DIPLOMARBEIT

Titel der Diplomarbeit

Alterations in the Gap-Junctional Protein Cx43

under Conditions of Ether Lipid Deficiency

Verfasserin

Fatma Aslı Erdem

angestrebter akademischer Grad

Magistra der Naturwissenschaften (Mag.rer.nat.)

Wien, 2011

Studienkennzahl lt. Studienblatt: A 490

Studienrichtung lt. Studienblatt: Diplomstudium Molekulare Biologie

Betreuerin / Betreuer: Univ.-Prof. Dr. Johannes Berger

   

 

ACKNOWLEDGEMENTS 

 

 

First, without my family nothing would have been possible: Thank you for encouraging me in 

all aspects and reminding me that there’s always a brake in life. 

   

Secondly, all teachers from my school, especially Rosemarie Fürst and Maria Schink (rest  in 

peace)  from preliminary  school; as well as all professors and  supervisors of my university 

years shall also be thanked who were keen on giving the best knowledge.  

 

In the course of my diploma thesis, special thanks go to Johannes Berger for his support and 

endless confidence in me.  

 

I also thank Sonja Forss‐Petter sincerely  for everything  including the critical reading of this 

manuscript. 

 

Thanks to my colleagues in the lab for the nice and supportive atmosphere. 

 

My deepest gratitudes go to my  friends Anja, Antonia, Franziska,  Iduna, Song‐Hi and Sania 

for their never‐ending care and support. 

 

 

This thesis is dedicated to all RCDP children and their caring parents. 

 

 

Fatma, Vienna 2011. 

 

 

CONTENTS 

 

1  Abstract ........................................................................................................................................... 5 

2  Introduction ..................................................................................................................................... 7 

2.1  Membranes and Lipids ............................................................................................................ 7 

2.2  Membrane Rafts .................................................................................................................... 10 

2.3  Ether Lipids ............................................................................................................................ 12 

2.3.1  Biosynthesis of Plasmalogens ........................................................................................ 14 

2.3.2  Peroxisomes and the Peroxisomal Import .................................................................... 15 

2.4  Rhizomelic Chondrodysplasia Punctata (RCDP) .................................................................... 17 

2.4.1  Cases of RCDP associated with heart abnormalities ..................................................... 18 

2.4.2  Mouse Models ............................................................................................................... 20 

2.5  Connexins .............................................................................................................................. 21 

2.6  The role of lipid rafts in gap junctions ................................................................................... 24 

2.7  Connexin‐43........................................................................................................................... 25 

2.7.1  The role of Cx43 in cardiac function .............................................................................. 28 

3  Aim of the Study ............................................................................................................................ 31 

4  Materials and Methods ................................................................................................................. 32 

5  Results ........................................................................................................................................... 42 

5.1  Cx43 from dermal fibroblasts is detected as several bands in immunoblot analysis ........... 42 

5.2  Amount of expressed Connexin‐43 depends on the cell confluency .................................... 42 

5.3  Human primary fibroblasts deficient in ether lipids show a clear reduction in Cx43 ........... 43 

5.4  In ether‐lipid deficient cells Cx43 expression is not increased upon confluency .................. 44 

5.5  Three‐day‐treatment with ether lipid precursors is not sufficient to restore Cx43 levels ... 45 

5.6  Cx43 is concentrated at sites of cell‐cell contact .................................................................. 47 

5.7  Cx43 localization is affected by ether lipid‐deficiency .......................................................... 48 

5.8  Ether lipid deficiency leads to a mislocalization of Cx43 phospho‐isoforms in rafts ............ 49 

5.9  Adult Dhapat‐deficient mice show reduced amounts of Connexin‐43 in heart ................... 50 

6  Discussion ...................................................................................................................................... 52 

7  References ..................................................................................................................................... 59 

8  Appendix ........................................................................................................................................ 72 

 

 

ABBREVIATIONS 

   

AA  Arachidonic acid ADHAPS or ADHAP‐S  Alkyl‐dihydroxyacetone phosphate synthase App#  Application number BA  Batyl‐Alcohol BSA  Bovine serum albumin CoIP  Co‐immunoprecipitation Conj  conjugated const  constant Cx43  Connexin‐43 DHA  Docosahexaenoic acid DHAPAT or DHAP‐AT  Dihydroxy‐Aceton Phosphate Acyltransferase dNTP  Deoxynucleotide triphosphate ER  Endoplasmatic reticulum EtOH  Ethanol EtOH abs.  Ethanol absolute FA  Fatty acid FBS  Fetal bovine serum GJA1  Gap‐junctional Protein alpha 1 GPI  Glycosyl‐phosphatidyl‐inositol HDG  Hexadecylglycerol kDa  Kilo‐Dalton KO  Knockout o/n  Overnight PBD  Peroxisomal biogenesis disorder PBS  Phosphate‐buffered saline PC  Phosphatidylcholine PCR  Polymerase Chain Reaction PE  Phosphatidylethanolamine Pex  Peroxin PI  Protease inhibitor cocktail PMP  Peroxisomal membrane protein Pol  Polymerase PTS  Peroxisomal targeting signal RCDP  Rhizomelic Chondrodysplasia Punctata s.d.  Standard deviation SDS  Sodium dodecylsulfate SM  Sphingomyelin TAE  Tris‐Acetate‐EDTA TBST  Tris‐buffered saline supplemented with Tween TOF  Tetralogy of Fallot VLCFA  Very‐long‐chain fatty acids WT  Wildtype  

 

5

 

1 ABSTRACT 

  Plasmalogens are special ether  lipids that differ  in having a vinyl ether bond at their sn1 

position and in being abundant in membrane rafts. Plasmalogen deficiency leads to the rare 

inherited disorder rhizomelic chondrodysplasia punctata (RCDP) that,  in some cases,  is also 

accompanied  by  heart  defects.  In  non‐RCDP  patients,  such  cardiac  defects  have  been 

associated with a downregulation and/or mislocalization of Connexin‐43 (Cx43). This protein 

has been shown to be reduced in fibroblasts of ether lipid‐deficient mice.

  The aim of the present thesis was to detect a possible molecular  link between Cx43 and 

ether lipids in RCDP cells and hearts of mice deficient in ether lipids. 

  We were  able  to  distinguish  the  non‐phosphorylated  and  phosphorylated  isoforms  of 

Cx43  in  our  system.  The  non‐phosphorylated  isoform  represents  newly  synthesized 

intracellular protein, while phosphorylated Cx43  isoforms are at  the cell  surface or  in gap 

junctions. Our results demonstrate a confluency‐dependent expression of Cx43. This protein 

was  upregulated  in  human  primary  control  fibroblasts  upon  confluency.  However,  this 

induction  was  not  observed  in  ether  lipid‐deficient  fibroblasts.  These  cells  showed  a 

significant  reduction  in  Cx43  protein  levels  compared  to  control.  Interestingly,  Cx43 was 

particularly  reduced  in  its  phospho‐isoforms.  Furthermore,  immunofluorescence  staining 

revealed Cx43 to be localized exclusively at sites of cell‐cell contact in control cells, resulting 

in  a  continuous  signal. Human primary  fibroblasts  lacking  ether  lipids did not  exhibit  this 

pattern. We  also  examined  localization  of  Cx43  in  rafts  by  isolating  detergent‐resistant 

membranes from both primary cell lines and detected most of the Cx43 phospho‐isoforms to 

be  in  raft  fractions of control cells, whereas  in ether  lipid‐deficient cells  they were merely 

present. Due  to  the many  reported  RCDP  cases  associated with  heart  anomalies, mouse 

heart tissues were examined. Hearts of mice lacking a crucial biosynthetic enzyme for ether 

lipid biosynthesis also showed significantly lower amounts of Cx43.  

  Taken  together,  this  study  points  towards  a  possible  involvement  of  Cx43  in  the 

pathologic course of RCDP. It is also tempting to speculate that Cx43 might be involved in the 

molecular mechanisms underlying underlying  the heart defects  reported  in RCDP patients. 

Thus, these data provide sufficient information to justify future detailed investigations.

 

KURZFASSUNG 

  Plasmalogene sind spezielle Ether Lipide, die sich durch eine Vinyl‐Ether‐Bindung an der 

sn1‐Position  unterscheiden  und  in  lipid  rafts  vorkommen. Der Ausfall  von  Plasmalogenen 

führt  zu  rhizomelischer  Chondrodysplasie  punctata  (RCDP),  einer  seltenen  vererbbaren 

Krankheit die in einigen Fällen auch von Herzdefekten begleitet ist. Letztere wurden in nicht‐

RCDP  Patienten mit  einer  Herunterregulation  und  falschen  Lokalisation  von  Connexin‐43 

(Cx43)  in Verbindung gebracht. Dieses Protein wurde  in Ether Lipid‐defizienten Mäusen  in 

reduzierten Mengen vorgefunden. 

  Das Ziel dieser Arbeit war, eine mögliche molekulare Verbindung zwischen Ether‐Lipiden 

und Cx43 in RCDP Zellen sowie Ether Lipid‐defizienten Mausherzen aufzudecken.  

  Wir  konnten  in  unserem  System  nicht‐phosphorylierte  und  phosphorylierte  Isoformen 

von Cx43 erkennen. Die nicht‐phosphorylierte Isoform stellt neu synthetisiertes Protein dar, 

während  phosphorylierte  Cx43  Isoformen  an  der  Zelloberfläche  oder  in  Gap  Junctions 

eingebaut sind. Unsere Ergebnisse zeigen eine Dichte‐abhängige Expression von Connexin‐43. 

Die  Cx43  Phospho‐Isoformen  waren  in  humanen  primären  Kontrollfibroblasten  mit  der 

Dichte erhöht. Jedoch wurde dieser Effekt in Ether Lipid‐defizienten Zellen nicht beobachtet. 

Zusätzlich  waren  in  dieser  Zelllinie  die  Proteinmengen  von  Cx43  im  Vergleich  zu  den 

Kontrollzellen signifikant reduziert. Interessanterweise war diese Reduktion vor allem in den 

Phospho‐Isoformen  prominent.  Zudem  zeigten  Immunfluoreszenzfärbungen,  dass Cx43  an 

Stellen  von  Zell‐Zellkontakten  lokalisiert,  sodass  ein  kontinuierliches  Signal  entsteht, 

während diese Färbung in den primären Fibroblasten ohne Ether Lipide nicht zu finden war. 

Wir  untersuchten  auch  die  Raft‐Lokalisation  von  Cx43  durch  die  Isolation  von Detergenz‐

resistenten Membranen der beiden Zelllinien und fanden  in Kontrollzellen den Großteil der 

Cx43‐Phosphoisoformen  in den Raft‐Fraktionen, während  in mutanten Zellen kaum welche 

anwesend  waren.  Die  berichteten  RCDP‐Fälle  mit  Herzanomalien  veranlassten  uns  zur 

Überprüfung von Cx43 in Herzgeweben von Mäusen. Verglichen mit Wildtyp‐Mäusen, waren 

Cx43 Proteinmengen in den Herzen der Ether Lipid‐defizienten Mäuse signifikant reduziert. 

  Zusammengefasst  deutet  diese  Arbeit  auf  eine  mögliche  Beteiligung  von  Cx43  im 

pathologischen Ablauf des RCDP an. Damit ist es naheliegend zu vermuten, dass Cx43 in den 

zugrunde  liegenden molekularen Mechanismen  der  Herzphänotypen  von  RCDP‐Patienten 

beteiligt  sein  kann.  Diese  Daten  beschaffen  genügend  Information,  um  detaillierte 

Untersuchungen zu rechtfertigen.   

 

7

 

2 INTRODUCTION 

Cells are the smallest units forming the whole organism and thus crucial for  its appropriate 

function. Membranes  allow  their  existence  and  are  a  barrier  to  help  control  passage  of 

metabolites,  ions,  substrates.  By  doing  so,  they  automatically  serve  as  a  first  platform  in 

initiating signaling into and out of the cell. Therefore, their composition is essential to clearly 

define each task.   

2.1 Membranes and Lipids 

  Plasma membranes  of mammalian  cells  are  bilayers  composed  of  phospholipids.  Their 

chemical,  amphiphilic  composition  renders  them  bipolar,  with  a  polar  hydrophilic  head 

group and a nonpolar hydrophobic tail bearing fatty acid chains. This allows a spontaneous 

attraction of the tails to each other and the polar heads to be exposed to the aqueous face, 

leading to a typical bilayer structure (Figure 2‐1) (Alberts, 2008). 

 

  However, the leaflets of the bilayer are by far not identical: while the outer part has been 

reported  to  contain  more  choline‐containing  phospholipids,  the  inner  part  has 

predominantly aminophospholipids (Fadeel and Xue, 2009; Quinn and Kagan, 2002) (Figures 

2‐1, 2‐2).  This asymmetry is maintained and used deliberately for signaling and for achieving 

specific domains  in the membrane, which  is also the reason for the apical‐basal polarity of 

epithelial cells (Cooper, 2000; Simons and van Meer, 1988). 

Figure  2‐1.  Schematic  illustration  of  the  membrane  bilayer 

depicting  its  typical  lipids.  Note  the  asymmetry  between  the 

leaflets. (modified from The Cell: A Molecular Approach 2nd ed.)

Introduction 

 

 

  In  addition  to phospholipids  that  can be divided  further  into  glycerophospholipids  and 

sphingolipids (Figure 2‐3), mammalian membranes contain glycolipids and cholesterol. Each 

lipid class will be briefly discussed here, with a stronger emphasis on glycerophospholipids. 

 

  Glycerophospholipids are  the major  structural  lipids and consist of a glycerol backbone 

that  offers  three  hydroxyl moieties which  are  defined with  sn  (stereospecific  numbering) 

positions1. Two of these, sn1 and sn2, are generally esterified to fatty acids while the “head” 

                                                            1 Lipidmaps.org 

Figure 2‐2. Percentage of major membrane phospholipids in the cytoplasmic and outer leaflets 

as reported in the human erythrocyte membrane.   

PC‐phosphatidylcholine,  PE‐phostphatidyl  ethanolamine,  SM‐sphinghomyelin,  PI‐phosphatidylinositol,  PS‐

phosphatidylserine   (Quinn and Kagan, 2002) 

Cytoplasmic Leaflet Outer Leaflet

Figure 2‐3. Overview of membrane lipids illustrated as building blocks 

 (from lipidlibrary.aocs.org) 

Introduction 

9

 

is attached to a phosphate group bearing an alcohol such as choline, ethanolamine or serine 

(Figures 2‐3, 2‐4) (Alberts, 2008; Sprong et al., 2001).  

 

  Phosphatidylcholine  (PC)  is  the main  lipid  accounting  for  about  50%  or more  of  the 

phospholipids. Another phospholipid  is phosphatidylethanolamine (PE) with a smaller head 

group and a conical shape  leading to curvature stress  in the membrane that causes events 

like budding, fission and fusion. Phosphatidylserine  is normally kept  in the  inner  leaflet but 

switched to the outer side  if the cell undergoes apoptosis  (Fahy et al., 2005; Marsh, 2007; 

van Meer, 2005; van Meer et al., 2008).  

  Sphingolipids  comprise  the  second  category,  differing  in  their  backbone  containing 

sphingosine  instead  of  glycerol.  The  main  representative  is  sphingomyelin  (SM)  with  a 

phosphocholine head  group  (Figure 2‐5),  and  is mainly  located  in  the outer  leaflet of  the 

membrane. Sphingomyelin is able to form a solid membrane on its own due to its saturated 

tails,  leading  to  a  separate,  less  fluid  phase  in  the membrane  and  thus making  a  tighter 

packing possible (van Meer, 2005; van Meer and Lisman, 2002).  

Figure 2‐4. Schematic  illustration of a glycerophospholipid with  its basic  structure  found  in 

mammalian membranes. Structure of a bilayer (A) composed of phospholipids which consist of 

a hydrophilic head (green) and two hydrophobic tails (purple) attached to the three moieties of 

a glycerol molecule (B and C).  (modified from Nature Scitable)

Introduction 

10 

 

 

 

  Cholesterol is the only non‐polar lipid constituent of mammalian membranes, accounting 

for about 25% of lipids, being responsible for its fluidity and packing (Alberts, 2008; Ikonen, 

2008).  Cholesterol  has  been  shown  to  especially  associate with  sphingomyelin,  for which 

models were  raised  to  explain  the  reason  (reviewed  in  Ikonen,  2008). Nevertheless,  this 

tendency allows special domains  in  the membrane  to  form,  leading  to dynamic platforms, 

termed membrane rafts (Pralle et al., 2000). 

  Other  lipid  species  occur  as minor  components  of  the membrane,  such  as  glycolipids 

containing sugar units, phosphoinositides, and ether lipids, which differ in their sn1 position 

carrying an ether bond. 

2.2 Membrane Rafts 

  The  early  view  of  the  cell membrane  to  solely  be  an  inert  “solvent”  for  membrane 

proteins  (Singer  and Nicolson,  1972) was  shown  to  be wrong  through  the  emergence  of 

studies  reporting  domains  to  be  present  in  the  membrane  (Spector  and  Yorek,  1985). 

Eventually,  the  existence  of  such  domains  was  generally  accepted,  leading  to  the  term 

“membrane  rafts”  suggested  by  Simons  and  van  Meer  (Simons  and  van  Meer,  1988). 

According to the raft concept that was revised at the Keystone symposium (Pike, 2006), rafts 

are  floating microdomains  enriched  in  sterol  and  sphingolipids with  highly  dynamic  and 

heterogenous  features and  can be  stabilized  to  result  in  larger platforms  (Jacobson et al., 

2007) (Figure 2‐6).  

Figure  2‐5.  Basic  structure  of  a 

sphingolipid.  The  head  group  (“R”)  is 

commonly  a  phosphocholine  or  a 

phosphoethanolamine. (modified from themedicalbiochemistrypage.org)

Introduction 

 

 

  According  to  Simons  and  Toomre  (2000)  these membrane  rafts  “form  distinct  liquid‐

ordered  phases  in  the  lipid  bilayer, dispersed  in  a  liquid‐disordered matrix  of  unsaturated 

glycerolipids”.  Each  of  these  detergent‐resistant  domains  (DRMs),  as  they  are  isolated 

biochemically  (Coskun and Simons, 2010),  is unique on  its own as a result of specific  lipid‐

lipid,  lipid‐protein  as  well  as  protein‐protein  interactions.  Thus,  it  is  possible  to  actively 

exclude and/or  include proteins  (Pike, 2004, 2009; Simons and Toomre, 2000) and certain 

proteins have been found to preferentially associate  into rafts. The best example would be 

glycosyl‐phosphatidyl‐inositol (GPI)‐anchored proteins that are  localized at the outer  leaflet 

(Chatterjee  and  Mayor,  2001).  This  anchor  is  a  complex  compound  consisting  of 

phosphatidylinositol, sugar residues and a lipid part that bears an ether bond and is linked to 

the protein (Mayor and Riezman, 2004). Also double‐acylated, palmitoylated or cholesterol‐

binding proteins have been shown in rafts (Chatterjee and Mayor, 2001; Levental et al., 2010; 

Pike, 2004).  

  The  functions  of  rafts  are manifold,  but most  importantly,  they  serve  as  platforms  to 

cluster proteins for their interaction or initiation of subsequent signaling events (Brown and 

London,  2000;  Simons  and  Toomre,  2000;  Thomas  et  al.,  2004),  to  give  rise  to  cell‐cell 

interactions,  trafficking and polarization  (Bretscher and Munro, 1993; Brown and  London, 

1998; Mayor and Riezman, 2004; Rajendran and Simons, 2005). 

Figure  2‐6.  Raft model.    Cholesterol  and  sphingolipid‐enriched  domains  are  present  in  the 

glycerophospholipid  (GPL)  membrane,  bearing  raft  proteins  and  thus  excluding  non‐raft 

proteins.  (modified from Lingwood & Simons, 2010)

Introduction 

12 

 

  In  addition  to  their  fundamental  components  sphingolipid  and  cholesterol,  Pike  and 

colleagues could first show through electrospray ionization/mass spectometry (ESI/MS) that 

rafts also  contain a  substantial amount of plasmalogens, members of  the ether  lipid  class 

(Pike et al., 2002). 

2.3 Ether Lipids 

  These  special glycerophospholipids differ  in  their  sn1 position by having an ether bond 

instead  of  an  ester.  Ether  lipids  can  be  divided  into  two  groups,  contingent  upon  the 

substituents  at  the  sn1  position:  (1)  alkylacyl  (often  used  plasmanyl  as  prefix)  and  (2) 

alkenylacyl  (plasmenyl)  glycerophospholipids.  The  alkylacyl  species  consist of  the platelet‐

activating  factor  (PAF),  seminolipids,  and  the  lipid moiety of GPI‐anchors  (Farooqui et  al., 

2008; Kanzawa et al., 2009). The alkenylacyl class, also known as plasmalogens in mammals, 

further differs slightly due to its vinyl ether bond (Figure 2‐7) at the sn1 position, which has 

been found almost exclusively with 16:0, 18:0 and 18:1 fatty acids. The sn2 position normally 

has  a  polyunsaturated  fatty  acid  (PUFA)  such  as  docosahexaenoic  acid  (DHA,  ω‐3)  or 

arachidonic  acid  (AA,  ω‐6),  while  the  head  group  at  sn3  can  be  either  a  conventional 

phosphoethanolamine or phosphocholine (Nagan and Zoeller, 2001).  

 

  Although  these  lipids  have  been  neglected  for  many  years,  they  are  of  particular 

importance, since they comprise 18% of the total phospholipid mass in humans. This value is 

much higher in some tissues including brain, skeletal muscle, lymphocytes, macrophages and 

heart (Nagan and Zoeller, 2001). Many functions have been found for plasmalogens that are 

now  being  increasingly  studied.  They  are  thought  to  quickly  respond  to  different 

Figure 2‐7. Structure of a plasmalogen. Plasmalogens bear the typical double bond at their sn1 

positions. R1 is either 16:0, 18:0 and 18:1, R2 either arachidonic acid or docosahexaenoic acid; the 

sn3  position  harbors  the  conventional  head  groups  (phosphatidylcholine, 

phosphatidylethanolamine).   (modified from Wallner and Schmitz, 2011) 

Introduction 

 

environmental conditions due to their short half‐lives (Wallner and Schmitz, 2011), with 30 

minutes for plasmenylcholine and about 3 hours for plasmenylethanolamine (Rintala et al., 

1999). Glaser and Gross could show that plasmenylethanolamine can increase the kinetics of 

vesicle  fusion  (Glaser and Gross, 1994), while a plasmalogen‐deficient murine cell  line has 

been reported with a reduction in HDL‐mediated cholesterol efflux that could be restored to 

control  levels by  treatment with a precursor  substance  (Mandel et al., 1998). This  can be 

explained  by  plasmalogens  leading  to  a  tighter  packing  of  the membrane  (Gorgas  et  al., 

2006), which  could  also be  a prerequisite  for  a  correct membrane  trafficking  (Thai et  al., 

2001). Another function that was proposed for plasmalogens is to act as a storage depot for 

PUFAs and thus, for second messengers, due to the possibility of arachidonic acid (AA) being 

metabolized  to  such  (prostaglandins  etc.).  Additionally,  the  double  bond  is  thought  to 

protect against radicals (Farooqui and Horrocks, 2001). Moreover, plasmalogens are thought 

to play a role  in  the process of myelination as  they occur  in high concentrations  in myelin 

(Gorgas et al., 2006).  

  Interestingly, plasmenyl ethanolamine was shown to be enriched in rafts of, for example, 

KB cells2 (Pike et al., 2002) and also  in detergent‐resistant membranes  isolated  from brain 

myelin (Rodemer et al., 2003) as well as in plasma membrane fractions of T‐cells (Zech et al., 

2009).  In  our  laboratory,  it  could  be  shown  by  sucrose  gradient  centrifugation  that 

plasmalogen deficiency specifically leads to alterations of raft proteins such as Flotillin (Flot) 

and  the GPI‐anchored  protein  Thy‐1, which  shift  to  non‐raft  fractions  (Fabian Dorninger, 

2011, Diploma  Thesis).  Thus,  it  is  possible  that  these  lipid  species  contribute  to  or  even 

enable  rafts  to  accomplish  the  various  functions  described  above,  emphasizing  their 

importance for cell membranes.  

                                                            2 epidermal carcinoma cells derived from Hela cells (ATCC: CCL‐17) 

Introduction 

14 

 

 

2.3.1 Biosynthesis of Plasmalogens  

  The generation of plasmalogens is a multi‐step process involving the peroxisomes and the 

ER  membrane  (Figure  2‐8).  Long‐chain  fatty  alcohols  and  dihydroxyacetone  phosphate 

(DHAP) are the starting substrates. Peroxisomes offer an environment for the first two steps: 

DHAP‐acyltransferase (DHAPAT) catalyzes the esterification of DHAP with an acyl‐CoA, which 

is then converted  into alkyl‐DHAP by alkyl‐DHAP‐synthase  (ADHAPS). Thus, ADHAPS  inserts 

the typical ether bond by  incorporating a  long‐chain fatty alcohol, derived from the diet or 

produced by the enzyme fatty acyl‐CoA reductase (FAR), at the sn1 position. The remaining 

steps are  then  carried out at  the  cytosolic  side of  the ER, as  is  the  case  for diacylglycerol 

biosynthesis:  reduction  to  alkyl‐glycero‐3‐phosphate  (alkyl‐G3P), which  is  converted  to  1‐

alkyl‐2‐acyl‐G3P and finally 1‐alkyl‐2‐acyl‐glycerol that eventually obtains  its head group via 

the phosphotransferases (Brites et al., 2004; Nagan and Zoeller, 2001; Wallner and Schmitz, 

2011).  

  It  is clear that, to ensure a functional biosynthetic pathway, all respective enzymes have 

to be present at  their  right places. Therefore, a  functional  transport system  is  required  to 

fulfill  this  task.  For  the enzymes  at  the  ER membrane,  this will not be discussed here,  as 

attachment  to  the  ER  is  a  common  event  for  the  cell  and  has  been  intensively  studied 

(Rapoport, 2007). However, the peroxisomal  location of DHAPAT and ADHAPS  is crucial for 

their  proper  enzymatic  activity  and  stability.  Furthermore,  co‐immunoprecipitation  (CoIP) 

revealed  a  heterotrimeric  protein  complex  including  a  DHAPAT  isomer  in  a  different 

conformation  (Biermann  et  al.,  1999).  It  is  also  known  that  proper  activity  of DHAPAT  is 

dependent upon  this  interaction  (Nagan and Zoeller, 2001), which was also  reflected as a 

reduction in ADAPS‐deficient human skin fibroblasts (Thai et al., 2001). Thus, both enzymes 

have to be imported into peroxisomes, for which they harbor a peroxisome targeting signal 

(PTS): ADHAPS is a PTS2 cargo protein and DHAPAT carries a PTS1 sequence.  

Introduction 

15

 

 

2.3.2 Peroxisomes and the Peroxisomal Import 

  Peroxisomes are ubiquitous organelles surrounded by a single membrane. As described 

above, peroxisomes are the site for the first two steps of ether lipid biosynthesis. However, 

they  are  also  responsible  for  a  variety of metabolic  reactions  such  as  β‐oxidation of  very 

long‐chain fatty acids (VLCFA), fatty acid (FA) α‐oxidation, elongation of Fas and degradation 

of amino acids as well as of hydrogen peroxide (Wanders and Waterham, 2006). Thus, also 

various  transporters  have  to  be  present  in  the  membrane  to  make  the  import  of  the 

substrates possible.  

Figure  2‐8.  Biosynthesis  of  alkenylacyl  ether  lipids.  In  the  peroxisomal  compartment,  DHAP 

originating  from  the glycolytic pathway  is converted  to acyl‐DHAP by  the enzyme DHAPAT and 

subsequently  a  long‐chain  fatty  alcohol  is  introduced  by  the  synthase  ADHAPS.  The  resulting 

compound alkyl‐DHAP is a substrate for the reductase at the ER membrane and thus is exported 

and used  for  the  final  synthesis of plasmalogens. DHAP = dihydroxyacetone phosphate; Far1 = 

fatty  acyl‐CoA  reductase1;  G3PDH  =  glyceraldehyde‐3‐phosphate  dehydrogenase;  DHAP‐AT  = 

DHAP acyltransferase; ADHAP‐S = alkyl‐DHAP phosphate synthase; AADHAP‐R = acyl/alkyl‐DHAP 

reductase; AAG3P‐AT = acyl/alkyl‐glycero‐3‐phosphate‐acyltransferase; PH = phosphohydrolase; 

C‐PT, E‐PT = choline or ethanolamine phosphotransferase; GPC, GPE = glycerophospho‐ choline 

or ‐ ethanolamine, respectively.    (modified from Wallner and Schmitz, 2011) 

Introduction 

16 

 

  For  the biogenesis,  the peroxisomal membrane  is derived  from  the ER  followed by  the 

peroxisomal membrane proteins (PMPs) being integrated through the specific Peroxin (Pex), 

Pex19. Dysfunction  of  Pex  proteins  involved  in  this  process  can  cause  lethal  peroxisomal 

biogenesis  disorders  (PBD),  such  as  the  Zellweger  syndrome, where  no  peroxisomes  are 

present. 

  The  organelle  is  then  completed  when  all  the  needed  proteins  are  imported  via  the 

existing soluble receptors PEX5 and PEX7, which recognize their respective PTS located in the 

cargo  proteins.  PEX5  binds  PTS1,  a  short  peptide  sequence  (‐SKL  or  variants)  at  the  C‐

terminal end, while Pex7 associates with the nonapeptide PTS2 near the N‐terminus.  

  The delivery  is  thought  to be  initiated by  the binding of  the PEX5  receptor  to  the PTS1 

sequence  of  a  protein  in  the  cytosol  (Figure  2‐9).  This  pair  then  associates  to  a  docking 

complex  at  the peroxisomal membrane  to be  integrated. Consequently,  substrate  release 

occurs through the help of various Pex proteins. Finally, the receptor is either ubiquitinylated 

for  degradation  or  recycled  back  into  the  cytosol.  For  PEX7  and  PTS2,  the mechanism  is 

thought to be similar (Erdmann and Schliebs, 2005). 

 

  So  far,  these  two receptors with  the associated protein complexes seem  to be  the only 

transport machineries responsible for translocating matrix proteins into the peroxisomes. Of 

course,  transporters  for  substrates  that  are  needed  for  various metabolic  pathways  also 

have  to  be  considered.  Thus, mutations  in  the  respective  PEX  genes  can  lead  to  empty 

organelles which are then called “ghosts”, consequently leading to non‐functional metabolic 

pathways (Ma et al., 2011). Such a condition would be detrimental in humans but also single 

peroxisomal  enzyme  deficiencies  can  lead  to  severe  disorders  such  as  X‐linked 

Figure 2‐9. Peroxisomal matrix protein import.  Transport  of  matrix  proteins  into  the  peroxisome 

principally  occurs  in  four  steps:  cytosolic  receptor 

Pex5 binds a PTS1‐carrying protein, directing it to the 

peroxisomal membrane where docking to a complex 

occurs  followed  by  the  release  of  the  substrate  to 

the matrix and subsequently of the receptor back to 

the cytosol.   (modified from Erdmann and Schliebs, 2005) 

Introduction 

17

 

adrenoleukodystrophy  with  a  deficient  VLCFA  transporter,  Refsum  disease  where  the 

alanine:glyoxylate  aminotransferase  is mutated  and  rhizomelic  chondrodysplasia  punctata 

(RCDP)  that  manifests  through  mutations  in  PEX7,  DHAPAT  or  ADHAPS  (Wanders  and 

Waterham, 2006). RCDP will be described in detail as it will be relevant for this manuscript. 

2.4 Rhizomelic Chondrodysplasia Punctata (RCDP) 

  RCDP is a deleterious autosomal recessive peroxisomal disorder characterized by skeletal 

abnormalities  (shortening  of  the  proximal  bones,  rhizomelia),  mental  retardation, 

developmental delay, cataracts and facial dysmorphisms (Figure 2‐10), with a prevalence of 

1 in 100,000 individuals (Stoll et al., 1989). Psychomotoric abilities are impaired and seizures 

are common. Respiratory problems additionally  impede the  lives of the patients. However, 

RCDP may also show up in milder forms (Steinberg et al., 2006). Around 60% of the affected 

children survive the first year after birth (Shanske et al., 2007). 

 

  There are three types of RCDP:  in the classical form (type 1) which  is the most common 

with more than 90%, the gene encoding for PEX7 is mutated (Braverman et al., 1997; Motley 

et al., 1997; Purdue et al., 1997) while type 2 and 3 are caused by mutations in DHAPAT and 

ADHAPS with less than 10% affected patients (de Vet et al., 1998; Itzkovitz et al., 2011; Thai 

Figure 2‐10. Overview of phenotypes  in RCDP. Depending on  the affected gene, RCDP  is 

characterized into three types, manifesting itself in anomalies such as skeletal abnormalities, 

mental retardation and cataracts. 

Introduction 

18 

 

et al., 1997; Wanders et al., 1994). Although the progression of RCDP  is quite similar  in all 

patients,  there  have  been  reports  on  cases  with  additional  anomalies,  especially  such 

regarding the heart. 

2.4.1 Cases of RCDP associated with heart abnormalities 

  Cardiac  complications  described  in  RCDP  cases  are  mostly  congenital  heart  lesions. 

Already Schönenberg and Schallock  (Sastrowijoto et al., 1994)  informed about RCDP cases 

with cardiac abnormalities in 1953, but did not give any details. Through literature research 

we found 47 RCDP case reports, of which 11 were described to be associated with congenital 

heart lesions. The most common described phenotypes include the following: 

1) Ventricular septal defect (VSD) 

  The wall  (septum) which separates  the ventricles  from each other contains an opening, 

leading  to a  transport of deoxygenated blood  to  the  lungs. Fourie  reported a  case with a 

large VSD resulting from the complete absence of the infundibular septum. The case report 

of  Pascolat  described  a  specific  VSD  called  “subaortic  perimembranous  intraventricular 

communication” (see Table 2‐1). 

2) Pulmonary atresia (PA) and pulmonary stenosis (PS) 

  While  in PA the pulmonary valve  is underdeveloped,  it  is defective  in PS.  In both cases, 

blood partially cannot flow out to the lungs. 

3) Tetralogy of Fallot (TOF) 

  A heart disorder commonly associated with RCDP  is tetralogy of Fallot which consists of 

four  components:  ventricular  septal  defect,  pulmonary  stenosis,  an  aorta  that  is  directly 

placed above the VSD (overriding aorta) and right ventricular hypertrophy (RVH) in which the 

right  ventricle  thickens  as  a  cause  of  the  heart  pumping  harder  due  to  the  narrowed 

pulmonary valve (Figure 2‐11). 

Introduction 

19

 

 

4) Atrial septal defects (ASD) 

  Atria are not completely restricted from each other through the septum and thus lead to 

the  same  effect  as  VSD.  Yalin  and  colleagues  (2003)  reported  specific  ASD  types  called 

“patent foramen ovale”, a remnant of the fetal septal connection, which was also the case in 

Dilli et al. and twice in Fourie’s literature review (Fourie, 1995). The patient in Pascolat’s case 

showed a moderate interatrial communication along with repercussion (see Table 2‐1).  

5) Patent ductus arteriosus (PDA) 

  Before birth, the pulmonary artery and the aorta have a small connection to each other, 

allowing  the blood of  the mother  to bypass  the  lungs. This  connection  is normally  closed 

after birth; if PDA is present, this event cannot occur. 

  Additional conditions are  listed  in Table 2‐1 that summarizes our  literature findings.  It  is 

noteworthy that some of these heart complications were also linked to the reduced levels of 

a special protein, Connexin‐43 (Cx43), which will be covered in its own section. 

 

Figure 2‐11. Pathologies in TOF compared to healthy heart. Deoxygenated blood is not able 

to  flow  to  the  lungs  due  to  closed  or  narrowed  pulmonary  valves,  leading  to  a  stronger 

pumping of the right ventricle that will thicken itself. Additionaly, oxygen‐poor blood will mix 

with oxygen‐richblood as a result of a ventricular septal defect and an aorta located between 

the ventricles.   (modified from my.clevelandclinic.org) 

Normal  TOF

Introduction 

20 

 

 

2.4.2 Mouse Models 

  Plasmalogen studies were also performed in several mouse models. The group of Wilhelm 

Just was first to characterize the role of ether lipids by disrupting the Dhapat gene in mice, 

of  which  about  40%  died  within  4‐6  weeks.  Living  homozygous  mice  displayed  ocular 

anomalies  (Rodemer et al., 2003), besides an  affected  fertility  in  females and a  complete 

infertility  in males due to spermatogenetic arrest. More detailed analyses revealed defects 

including  impaired  CNS myelination with  a  reduction  in myelin  basic  protein, migrational 

delay of precursor granule cells and a decrease  in  the conduction velocity of axons  in  the 

corpus  callosum,  a  region  connecting  the  two  hemispheres  and  thus  allowing  their 

coordination (Teigler et al., 2009). Additionally, the reduction of Cx43, a protein shown to be 

present  in  rafts, has been documented by Rodemer et al.  in cultured  fibroblasts obtained 

from these mice (Rodemer et al., 2003). Interestingly, skeletal abnormalities were not noted 

in  this mouse model.  Behavioral  studies  recently  performed  by  our  group3 demonstrated 

sensomotoric abnormalities  in  these mice, proportionally  increasing with age. The animals 

                                                            3 By Fabian Dorninger, 2011, diploma thesis  

Year  Publication  Details 

1994  Sastrowijoto et al.  Abortion, DiGeorge anomaly 

2002  Castro et al.  AS 

2003  Pascolat et al.  subaortic perimembranous IVC with moderate repercussion and IAC 

2003  Yalin et al.  PFO, membranous VSD 

2007  Figueiredo et al.  Mild mid‐bibasal crepitation and absence of abdominal alterations 

2008  Dilli et al.  Aberrant intracardiac band, mild PS, PFO and PDA; fetal arrhythmia 

2008  Kazemian et al.  TOF 

2010  Akgun et al.  TOF 

2010  Naher et al.  Small membranous VSD 

2010  Nimmo et al.  TOF 

2011  Oswald et al. Moderate to severe biventricular dysfunction and tricuspid regurgitation compatible with persistent pulmonary hypertension 

  Total 11  out of 47 RCDP cases 

Table 2‐1. RCDP cases associated with heart complications.  

AS, aortic stenosis; IVC, intraventricular communication; IAC, interatrial communication; PFO, 

patent foramen ovale; VSD, ventricular septal defect; PS, pulmonary stenosis; PDA, patent ductus 

arteriosus; TOF, tetralogy‐of‐Fallot 

Introduction 

21

 

also  exhibited  a  clamping  reflex with  a  poor  performance  on  the  balance  beam  and  the 

rotarod. 

  Mice  lacking  the  peroxisomal  transporter  Pex7  have  been  reported  to  be  severely 

hypotonic at birth having a high mortality rate of 70% before weaning (Brites et al., 2003). 

Surviving Pex7‐/‐ mice were  infertile and displayed decreased motility along with cataracts. 

Furthermore,  endochondral  ossification,  which  is  one  of  the  essential  processes  in  the 

skeletal development, was severely impaired. The authors proposed this characteristic to be 

the  origin  of  the  skeletal  hallmarks  seen  in  patients.  Additional  investigations  were 

performed  on  coronal  sections  of  the  cortex  of  embryonic  Pex7‐/‐ mice  which  revealed 

defective neuronal migration. Consequently, authors  suggested  this  to be due  to deficient 

ether lipids and VLCFA accumulation. Indeed, a later publication by the same group justified 

this view through a mouse model deficient in both ether lipids and a transporter for VLCFAs, 

indicating a possible modulatory role of plasmalogens in VLCFA‐induced pathology (Brites et 

al.,  2009). Despite  all  these  findings,  adult  Pex7‐/‐  did  not  have  elevated VLCFA  levels,  in 

contrast to their high accumulation in RCDP type 1 patients. 

  A Pex7 hypomorphic mouse model was  recently documented, as having a  reduction  in 

Pex7  transcript  levels  to  less  than  5%  of  wildtype  (Braverman  et  al.,  2010)  which 

nevertheless caused moderate defects  in the plasmalogen synthesis. The mice were  fertile 

and had a normal life span, however, their skeleton was smaller and cataracts were visible. 

Braverman and colleagues suggested this model to reflect the milder RCDP phenotypes. 

  Very recently, an Adhaps mouse model has been described by Liegel et al., arising from a 

hypomorphic  point mutation  that  resulted  in  high  levels  of  incomplete  and  unfunctional 

transcript. Also here, a certain peri/prenatal lethality, infertility and cataracts were observed. 

Remarkably,  in  these mice symptoms of hypotonia or delayed growth were missing, along 

with a lack of defects in neuronal migration, bone development or myelination. The authors 

supposed the reason to be the residual amounts in plasmalogen. 

2.5 Connexins 

  Cells have different ways to communicate with each other, be it indirectly through signals 

or  in  a  direct  way.  The  most  direct  communication  is  probably  made  possible  by  gap 

junctions, used  to  coordinate  cellular events  in  tissues  in a most efficient way. Here,  two 

cells are connected to each other by a channel spanning from one to the other membrane, 

Introduction 

22 

 

leaving  a  gap  of  about  2‐3  nm.  This  gap  junction  (GJ)  is  composed  of  two  hemichannels 

provided by each of the contacting cells. Such a hemichannel or connexon  is a hexamer of 

connexins,  which  have  four  transmembrane  domains  with  one  intracellular  and  two 

extracellular loops, N‐ and C‐terminal ends being cytosolic (Figure 2‐12). Docking is possible 

through the cystein residues in the extracellular loops (Martin and Evans, 2004).  

  connexins are a whole family of gap‐junctional proteins arising from 21 different Connexin 

genes in humans that differ mainly in the carboxy‐terminal domain and are named according 

to  their  molecular  weight  with  the  prefix  “Cx”  (Willecke  et  al.,  2002).  An  alternative 

nomenclature classifies the proteins according to their sequence similarity and the length of 

the cytoplasmic loop, with α and β subgroups and the prefix “Gj”. Accordingly, Cx43 is Gjα1 

or  Gja1.  Currently,  the  latter  system  is  often  used  for  the  gene  names,  while  the  Cx 

nomenclature is common for the protein (Harris and Locke, 2009).  

 

  One  tissue  or  cell‐type  can  express many  Connexin  isoforms, making  possible  to  have 

homo‐ or hetero‐oligomeric connexons. However,  it has been found that not all Connexins 

are “compatible” with each other but generally within a subgroup (Segretain and Falk, 2004). 

  The oligomerization occurs already at the ER membrane  for most of the connexins and, 

after being transported to the plasma membrane, they can serve as functional units for ATP 

uptake,  NAD+  release,  kinase  activation  and  important  cellular  events  such  as  apoptosis 

(Goodenough  and  Paul,  2003),  forming  a  non‐junctional  pool  of  hemichannels.  These 

connexons can then group together and are able to dock to other connexons of an apposing 

cell, yielding gap  junction channels. Also here,  it  is possible to assemble with connexons of 

Figure  2‐12.  Connexins  and  gap  junctions.  A)  Topological  organization  of  a  Connexin  in  the 

membrane  with  its  extracellular  loops  (E1  and  E2)  and  4  transmembrane  domains  (M);  B) 

Illustration of a gap junction plaque with the two cell membranes contributing connexons. E1, E2: 

extracellular loop 1, 2; M1‐4: transmembrane domains 1‐4; ©: Cystein residues. (modified from Söhl and Willecke, 2004) 

Introduction 

23

 

either  the  same  or  different  types,  resulting  in  homo‐  or  heterotypic  channels  which 

determines the specific permeability of each channel (Figure 2‐13) (Segretain and Falk, 2004). 

 

  Further  aggregation  into  tight  clusters  results  in  so‐called  gap  junction  plaques.  How 

these  stages  are  achieved  has  not  been  clarified  yet,  however,  results  from  electron‐

microscopic and electro‐physiological  studies  indicated undocked connexons  to group  in a 

loose manner and, after forming full  intercellular channels, to aggregate. Additionally, new 

channels can join the cluster, rendering the plaque to grow (Johnson et al., 1974). In contrast 

to the last point, fluorescence recovery after photobleaching (FRAP) of transfected HeLa cells 

suggested  that not  channels but new  connexons enter  the  clusters at  their outer margins 

(Lauf et al., 2002). Also, it is not clear yet whether connexons dock first and then aggregate 

or  vice  versa,  along with  the exact mechanism. Gap  junction plaques  are highly dynamic: 

they can grow or shrink, probably reacting to changes  in  intercellular interaction (Jordan et 

al., 1999; Lopez et al., 2001) resulting in a turnover of about 2 to 4 hours (Harris and Locke, 

2009). 

  This docking establishes  a direct  and  functional  cell‐cell  communication  that  is  termed 

"gap‐junctional  intercellular  communication"  (GJIC),  as  the  formed  channel  can  convey 

molecules of up to 1 kDa, including ions, ATP, cAMP and small metabolites such as glucose. 

In addition  to  this metabolic  coupling, gap  junctions also  relay electrical  currents  that are 

fundamental for the electrical coupling of cardiomyocytes, interneurons and smooth muscle 

cells  (Harris and  Locke, 2009; Kumar and Gilula, 1996). Furthermore,  these  structures  can 

Figure 2‐13. Differential assembly options of Connexins in hemichannels and gap junctions. 

Connexins  of  the  same  isoform  assemble  into  homomeric  connexons,  while  heteromeric 

hemichannels  are  composed of  different Cx  types. A  further  combination  can happen with 

different connexons resulting in heterotypic or same connexon types giving rise to homotypic 

channels.   (from  Kumar and Gilula, 1996) 

Introduction 

24 

 

open or close depending on signals such as voltage, pH, intracellular Ca2+ or phosphorylation 

at  their  C‐terminal  domains  (Spray  et  al.,  1984).  Each  Connexin  isoform  differs  from  the 

other, thus  leading to connexons and gap  junctions to have unique conductive, gating and 

permeability properties (Goldberg et al., 2004). (Naus and Laird, 2010) 

  As  gap  junctions  are  almost  ubiquitously  expressed  and  have  been  intensively  studied 

since their discovery, a variety of functions has been and is still being identified. By allowing 

coordinated  responses  of  tissues  to  external  signals  through  metabolic  cooperation  to 

maintain tissue homeostasis or through electrical propagation (Mese et al., 2007) they play a 

role in essential cellular events such as proliferation, migration, differentiation and apoptosis 

(Gilleron  et  al.,  2009;  Laird,  2006). Many  publications  could  show  that  cell  death  can  be 

propagated to  living cells, as shown  in many cancer types  like  lung and brain cancer, which 

display a reduced gap‐junctional coupling (reviewed in Naus and Laird, 2010). Gap junctions 

have long been implicated in growth control, which was unambiguously shown with the help 

of mice  lacking  specific connexins  such as Cx43,  leading  to  lung neoplasms  (Cronier et al., 

2009). 

2.6 The role of lipid rafts in gap junctions 

  It is obvious that gap junctions and especially the formation of gap junction plaques must 

require a  special  lipid environment  to allow  such a  tight aggregation. Hence,  studies have 

been  performed  to  determine  the  lipid  surroundings  of  gap  junctions.  Gap  junction 

preparations  after  detergent  extraction  displayed  high  amounts  in  sphingomyelin  and 

cholesterol compared with the remaining plasma membrane (Malewicz et al., 1990). When 

applied  exogenously,  cholesterol  increased  gap  junction  assembly  by  de  novo  protein 

translation  (Meyer  et  al.,  1990).  Several  connexins,  including  Cx43,  have  been  shown  by 

immunofluorescence  to  colocalize  with  Caveolin‐1  (Cav‐1)  at  sites  of  cell‐cell  contact, 

indicating association with rafts in junctional areas. This was also confirmed by CoIP and raft 

isolates  obtained  by  sucrose  density  gradient  after  detergent  extraction,  revealing  the 

presence  of  Cx43  in DRMs  and  a  possible  interaction with  Cav‐1  (Schubert  et  al.,  2002). 

However,  it  seems  that not all  connexins behave  similarly: Cx26 was present  in  rafts only 

with Cav‐1, while Cx50 was not  found  in rafts at all. Hesketh and coworkers also reported 

the presence of Cx43 in raft isolates of canine heart (Hesketh et al., 2010). These and other 

Introduction 

25

 

strong findings point towards an association of Connexins with rafts (Figure 2‐14) (Defamie 

and Mesnil, 2011). 

 

2.7 Connexin‐43 

  One of  the best  studied  representatives of  the Connexin  family  is Cx43. This particular 

Connexin shows widespread expression in lungs, developing skeleton and lens, vasculature, 

the ear  in  low  levels,  reproductive  systems of both male and  female,  secretory  system,  in 

keratinocyte  development  and  dermal  fibroblasts  of  the  skin,  astrocytes  in  the  nervous 

system and the heart (Harris and Locke, 2009). 

  Cx43  is  assembled  into  connexons  and  transported  to  the  cell  surface  just  like  other 

connexins, however,  the oligomerization  likely occurs  after  the ER, probably  at  the  trans‐

golgi network  (Das  Sarma  et  al.,  2002; Koval  et  al.,  1997; Musil  and Goodenough,  1993). 

Another  important  feature of Cx43  is  its hyperphosphorylation  that gives  rise  to different 

conformational  states  which  are  also  visible  as  distinct  bands  after  immunoblotting. 

Particularly, some of the 21 serine and two threonine residues at the C‐terminal domain are 

thought to be the main sites of modification (Martin and Evans, 2004). To date, at least two 

different phospho‐specific  isoforms have been reported (denoted as P1 and P2) along with 

Figure 2‐14. Gap Junctions in lipid rafts. Membrane domains possibly offer a platform for gap 

junction plaques due to the tight packing through cholesterol and sphingolipid‐enrichment. (modified from Defamie, 2011)

Introduction 

26 

 

the non and/or mildly phosphorylated form P0 (Figure 2‐15). This profile probably depends 

on the cell type (Musil et al., 1990b).  

 

  Mainly serine residues are being phosphorylated by various kinases such as the mitogen‐

activated protein kinase  (MAPK), protein kinase  c  (PKC) and PKA  in  inhibition of GJIC,  the 

casein kinases 1 and 2 (CK1 and 2) in gap junction assembly and even the cyclin‐dependent 

kinase Cdc2 for regulation during the cell cycle. In addition, the tyrosine kinase Src has been 

implicated in phosphorylation of Cx43 (Giepmans, 2004; Solan and Lampe, 2009).  

  Recently,  Solan  and  Lampe  could  assign  these  phosphorylation  states  to  some  serine 

residues  in  the  life  cycle  of  Cx43  by  using  both  immunocytochemistry  and western  blot 

analysis  with  phosphospecific  antibodies  in  several  cell  lines  (Solan  and  Lampe,  2007). 

Although not totally similar in all used cell lines, their findings support previous reports that 

generally  the  P2  isoform  occurs  exclusively  in  the  Triton  X‐100‐insoluble  gap  junction 

plaques, while  P1 may  represent  the  state  of  being  transported  to  or within  the  plasma 

membrane (Figure 2‐16) and P0 to represent newly synthesized protein (Koval et al., 1997; 

Musil et al., 1990a; Musil and Goodenough, 1991). 

Figure  2‐15.  Phospho‐specific  isoforms  of  Connexin‐43  as  detected  by  immunoblotting  in 

dermal fibroblasts. Hyperphosphorylation of Cx43 results in characteristic bands in immunoblots, 

termed  P0  to  P2.  These  bands  are  caused  by  conformational  isoforms  with  different 

electrophoretic mobilities.   (from doctoral thesis of Jared M Churko , 2011 – modified for illustration purposes) (Churko et al., 2011) 

Introduction 

27

 

 

  Mutations in the gene coding for Connexin‐43 (GJA1) in humans have recently been found 

to be  the  genetic defect  in  the  very  rare pleiotropic,  congenital  and autosomal dominant 

disorder  Oculodentodigital  dysplasia  (ODDD)  which  causes  craniofacial  anomalies,  eye 

problems  including  cataracts,  abnormal  dentition,  syndactyly  or  other  malformations  in 

hands  or  feet with  further  skeletal  abnormalities  as well  as  conductive  hearing  loss  and 

neurologic  symptoms  such  as  ataxia  and  seizures,  often  accompanied  by  a mild mental 

retardation (Paznekas et al., 2003). Anomalies  in skin, hair and nails are also common. The 

incidence is thought to be in the range of one in ten‐million individuals (Loddenkemper et al., 

2002). In 3% of cases, congenital heart diseases have been recorded that include ASD, VSD, 

PS and  right bundle branch block. However, also ODDD cases without any mutations have 

been reported (Paznekas et al., 2003; Paznekas et al., 2009). 

   

Figure 2‐16. Model depicting phosphorylation states  in  the Connexin  life cycle. Certain serine 

residues are phosphorylated at different time points in the course of Cx43 trafficking to achieve 

distinct conformational states, as shown in the inset immunoblot image.  (modified from Solan and Lampe, 2007)

Introduction 

28 

 

2.7.1 The role of Cx43 in cardiac function 

  It is well known that the contraction of the heart is facilitated by gap junctions conveying 

electrical  signals.  Cx43  is  the  dominating  gap‐junctional  protein  expressed  by 

cardiomyocytes  in  ventricles  and  atria,  together with Cx40  in  the  latter  chambers  (Figure 

2‐17A). Also the intrinsic conduction system where the electrical impulses are generated and 

conveyed  to  allow  a  coordinated  contraction  contains  Cx43, mainly  in  the  branches  that 

submit the currents to the right and left ventricles. On the cellular level, it is responsible for 

the electrical conduction from cell to cell by being confined to the intercalated discs, special 

connections  allowing  for  a  synchronized  contraction  of  the  cardiac  tissue  (Figure  2‐17B). 

Thus, Cx43 is essential for the proper functioning of the heart (Severs et al., 2008). 

 

  Interestingly,  although  mutations  in  GJA1  were  later  attributed  to  cause  ODDD  (see 

above), heart phenotypes arising  from mutant Cx43 have been  reported. Six children with 

visceroatrial heterotaxia  (defect  in establishing  the  left‐right asymmetry) had mutations  in 

the C‐terminal domain, five of which had a Ser364Pro mutation that is the phosphorylation 

site attributed to lead to P1 (Britz‐Cunningham et al., 1995). Furthermore, eight hypoplastic 

left heart (HLH) patients were also found to have mutations in GJA1, which were close to the 

serine phosphorylation  site S368  (Dasgupta et al., 2001)  that has been associated with P2 

and decreased dye transfer when phosphorylated (Lampe and Lau, 2000). 

Figure  2‐17.  Connexins  in  the  heart.  A)  Overview  of  the  Connexin  expression  pattern  in  adult 

mammalian heart. B)  Immunocytochemical  labeling of Cx43  in  longitudinal sections of human  left 

ventricle samples. Cx43  is concentrated at sites of  intercalated discs (arrow) to allow a directional 

flow of currents.    (from Severs et al., 2008; Kostin et al., 2004) 

Introduction 

29

 

  Thus,  it  is well accepted  that Cx43  is associated with heart abnormalities, mostly  in  the 

form of arrhythmias,  rather  in a  functional context by changes  in distribution and protein 

levels. Immunohistochemical studies in ventricular samples of ischemic patients and patients 

affected with  aortic  stenosis  revealed  a  reduction  in  gap  junction  surface  area  per  unit 

volume of about 40% compared to control heart tissues (Peters et al., 1993). This finding was 

roughly  confirmed  in  ischemic  and  dilated  cardiomyopathy  human  hearts  (Dupont  et  al., 

2001).  Interestingly,  Kostin  and  colleagues  could  show  an  initial  increase  of  44%  in  Cx43 

protein  levels  relative  to  controls  followed,  by  a  decrease  with  the  hypertrophy  stage, 

categorized according to the ejection fraction (Kostin et al., 2004). In the advanced stage, the 

reduction was  accompanied  by  regions  of  low  Cx43  signal whereas  in  the  stage  of  Cx43 

increase,  an  additional  localization  at  the  lateral membrane  of  the  cardiomyocytes  was 

detected,  a  finding  also  reported  in  tetralogy  of  Fallot‐patients  (Kolcz  et  al.,  2005). 

Heterogenous expression of Cx43 was also observed in patients with congestive heart failure 

and ventricular arrhythmia who had a decreased ejection fraction upon electrocardiographic 

assessment  (Boulaksil  et  al.,  2010).  These  data  corroborate  findings  in  rat  hypertension 

models  (Haefliger  and Meda,  2000)  and  canine model  of  heart  failure, where  also  Cx43 

interaction with ZO‐1 at  intercalated discs were disrupted and changes  in phosphorylation 

states were  indicated  (Hesketh  et  al.,  2010;  Poelzing  and  Rosenbaum,  2004).  In  another 

canine study,  infarct size was significantly reduced when hearts were pre‐treated with  the 

gap‐junction uncoupler substance heptanol before conditioning for  ischemia,  indicating the 

propagation  of  signals  through  gap  junctions  (Saltman  et  al.,  2002).  In  contrast,  mice 

engrafted with embryonic cardiomyocytes have been reported to be less vulnerable to post‐

infarct arrhythmias (Roell et al., 2007)  implying that Cx43 might have a function that varies 

depending  on  the  species.  Left‐right  asymmetry was  also  found  in  Xenopus  studies with 

abnormally expressed Cx43 were also documented (Levin and Mercola, 1998).  

  Reaume and coworkers established  the  first  targeted deletion of  the Gja1 gene  in mice 

most of which could be born without complications,  implying a backup  for the  function of 

Cx43 in murine development (Reaume et al., 1995). However, the pups died already after 5 

hours due  to obstructions  in  the right ventricular outflow  tract of  the heart. Nevertheless, 

cardiac‐restricted  Cx43  inactivation  prolonged  their  lifespan  by  2  months  after  which 

spontaneous ventricular arrhythmias and subsequent cardiac death occurred  in all animals 

(Gutstein  et  al.,  2001a). Chimeric mice  generated  by Cx43‐deficient  embryonic  stem  cells 

Introduction 

30 

 

were  shown  to  have  reduced  fractional  shortening  (Gutstein  et  al.,  2001b)  and  Cx43+/‐ 

heterozygote  mice  revealed  a  reduction  in  the  ventricular  conduction  velocity  by  38% 

compared to wildtypes whereas the same parameter of the atrium was not affected at all. In 

the  atria,  Cx40  is  additionally  expressed,  suggesting  that  this  protein  can  prevent  the 

emergence  of  phenotypes  in  these  chambers  (Thomas  et  al.,  1998).  Therefore,  Cx43  is 

indeed a very important component for the cardiac tissue. 

   

 

31

 

3 AIM  OF  THE  STUDY 

  The aim of the thesis was to clarify whether Connexin‐43  is altered under conditions of 

ether lipid deficiency.

  Thus, by using  immunoblot and  immunofluorescence techniques on ether  lipid‐deficient 

mice and human primary fibroblasts of a patient with rhizomelic chondrodysplasia punctata, 

we wanted to answer following questions:

1) Is  there  a difference  in Cx43 protein  amounts  and phosphorylation  states  in ether 

lipid‐deficient cells compared to normal cells?

2) Are confluency conditions able to influence the expression levels of this protein and, 

if so, does the loss of ether lipids change this response?

3) Does the subcellular  localization of Cx43  in ether  lipid‐deficient cells differ from that 

of normal cells?

4) Does Cx43 differ in its presence in raft isolates when ether lipids are not present?

5) Are alterations in Cx43 protein amounts induced in mouse hearts lacking ether lipids?

 

   

 

32 

 

4 MATERIALS  AND  METHODS 

Materials 

Cell Culture 

Complete Medium 

Human primary fibroblasts: RPMI‐1640 (Lonza) 

Mouse fibroblasts: DMEM (Lonza) 

Both supplemented with 10% heat‐inactivated fetal‐

bovine serum, 1% Penicilline‐Streptomycine, 2 mM L‐

Glutamine and 0.5% Fungizone 

PBS  Without Mg2+ and Ca2+, sterile, Lonza 

Trypsin  0.25% Lonza 

BA (DL‐Batyl alcohol) 

HDG (Hexadecyl‐sn‐gylcerol) 

Working concentration: 20 µM 

stock  solution of 20mM  in EtOH  abs. was diluted  into 

complete medium 

Batyl Alcohol – Sigma Aldrich (B402) 

1‐o‐Hexadecyl‐sn‐glycerol – Santa Cruz (202394) 

 

PCR 

Materials for PCR 

GoTaq Pol and 5x GoTaq Buffer – Promega 

dNTPs – Peqlab 

Oligonucleotides custom‐made by Eurofins MWG 

Operon 

1x TAE‐Buffer 

40mM Tris‐Acetate, 1mM EDTA 

pH 8.0 

Primers OLI 1626: 5’‐GATACCTACTTTGTCCCAATTAGC‐3’  

OLI 1627: 5’‐GCTGGTCTCAAACAGCTACGTAGCTGA‐3’  

OLI 1628: 5’‐CGCATCGCCTTCTATCGCCTTCTTG‐3’ 

 

Materials and Methods 

33

 

Lysis/Homogenization 

RIPA‐Buffer 

50mM Tris, 150mM NaCl,  

1mM EDTA, 1mM EGTA 

1% NP40, 1% Sodium deoxycholic acid, 0.1% SDS 

pH 7.5 

Lysis Buffer 

RIPA containing 1x protease inhibitor cocktail and 

phosphatase inhibitors (2mM Na3VO4, 14mM NaF) 

In case of hearts, additional ATP (final conc 2mM) was 

added. 

Protease inhibitor cocktail 

(PI) 

Complete  protease  inhibitor  tablets  (Roche).  One 

tablet was dissolved  in 2ml dH2O  to yield a 25x stock 

solution which was  either used directly or  frozen  for 

later use. 

Phosphatase inhibitors 

Sodium  orthovanadate  (Na3VO4),  an  inhibitor  of  Tyr‐

phosphatases,  was  prepared  as  a  100mM  stock 

solution (storage at room temperature) 

Sodium  fluoride  (NaF,  inhibitor  of  Ser/Thr‐

Phosphatases) was  prepared  as  700mM  aliquots  and 

stored at ‐20 °C. 

 

DRM isolation 

5xTNE 

 

250 mM Tris‐HCl, 750 mM NaCl, 10 mM EDTA 

pH 7.4 

Sucrose solutions  

(56%, 35%, 5% w/v) All prepared in 1xTNE 

2%Triton/TNE‐PI 2% Triton X‐100 in 1xTNE supplied with Protease‐

inhibitor cocktail 

     

SDS‐PAGE/Immunoblotting 

4x Loading buffer 250 mM (w/v) Tris‐Cl (pH 6.8), 40% (v/v) Glycerin, 20% 

(v/v) β‐Mercaptoethanol, 8% (w/v) SDS, 0.008% (w/v) 

 

34 

 

Bromophenol blue 

10x Electrophoresis Buffer  250 mM Tris‐Cl, 1.92 mM Glycine, 1% SDS 

Transfer Buffer 

48 mM Tris‐Cl, 39 mM Glycine 

0.0375% SDS, 20% Methanol 

5xTBST 

749.5 mM NaCl, 124.7 mM Tris, 0.0025% (v/v) Tween 

pH adjusted to 7.5, then 2.5ml Tween added 

5x Stripping Buffer  2.5M NaCl, 1 M Glycine, pH 2.5 

Marker 

PageRuler Prestained Protein Ladder  

(Fermentas #26616) 

Antibody dilutions 

Primary antibodies 1:25,000 in 2% BSA/TBST 

Secondary antibodies 1:40,000 in TBST 

Miscellaneous 

Immobilon™ Western Chemiluminescent Substrate 

(Millipore) 

Protran® Nitrocellulose Transfer Membrane and 

Whatman Filter Papers (3mm, Whatman) 

 

Immunocytochemistry 

10x PBS 

101 mM Na2HPO4, 27mM KCl, , 18mM KH2HPO4, 1.4M 

NaCl; pH 7.4 adjusted with NaOH 

autoclaved before use 

Blocking Buffer  10% FBS and 1% BSA, in 1xPBS 

Geltol 

24mM Tris‐Cl (pH 8.5), 6% Glycerine, 2.4% (v/v) 

Mowiol; mixed at 50 °C for 10 minutes and centrifuged 

at  5,000 g for 15 minutes 

Antibodies 

α‐Connexin‐43, polyclonal, rabbit (Abcam, Cat# 11370) 

α‐Transferrin Receptor, monoclonal, mouse (Zymed) 

α‐Actin – monoclonal, mouse (Chemicon)  

α‐rabbit – Cy2‐conjugated, donkey (Jackson IR) 

α‐mouse – Cy3‐conjugated, goat (Jackson IR) 

Materials and Methods 

35

 

Chemicals 

Standard chemicals were purchased from Merck or Sigma‐Aldrich. 

Acrylamide 4x

BisacrylamideGerbu Biochemicals 

Bovine Serum Albumin (BSA)

Ethylene glycol tetraacetic acid (EGTA)

Gelatine from porcine skin type A

Sodium dodecyl sulfate (SDS)

Sucrose

Sigma‐Aldrich 

Etylene diamine tetraacetic acid (EDTA)

β‐MercaptoethanolAppliChem 

Ethidiumbromide BioRad 

Formaldehyde, 37%

Sodium deoxycholate

N,N,N’,N’‐Tetramethylethylendiamine (TEMED)

Tris‐hydroxymethyl‐aminomethane (Tris)

Tween®20

Merck 

Mowiol Carl Roth 

NP‐40 Calbiochem 

Ponceau S Fluka 

Triton®X‐100 Promega 

DAPI (Cat# 10236276001) Roche 

 

   

 

36 

 

Equipment 

Tool  Company 

Cell Culture Incubators  Heraeus 

Cell Culture Lamina  Sterile VBH Compact 

Centrifuges  Eppendorf 5415D, 5415R 

Refrigerated Centrifuge 2K15, 4K15 (Sigma) 

Electrophoresis Power Supply   E425, Consort 

Fluor‐S‐MaxImager  BioRad 

Gel Doc™ 2000  BioRad 

IX71 Inverse Fluorescence Microscope  Olympus 

Mini‐PROTEAN® 3 Electrophoresis System  BioRad 

MyCycler™ Thermal Cycler  BioRad 

Optima™ LE‐80k Ultracentrifuge  Beckman 

PHM92 Lab pH Meter  Radiometer Analytical 

Polytron rotor  PT‐3100 

PowerPac™ 3000 Power Supply  BioRad 

Spectrophotometer  Hitachi U‐2001 

Thermomixer comfort  Eppendorf 

Transfer Cell  Trans‐Blot® Semi‐dry Electrophoretic Transfer Cell (BioRad) 

Ultracentrifuge tube  Ultra‐Clear Tube 14x95 mm (Beckman) 

Vortex‐Genie™  Scientific Industries 

Water Bath  GFL Water Bath No. 1003 

 

Cell lines 

  All cell  lines were available  in  the  laboratory at  the beginning of  the study. The human 

RCDP  primary  fibroblast  cell  line  was  originally  provided  by  Prof.  Dr.  Nancy  Braverman 

(Children’s  Hospital  Research  Institute, McGill  University, Montreal)  while  controls  were 

obtained  from  the  general  hospital  of  Vienna  (AKH).  Studies  involving  primary  human 

fibroblasts were already approved by the Ethical Review Board of the Medical University of 

Vienna (App# 729/2010).  

  The  human  RCDP  primary  fibroblast  cell  line  was  derived  from  a  patient  bearing  a 

deletion of a single base pair in DHAPAT (c.1428delC/1428delC), leading to a premature stop 

codon and probably nonsense‐mediated decay of the transcript (Nimmo et al., 2010). Mass 

spectrometric  analyses  done  in  our  lab  (Fabian  Dorninger,  2011,  Diploma  Thesis)  in 

Materials and Methods 

37

 

collaboration with Alexander Brodde and Britta Brügger (University of Heidelberg) revealed 

very low plasmalogen amounts in these cells (less than 2%). 

  All cell lines were cultured in appropriate dishes (10cm) at 37 °C with 5% CO2. Plates were 

split  (1:2‐1:20) by  incubation with 0.25%  (v/v)  trypsin at 37 °C  for 5‐40 min  (depending on 

cell  line)  after washing with  PBS.  Complete medium was  used  to  inactivate  trypsin  and 

distribute cells onto additional plates. For analysis, cells at passages 4 to 30 were used. 

  Treatments  with  ether  lipid  precursors  BA  and  HDG  were  done  at  a  working 

concentration of 20 µM in complete medium for three consecutive days, with new medium 

added every 24 hours. On the fourth day, cells were harvested for analysis. 

Mice 

  Dhapat‐deficient mice (outbred C57/Bl6 x CD1) were available and originally provided by 

the  laboratory  of Wilhelm  Just  (Heidelberg  University),  where  they  have  been  breeded 

(Rodemer  et  al.,  2003).  All  animals  received  human  care  according  to  the  “Principles  of 

Laboratory Animal Care” (National Society for Medical Research) and the “Guide for the Care 

and Use of Laboratory Animals” (National Academy of Sciences) (NIH Publication No. 86‐23, 

revised 1985). 

  The animals were housed at the animal  facility of the Medical University of Vienna  in a 

temperature‐  and  humidity‐regulated  environment  with  12:12  hour  light‐dark  cycle  and 

constant acoustic background. Standard mouse chow and water was supplied ad libitum. 

Methods 

Genotyping 

DNA was isolated from cells in culture (up to 106) by using the “Blood and Tissue Kit” (Qiagen) 

according  to  the manufacturer’s protocol. PCR was done by amplifying exon 7 of  the wild 

type Dhapat gene (primers OLI1626, 1627), and the neomycin cassette‐DHAPAT junction of 

the DHAPAT knockout allele (OLI1627, 1628). PCR products were either loaded directly onto 

a Agarose gel or stored at 4 °C until further analysis. 

 

38 

 

 Agarose gels were made in TAE buffer by boiling for about 3‐5 minutes until fully dissolved. 

After cooling  to ~60  °C, ethidium bromide was added  to a  final concentration of 0.5µg/ml 

and the solution poured into appropriate trays with combs. The solidified gel was put into a 

chamber filled up with TAE buffer and, after loading the samples next to a size marker, run 

at 90 V  (const.)  for one hour. DNA bands were visualized  through UV‐light using a GelDoc 

2000 (BioRad) with its own software. 

Cell Lysis and Isolation of Proteins 

  Cells were grown to around 100% confluency prior to  lysis. After washing once with PBS 

and addition of cold  lysis buffer  (0.7  ‐ 1 ml), dishes were scraped off on  ice with a rubber 

policeman  into  tubes  and  frozen. On  the  following  day,  the  thawed  lysates were  passed 

through  25‐  and  27‐gauge  needles  3  times  each  to  disrupt  cellular  membranes  and 

incubated on ice for 20 minutes. Eventually, centrifugation at 16,100 g at 4 °C for 20 minutes 

ensured pelleting of DNA  and  lipids.  The  supernatants  containing proteins were  collected 

and either frozen at ‐20 °C or further used for concentration measurements. 

Tissue homogenization 

  Wildtype and Dhapat‐deficient  fetal mice at embryonic day 18.5 and adult mice at 16.5 

months were sacrificed using CO2 inhalation and tissues dissected, being immediately shock‐

frozen in liquid nitrogen and stored at ‐20 °C until use.  

  For homogenization, frozen tissues were thawed and weighed. Heart homogenates were 

achieved with 10 vol  lysis buffer  (containing 2mM ATP) using a  rotor. Homogenates were 

incubated  on  ice  for  20  minutes  before  centrifugation  at  4  °C  for  20min  at  16,100  g. 

Supernatants were collected and either  frozen at  ‐20  °C or used  further  for concentration 

measurement. 

   

Mastermix (MM) per sample

4.0 µl  5x GoTaq Buffer0.4 µl  10mM dNTPs1.0 µl  OLI16261.0 µl  OLI16271.0 µl  OLI162811.5 µl  H2O 0.1 µl  GoTaq Pol1 µl  DNA 

PCR program  

94 °C 1 min  

94 °C 20 sec 35x 60 °C 20 sec

72 °C 50 sec

72 °C 7 min  4 °C

 

Materials and Methods 

39

 

Isolation of Detergent‐Resistant Membranes 

  The method by Lingwood & Simons was used to  isolate DRMs from cells (Lingwood and 

Simons,  2007).  Briefly,  around  20  culture  dishes  (approximately  20x  5*106) were washed 

with cold PBS once and  lysed on  ice by scraping  in cold 1x TNE buffer supplemented with 

protease inhibitors (TNE‐PI). The lysate was transferred into a tube and centrifuged at 400 g 

at  4  °C  for  5  minutes,  followed  by  resuspension  of  the  pellet  in  550  µl  TNE‐PI.  After 

subsequent  homogenization  steps  with  25g  and  27g  needles  (25  strokes  each),  2% 

Triton/TNE‐PI was added to 500 µl homogenate and mixed. After  incubation for 30 min on 

ice,  the sucrose gradient was prepared  in an ultracentrifuge  tube by combining  the whole 

mixture with 2 ml of 56%  sucrose at  the bottom of an ultracentrifuge  tube  (yielding 40% 

sucrose). Further sucrose solutions (35% and 5%) were layered on top (to cover the solution). 

A final centrifugation at 271,000 g at 4 °C for 18 hrs allowed separation of DRM fractions that 

were collected in 1 ml aliquots and analyzed by immunoblotting for raft markers. 

Protein concentration measurement 

  The  amount  of  protein  contained  in  each  lysate  or  homogenate  was  determined  in 

triplicates by using  the Bradford Assay  (BioRad). Briefly, a 1:4 dilution of Bradford  reagent 

was prepared and used with 200 µl total volume of a mixture of water and either sample or 

BSA of known concentrations for the standard curve and buffer as blank. 

  Protein standards were prepared with different BSA amounts (like 0, 2, 3, 4, 5 µg) out of a 

stock  (0.5 µg/µl)  into plastic  cuvettes. After  adding buffer  (amount depending on  sample 

volume to be used  in the measurements), the mixtures were filled up with water to a total 

volume of 200 µl  and  incubated  for 8‐10 minutes with 800 µl of  the prediluted Bradford 

reagent (time was equal  in one series of measurements) prior to measuring absorbance at 

595nm  in  a  spectrophotometer.  In  order  to  stay  within  an  appropriate  detection  range 

(absorption values 0.2 to 0.5), dilutions of the samples were prepared accordingly. The data 

was analyzed using the Excel program to plot a standard curve and calculate the amount of 

protein and concentration in each sample. 

Western Blotting 

SDS‐Polyacrylamide  Gel  Electrophoresis.  For  a  clear  separation  of  Connexin‐43,  two  9% 

polyacrylamide  gels  with  a  gel  thickness  of  0.75  or  1.5mm  were  prepared  (30%  wt/vol 

acrylamide,  0.8%  bisacrylamide)  in  an  electrophoretic  chamber  of  the  Miniprotean®  3 

 

40 

 

system  (BioRad).  Loading buffer was added  to each  sample and heated  for 10 minutes at 

85 °C (tissue homogenates were treated at 95 °C). After pelleting at 12,000 g for 10 minutes, 

the supernatant of the samples and molecular weight marker were loaded onto gels and run 

at 60 mA (250 V) for about 1 hour. 

Semi‐Dry Transfer and Blocking. Proteins were transferred onto a nitrocellulose membrane. 

Therefore, the membrane was sandwiched with the gel on top between 6 Whatman papers 

(3 on top, 3 below), all equilibrated in transfer buffer and eventually transferred at 260 mA 

(25  V max)  for  25  to  27 minutes  in  a  semi‐dry  blot  transfer  chamber. Membranes were 

washed with distilled water and transfer quality monitored by staining with Ponceau which 

was  subsequently washed  off with  TBST.  Blocking was  done with  4%  (w/v)  non‐fat  dried 

milk/TBST twice in total of 1 hour.  

Primary and Secondary Antibody  incubations. After blocking, the membranes were washed 

3x with TBST prior to addition of the primary antibody dilution o/n at 4 °C. On the next day, 

membranes  were  washed  and  incubated  at  RT  with  the  according  secondary  antibody. 

Specificity was confirmed for each antibody. 

Detection.  Enhanced  chemiluminescence  (ECL)  substrate  was  prepared  (1:1  mixture  of 

Peroxide  and  Luminol  reagents)  enough  to  cover  the membrane  with  which  they  were 

incubated by shaking  for 2 minutes  in boxes. Membranes were put between two  layers of 

plastic  foil  to maintain wetness and developed  in a BioRad Fluor‐S MAX MultiImager. The 

software Quantity One  (BioRad) allowed  to detect bands and acquire  images. Parameters 

were  adjusted  to  “Ultrasensitivity Chemiluminiscence” with  an  Imaging Area of 32x32  cm 

and Normal Dark Subtraction. 

Stripping.  For detection of  further proteins on  the  same membrane,  stripping buffer was 

added for 3x10min before incubation with the new primary antibody o/n.  

Densitometric Analysis. In SDS‐PAGE, Cx43 migrates in at least three isoforms (see according 

chapter in the introduction); one mildly phosphorylated that is detected around 43 kDa and 

two phospho‐isoforms at 45 and 48 kDa, respectively.  In our case, the two phosphorylated 

forms were not clearly separated  (cf. Figure 5‐1), which was  the  reason  for us  to quantify 

and illustrate them as one in our figures.  

  Pixel  intensities  of  each  band  on  the  membrane  were  obtained  using  the  Volume 

Rectangle Tool in Quantity One® (BioRad). Briefly, each band was enclosed with a rectangle 

Materials and Methods 

41

 

of  an  appropriate  size.  Two  copies  of  each  rectangle were  placed  in  the  lane  above  and 

below the rectangle to obtain the background  intensity for each band. The data containing 

the  total  intensities within each  rectangle  (“volume”)  and  the  area of  the  rectangle were 

exported  for  analysis  into  Microsoft  Office  Excel  where  the  background  values  were 

subtracted from the corresponding intensity of the bands. This was done for both Cx43 and 

β‐actin (loading control). The value of Cx43 was divided by the one of β‐actin to normalize, 

and the results were plotted in diagrams. 

Immunocytochemistry 

  Cells  were  seeded  in  6‐well  plates  containing  coverslips  and  cultivated  to  needed 

densities. For staining, following steps were performed (each followed by washes with PBS 

3x for 5 minutes): 

Fixation. Coverslips were washed with PBS and fixed with 3.7% formaldehyde in PBS for 15 

minutes at room temperature. 

Permeabilization.  To  make  the  cytosol  accessible  for  the  antibodies,  the  fixed  cells  on 

coverslips were incubated with 2 ml 0.5% Triton X‐100 in PBS for 5 minutes. 

Blocking.  Each  coverslip was placed upside‐down on 90 µl of blocking buffer on parafilm, 

prepared in a humid glass chamber and incubated for 90 minutes at room temperature. 

Primary and Secondary Antibody incubations. Primary antibodies were diluted 1:1000 in PBS 

containing  10%  FBS  and  used  to  incubate  coverslips  for  2  hours  at  room  temperature. 

Incubation with secondary antibodies (1:400 in 10% FBS/PBS) was done overnight at 4 °C in 

dark. Next day, coverslips were incubated with DAPI to visualize nuclei and finally mounted 

in Geltol onto  labeled glass slides which were dried  in the dark at room temperature for a 

couple of days. Slides were stored in the dark at 4°C. 

Microscopy.  Images  of  the  stained  cells  were  obtained with  a  Fluorescence Microscope 

through a 20x objective using  the  software M^cell  (Olympus) and  imported  to Photoshop 

(Adobe) for subsequent analysis. 

Statistical analysis 

Statistical  significance  was  determined  using  two‐tailed  student’s  t‐test  assuming  equal 

variance of the two samples. Error Bars represent standard deviation (s.d.). 

   

 

42 

 

5 RESULTS 

5.1 Cx43 from dermal fibroblasts is detected as several bands in immunoblot 

analysis 

As mentioned  before,  Connexin‐43  is  phosphorylated  on  serine  residues  in  its  C‐terminal 

domain which leads to conformational changes and gives rise to phospho‐isoforms migrating 

differently  in  SDS‐Polyacrylamide  gel  electrophoresis  (PAGE).  In  our  gel  system, we  could 

detect two bands  in total homogenates of human primary fibroblasts with the commercial 

antibody  recognizing  total Cx43  (Figure 5‐1). We defined  the  lower bands migrating at 43 

kDa as P0 and  the upper, diffuse band probably  represents P1 and P2 migrating  together. 

Therefore, this denotation was used in all figures of the present thesis showing such blots. 

 

5.2 Amount of expressed Connexin‐43 depends on the cell confluency 

  Cx43  is  a  protein  facilitating  intercellular  communication  and  for  this  reason  cells  are 

connected with each other in a huge network in tissues of living organisms. In culture, these 

conditions  can  vary  by  the  density  of  the  cells.  Hence,  we  wanted  to  elucidate  the 

relationship  between  Cx43  expression  levels  and  the  confluency  of  the  cells  by  culturing 

human control fibroblasts at different densities. Low densities represent single cells with no 

contact to each other, whereas at high densities cells were growing onto each other, leaving 

almost no  free space  in  the plate and  thus  resulting  in many contacts. We analyzed  three 

independent  lysates  of one  control  cell  line  by  immunoblot  analysis  and  could  observe  a 

density‐dependent expression pattern. According to the densitometric analysis of the signal 

intensities and normalization to the β‐actin levels (Figure 5‐2), the upper band reflecting P1 

and P2 was about 10‐fold more  intense  in high‐density  cultures  than  in  low‐density ones. 

Figure 5‐1. In western blot analysis Connexin‐43 migrates as at least two isoforms. Detection of 

Cx43  in  total  lysates of human primary  fibroblasts of a healthy  control with an antibody  raised 

against  the amino acids 362‐382 of human protein, as seen  in our gel system. P0 migrated as a 

distinct band at around 43 kDa while P1 and P2 migrated together at approximately 45 kDa. 

P1+P2

P0

Cx43

 

43

 

Although  also  statistically  significant  in  the  low‐density  cultures,  the  difference  in  P0 

representing unphosphorylated, intracellular Cx43, was much lower (less than 2‐fold). 

 

 

5.3 Human primary fibroblasts deficient in ether lipids show a clear 

reduction in Cx43 

  As the expression of Cx43 was upregulated in cells cultured at high densities, we collected 

total protein isolates of control and DHAPAT‐deficient human primary fibroblasts cultured at 

high  densities  in  triplicates  and  loaded  these  next  to  each  other.  Our  results  showed  a 

striking  quantitative  difference  in  P1  and  P2  in  the  mutant  cell  line  with  a  statistically 

significant reduction of mean value (p<0.05)  in comparison with that of the control (Figure 

5‐3).  In  contrast,  the  amount  of  newly  synthesized  Cx43  (P0  band) was  not  substantially 

altered by cell density. 

Figure  5‐2.  Connexin‐43  expression  is  dependent  on  the  cell  confluency.  (A)  Immunoblot 

analysis of Cx43  in 2.5 µg total  lysates of primary human fibroblasts harvested at high and  low 

densities  as  indicated.  (B)  Quantification  of  the  signal  intensities  of  P0  and  P1+P2  after 

normalization to β‐actin is shown as mean value ±s.d. * p<0.05; *** p<0.001; n=3/group 

 

44 

 

 

 

5.4 In ether‐lipid deficient cells Cx43 expression is not increased upon 

confluency 

  We  were  curious  about  the  density  response  in  the  ether  lipid‐deficient  cells  and 

performed the same analysis to determine whether a similar relationship exists as in control. 

(Figure 5‐4). The difference between Cx43 levels at low and high densities was not present in 

the mutant cells.  In comparison with control cells, the phospho‐isoforms were significantly 

lower  in  DHAPAT‐deficient  cells.  P0,  in  contrast,  showed  no  statistically  significant 

differences  between mutant  and  control  cells,  or  between  high‐  and  low‐densitiy  culture 

conditions. 

 

Figure  5‐3.  Connexin‐43  amounts  in  dense  control  and  DHAPAT‐deficient  human  primary 

fibroblasts.  (A)  Immunoblot  analysis  of  Cx43  isoforms  in  10  µg  total  protein  isolates  from 

DHAPAT‐deficient  and  control  fibroblasts.  (B)  Signal  intensities  of  P0  and  P1+P2  after 

normalization to β‐actin plotted as mean value ±s.d. * p<0.05; n=3/group

Results 

45

 

 

 

5.5 Three‐day‐treatment with ether lipid precursors is not sufficient to 

restore Cx43 levels 

  Based on  the  findings  that  cells  lacking ether  lipids had a  significant  reduction  in Cx43 

levels  and  did  not  exert  the  same  confluency‐dependent  response  as  controls, we  asked 

whether this alteration was a direct cause of plasmalogen deficiency and, hence, might be 

restored by addition of precursor substances  into the culture medium. Data  from previous 

lipid  profile  studies  performed  in  our  laboratory  (Fabian  Dorninger,  Diploma  Thesis)  in 

collaboration with Alexander Brodde and Britta Brügger  (University of Heidelberg) showed 

that  in  cultured  fibroblasts  derived  from  a  patient  affected  by mild  RCDP,  the  levels  of 

plasmenyl‐ethanolamine were increased to control values after three days of treatment with 

batyl  alcohol  (BA)  or  hexadecylglycerol  (HDG).  Thus,  we  treated  the  DHAPAT‐deficient 

fibroblasts  (derived  from  a  severe  RCDP  patient)  with  both  plasmalogen  precursor 

substances for three consecutive days to finally obtain lysates and determine the amounts of 

the various Cx43 isoforms by immunoblot analysis. 

Figure 5‐4. Connexin‐43 amounts in confluent and non‐confluent control and DHAPAT cells. 

(A) Analysis of Cx43  in 2.5 µg  total protein  lysates of both  control and ether‐lipid deficient 

human  fibroblasts  by Western Blot  and  its  (B)  quantification  after  normalization  to  β‐actin 

with mean value ±s.d. * p<0.05; *** p<0.001; n=3/group 

 

46 

 

 

  Our findings are shown in Figure 5‐5 for two different lysates each for untreated, ethanol‐ 

and BA‐treated  cells. Quantification by densitometric analysis  showed  that  the amount of 

Cx43 protein was not restored or markedly affected after  treatment with batyl alcohol  for 

three days. We also tried to supplement with hexadecylglycerol  in the very same cell  lines, 

however, also this treatment was insufficient (Figure 5‐6). 

 

 

Figure 5‐5.  Immunoblot of normal and DHAPAT‐deficient human fibroblasts after treatment with 

batyl alcohol. (A) Cx43 in 10 µg total protein isolates of control and mutant cells after being treated 

for  three  consecutive  days with  20 µM  batyl  alcohol  (BA),  ethanol  (EtOH)  or medium  (Ctrl).  Two 

independent  cultures were  analyzed  for  each  condition.  (B)  Densitometric  analysis  of  the  signal 

intensities after normalizing to β‐actin. 

Figure  5‐6.  Immunoblot  of  normal  and  DHAPAT‐deficient  human  fibroblasts  after  treatment 

with hexadecylglycerol. (A) Cx43  in 10 µg total protein  isolates of control and mutant cells after 

being treated for three consecutive days with 20 µM hexadecylglycerol (HDG), ethanol (EtOH) or 

medium (Ctrl). Two  independent cultures were analyzed for each condition. (B) Signal  intensities 

were normalized to β‐actin and plotted in bars. 

Results 

47

 

5.6 Cx43 is concentrated at sites of cell‐cell contact 

  As  it  is thought that gap junction plaques arise through the support of  lipid rafts, we set 

out  to  investigate  the subcellular  localization of  the gap‐junctional protein Cx43. Thus, we 

first looked by direct immunofluorescence microscopy in control primary fibroblasts cultured 

at  high  densities  and  stained  for  Cx43  and  in  parallel  double  stained  for  the  transferrin 

receptor (TfR) to visualize the membrane boundaries (Figure 5‐7).  

 

  Cx43  immunofluorescence  clearly  showed  a  typical membrane‐staining  and was more 

concentrated in areas of the membrane where the cell contacted another cell. Importantly, 

in these areas Cx43 frequently showed strong extended stretches of fluorescence, probably 

arising  from many  gap  junctions  continuously  lining  the  contact  sites  and  amplifying  the 

signal  intensity. Weak  fluorescence  signals of Cx43 were also  visible  close  to  the nucleus, 

indicating  trafficking  intermediates  in  the  ER  or  Golgi.  TfR  staining was weaker  but  also 

localized  to  the membrane although not as apparent as Cx43. A cell group with extensive 

Figure 5‐7. Cx43 localization in normal human fibroblasts is confined to sites of cell‐cell contact. 

Primary human  fibroblasts were  immunostained  for Cx43 and TfR being  imaged by  fluorescence 

microscopy  at  20x magnification: Cx43  (green,  left  panel),  TfR  (red,  central  panel), merge  (right 

panel). Nuclear staining with DAPI (blue) is shown in the merged panel only. Cx43 was observed at 

cell‐cell contacts and was not present at areas where no neighboring cell was present. Frequently, 

it  also  appeared  as  stretches  (arrowheads)  in  these  contact  sites.  Such  a  region  (box) has been 

magnified  in  an  inset  image  in  the  merged  panel  (A).  Another  group  of  three  control  cells 

contacting each other (B). Also here, the characteristic stretch pattern was observed (arrowheads). 

Such an area (boxed region) has been magnified in the inset. 

 

48 

 

cell‐cell  contacts  is depicted  in  Figure 5‐7B. Note  the membrane  areas devoid of  contact, 

which  also  lack  Cx43  immunoreactivity,  indicating  that  Cx43  is  specifically  recruited  to 

contact sites. 

5.7 Cx43 localization is affected by ether lipid‐deficiency 

  The  localization of Cx43 was also examined  in ether  lipid‐deficient cells and most of the 

cells showed reduced Cx43 staining at the cell surface (Figure 5‐8). Although the staining at 

the membrane was visibly  lower  than  for  controls,  their plasma membrane  featured  sites 

with  strong  staining;  however,  contrary  to  the  characteristic  stretches,  Cx43  appeared  as 

punctae in the membrane. Apparently, there were no similar compact aggregations of Cx43 

at sites of cell‐cell contact. We could rarely spot a staining similar to that in controls and this 

was  usually  at  sites  devoid  of  contact  zones.  TfR  showed  a  slightly  stronger  intracellular 

staining  compared  to  controls.  These  results  suggest  that  Cx43  trafficking  within  the 

membrane, possibly to lipid rafts, cannot be accomplished when cells lack ether lipids. 

 

 

Figure 5‐8. Ether lipid‐deficient cells show impaired Cx43 localization. 

Immunostaining of fixed ether  lipid‐deficient pimary human fibroblasts for Cx43 and TfR at 20x 

magnification:  Cx43  (green,  left  panel),  TfR  (red,  central  panel), merge  (right  panel).  Nuclear 

staining with DAPI (blue)  is shown  in the merged panel only. (A and B) Cx43 staining was much 

lower at  the plasma membrane where  it appeared as punctae  (boxed  regions and  insets). The 

typical line pattern seen in controls was rarely present and not confined to cell‐cell contacts. 

Results 

49

 

5.8 Ether lipid deficiency leads to a mislocalization of Cx43 phospho‐

isoforms in rafts 

  Next, we isolated detergent‐resistant membranes (DRM) from both control and DHAPAT‐

deficient fibroblasts and  loaded equal volumes of density gradient fractions to detect Cx43 

along with  the  raft  proteins  Flotillin  (Flot)  and  Thy‐1  as well  as  the  non‐raft membrane 

protein  TfR  in  detergent‐resistant  and  –soluble  fractions.  Flot  and  Thy‐1  were  no more 

localized  as  in  the  control  cell  line  in  raft  fractions only,  and  TfR  showed  a  shift  towards 

detergent‐soluble fractions (Figure 5‐9). Total Cx43 amounts were lower in the mutant cells 

and,  in particular,  it was hardly detectable  in raft fractions. Also the Cx43 amounts  in non‐

raft fractions were decreased. Interestingly, the intensity of Cx43 bands in the middle‐dense 

fraction was  similar  to  that  in  raft  fractions  of  controls  and  comparable  to  the  level  in 

DHAPAT‐deficient cells. 

 

Figure 5‐9.  Immunoblot analysis of several proteins  in detergent‐resistant membranes of both 

control and DHAPAT‐deficient cells. A) Immunoblots with equal volumes of protein (18 µl) from 

fractions  1‐4,  7,  10‐12  collected  after  density‐gradient  centrifugation  of  control  and  DHAPAT‐

deficient  human  primary  fibroblast‐lysates,  loaded  and  probed  for  Flotillin  (Flot),  Thy‐1, 

Transferrin receptor (TfR) and Cx43. Proteins are separated according to their solubility with the 

detergent and density,  floating  from dense  (10‐12)  to  lighter  fractions  (1‐4) with  the decreasing 

sucrose  concentration.  Therefore,  raft  proteins  such  as  Thy‐1  and  Flot will  appear  in  the  first 

fractions due to the detergent‐resistant properties of rafts (B). 

A 

B 

 

50 

 

 

5.9 Adult Dhapat‐deficient mice show reduced amounts of Connexin‐43 in 

heart 

  Since  in  the  literature  a  significant  incidence  of  heart  anomalies  in  RCDP  patients  has 

been reported and such heart defects were linked to a reduction in Cx43, we asked whether 

hearts  of Dhapat‐deficient mice were  also  affected. We  approached  this  question  in  two 

ways: 1) biochemically, by comparing the amounts of Cx43  in homogenized heart tissue of 

wildtype and Dhapat‐/‐ mice and 2) functionally through electrocardiographic assessment of 

the  hearts  in  vivo  (ongoing  work  by  Fabian  Dorninger  and  Gerhard  Zeitler  from  our 

laboratory  in  collaboration with  Reginald  Bittner  from  the  Institute  of  Anatomy, Medical 

University  of  Vienna).  The  biochemical  analysis was  done  using  hearts  of  late‐stage  fetal 

mice (E18.5) and 14‐16.5‐months old mice. Therefore, heart tissues were homogenized and 

protein extracts separated for  immunoblot analysis of Cx43 and β‐actin. Mutant embryonic 

hearts did not show any differences  in Cx43 amounts (Figure 5‐10); all Cx43  isoforms were 

detected  at  similar  levels  in wildtype  and Dhapat‐KO mice. Thus,  the  amounts of Cx43  in 

hearts of developing mice lacking ether lipids do not appear to be affected. 

 

   

Figure 5‐10. Immunoblot analysis of Cx43 in fetal heart homogenates. 

Cx43  and  β‐actin  in  heart  homogenates  of  wildtype  and  Dhapat‐KO 

mice (n=3 each).  

Results 

51

 

  In  contrast,  cardiac  levels  of  Cx43  in  adult Dhapat‐/‐ mice  indeed  showed  a  difference 

when compared with wildtype  levels; while the band depicting P0 was of similar  intensity, 

we detected a statistically significant reduction (p<0.01) in the mean value of Cx43 phospho‐

isoforms normalized to β‐actin levels (Figure 5‐11). Taken together, these results show that 

ether lipid deficiency affects Cx43 at older ages but not in developing mice. 

 

 

   

Figure  5‐11.  Cx43  is  reduced  in  its  protein  amounts  in  adult  heart  homogenates  of Dhapat‐

deficient mice. A)  Immunoblot analysis of Cx43 and Actin  in heart homogenates of adult control 

and DHAPAT‐KO mice (n=3 each, ages 14‐16.5 months). B) Densitometric quantification displayed 

of mean value ± s.d. of Cx43 signal intensities after normalization to β‐actin. * p<0.05; ** p<0.01 

 

52 

 

6 DISCUSSION 

  Our objective was to find out whether ether lipids in general might have an effect on Cx43 

in terms of protein levels, phosphorylation states and localization in cells as well as in heart 

tissue.  This  gap‐junctional  protein,  responsible  for  intercellular  communication  in  many 

tissues  of  mice  and  humans,  was  shown  to  be  reduced  in  ether  lipid‐deficient  mouse 

embryonic  fibroblasts  (Rodemer  et  al.,  2003)  and  to  be  additionally mislocalized  in many 

heart defects. Some of these heart defects such as atrioseptal defects were also found in the 

human disorder of ether  lipid deficiency, RCDP,  implying an  involvement of  these  lipids  in 

heart  phenotypes.  Ether  lipids  are  present  in  lipid  rafts  which  serve  as  platforms  to 

concentrate protein complexes such as Cx43 gap junctions into plaques.  

  Thus, we wanted to find out whether, under conditions of ether lipid deficiency; 1) Cx43 is 

altered  in  amounts  and  phosphorylation  states;  2)  confluency  state  of  the  cells  might 

influence  the  expression  of  this  protein  as  in  control;  3)  Cx43  is  localized  at  similar  sites 

compared  to  normal  cells;  4)  a  change  is  induced  in  the  phosphorylated  isoforms  being 

distributed  in raft and non‐raft areas of the membrane; and 5) heart tissues might react to 

the absence of ether lipids with a change in Cx43 protein amounts. 

  We  could  show  that dermal  fibroblasts of a  control  subject express Cx43 and  that  this 

expression was  dependent  upon  confluency  of  the  cell  culture.  By  culturing  cells  at  two 

different  densities,  that  is,  one  set  of  cells  seeded  at  very  low  numbers  to  ensure  a 

surrounding of each cell with no contacts (around 10‐20% confluency) and another set with 

a high cell number  to achieve a culture where cells even grow onto each other  (ca. 100% 

confluent), we gained a comparative tool to resolve the  issue whether culture density may 

influence the amount of Cx43. Both sets were kept in culture at otherwise similar conditions 

for at least three days after seeding. We found a striking difference between low and high‐

density control cells (cf. Figure 5‐2), especially in the slower‐migrating isoforms of Cx43 that 

were attributed to the pool of protein on the way to or  in the plasma membrane (P1) and 

such  in gap  junctions (P2) at the cell surface (denoted as “P1+P2”  in our figures). We could 

confirm by densitometric analysis of the immunoblot that Cx43 was significantly increased in 

high‐density cells; these cells had around 91% more Cx43 than low‐density cells. This finding 

indicates that many contacts results in more Cx43 being trafficked to and integrated into the 

plasma membrane  and  probably more  gap  junctions  being  formed  to  establish  sufficient 

intercellular communication. Our results are consistent with findings  in cultured rat cardiac 

Discussion 

53

 

myocytes  in  which  Cx43  amounts,  especially  the  phosphorylated  forms,  increased  with 

culture  time  (Oyamada  et  al.,  1994).  This  was  also  confirmed  by  immunofluorescence 

microscopy  in  Sertoli  cells  in  testis  (Lablack  et  al.,  1998).  The  lower  Cx43  band  (P0) 

delineated to represent newly synthesized  intracellular protein was also slightly stronger  in 

our  control  cells,  implying  that also  synthesis of new proteins was  induced upon  contact. 

Thus, it seems that new cell‐cell interactions not only give rise to protein integration into the 

membrane  and  gap  junction  formation  but  also  to  the  synthesis  of  new  connexins  to 

replenish  an  existing  pool.  The  latter  is  in  good  agreement  with  findings  of Meyer  and 

colleagues, who inhibited protein synthesis with cycloheximide and could show that the gap 

junction stimulation by cholesterol was abolished  in Novikoff hepatoma cells (Meyer et al., 

1990). 

  As Cx43 has been shown by the group of Wilhelm Just to be reduced in mouse embryonic 

fibroblasts (MEF) deficient in ether lipids (Rodemer et al., 2003), it was obvious to determine 

whether this fact applies also to human fibroblasts or was species‐specific. Therefore, Cx43 

protein  levels of human primary fibroblasts from an RCDP patient having a mutation  in the 

DHAPAT gene were examined by Western blot analysis. Again, also here we assured similar 

conditions  for the culturing. We  found a reduction of Cx43  in ether  lipid‐deficient cells  (cf. 

Figure 5‐3). Particularly,  this change was remarkable  for  the phospho‐isoforms of Cx43. As 

the phosphorylated  forms are mostly associated with gap  junction  formation  (P2),  surface 

membrane  localization  and  late  endosome  trafficking,  these  findings  suggest  a  reduced 

amount of functional connexons at cell‐cell contacts. Lipid rafts have been shown to contain 

ether lipids and, as gap junction plaques are thought to be tightly packed through lipid rafts, 

it  is  possible  that  ether  lipid  deficiency  cannot  offer  the  environment,  in  terms  of  rafts, 

needed for Cx43 to be phosphorylated, leading to an impaired formation of gap junction and 

subsequently,  plaques.  It  is  also  possible  that  the  signaling  pathway  that  leads  to 

phosphorylation of Cx43 relies on arachidonic acid (AA), which can be “stored” in ether lipids 

at  their  sn2  position.  Additionally, when  these  lipid  species  are  not  present,  it  has  been 

shown that arachidonic acid release from (non‐plasmalogen) phospholipids was increased in 

mutant macrophages (Gaposchkin et al., 2008). Furthermore, free AA reduced Cx43 amounts 

and uncoupled rat myocardial cells and cultured astrocytes upon  treatment  (Martinez and 

Saez, 1999; Massey et al., 1992). This might also be the case for dermal fibroblasts. 

 

54 

 

  We were curious whether DHAPAT‐deficient cells were also able to respond according to 

density as in controls, and performed the same analysis in these cells. Our findings revealed 

a  striking  difference  in  comparison  with  the  controls  (cf.  Figure  5‐4).  Cultured  human 

primary  fibroblasts when  lacking ether  lipids did not display  the  increase  in Cx43  levels at 

high  densities  compared  with  low‐density  cells,  implying  that  either  the  cells  cannot 

recognize or convey the signal of contact, or their ability to  initiate events for gap  junction 

formation  is  impaired.  In  the  context  of  ether  lipids,  however,  it  is  possible  that 

hemichannels  cannot be  recognized  as  substrates  for phosphorylation  to P2  state due  to 

different lipid environment, resulting in an impaired gap junction and plaque formation. 

  Based  on  these  findings  we  then  supplied  the  ether  lipid‐deficient  human  primary 

fibroblast  cell  line with  ether  lipid  precursors  in  order  to  restore  the  lipid  profile  and  to 

investigate  the  consequence  on  Cx43  levels.  Therefore,  we  treated  human  primary 

fibroblasts of a  control and a DHAPAT‐deficient patient each with  two different precursor 

substances, to circumvent the peroxisomal steps, for three consecutive days, sufficient time 

to  restore  plasmalogen  levels  in  fibroblasts  as  we  know  from  previous  findings  (Fabian 

Dorninger, 2011, Diploma Thesis) and partially in lymphocytes from RCDP type I and type II 

patients (Wood et al., 2011). Surprisingly, we did not observe a normalization of the amount 

of phosphorylated Cx43  (cf. Figure 5‐5 and Figure 5‐6). This might have several reasons: 1) 

this time span was not enough to elevate Cx43 amounts to control  levels; 2) the cells were 

already too dense, having already established contacts, when the supplementary treatment 

started, thereby not allowing a sufficient turnover and increase of Cx43; 3) this finding might 

be unique  for this particular cell  line; 4) the  lipid profile might not reflect the endogenous 

normal plasmalogen composition, as plasmalogen precursors can only  recover one species 

according  to  their  chain  length  at  the  sn1  position,  implying  that  the  restored  lipid 

subspecies  are  not  needed  for  rafts  in  which  Cx43  gap  junctions  normally  concentrate. 

Therefore, a combination of many precursor substances may clarify the  latter  idea. For the 

third point, we  already  started  to  cultivate  further  cell  lines  from other RCDP patients  to 

analyze  their  Cx43  levels.  A  time  course  should  be  done  as  well  as  similar  confluency 

conditions are needed for the remaining mentioned hypotheses. 

  Cx43 was  further  examined  by  immunofluorescence microscopy  to  check whether  the 

protein  amounts  are  also  reflected  in  its  subcellular  localization.  The  characteristic 

membrane staining  in human control fibroblasts (cf. Figure 5‐7) was exclusively confined to 

Discussion 

55

 

sites  of  cell‐cell  contact,  likely  to  represent  gap  junctions.  This was  also  reported  in  rat 

ventricular myocytes (Kwak et al., 1999). Additionally, we observed stretches of fluorescent 

signal  in  some  areas  of  these  contact  sites,  resulting  in  a much  stronger  staining, which 

might  represent  series of gap  junction plaques. This kind of  staining was also observed  in 

previous findings by others, however, the authors did not specifically designate these areas 

to be assemblies of gap junctions (Das Sarma et al., 2002; Koval et al., 1997; Stuhlmann et al., 

2003). 

  In ether  lipid‐deficient cells,  immunofluorescent  labeling of Cx43 confirmed our  findings 

from Western Blot analysis (cf. Figure 5‐8). First, the overall membrane staining of Cx43 was 

clearly weaker than in normal controls, and the extended stretched were not present at all, 

which might indicate a reduced number or even an impaired plaque formation possibly due 

to altered rafts based on the absence of ether lipids. Instead, Cx43 was occasionally visible as 

a  punctate  staining  at  contact  sites  that  could  result  from  the  cell  trying  to  restore 

intercellular communication by small aggregations through different non‐plasmalogen rafts. 

  We also  investigated Cx43  in raft fractions biochemically by  isolating detergent‐resistant 

membranes and noticed  that, while control cells exhibited  stronger P0 but  low P1 and P2 

isoforms in non‐raft fractions (cf. Figure 5‐9, lanes 10‐12), DHAPAT‐deficient cells had lower 

amounts, especially of P0. This is in good agreement with our previous findings showing an 

overall  reduction  in Cx43. Furthermore,  raft  fractions of control cells displayed  the  typical 

isoforms  of Cx43 with  stronger  P1  and  P2 whereas  the mutant  cell  line,  in  contrast,  had 

substantially  less  Cx43  in  raft  fractions.  Previous  observations  from  our  lab  showed  that 

several raft proteins  in  the same  fibroblast cultures exhibited an altered  floating behavior, 

shifting  towards  non‐raft  fractions  (F.  Dorninger,  2011,  Diploma  Thesis).  Taken  together, 

these results further support our hypothesis that ether lipid‐containing rafts probably serve 

as  platforms  for  gap  junction  aggregation  and  that  cell membranes  lacking  ether  lipids 

cannot accomplish this function.  

  Regarding our  finding  in control cells  that  some of  the phospho‐isoforms of Cx43 were 

additionally  present  in  non‐raft  fractions;  this  has  also  been  described  in  NIH  3T3  cells, 

immortalized mouse embryonic fibroblasts, which the authors suggested to be the result of 

the dynamic modulation by kinases and phosphatases (Schubert et al., 2002). However, this 

was certainly not the case with canine heart raft preparations, where only the gap‐junctional 

phospho‐isoforms were  found  in  detergent‐resistant  fractions  (Hesketh  et  al.,  2010).  It  is 

 

56 

 

possible that this controversy is a result of technical differences such as the isolation method 

or  the  usage  of  phosphatase  inhibitors.  Additionally,  this  behavior  might  be  tissue‐  or 

species‐specific. 

  There  are  increasing  numbers  of  reports  about  RCDP  cases  associated with  congenital 

heart phenotypes and also of Cx43 being altered in both amounts and localization in similar 

cardiac abnormalities. Thus, it was of interest to examine hearts of ether lipid‐deficient mice 

for this gap‐junctional protein. We investigated mice of two extreme ages: either developing 

or  very  old  mice.  Cx43  is  first  detected  in  the  ventricles  and  then  in  atria  at  around 

embryonic  day  12.5  (E12.5). We  analyzed  the  amounts  of  Cx43  in  developing  animals  at 

E18.5 and observed equal levels when WT and DHAPAT‐KO are compared (cf. Figure 5‐10). It 

is  likely  that  Cx43  can  be  substituted  by  other members  of  the  Cx  family  during  cardiac 

development,  in agreement with the observation that Cx43 KO mice develop and are born 

without  any  complications  (Reaume  et  al.,  1995).  Cardiac‐specific  inactivation  of  Cx43  in 

mice  resulted  in  normal  heart  structure  and  most  functions;  however,  the  conduction 

velocity  of  the  ventricles  was  remarkably  decreased  and  the  animals  died  due  to 

spontaneous  ventricular  arrhythmias  (Gutstein  et  al.,  2001a).  It  remains  to  be  elucidated 

whether ventricular abnormalities are  featured  in ether‐lipid deficient mice as well. Fabian 

Dorninger and Gerhard Zeitler from our lab, collaboration with the group of Reginald Bittner 

from the Institute of Anatomy (Medical University of Vienna) are now functionally measuring 

hearts of living mice by echocardiography to answer this question.  

  In contrast, adult hearts of Dhapat‐/‐ mice exhibited a striking reduction in Cx43 (cf. Figure 

5‐11),  implying that Cx43 expression probably decreases with age, which should be further 

examined  in  a  time  course.  One  of  the  functions  attributed  to  plasmalogens  was  their 

protective  role  against  oxidative  stress.  Cholesterol‐fed  rat  hearts  were  shown  to  have 

reduced Cx43 content  in the  intercalated discs at  increased superoxide  levels (Gorbe et al., 

2011),  which might  be  caused  by  amounts  of  plasmalogens  insufficient  to  prevent  this 

oxidative  increase.  Oxidative  stress  was  reported  to  be  less  damaging  to  cells  when 

astrocytes were coupled to each other via gap junctions (Blanc et al., 1998), which was also 

shown for mouse myocytes being more resistant to H2O2 toxicity in culture (Nakamura et al., 

1994).  Partial  deficiency  in  Cx43  in  heterozygous  mice  did  not  lead  to  the  remarkable 

decrease in infarct size after ischemic preconditioning as seen in wildtype mice (Schwanke et 

al., 2002). The mechanism is thought to be mediated by gap junction‐coupled cells spreading 

Discussion 

57

 

protective antioxidants to areas of stressed cells (Harris and Locke, 2009). In the context of 

our  finding,  this may  also  be  the  case:  oxidative  stress  due  to  lack  of  plasmalogens may 

downregulate Cx43 levels, leading to an uncoupling and thus accumulation of more radicals. 

  As  the  heart  additionally  expresses  other  gap‐junctional  proteins,  it  remains  to  be 

elucidated whether the reduction in protein amounts is unique to Cx43 and the defects arise 

from decreased  total protein  levels, malfunctioning or possibly  impaired cooperation with 

other connexins. 

  Our  results  strongly  suggest  an  impact  of  ether  lipid‐deficiency  on  the  gap‐junctional 

protein Cx43. While  the cells examined by  immunoblot or  immunocytochemistry methods 

provide molecular  insights, heart  tissues of mice clearly support  this  finding. Nevertheless, 

dye‐coupling  studies  may  reveal  the  consequences  of  ether  lipid‐deficiency  on  the 

functionality of gap junctions. 

 

  Rhizomelic  chondrodysplasia  punctata  and  oculodentodigital  dysplasia  have  many 

features in common in clinical terms, such as skeletal (especially craniofacial) malformations, 

cataracts and neurologic symptoms beside those regarding the heart. Cx43 in the skeleton is 

essential for its development and constant remodeling, since it is expressed in all cells in this 

tissue  as  the  predominant  gap  junction  protein.  Cx43  null mice  were  reported  to  have 

craniofacial  malformations  and  delayed  ossification  (Lecanda  et  al.,  2000),  which  also 

occurred in the Pex7‐/‐ mice (Brites et al., 2003).  

  Furthermore,  the  developing  lens  expresses  Cx43,  especially  lens  epithelial  cells  need 

them for a tight connection to each other to exchange metabolites and maintain the osmotic 

balance. Accordingly, Cx43 deficiency in mice leads to a separation of the lens epithelial cells 

(Gao and Spray, 1998), disturbing metabolic sharing and osmotic balance and, initiating the 

cataract  formation that  is characteristic  for ODDD but also RCDP patients. Cultured mouse 

lens epithelial cells of mice have been shown to be enriched in plasmenylethanolamine (Thai 

et  al.,  1999),  while  such  from  canine  tissues  contained  a  substantial  amount  of 

phosphatidylcholine plasmalogens (Greiner et al., 1994).  

  Also  neurologic  symptoms,  such  as  seizures  are  present  in  both  RCDP  and  ODDD, 

indicating a further crosstalk of ether  lipids and Cx43 that  is expressed  in astrocytes  in the 

central nervous system. Mice with a targeted  inactivation of Cx43 specifically  in astrocytes 

exhibited a poor performance on the rotarod and were found to have an increased amount 

 

58 

 

of acetylcholine in the frontal cortex (Frisch et al., 2003). Additionally, functional coupling of 

astrocytes was  decreased  by  around  50%  (Theis  et  al.,  2003).  The myelin  sheath  that  is 

responsible for the nerve conduction was also shown to be enriched in plasmalogens as well 

as connexins (Farooqui and Horrocks, 2001).  

 

  Further studies have to focus on the many  interconnections of Cx43 with ether  lipids to 

uncover  their  functional  importance  for each other.  In addition,  it would be of  interest  to 

extend the studies to the other gap‐junctional proteins. Ether  lipid‐ and connexin‐deficient 

mouse models as well as cell lines derived from patients with ODDD or RCDP would be useful 

material for such future projects. 

 

   

 

 

7 REFERENCES 

General 

Childrensmemorial.org 

Lipidlibrary.org 

My.clevelandclinic.org 

Orpha.net 

Mayoclinic.com 

Mdmedicine.wordpress.com 

 

Fabian Dorninger (2011), “Characterization of Cellular Membranes under Conditions of Ether Lipid 

Deficiency”, Diploma Thesis. 

 

Literature 

1) Akgun, C., Akbayram, S., Tuncer, O., Taskin, G., and Ceylan, A. (2010). Chondrodysplasia punctata associated with tetralogy of Fallot in a newborn infant. Genet Couns 21, 253‐256. 

 2) Alberts, B. (2008). Molecular biology of the cell, 5th edn (New York: Garland Science). 

 3) Biermann,  J.,  Just, W.W., Wanders, R.J., and Van Den Bosch, H.  (1999). Alkyl‐dihydroxyacetone phosphate  synthase  and  dihydroxyacetone  phosphate  acyltransferase  form  a  protein  complex  in peroxisomes. European journal of biochemistry / FEBS 261, 492‐499. 

 4) Blanc, E.M., Bruce‐Keller, A.J., and Mattson, M.P. (1998). Astrocytic gap junctional communication decreases neuronal vulnerability to oxidative stress‐induced disruption of Ca2+ homeostasis and cell death. Journal of neurochemistry 70, 958‐970. 

 5) Boulaksil, M., Winckels, S.K., Engelen, M.A., Stein, M., van Veen, T.A., Jansen, J.A., Linnenbank, A.C., Bierhuizen,  M.F.,  Groenewegen,  W.A.,  van  Oosterhout,  M.F.,  et  al.  (2010).  Heterogeneous Connexin43  distribution  in  heart  failure  is  associated  with  dispersed  conduction  and  enhanced susceptibility to ventricular arrhythmias. European journal of heart failure 12, 913‐921. 

 6) Braverman, N., Steel, G., Obie, C., Moser, A., Moser, H., Gould, S.J., and Valle, D. (1997). Human PEX7  encodes  the  peroxisomal  PTS2  receptor  and  is  responsible  for  rhizomelic  chondrodysplasia punctata. Nature genetics 15, 369‐376. 

 7) Braverman, N., Zhang, R., Chen, L., Nimmo, G., Scheper, S., Tran, T., Chaudhury, R., Moser, A., and Steinberg, S. (2010). A Pex7 hypomorphic mouse model for plasmalogen deficiency affecting the lens and skeleton. Molecular genetics and metabolism 99, 408‐416. 

 

 

 

8) Bretscher, M.S., and Munro, S.  (1993). Cholesterol and  the Golgi apparatus. Science 261, 1280‐1281. 

 9) Brites, P., Mooyer, P.A., El Mrabet, L., Waterham, H.R., and Wanders, R.J.  (2009). Plasmalogens participate  in very‐long‐chain fatty acid‐induced pathology. Brain  : a  journal of neurology 132, 482‐492. 

 10) Brites, P., Motley, A.M., Gressens, P., Mooyer, P.A., Ploegaert, I., Everts, V., Evrard, P., Carmeliet, P.,  Dewerchin, M.,  Schoonjans,  L.,  et  al.  (2003).  Impaired  neuronal migration  and  endochondral ossification  in  Pex7  knockout  mice:  a  model  for  rhizomelic  chondrodysplasia  punctata.  Human molecular genetics 12, 2255‐2267. 

 11) Brites, P., Waterham, H.R., and Wanders, R.J. (2004). Functions and biosynthesis of plasmalogens in health and disease. Biochimica et biophysica acta 1636, 219‐231. 

 12) Britz‐Cunningham, S.H., Shah, M.M., Zuppan, C.W., and Fletcher, W.H. (1995). Mutations of the Connexin43  gap‐junction  gene  in patients with heart malformations  and defects of  laterality.  The New England journal of medicine 332, 1323‐1329. 

 13)  Brown, D.A.,  and  London,  E.  (1998).  Functions  of  lipid  rafts  in  biological membranes. Annual review of cell and developmental biology 14, 111‐136. 

 14) Brown, D.A., and London, E. (2000). Structure and function of sphingolipid‐ and cholesterol‐rich membrane rafts. The Journal of biological chemistry 275, 17221‐17224. 

 15) Chatterjee, S., and Mayor, S. (2001). The GPI‐anchor and protein sorting. Cellular and molecular life sciences : CMLS 58, 1969‐1987. 

 16) Churko,  J.M., Shao, Q., Gong, X.Q., Swoboda, K.J., Bai, D., Sampson,  J., and Laird, D.W.  (2011). Human  dermal  fibroblasts derived  from oculodentodigital dysplasia patients  suggest  that patients may have wound‐healing defects. Human mutation 32, 456‐466. 

 17) Cooper, G.M.  (2000). The cell  : a molecular approach, 2nd edn  (Washington, D.C., Sunderland, Mass.: ASM Press ; Sinauer Associates). 

 18) Coskun, U., and Simons, K. (2010). Membrane rafting: from apical sorting to phase segregation. FEBS letters 584, 1685‐1693. 

 19) Cronier, L., Crespin, S., Strale, P.O., Defamie, N., and Mesnil, M. (2009). Gap junctions and cancer: new functions for an old story. Antioxidants & redox signaling 11, 323‐338. 

 20) Das Sarma,  J., Wang, F., and Koval, M.  (2002). Targeted gap  junction protein constructs  reveal connexin‐specific  differences  in  oligomerization.  The  Journal  of  biological  chemistry  277,  20911‐20918. 

 

 

 21) Dasgupta, C., Martinez, A.M., Zuppan, C.W., Shah, M.M., Bailey, L.L., and Fletcher, W.H. (2001). Identification of connexin43  (alpha1) gap  junction gene mutations  in patients with hypoplastic  left heart syndrome by denaturing gradient gel electrophoresis (DGGE). Mutation research 479, 173‐186. 

 22)  de  Vet,  E.C.,  Ijlst,  L.,  Oostheim,  W.,  Wanders,  R.J.,  and  van  den  Bosch,  H.  (1998).  Alkyl‐dihydroxyacetonephosphate synthase. Fate in peroxisome biogenesis disorders and identification of the point mutation underlying a single enzyme deficiency. The  Journal of biological chemistry 273, 10296‐10301. 

 23)  Defamie,  N.,  and  Mesnil,  M.  (2011).  The  modulation  of  gap‐junctional  intercellular communication by lipid rafts. Biochimica et biophysica acta. 

 24) Dilli, D., Yasar, H., Baydar, Z., Dilmen, U., Ceylaner, S., Altug, N., and Karadeniz, S. (2008). A case of rhizomelic chondrodysplasia punctata complicated with fetal arrhythmia. Erc Med J. 

 25) Dupont, E., Matsushita, T., Kaba, R.A., Vozzi, C., Coppen, S.R., Khan, N., Kaprielian, R., Yacoub, M.H., and Severs, N.J. (2001). Altered connexin expression in human congestive heart failure. Journal of molecular and cellular cardiology 33, 359‐371. 

 26)  Erdmann,  R.,  and  Schliebs, W.  (2005).  Peroxisomal matrix  protein  import:  the  transient  pore model. Nature reviews Molecular cell biology 6, 738‐742. 

 27)  Fadeel,  B.,  and  Xue,  D.  (2009).  The  ins  and  outs  of  phospholipid  asymmetry  in  the  plasma membrane:  roles  in health and disease. Critical  reviews  in biochemistry and molecular biology 44, 264‐277. 

 28) Fahy, E., Subramaniam, S., Brown, H.A., Glass, C.K., Merrill, A.H.,  Jr., Murphy, R.C., Raetz, C.R., Russell, D.W., Seyama, Y., Shaw, W., et al.  (2005). A comprehensive classification system  for  lipids. Journal of lipid research 46, 839‐861. 

 29)  Farooqui, A.A.,  Farooqui,  T.,  and Horrocks,  L.A.  (2008). Metabolism  and  function  of  bioactive ether lipids in the brain (New York: Springer). 

 30)  Farooqui,  A.A.,  and  Horrocks,  L.A.  (2001).  Plasmalogens:  workhorse  lipids  of  membranes  in normal and  injured neurons and glia. The Neuroscientist  : a  review  journal bringing neurobiology, neurology and psychiatry 7, 232‐245. 

 31) Figueiredo, S.d.S., Sousa de Araujo, J., Kozan, J.E.M., dos Santos, N.C.L., and Tanganeli, V. (2007). Rhizomelic Chondrodysplasia Punctata: a case report and brief literature review. Radiol Bras 40, 69‐72. 

 32) Fourie, D.T. (1995). Chondrodysplasia punctata: case report and literature review of patients with heart lesions. Pediatric cardiology 16, 247‐250. 

 

 

 33) Frisch, C., Theis, M., De Souza Silva, M.A., Dere, E., Sohl, G., Teubner, B., Namestkova, K., Willecke, K., and Huston, J.P. (2003). Mice with astrocyte‐directed inactivation of connexin43 exhibit increased exploratory  behaviour,  impaired motor  capacities,  and  changes  in  brain  acetylcholine  levels.  The European journal of neuroscience 18, 2313‐2318. 

 34) Gao,  Y.,  and  Spray, D.C.  (1998).  Structural  changes  in  lenses of mice  lacking  the  gap  junction protein connexin43. Investigative ophthalmology & visual science 39, 1198‐1209. 

 35)  Gaposchkin,  D.P.,  Farber,  H.W.,  and  Zoeller,  R.A.  (2008).  On  the  importance  of  plasmalogen status  in stimulated arachidonic acid release  in  the macrophage cell  line RAW 264.7. Biochimica et biophysica acta 1781, 213‐219. 

 36) Giepmans, B.N. (2004). Gap junctions and connexin‐interacting proteins. Cardiovascular research 62, 233‐245. 

 37) Gilleron, J., Carette, D., Durand, P., Pointis, G., and Segretain, D. (2009). Connexin 43 a potential regulator of  cell proliferation  and  apoptosis within  the  seminiferous epithelium. The  international journal of biochemistry & cell biology 41, 1381‐1390. 

 38) Glaser, P.E., and Gross, R.W. (1994). Plasmenylethanolamine facilitates rapid membrane fusion: a stopped‐flow  kinetic  investigation  correlating  the  propensity  of  a  major  plasma  membrane constituent  to  adopt  an HII phase with  its  ability  to promote membrane  fusion. Biochemistry 33, 5805‐5812. 

 39)  Goldberg,  G.S.,  Valiunas,  V.,  and  Brink,  P.R.  (2004).  Selective  permeability  of  gap  junction channels. Biochimica et biophysica acta 1662, 96‐101. 

 40)  Goodenough,  D.A.,  and  Paul,  D.L.  (2003).  Beyond  the  gap:  functions  of  unpaired  connexon channels. Nature reviews Molecular cell biology 4, 285‐294. 

 41) Gorbe, A., Varga, Z.V., Kupai, K., Bencsik, P., Kocsis, G.F., Csont, T., Boengler, K., Schulz, R., and Ferdinandy,  P.  (2011).  Cholesterol  diet  leads  to  attenuation  of  ischemic  preconditioning‐induced cardiac  protection:  the  role of  connexin  43. American  journal of physiology Heart  and  circulatory physiology 300, H1907‐1913. 

 42) Gorgas, K., Teigler, A., Komljenovic, D., and  Just, W.W.  (2006). The ether  lipid‐deficient mouse: tracking down plasmalogen functions. Biochimica et biophysica acta 1763, 1511‐1526. 

 43)  Greiner,  J.V.,  Auerbach,  D.B.,  Leahy,  C.D.,  and  Glonek,  T.  (1994).  Distribution  of membrane phospholipids in the crystalline lens. Investigative ophthalmology & visual science 35, 3739‐3746. 

 44) Gutstein, D.E., Morley, G.E.,  Tamaddon, H., Vaidya, D.,  Schneider, M.D.,  Chen,  J.,  Chien,  K.R., Stuhlmann, H., and Fishman, G.I. (2001a). Conduction slowing and sudden arrhythmic death in mice with cardiac‐restricted inactivation of connexin43. Circulation research 88, 333‐339. 

 

 

 45)  Gutstein,  D.E., Morley,  G.E.,  Vaidya,  D.,  Liu,  F.,  Chen,  F.L.,  Stuhlmann,  H.,  and  Fishman,  G.I. (2001b). Heterogeneous expression of Gap junction channels in the heart leads to conduction defects and ventricular dysfunction. Circulation 104, 1194‐1199. 

 46)  Haefliger,  J.A.,  and Meda,  P.  (2000).  Chronic  hypertension  alters  the  expression  of  Cx43  in cardiovascular muscle cells. Brazilian journal of medical and biological research = Revista brasileira de pesquisas medicas e biologicas / Sociedade Brasileira de Biofisica  [et al] 33, 431‐438. 

 47) Harris, A.L., and Locke, D. (2009). Connexins : a guide (New York, N.Y.: Springer). 

 48) Hesketh, G.G., Shah, M.H., Halperin, V.L., Cooke, C.A., Akar, F.G., Yen, T.E., Kass, D.A., Machamer, C.E., Van Eyk, J.E., and Tomaselli, G.F. (2010). Ultrastructure and regulation of lateralized connexin43 in the failing heart. Circulation research 106, 1153‐1163. 

 49)  Ikonen,  E.  (2008).  Cellular  cholesterol  trafficking  and  compartmentalization.  Nature  reviews Molecular cell biology 9, 125‐138. 

 50)  Itzkovitz, B.,  Jiralerspong, S., Nimmo, G.,  Loscalzo, M., Horovitz, D.D., Snowden, A., Moser, A., Steinberg,  S., and Braverman, N.  (2011).  Functional  characterization of novel mutations  in GNPAT and AGPS, causing Rhizomelic Chondrodysplasia Punctata (RCDP) types 2 and 3. Human mutation. 

 51) Jacobson, K., Mouritsen, O.G., and Anderson, R.G. (2007). Lipid rafts: at a crossroad between cell biology and physics. Nature cell biology 9, 7‐14. 

 52)  Johnson, R., Hammer, M., Sheridan,  J., and Revel,  J.P.  (1974). Gap  junction  formation between reaggregated  Novikoff  hepatoma  cells.  Proceedings  of  the  National  Academy  of  Sciences  of  the United States of America 71, 4536‐4540. 

 53)  Jordan, K.,  Solan,  J.L., Dominguez, M.,  Sia, M., Hand, A.,  Lampe, P.D.,  and  Laird, D.W.  (1999). Trafficking,  assembly,  and  function  of  a  connexin43‐green  fluorescent  protein  chimera  in  live mammalian cells. Molecular biology of the cell 10, 2033‐2050. 

 54) Kanzawa, N., Maeda, Y., Ogiso, H., Murakami, Y., Taguchi, R., and Kinoshita, T. (2009). Peroxisome dependency of alkyl‐containing GPI‐anchor biosynthesis  in  the endoplasmic  reticulum. Proceedings of the National Academy of Sciences of the United States of America 106, 17711‐17716. 

 55)  Kazemian,  M.,  Fakhraee,  S.H.,  Borjian,  L.,  and  Yeganeh,  M.H.  (2009).  [A  case  of  rhizomelic chondrodysplasia punctata with congenital heart disease]. J Bab Uni Med Sci 11. 

 56) Kolcz, J., Drukala, J., Bzowska, M., Rajwa, B., Korohoda, W., and Malec, E. (2005). The expression of connexin 43 in children with Tetralogy of Fallot. Cellular & molecular biology letters 10, 287‐303. 

 

 

 

57) Kostin, S., Dammer, S., Hein, S., Klovekorn, W.P., Bauer, E.P., and Schaper, J. (2004). Connexin 43 expression  and  distribution  in  compensated  and  decompensated  cardiac  hypertrophy  in  patients with aortic stenosis. Cardiovascular research 62, 426‐436. 

 58) Koval, M., Harley, J.E., Hick, E., and Steinberg, T.H. (1997). Connexin46 is retained as monomers in a trans‐Golgi compartment of osteoblastic cells. The Journal of cell biology 137, 847‐857. 

 59) Kumar, N.M., and Gilula, N.B. (1996). The gap junction communication channel. Cell 84, 381‐388. 

 60)  Kwak,  B.R.,  van  Kempen,  M.J.,  Theveniau‐Ruissy,  M.,  Gros,  D.B.,  and  Jongsma,  H.J.  (1999). Connexin expression  in cultured neonatal  rat myocytes  reflects  the pattern of  the  intact ventricle. Cardiovascular research 44, 370‐380. 

 61) Lablack, A., Bourdon, V., Defamie, N., Batias, C., Mesnil, M., Fenichel, P., Pointis, G., and Segretain, D. (1998). Ultrastructural and biochemical evidence for gap junction and connexin 43 expression in a clonal Sertoli cell line: a potential model in the study of junctional complex formation. Cell and tissue research 294, 279‐287. 

 62) Laird, D.W.  (2006). Life cycle of connexins  in health and disease. The Biochemical  journal 394, 527‐543. 

 63) Lampe, P.D., and Lau, A.F. (2000). Regulation of gap  junctions by phosphorylation of connexins. Archives of biochemistry and biophysics 384, 205‐215. 

 64)  Lauf, U., Giepmans, B.N.,  Lopez, P., Braconnot, S., Chen, S.C., and Falk, M.M.  (2002). Dynamic trafficking  and  delivery  of  connexons  to  the  plasma membrane  and  accretion  to  gap  junctions  in living  cells. Proceedings of  the National Academy of  Sciences of  the United  States of America 99, 10446‐10451. 

 65)  Lecanda,  F.,  Warlow,  P.M.,  Sheikh,  S.,  Furlan,  F.,  Steinberg,  T.H.,  and  Civitelli,  R.  (2000). Connexin43  deficiency  causes  delayed  ossification,  craniofacial  abnormalities,  and  osteoblast dysfunction. The Journal of cell biology 151, 931‐944. 

 66)  Levental,  I.,  Lingwood,  D.,  Grzybek,  M.,  Coskun,  U.,  and  Simons,  K.  (2010).  Palmitoylation regulates raft affinity for the majority of integral raft proteins. Proceedings of the National Academy of Sciences of the United States of America 107, 22050‐22054. 

 67) Levin, M., and Mercola, M. (1998). Gap junctions are involved in the early generation of left‐right asymmetry. Developmental biology 203, 90‐105. 

 68)  Lingwood,  D.,  and  Simons,  K.  (2007).  Detergent  resistance  as  a  tool  in membrane  research. Nature protocols 2, 2159‐2165. 

 

 

 

69)  Loddenkemper,  T.,  Grote,  K.,  Evers,  S.,  Oelerich, M.,  and  Stogbauer,  F.  (2002).  Neurological manifestations of the oculodentodigital dysplasia syndrome. Journal of neurology 249, 584‐595. 

 70) Lopez, P., Balicki, D., Buehler, L.K., Falk, M.M., and Chen, S.C. (2001). Distribution and dynamics of gap junction channels revealed in living cells. Cell communication & adhesion 8, 237‐242. 

 71) Ma,  C.,  Agrawal, G.,  and  Subramani,  S.  (2011).  Peroxisome  assembly: matrix  and membrane protein biogenesis. The Journal of cell biology 193, 7‐16. 

 72) Malewicz,  B.,  Kumar,  V.V.,  Johnson,  R.G.,  and  Baumann, W.J.  (1990).  Lipids  in  gap  junction assembly and function. Lipids 25, 419‐427. 

 73) Mandel, H., Sharf, R., Berant, M., Wanders, R.J., Vreken, P., and Aviram, M. (1998). Plasmalogen phospholipids  are  involved  in  HDL‐mediated  cholesterol  efflux:  insights  from  investigations  with plasmalogen‐deficient cells. Biochemical and biophysical research communications 250, 369‐373. 

 74)  Marsh,  D.  (2007).  Lateral  pressure  profile,  spontaneous  curvature  frustration,  and  the incorporation and conformation of proteins in membranes. Biophysical journal 93, 3884‐3899. 

 75) Martin, P.E., and Evans, W.H. (2004). Incorporation of connexins into plasma membranes and gap junctions. Cardiovascular research 62, 378‐387. 

 76) Martinez,  A.D.,  and  Saez,  J.C.  (1999).  Arachidonic  acid‐induced  dye  uncoupling  in  rat  cortical astrocytes is mediated by arachidonic acid byproducts. Brain research 816, 411‐423. 

 77) Massey, K.D., Minnich, B.N., and Burt, J.M. (1992). Arachidonic acid and lipoxygenase metabolites uncouple neonatal rat cardiac myocyte pairs. The American journal of physiology 263, C494‐501. 

 78) Mayor, S., and Riezman, H. (2004). Sorting GPI‐anchored proteins. Nature reviews Molecular cell biology 5, 110‐120. 

 79) Mese, G., Richard, G., and White, T.W.  (2007). Gap  junctions: basic structure and function. The Journal of investigative dermatology 127, 2516‐2524. 

 80)  Meyer,  R.,  Malewicz,  B.,  Baumann,  W.J.,  and  Johnson,  R.G.  (1990).  Increased  gap  junction assembly between cultured cells upon cholesterol supplementation. Journal of cell science 96 ( Pt 2), 231‐238. 

 81) Motley, A.M., Hettema, E.H., Hogenhout, E.M., Brites, P., ten Asbroek, A.L., Wijburg, F.A., Baas, F., Heijmans, H.S., Tabak, H.F., Wanders, R.J., et al.  (1997). Rhizomelic chondrodysplasia punctata  is a peroxisomal protein targeting disease caused by a non‐functional PTS2 receptor. Nature genetics 15, 377‐380. 

 

 

 

82) Musil,  L.S., Beyer, E.C., and Goodenough, D.A.  (1990a). Expression of  the gap  junction protein connexin43  in  embryonic  chick  lens:  molecular  cloning,  ultrastructural  localization,  and  post‐translational phosphorylation. The Journal of membrane biology 116, 163‐175. 

 83)  Musil,  L.S.,  Cunningham,  B.A.,  Edelman,  G.M.,  and  Goodenough,  D.A.  (1990b).  Differential phosphorylation of the gap junction protein connexin43 in junctional communication‐competent and ‐deficient cell lines. The Journal of cell biology 111, 2077‐2088. 

 84)  Musil,  L.S.,  and  Goodenough,  D.A.  (1991).  Biochemical  analysis  of  connexin43  intracellular transport, phosphorylation, and assembly into gap junctional plaques. The Journal of cell biology 115, 1357‐1374. 

 85)  Musil,  L.S.,  and  Goodenough,  D.A.  (1993).  Multisubunit  assembly  of  an  integral  plasma membrane channel protein, gap  junction connexin43, occurs after exit  from  the ER. Cell 74, 1065‐1077. 

 86) Nagan, N., and Zoeller, R.A.  (2001). Plasmalogens: biosynthesis and  functions. Progress  in  lipid research 40, 199‐229. 

 87) Naher, B.S., Mannan, M., Noor, K., and Shahidullah, M.  (2010). Chondrodysplasia Punctata  in a Newborn; Rhizomelic Type: A Case Report. Bangladesh J Child Health 34, 28‐30. 

 88) Nakamura, T.Y., Yamamoto, I., Kanno, Y., Shiba, Y., and Goshima, K. (1994). Metabolic coupling of glutathione  between mouse  and  quail  cardiac myocytes  and  its  protective  role  against  oxidative stress. Circulation research 74, 806‐816. 

 89) Naus, C.C., and Laird, D.W. (2010). Implications and challenges of connexin connections to cancer. Nature reviews Cancer 10, 435‐441. 

 90) Nimmo, G., Monsonego, S., Descartes, M., Franklin, J., Steinberg, S., and Braverman, N. (2010). Rhizomelic chrondrodysplasia punctata type 2 resulting from paternal  isodisomy of chromosome 1. American journal of medical genetics Part A 152A, 1812‐1817. 

 91)  Oswald,  G.,  Lawson,  C.,  Raymond,  G.,  Golden, W.C.,  and  Braverman,  N.  (2011).  Rhizomelic chondrodysplasia  punctata  type  1  and  fulminant  neonatal  respiratory  failure,  a  case  report  and discussion of pathophysiology. American journal of medical genetics Part A. 

 92) Oyamada, M., Kimura, H., Oyamada, Y., Miyamoto, A., Ohshika, H.,  and Mori, M.  (1994).  The expression,  phosphorylation,  and  localization  of  connexin  43  and  gap‐junctional  intercellular communication  during  the  establishment  of  a  synchronized  contraction  of  cultured  neonatal  rat cardiac myocytes. Experimental cell research 212, 351‐358. 

 93)  Pascolat,  G.,  Zindeluk,  J.L.,  Abrao,  K.C.,  Rodrigues,  F.M.,  and  Guedes,  C.I.  (2003).  Rhizomelic chondrodysplasia punctata ‐ case report. Jornal de pediatria 79, 189‐192. 

 

 

 94) Paznekas, W.A., Boyadjiev, S.A., Shapiro, R.E., Daniels, O., Wollnik, B., Keegan, C.E.,  Innis,  J.W., Dinulos, M.B., Christian, C., Hannibal, M.C., et al.  (2003). Connexin 43  (GJA1) mutations  cause  the pleiotropic phenotype of oculodentodigital dysplasia. American  journal of human genetics 72, 408‐418. 

 95) Paznekas, W.A., Karczeski, B., Vermeer, S., Lowry, R.B., Delatycki, M., Laurence, F., Koivisto, P.A., Van Maldergem,  L.,  Boyadjiev,  S.A.,  Bodurtha,  J.N.,  et  al.  (2009).  GJA1 mutations,  variants,  and connexin 43 dysfunction as it relates to the oculodentodigital dysplasia phenotype. Human mutation 30, 724‐733. 

 96)  Peters,  N.S.,  Green,  C.R.,  Poole‐Wilson,  P.A.,  and  Severs,  N.J.  (1993).  Reduced  content  of connexin43 gap junctions in ventricular myocardium from hypertrophied and ischemic human hearts. Circulation 88, 864‐875. 

 97) Pike, L.J. (2004). Lipid rafts: heterogeneity on the high seas. The Biochemical journal 378, 281‐292. 

 98)  Pike,  L.J.  (2006).  Rafts  defined:  a  report  on  the  Keystone  Symposium  on  Lipid  Rafts  and  Cell Function. Journal of lipid research 47, 1597‐1598. 

 99) Pike, L.J. (2009). The challenge of lipid rafts. Journal of lipid research 50 Suppl, S323‐328. 

 100) Pike, L.J., Han, X., Chung, K.N., and Gross, R.W.  (2002). Lipid rafts are enriched  in arachidonic acid and plasmenylethanolamine and  their composition  is  independent of caveolin‐1 expression: a quantitative electrospray ionization/mass spectrometric analysis. Biochemistry 41, 2075‐2088. 

 101) Poelzing, S., and Rosenbaum, D.S. (2004). Altered connexin43 expression produces arrhythmia substrate  in  heart  failure.  American  journal  of  physiology  Heart  and  circulatory  physiology  287, H1762‐1770. 

 102) Pralle, A., Keller, P., Florin, E.L., Simons, K., and Horber, J.K. (2000). Sphingolipid‐cholesterol rafts diffuse as small entities in the plasma membrane of mammalian cells. The Journal of cell biology 148, 997‐1008. 

 103) Purdue, P.E., Zhang, J.W., Skoneczny, M., and Lazarow, P.B. (1997). Rhizomelic chondrodysplasia punctata  is caused by deficiency of human PEX7, a homologue of  the yeast PTS2  receptor. Nature genetics 15, 381‐384. 

 104) Quinn, P.J., and Kagan, V.E.  (2002). Phospholipid metabolism  in apoptosis  (New York: Kluwer Academic/Plenum Publishers). 

 105) Rajendran, L., and Simons, K. (2005). Lipid rafts and membrane dynamics. Journal of cell science 118, 1099‐1102. 

 

 

 

106) Rapoport, T.A.  (2007). Protein  translocation across  the eukaryotic endoplasmic  reticulum and bacterial plasma membranes. Nature 450, 663‐669. 

 107) Reaume, A.G., de Sousa, P.A., Kulkarni, S., Langille, B.L., Zhu, D., Davies, T.C., Juneja, S.C., Kidder, G.M., and Rossant, J. (1995). Cardiac malformation in neonatal mice lacking connexin43. Science 267, 1831‐1834. 

 108)  Rintala,  J.,  Seemann,  R.,  Chandrasekaran,  K.,  Rosenberger,  T.A.,  Chang,  L.,  Contreras, M.A., Rapoport,  S.I.,  and Chang, M.C.  (1999).  85  kDa  cytosolic phospholipase A2  is  a  target  for  chronic lithium in rat brain. Neuroreport 10, 3887‐3890. 

 109) Rodemer, C., Thai, T.P., Brugger, B., Kaercher, T., Werner, H., Nave, K.A., Wieland, F., Gorgas, K., and Just, W.W. (2003).  Inactivation of ether  lipid biosynthesis causes male  infertility, defects  in eye development and optic nerve hypoplasia in mice. Human molecular genetics 12, 1881‐1895. 

 110) Roell, W., Lewalter, T., Sasse, P., Tallini, Y.N., Choi, B.R., Breitbach, M., Doran, R., Becher, U.M., Hwang, S.M., Bostani, T., et al.  (2007). Engraftment of connexin 43‐expressing cells prevents post‐infarct arrhythmia. Nature 450, 819‐824. 

 111) Rosa Castro, R., Rosario Torres, I., Felipe Velasquez, V., Rosalio Ballona, C., Iris Kikushima, Y., and Eva  Klein,  D.  (2002).  [REPORTE  DE  UN  CASO  DE  CONDRODISPLASIA  PUNCTATA  VARIEDAD RIZOMÉLICA]. Folia Dermatológica Peruana 13. 

 112)  Saltman,  A.E.,  Aksehirli,  T.O.,  Valiunas,  V.,  Gaudette,  G.R.,  Matsuyama,  N.,  Brink,  P.,  and Krukenkamp, I.B. (2002). Gap junction uncoupling protects the heart against ischemia. The Journal of thoracic and cardiovascular surgery 124, 371‐376. 

 113)  Sastrowijoto,  S.H.,  Vandenberghe,  K., Moerman,  P.,  Lauweryns,  J.M.,  and  Fryns,  J.P.  (1994). Prenatal ultrasound diagnosis of  rhizomelic  chondrodysplasia  punctata  in  a primigravida.  Prenatal diagnosis 14, 770‐776. 

 114)  Schubert, A.L.,  Schubert, W.,  Spray, D.C., and  Lisanti, M.P.  (2002). Connexin  family members target to lipid raft domains and interact with caveolin‐1. Biochemistry 41, 5754‐5764. 

 115) Schwanke, U., Konietzka,  I., Duschin, A., Li, X., Schulz, R., and Heusch, G.  (2002). No  ischemic preconditioning  in  heterozygous  connexin43‐deficient mice. American  journal  of  physiology Heart and circulatory physiology 283, H1740‐1742. 

 116)  Segretain,  D.,  and  Falk,  M.M.  (2004).  Regulation  of  connexin  biosynthesis,  assembly,  gap junction formation, and removal. Biochimica et biophysica acta 1662, 3‐21. 

 117) Severs, N.J., Bruce, A.F., Dupont, E., and Rothery, S.  (2008). Remodelling of gap  junctions and connexin expression in diseased myocardium. Cardiovascular research 80, 9‐19. 

 

 

 

118)  Shanske, A.L., Bernstein,  L.,  and Herzog, R.  (2007). Chondrodysplasia punctata  and maternal autoimmune disease: a new case and review of the literature. Pediatrics 120, e436‐441. 

 119) Simons, K., and Toomre, D. (2000). Lipid rafts and signal transduction. Nature reviews Molecular cell biology 1, 31‐39. 

 120) Simons, K., and van Meer, G. (1988). Lipid sorting in epithelial cells. Biochemistry 27, 6197‐6202. 

 121) Singer, S.J., and Nicolson, G.L. (1972). The fluid mosaic model of the structure of cell membranes. Science 175, 720‐731. 

 122) Solan,  J.L., and Lampe, P.D.  (2007). Key connexin 43 phosphorylation events  regulate  the gap junction life cycle. The Journal of membrane biology 217, 35‐41. 

 123)  Solan,  J.L.,  and  Lampe,  P.D.  (2009).  Connexin43  phosphorylation:  structural  changes  and biological effects. The Biochemical journal 419, 261‐272. 

 124)  Spector,  A.A.,  and  Yorek,  M.A.  (1985).  Membrane  lipid  composition  and  cellular  function. Journal of lipid research 26, 1015‐1035. 

 125) Spray, D.C., White, R.L., de Carvalho, A.C., Harris, A.L., and Bennett, M.V. (1984). Gating of gap junction channels. Biophysical journal 45, 219‐230. 

 126) Sprong, H., van der Sluijs, P., and van Meer, G. (2001). How proteins move lipids and lipids move proteins. Nature reviews Molecular cell biology 2, 504‐513. 

 127) Steinberg, S.J., Dodt, G., Raymond, G.V., Braverman, N.E., Moser, A.B., and Moser, H.W. (2006). Peroxisome biogenesis disorders. Biochimica et biophysica acta 1763, 1733‐1748. 

 128) Stoll, C., Dott, B., Roth, M.P., and Alembik, Y. (1989). Birth prevalence rates of skeletal dysplasias. Clinical genetics 35, 88‐92. 

 129) Stuhlmann, D., Ale‐Agha, N., Reinehr, R., Steinbrenner, H., Ramos, M.C., Sies, H., and Brenneisen, P.  (2003). Modulation of homologous gap  junctional  intercellular communication of human dermal fibroblasts  via  a paracrine  factor(s)  generated by  squamous  tumor  cells. Carcinogenesis 24, 1737‐1748. 

 130)  Teigler,  A.,  Komljenovic,  D.,  Draguhn,  A.,  Gorgas,  K.,  and  Just,  W.W.  (2009).  Defects  in myelination, paranode organization and Purkinje cell  innervation  in  the ether  lipid‐deficient mouse cerebellum. Human molecular genetics 18, 1897‐1908. 

 131) Thai, T.P., Heid, H., Rackwitz, H.R., Hunziker, A., Gorgas, K., and  Just, W.W.  (1997). Ether  lipid biosynthesis:  isolation  and  molecular  characterization  of  human  dihydroxyacetonephosphate acyltransferase. FEBS letters 420, 205‐211. 

 

 

 132) Thai, T.P., Rodemer, C.,  Jauch, A., Hunziker, A., Moser, A., Gorgas, K., and  Just, W.W.  (2001). Impaired membrane traffic in defective ether lipid biosynthesis. Human molecular genetics 10, 127‐136. 

 133) Thai, T.P., Rodemer, C., Worsch, J., Hunziker, A., Gorgas, K., and Just, W.W. (1999). Synthesis of plasmalogens in eye lens epithelial cells. FEBS letters 456, 263‐268. 

 134) Theis, M., Jauch, R., Zhuo, L., Speidel, D., Wallraff, A., Doring, B., Frisch, C., Sohl, G., Teubner, B., Euwens, C., et al. (2003). Accelerated hippocampal spreading depression and enhanced  locomotory activity in mice with astrocyte‐directed inactivation of connexin43. The Journal of neuroscience : the official journal of the Society for Neuroscience 23, 766‐776. 

 135) Thomas, S., Preda‐Pais, A., Casares, S., and Brumeanu, T.D.  (2004). Analysis of  lipid  rafts  in T cells. Molecular immunology 41, 399‐409. 

 136) Thomas, S.A., Schuessler, R.B., Berul, C.I., Beardslee, M.A., Beyer, E.C., Mendelsohn, M.E., and Saffitz,  J.E.  (1998). Disparate effects of deficient expression of connexin43 on atrial and ventricular conduction:  evidence  for  chamber‐specific molecular  determinants  of  conduction.  Circulation  97, 686‐691. 

 137) van Meer, G. (2005). Cellular lipidomics. The EMBO journal 24, 3159‐3165. 

 138) van Meer, G., and Lisman, Q. (2002). Sphingolipid transport: rafts and translocators. The Journal of biological chemistry 277, 25855‐25858. 

 139) van Meer, G., Voelker, D.R., and Feigenson, G.W. (2008). Membrane lipids: where they are and how they behave. Nature reviews Molecular cell biology 9, 112‐124. 

 140) Wallner, S., and Schmitz, G. (2011). Plasmalogens the neglected regulatory and scavenging lipid species. Chemistry and physics of lipids 164, 573‐589. 

 141) Wanders,  R.J.,  Barth,  P.G.,  Schutgens,  R.B.,  and  Tager,  J.M.  (1994).  Clinical  and  biochemical characteristics of peroxisomal disorders: an update. European journal of pediatrics 153, S44‐48. 

 142) Wanders, R.J., and Waterham, H.R. (2006). Biochemistry of mammalian peroxisomes revisited. Annual review of biochemistry 75, 295‐332. 

 143) Willecke, K., Eiberger, J., Degen, J., Eckardt, D., Romualdi, A., Guldenagel, M., Deutsch, U., and Sohl,  G.  (2002).  Structural  and  functional  diversity  of  connexin  genes  in  the mouse  and  human genome. Biological chemistry 383, 725‐737. 

 144) Wood,  P.L.,  Khan, M.A.,  Smith,  T.,  Ehrmantraut,  G.,  Jin, W.,  Cui, W.,  Braverman,  N.E.,  and Goodenowe, D.B.  (2011).  In  vitro  and  in  vivo  plasmalogen  replacement  evaluations  in  rhizomelic 

 

 

chrondrodysplasia  punctata  and  Pelizaeus‐Merzbacher  disease  using  PPI‐1011,  an  ether  lipid plasmalogen precursor. Lipids in health and disease 10, 182. 

 145) Yalin, C.T., Bayrak, I.K., Danaci, M., and Incesu, L. (2003). [Yenidoganda rizomelik kondrodisplazi punktata ve foramen magnum stenozu]. Tanisal ve Girisimsel Radyoloji 9, 100‐103. 

 146) Zech, T., Ejsing, C.S., Gaus, K., de Wet, B., Shevchenko, A., Simons, K., and Harder, T.  (2009). Accumulation of raft lipids in T‐cell plasma membrane domains engaged in TCR signalling. The EMBO journal 28, 466‐476. 

 

 

    

 

 

8 APPENDIX 

 

CURRICULUM VITAE  

Name:  Fatma Aslı Erdem 

Date of birth:  07/07/1987 

Residency:   Vienna, Austria 

E‐mail:  fatma.erdem@meduniwien.ac.at  

  

EDUCATIONAL BACKGROUND 

Molecular Biology Studies 2006‐2011 Center for Molecular Biology, University of Vienna, Austria  since September 2010: Diploma thesis 

Thesis title: Alterations in the gap‐junctional protein Connxin‐43 under 

conditions of ether lipid deficiency 

Institute: Center for Brain Research 

Medical University of Vienna, Austria 

Supervisor:  Prof. Dr. Johannes Berger 

Graduation in Software Engineering 2001‐2006 Higher Technical College of Vienna (HTL Donaustadt)  

Secondary School (AHS Rosasgasse) 1997‐2001 

Primary School (VS Nymphengasse) 1993‐1997