract on honey bees that showed thepotential for improving the survival and the immunity of bees infected with N. ceranae. Theeffect on immunity has been demonstrated through increased expression of immune-relatedgenes in both non-infected bees and bees infected with N. ceranae. Besides, A. bisporusextract was effective in reducing the number of Nosema spores. The best results wereobserved when the extract was applied at the moment of infection or preventively (beforeor simultaneously with the Nosema infection). Finally, the tested extract has a strongstimulatory effect on gene expression in both N. ceranae-infected and uninfected bees. Inthe absence of adequate and safe natural-based therapy for nosemosis, we can concludethat A. bisporus extract has a great potential for use in the control of this bee disease andneeds to be further investigated in the field experiments.
Supplementary Materials: The following are available online at https://www.mdpi.com/article/10.3390/insects12100915/s1, Figure S1: Daily food consumption per bee in the non-infectedgroup (NI), infected group (I) and the groups infected with N. ceranae and treated with A. bisporusextract from the day 1 (I-Abs1), day 3 (I-Abs3) and day 6 (I-Abs6).
Author Contributions: Conceptualization: Z.S., U.G., and I.M.; Design of experiment and methodol-ogy: U.G., and Z.S.; Laboratory analysis: U.G., J.V., M.R., and B.V.; Data curation: U.G., M.R., andB.V.; Writing, review and editing: U.G., M.R., Z.S., J.S., J.V., B.V., and I.M. All authors have read andagreed to the published version of the manuscript.
Funding: The study was supported by the Ministry of Education, Science and Technological De-velopment of the Republic of Serbia (contract no. 451-03-9/2021-14/200143 for the project led byZoran Stanimirovic).
Institutional Review Board Statement: Ethical review and approval were waived for this study, dueto the study of invertebrates only (honey bees are exempted from ethical review).
Data Availability Statement: The data presented in this study are available on request from thecorresponding author. The data are not publicly available due to the excessive data size.
Insects 2021, 12, 915 11 of 14
Conflicts of Interest: The authors declare no conflict of interest.
References1. Burnham, A.J. Scientific Advances in Controlling Nosema ceranae (Microsporidia) Infections in Honey Bees (Apis mellifera). Front.
Vet. Sci. 2019, 6, 79. [CrossRef]2. Reeves, A.M.; O’Neal, S.T.; Fell, R.D.; Brewster, C.C.; Anderson, T.D. In-Hive Acaricides Alter Biochemical and Morphological
Indicators of Honey Bee Nutrition, Immunity, and Development. J. Insect Sci. 2018, 18. [CrossRef]3. Stanimirovic, Z.; Glavinic, U.; Ristanic, M.; Aleksic, N.; Jovanovic, N.M.; Vejnovic, B.; Stevanovic, J. Looking for the causes of and
solutions to the issue of honey bee colony losses. Acta Vet. 2019, 69, 1–31. [CrossRef]4. Barroso-Arévalo, S.; Vicente-Rubiano, M.; Puerta, F.; Molero, F.; Sánchez-Vizcaíno, J.M. Immune related genes as markers for
monitoring health status of honey bee colonies. BMC Vet. Res. 2019, 15, 72. [CrossRef]5. Glavinic, U.; Stevanovic, J.; Ristanic, M.; Rajkovic, M.; Davitkov, D.; Lakic, N.; Stanimirovic, Z. Potential of Fumagillin and
Agaricus blazei Mushroom Extract to Reduce Nosema ceranae in Honey Bees. Insects 2021, 12, 282. [CrossRef] [PubMed]6. Araneda, X.; Cumian, M.; Morales, D. Distribution, epidemiological characteristics and control methods of the pathogen Nosema
ceranae Fries in honey bees Apis mellifera L. (Hymenoptera, Apidae). Arch. Med. Vet. 2015, 47, 129–138. [CrossRef]7. Martín-Hernandez, R.; Bartolomé, C.; Chejanovsky, N.; Le Conte, Y.; Dalmon, A.; Dussaubat, C.; García-Palencia, P.; Meana, A.;
Pinto, M.A.; Soroker, V.; et al. Nosema ceranae in Apis mellifera: A 12 years postdetection perspective. Environ. Microbiol. 2018, 20,1302–1329. [CrossRef] [PubMed]
8. Chen, Y.P.; Evans, J.; Murphy, C.; Gutell, R.; Zuker, M.; Gundensen-Rindal, D.; Pettis, J.S. Morphological, Molecular, andPhylogenetic Characterization ofNosema ceranae, a Microsporidian Parasite Isolated from the European Honey Bee, Apis mellifera.J. Eukaryot. Microbiol. 2009, 56, 142–147. [CrossRef] [PubMed]
9. Gisder, S.; Hedtke, K.; Möckel, N.; Frielitz, M.C.; Linde, A.; Genersch, E. Five-year cohort study of Nosema spp. in Germany:Does climate shape virulence and assertiveness of Nosema ceranae? Appl. Environ. Microb. 2010, 76, 3032–3038. [CrossRef]
10. Copley, T.; Jabaji, S. Honeybee glands as possible infection reservoirs of Nosema ceranae and Nosema apis in naturally infectedforager bees. J. Appl. Microbiol. 2011, 112, 15–24. [CrossRef]
11. Glavinic, U.; Stevanovic, J.; Gajic, B.; Simeunovic, P.; Ðuric, S.; Vejnovic, B.; Stanimirovic, Z. Nosema ceranae DNA in honey beehaemolymph and honey bee mite Varroa destructor. Acta Vet.-Beograd 2014, 64, 349–357.
12. Gajger, I.; Kozaric, Z.; Berta, D.; Nejedli, S.; Petrinec, Z. Effect of the Herbal preparation Nozevict on the mid-gut structure ofhoneybees (Apis melífera) infected with Nosema sp. Spores. Vet. Med. 2011, 56, 344–351. [CrossRef]
13. Traver, B.E.; Fell, R.D. Nosema ceranae in drone honey bees (Apis mellifera). J. Invertebr. Pathol. 2011, 107, 234–236. [CrossRef]14. Dussaubat, C.; Brunet, J.-L.; Higes, M.; Colbourne, J.; Lopez, J.; Choi, J.H.; Hernández, R.M.; Botías, C.; Cousin, M.; McDonnell, C.;
et al. Gut Pathology and Responses to the Microsporidium Nosema ceranae in the Honey Bee Apis mellifera. PLoS ONE 2012, 7,e37017. [CrossRef] [PubMed]
15. Mayack, C.; Naug, D. Energetic stress in the honeybee Apis mellifera from Nosema ceranae infection. J. Invertebr. Pathol. 2009, 100,185–188. [CrossRef]
16. Aliferis, K.A.; Copley, T.; Jabaji, S. Gas chromatography–mass spectrometry metabolite profiling of worker honey bee (Apismellifera L.) hemolymph for the study of Nosema ceranae infection. J. Insect Physiol. 2012, 58, 1349–1359. [CrossRef]
17. Vidau, C.; Panek, J.; Texier, C.; Biron, D.G.; Belzunces, L.P.; Le Gall, M.; Broussard, C.; Delbac, F.; El Alaoui, H. Differentialproteomic analysis of midguts from Nosema ceranae-infected honeybees reveals manipulation of key host functions. J. Invertebr.Pathol. 2014, 121, 89–96. [CrossRef]
18. Mayack, C.; Naug, D. Parasitic infection leads to decline in hemolymph sugar levels in honeybee foragers. J. Insect Physiol. 2010,56, 1572–1575. [CrossRef]
19. Hernández, R.M.; Botías, C.; Barrios, L.; Martínez-Salvador, A.; Meana, A.; Mayack, C.; Higes, M. Comparison of the energeticstress associated with experimental Nosema ceranae and Nosema apis infection of honeybees (Apis mellifera). Parasitol. Res. 2011,109, 605–612. [CrossRef]
20. Aufauvre, J.; Misme-Aucouturier, B.; Viguès, B.; Texier, C.; Delbac, F.; Blot, N. Transcriptome Analyses of the Honeybee Responseto Nosema ceranae and Insecticides. PLoS ONE 2014, 9, e91686. [CrossRef]
21. Glavinic, U.; Stankovic, B.; Draskovic, V.; Stevanovic, J.; Petrovic, T.; Lakic, N.; Stanimirovic, Z. Dietary amino acid and vitamincomplex protects honey bee from immunosuppression caused by Nosema ceranae. PLoS ONE 2017, 12, e0187726. [CrossRef]
22. Glavinic, U.; Tesovnik, T.; Stevanovic, J.; Zorc, M.; Cizelj, I.; Stanimirovic, Z.; Narat, M. Response of adult honey bees treated inlarval stage with prochloraz to infection with Nosema ceranae. PeerJ 2019, 7, e6325. [CrossRef]
23. Tesovnik, T.; Zorc, M.; Ristanic, M.; Glavinic, U.; Stevanovic, J.; Narat, M.; Stanimirovic, Z. Exposure of honey bee larvaeto thiamethoxam and its interaction with Nosema ceranae infection in adult honey bees. Environ. Pollut. 2020, 256, 113443.[CrossRef] [PubMed]
24. Botías, C.; Barrios, L.; Nanetti, A.; Meana, A.; Martín-Hernández, R.; Garrido-Bailón, E.; Higes, M. Nosema spp. parasitizationdecreases the effectiveness of acaricide strips (Apivar®) in treating varroosis of honey bee (Apis mellifera iberiensis) colonies.Environ. Microbiol. Rep. 2011, 4, 57–65. [CrossRef]
25. Tihelka, E. Effects of synthetic and organic acaricides on honey bee health: A review. Slov. Vet.-Res. 2018, 55. [CrossRef]
Insects 2021, 12, 915 12 of 14
26. Katznelson, H.; Jamieson, C.A. Control of Nosema Disease of Honeybees with Fumagillin. Science 1952, 115, 70–71. [CrossRef][PubMed]
27. Bailey, L. Effect of Fumagillin upon Nosema apis (Zander). Nature 1953, 171, 212–213. [CrossRef] [PubMed]28. Huang, W.-F.; Solter, L.F.; Yau, P.; Imai, B.S. Nosema ceranae Escapes Fumagillin Control in Honey Bees. PLOS Pathog. 2013, 9,
e1003185. [CrossRef] [PubMed]29. Heever, J.P.V.D.; Thompson, T.; Otto, S.; Curtis, J.M.; Ibrahim, A.; Pernal, S.F. Evaluation of Fumagilin-B® and other potential
alternative chemotherapies against Nosema ceranae-infected honeybees (Apis mellifera) in cage trial assays. Apidologie 2015, 47,617–630. [CrossRef]
30. Heever, J.P.V.D.; Thompson, T.; Otto, S.; Curtis, J.M.; Ibrahim, A.; Pernal, S.F. The effect of dicyclohexylamine and fumagillin onNosema ceranae-infected honey bee (Apis mellifera) mortality in cage trial assays. Apidologie 2015, 47, 663–670. [CrossRef]
31. Stanimirovic, Z.; Stevanovic, J.; Bajic, V.; Radovic, I. Evaluation of genotoxic effects of fumagillin (dicyclohexylamine) bycitogenetic tests in vivo. Mut. Res.-Genet. Toxicol. Environ. Mutagenes. 2007, 628, 1–10. [CrossRef] [PubMed]
32. Stevanovic, J.; Stanimirovic, Z.; Radakovic, M.; Stojic, V. In vitro evaluation of the clastogenicity of fumagillin. Environ. Mol.Mutagenes. 2008, 49, 594–601. [CrossRef] [PubMed]
33. Higes, M.; Nozal, M.J.; Alvaro, A.; Barrios, L.; Meana, A.; Hernández, R.M.; Bernal, J.L. The stability and effectiveness offumagillin in controlling Nosema ceranae (Microsporidia) infection in honey bees (Apis mellifera) under laboratory and fieldconditions. Apidologie 2011, 42, 364–377. [CrossRef]
34. McCallum, R.; Olmstead, S.; Shaw, J.; Glasgow, K. Evaluating efficacy of Fumagilin-B® against Nosemosis and tracking seasonalsrends of Nosema spp. in Nova Scotia Honey bee colonies. J. Apic. Sci. 2020, 64, 277–286.
35. Sarlo, E.G.; Medici, S.K.; Porrini, M.P.; Garrido, P.M.; Floris, I.; Eguaras, M.J. Comparison between different fumagillin dosageand evaluation method in the apiary control of Nosemosis type C. Redia 2011, 94, 39–44.
36. Charistos, L.; Parashos, N.; Hatjina, F. Long term effects of a food supplement HiveAlive™ on honey bee colony strength andNosema ceranae spore counts. J. Apic. Res. 2015, 54, 420–426. [CrossRef]
37. Roussel, M.; Villay, A.; Delbac, F.; Michaud, P.; Laroche, C.; Roriz, D.; El Alaoui, H.; Diogon, M. Antimicrosporidian activity ofsulphated polysaccharides from algae and their potential to control honeybee nosemosis. Carbohydr. Polym. 2015, 133, 213–220.[CrossRef]
38. Stevanovic, J.; Stanimirovic, Z.; Simeunovic, P.; Lakic, N.; Radovic, I.; Sokovic, M.; Van Griensven, L.J. The effect of Agaricusbrasiliensis extract supplementation on honey bee colonies. Acad. Bras. Ciências 2018, 90, 219–229. [CrossRef]
39. Glavinic, U. The effects of various antimicrobials and supplements on the expression of immune-related genes, oxidative stressand survival of honey bee Apis mellifera infected with microsporidium Nosema ceranae. Ph.D. Thesis, Faculty of VeterinaryMedicine, University of Belgrade, Belgrade, Serbia, 2019.
40. Valizadeh., P.; Guzman-Novoa, E.; Goodwin, P.H. Effect of immune inducers on Nosema ceranae multiplication and their impacton Honey Bee (Apis mellifera L.) survivorship and behaviors. Insects 2020, 11, 572. [CrossRef]
41. Borges, D.; Guzman-Novoa, E.; Goodwin, P.H. Control of the microsporidian parasite Nosema ceranae in honey bees (Apismellifera) using nutraceutical and immuno-stimulatory compounds. PLoS ONE 2020, 15, e0227484. [CrossRef]
42. Borges., D.; Guzman-Novoa., E.; Goodwin, P.H. Effects of prebiotics and probiotics on honey bees (Apis mellifera) infected withthe microsporidian parasite Nosema ceranae. Microorganisms 2021, 9, 481. [CrossRef] [PubMed]
43. Nanetti, A.; Ugolini, L.; Cilia, G.; Pagnotta, E.; Malaguti, L.; Cardaio, I.; Matteo, R.; Lazzeri, L. Seed meals from Brassica nigra andEruca sativa control artificial Nosema ceranae infections in Apis mellifera. Microorganisms 2021, 9, 949. [CrossRef]
44. Cilia, G.; Garrido, C.; Bonetto, M.; Tesoriero, D.; Nanetti, A. Effect of Api-Bioxal® and ApiHerb® treatments against Nosemaceranae infection in Apis mellifera investigated by two qPCR methods. Vet. Sci. 2020, 7, 125. [CrossRef] [PubMed]
45. Cilia, G.; Fratini, F.; Tafi, E.; Turchi, B.; Mancini, S.; Sagona, S.; Nanetti, A.; Cerri, D.; Felicioli, A. Microbial profile of theven-triculum of honey bee (Apis mellifera ligustica Spinola, 1806) fed with veterinary drugs, dietary supplements and non-proteinamino acids. Vet. Sci. 2020, 7, 76. [CrossRef] [PubMed]
46. El Khoury, S.; Rousseau, A.; Lecoeur, A.; Cheaib, B.; Bouslama, S.; Mercier, P.-L.; Demey, V.; Castex, M.; Giovenazzo, P.; Derome, N.Deleterious Interaction Between Honeybees (Apis mellifera) and its Microsporidian Intracellular Parasite Nosema ceranae WasMitigated by Administrating Either Endogenous or Allochthonous Gut Microbiota Strains. Front. Ecol. Evol. 2018, 6. [CrossRef]
47. Michalczyk, M.; Sokół, R. Estimation of the influence of selected products on co-infection with N. apis/N. ceranae in Apis melliferausing real-time PCR. Invertebr. Reprod. Dev. 2018, 62, 92–97. [CrossRef]
48. Jovanovic, N.M.; Glavinic, U.; Delic, B.; Vejnovic, B.; Aleksic, N.; Mladjan, V.; Stanimirovic, Z. Plant-based supplement containingB-complex vitamins can improve bee health and increase colony performance. Prev. Vet.-Med. 2021, 190, 105322. [CrossRef]
49. Ishii, P.L.; Prado, C.K.; de Oliveira Mauro, M.; Carreira, C.M.; Mantovani, M.S.; Ribeiro, L.R.; Dichi, J.B.; Oliveira, R.J. Eval-uationof Agaricus blazei in vivo for antigenotoxic, anticarcinogenic, phagocytic and immunomodulatory activities. Regul. Toxicol.Pharm. 2011, 59, 412–422. [CrossRef] [PubMed]
50. Sokovic, M.; Ciric, A.; Glamoclija, J.; Nikolic, M.; Van Griensven, L.J.L.D. Agaricus Blazei Hot Water Extract Shows Anti QuorumSensing Activity in the Nosocomial Human Pathogen Pseudomonas Aeruginosa. Molecules 2014, 19, 4189–4199. [CrossRef]
51. Stojkovic, D.; Reis, F.S.; Glamoclija, J.; Ciric, A.; Barros, L.; Van Griensven, L.J.; Ferreira, C.F.R.I.; Sokovic, M. Cultivated strains ofAgaricus bisporus and A. brasiliensis: Chemical characterization and evaluation of antioxidant and antimicrobial properties forthe final healthy product–natural preservatives in yoghurt. Food Funct. 2014, 5, 1602–1612. [CrossRef]
Insects 2021, 12, 915 13 of 14
52. Stojkovic, D.; Smiljkovic, M.; Ciric, A.; Glamoclija, J.; Van Griensven, L.; Ferreira, I.; Sokovic, M. An insight into antidiabeticproperties of six medicinal and edible mushrooms: Inhibition of α-amylase and α-glucosidase linked to type-2 diabetes. S. Afr. J.Bot. 2019, 120, 100–103. [CrossRef]
53. da Silva de Souza, A.C.; Correa, V.G.; Goncalves, G.A.; Soares, A.A.; Bracht, A.; Peralta, R.M. Agaricus blazei bioactive com-pounds and their effects on human health: Benefits and controversies. Curr. Pharm. Des. 2017, 23, 2807–2834. [CrossRef][PubMed]
54. Gargano, M.L.; van Griensven, L.J.; Isikhuemhen, O.S.; Lindequist, U.; Venturella, G.; Wasser, S.P.; Zervakis, G.I. Medicinalmushrooms: Valuable biological resources of high exploitation potential. Plant Biosyst. 2017, 151, 548–565. [CrossRef]
55. Gallego, P.; Rojas, Á.; Falcón, G.; Carbonero, P.; García-Lozano, M.R.; Gil, A.; Grande, L.; Cremades, O.; Romero-Gómez, M.;Bautista, D.J.; et al. Water-soluble extracts from edible mushrooms (Agaricus bisporus) as inhibitors of hepatitis C viral replication.Food Funct. 2019, 10, 3758–3767. [CrossRef]
56. Vunduk, J.; Kozarski, M.; Djekic, I.; Tomaševic, I.; Klaus, A. Effect of modified atmosphere packaging on selected functionalcharacteristics of Agaricus bisporus. Eur. Food Res. Technol. 2021, 247, 829–838. [CrossRef]
57. Stamets, P.E.; Naeger, N.L.; Evans, J.D.; Han, J.O.; Hopkins, B.K.; Lopez, D.; Moershel, H.M.; Nally, R.; Sumerlin, D.; Taylor, A.W.;et al. Extracts of polypore mushroom mycelia reduce viruses in honey bees. Sci. Rep. 2018, 8, 13936. [CrossRef] [PubMed]
58. Klaus, A.; Kozarski, M.; Niksic, M.; Jakovljevic, D.; Todorovic, N.; Van Griensven, L.J.L.D. Antioxidative activities and chemicalchar-acterization of polysaccharides extracted from the basidiomycete Schizophyllum commune. LWT-Food Sci. Technol. 2011, 44,1–7. [CrossRef]
59. Cantwell, G.E. Standard methods for counting Nosema spores. Am. Bee J. 1970, 110, 222–223.60. Williamson, S.M.; Wright, G.A. Exposure to multiple cholinergic pesticides impairs olfactory learning and memory in honey-bees.
J. Exp. Biol. 2013, 216, 1799–1807.61. OIE–Office International Des Epizooties. Manual of Diagnostic Tests and Vaccines for Terrestrial Animals. Chapter 2.2.4.
Nosemosis of Honey Bees. 2018. Available online: https://www.oie.int/fileadmin/Home/eng/Health_standards/tahm/3.02.04_NOSEMOSIS_FINAL.pdf (accessed on 30 August 2021).
62. Simone, M.; Evans, J.D.; Spivak, M. Resin collection and social immunity in honey bees. Evolution 2009, 63, 3016–3022. [CrossRef]63. Evans, J.D.; Aronstein, K.; Chen, Y.P.; Hetru, C.; Imler, J.L.; Jiang, H.; Kanost, M.; Thompson, G.J.; Zou, Z.; Hultmark, D. Immune
pathways and defence mechanisms in honey bees Apis mellifera. Insect Mol. Biol. 2006, 15, 645–656. [CrossRef]64. Jehlík, T.; Kodrík, D.; Krištufek, V.; Koubová, J.; Sábová, M.; Danihlík, J.; Tomcala, A.; Frydrychová, R.C. Effects of Chlorella sp. on
biological characteristics of the honey bee Apis mellifera. Apidologie 2019, 50, 564–577. [CrossRef]65. Ricigliano, V.A.; Simone-Finstrom, M. Nutritional and prebiotic efficacy of the microalga Arthrospira platensis (spirulina) in
honey bees. Apidologie 2020, 51, 898–910. [CrossRef]66. Ricigliano, V.A.; Ihle, K.E.; Williams, S.T. Nutrigenetic comparison of two Varroa-resistant honey bee stocks fed pollen and
spirulina microalgae. Apidologie 2021, 52, 873–886. [CrossRef]67. Shumkova, R.; Balkanska, R.; Hristov, P. The Herbal Supplements NOZEMAT HERB® and NOZEMAT HERB PLUS®: An Alter-
native Therapy for N. ceranae Infection and Its Effects on Honey Bee Strength and Production Traits. Pathogens 2021, 10, 234.[CrossRef]
68. Williams, G.R.; Shutler, D.; Burgher-MacLellan, K.L.; Rogers, R.E. Infra-population and-community dynamics of the parasitesNosema apis and Nosema ceranae, and consequences for honey bee (Apis mellifera) hosts. PLoS ONE 2014, 9, e99465. [CrossRef]
69. Huang, W.F.; Solter, L.; Aronstein, K.; Huang, Z. Infectivity and virulence of Nosema ceranae and Nosema apis in commerciallyavailable North American honey bees. J. Invertebr. Pathol. 2015, 124, 107–113. [CrossRef]
70. Lull, C.; Wichers, H.J.; Savelkoul, H.F. Antiinflammatory and immunomodulating properties of fungal metabolites. Mediat.Inflamm. 2005, 2, 63–80. [CrossRef]
71. Vunduk, J.; Djekic, I.; Petrovic, P.; Tomaševic, I.; Kozarski, M.; Despotovic, S.; Nikšic, M.; Klaus, A. Challenging the differencebetween white and brown Agaricus bisporus mushrooms: Science behind consumers choice. Br. Food J. 2018, 120, 1381–1394.[CrossRef]
72. Zhao, S.; Gao, Q.; Rong, C.; Wang, S.; Zhao, Z.; Liu, Y.; Xu, J. Immunomodulatory effects of edible and medicinal mushrooms andtheir bioactive immunoregulatory products. J. Fungi 2020, 6, 269. [CrossRef]
73. Arismendi, N.; Vargas, M.; López, M.D.; Barría, Y.; Zapata, N. Promising antimicrobial activity against the honey bee parasiteNosema ceranae by methanolic extracts from Chilean native plants and propolis. J. Apic. Res. 2018, 57, 522–535. [CrossRef]
74. Fries, I.; Chauzat, M.P.; Chen, Y.P.; Doublet, V.; Genersch, E.; Gisder, S.; Higes, M.; McMahon, P.D.; Martín-Hernández, R.;Natsopoulou, M.; et al. Standard methods for Nosema research. J. Apicult. Res. 2013, 52, 1–28. [CrossRef]
75. Higes, M.; Garcia-Palencia, P.; Martín-Hernández, R.; Meana, A. Experimental infection of Apis mellifera honeybees with Nosemaceranae (Microsporidia). J. Invertebr. Pathol. 2007, 94, 211–217. [CrossRef]
76. Hayman, J.R.; Southern, T.R.; Nash, T.E. Role of sulfated glycans in adherence of the microsporidian Encephalitozoon intestinalisto host cells in vitro. Infect. Immun. 2005, 73, 841–848. [CrossRef] [PubMed]
77. Vunduk, J.; Wan-Mohtar, W.A.A.Q.I.; Mohamad, S.A.; Halim, N.H.A.; Dzomir, A.Z.M.; Žižak, Ž.; Klaus, A. Polysaccharides ofPleurotus flabellatus strain Mynuk produced by submerged fermentation as a promising novel tool against adhesion and biofilmformation of foodborne pathogens. LWT-Food Sci. Technol. 2019, 112, 108221. [CrossRef]
Insects 2021, 12, 915 14 of 14
78. Antunez, K.; Martín-Hernández, R.; Prieto, L.; Meana, A.; Zunino, P.; Higes, M. Immune-suppression in the honey bee (Apismellifera) following infection by Nosema ceranae (Microsporidia). Environ. Microbiol. 2009, 11, 2284–2290. [CrossRef]
79. Chaimanee, V.; Chantawannakul, P.; Chen, Y.; Evans, J.D.; Pettis, J.S. Differential expression of immune genes of adult honey bee(Apis mellifera) after inoculated by Nosema ceranae. J. Insect. Physiol. 2012, 58, 1090–1095. [CrossRef] [PubMed]
80. Badaoui, B.; Fougeroux, A.; Petit, F.; Anselmo, A.; Gorni, C.; Cucurachi, M.; Cersini, A.; Granato, A.; Cardeti, G.; Formato, G.;et al. RNA-sequence analysis of gene expression from honeybees (Apis mellifera) infected with Nosema ceranae. PLoS ONE 2017,12, e0173438. [CrossRef] [PubMed]
81. Djekic, I.; Vunduk, J.; Tomaševic, I.; Kozarski, M.; Petrovic, P.; Niksic, M.; Pudja, P.; Klaus, A. Total quality index of Agaricusbisporus mushrooms packed in modified atmosphere. J. Sci. Food Agric. 2017, 97, 3013–3021. [CrossRef] [PubMed]
82. Kozarski, M.; Klaus, A.; Jakovljevic, D.; Todorovic, N.; Vunduk, J.; Petrovic, P.; Niksic, M.; Vrvic, M.M.; Van Griensven, L.Antioxidants of edible mushrooms. Molecules 2015, 20, 19489–19525. [CrossRef]