altered expression and splicing of esrp1 in malignant...

1

Altered expression and splicing of ESRP1 in malignant melanoma correlates with epithelial-

mesenchymal status and tumor-associated immune cytolytic activity

Jun Yao1, Otavia L. Caballero2,3, Ying Huang4, Calvin Lin4, Donata Rimoldi5, Andreas Behren6,

Jonathan S. Cebon6, Mien-Chie Hung1, John N. Weinstein7, Robert L. Strausberg8*, Qi Zhao2,4*

1 Department of Molecular and Cellular Oncology, The University of Texas - M. D. Anderson

Cancer Center, Houston, TX, USA

2 Ludwig Collaborative Laboratory, Johns Hopkins University School of Medicine, Baltimore, MD,

USA

3 Orygen Biotecnologia, SA., São Paulo, SP, Brazil

4 Regeneron Pharmaceuticals Inc., Tarrytown, NY 10591, USA

5 Clinical Tumor Biology and Immunotherapy Unit, Ludwig Center, University of Lausanne,

Switzerland, Lausanne, Switzerland

6 Cancer Immunobiology Laboratory, Olivia Newton-John Cancer Research Institute, Victoria,

Australia

7 Department of Bioinformatics and Computational Biology, The University of Texas - M. D.

Anderson Cancer Center, Houston, TX, USA

8 Ludwig Cancer Research, New York, NY, USA

*Correspondence authors:

on June 16, 2018. © 2016 American Association for Cancer Research. cancerimmunolres.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on April 4, 2016; DOI: 10.1158/2326-6066.CIR-15-0255

http://cancerimmunolres.aacrjournals.org/

2

Qi Zhao, Regeneron Pharmaceuticals Inc., 777 Old Saw Mill River Road, Tarrytown, NY 10591,

[email protected]; Robert L. Strausberg, Ludwig Cancer Research, 666 3rd Ave, New

York, NY 10017, [email protected]

This work is funded by Ludwig Cancer Research and Regeneron Pharmaceuticals Inc.

There is no conflict of interest to be disclosed.




3

ABSTRACT

Melanoma is one of the major cancer types for which new immune-based cancer treatments

have achieved promising results. However, anti–PD-1 and anti–CTLA-4 therapies are effective

only in some patients. Hence, predictive molecular markers for the development of clinical

strategies targeting immune checkpoints are needed. Using the Cancer Genome Atlas (TCGA)

RNAseq data, we found expression of ESRP1, encoding a master splicing regulator in the

epithelial-to-mesenchymal transition (EMT), was inversely correlated with tumor-associated

immune cytolytic activity. That association holds up across multiple TCGA tumor types,

suggesting a link between tumor EMT status and infiltrating lymphocyte activity. In melanoma,

ESRP1 mainly exists in a melanocyte-specific truncated form transcribed from exon 13. This

was validated by analyzing CCLE cell line data, public CAGE data, and RT-PCR in primary cultured

melanoma cell lines. Based on ESRP1 expression, we divided TCGA melanoma cases into ESRP1

low, truncated, and full-length groups. ESRP1-truncated tumors comprise approximately two-

thirds of melanoma samples and reside in an apparent transitional state between epithelial and

mesenchymal phenotypes. ESRP1 full-length tumors express epithelial markers and constitute

about five percent of melanoma samples. In contrast, ESRP1-low tumors express mesenchymal

markers and are high in immune cytolytic activity as well as PD-L2 and CTLA-4 expression. Those

tumors are associated with better patient survival. Results from our study suggest a path

toward the use of ESRP1 and other EMT markers as informative biomarkers for

immunotherapy.




4

INTRODUCTION

Melanoma is one of the most invasive malignancies and patients with melanoma mainly die

from tumor metastasis. The reversible phenotype switch between proliferative and invasive

cells that drives the metastasis of tumor cells has been proposed as a model for melanoma

progression (1). Many transcription factors and signaling pathways induced by changes in the

microenvironment have been implicated in tumorigenesis and this phenotypic switch (2, 3).

MITF, a master transcriptional regulator involved in melanocyte differentiation and pigment

production, has been shown to play a critical role in melanoma development (4, 5). High

expression of MITF is associated with transformation of melanocytes and hyperproliferation of

the transformed cells. Down-regulation of MITF expression leads to greater invasive potential

of melanoma cells (3, 6, 7). Changes in the Wnt signaling pathway have also been implicated in

the phenotypic switch (8-11). The inversely expressed genes ROR1 and ROR2 are reported to be

associated with proliferative and invasive phenotypes in melanoma, respectively (12). However,

many of these observations are based on in vitro gain-of-function or loss-of-function

experiments and might not reflect the complexity of microenvironment changes and cohesive

signaling networks in vivo.

ESRP1 encodes a cell type-specific splicing regulator protein exclusively expressed in epithelial

cells such as those comprised of ectoderm-derived tissues and endothelial organ lining.

Expression of ESRP1 controls cell type–specific alternative splicing of many genes such as

FGFR2, CD44, and CTNND1 that are important signaling molecules mediating cell division,

growth, and differentiation under specific microenvironment settings (13). For example, two




5

alternative forms of FGFR2, IIIb and IIIc, which exhibit different affinity with their FGF ligands,

are predominantly expressed in epithelial and mesenchymal cells, respectively. The selective

expression of the FGFR2 IIIb or IIIc isoforms is under the control of ESRP1 (14). We previously

reported that dominance of epithelial or mesenchymal cell types exist in renal cell carcinoma

(15). Our results support the notion that clear cell RCC tumor originates from mesenchymal-like

stem cells embedded in adult kidney, unlike other subtypes of RCC, such as chromophobe, that

likely have an epithelial-like stem cell origin. Thus, ESRP1 and status of its target genes might

serve as molecular markers of tumor cells with epithelial or mesenchymal properties.

Skin cutaneous melanoma originates from melanocytes derived from multipotent neural crest

cells (NCC). NCC undergo EMT before delaminating from the dorsal neural tube and can

differentiate into many cell types such as neurons of the peripheral nervous system, glial and

Schwann cells, melanocytes and craniofacial cartilage. Although the EMT process enables NCC

migration, formation of NCC’s derivative structures requires re-aggregation of cells, often

coupled with the reverse mesenchymal-to-epithelial transition (MET) post migration (16, 17).

Behavior of neural crest stem cells during embryogenesis and their existence in adult NCC-

derived tissues raise questions about the origin and ultimate fate of melanoma cells (18).

Transformation of melanocytes is driven by somatic changes in cancer genomes. However,

these somatic changes are not sufficient to fully explain the highly heterogeneous and

metastatic nature of the disease. A comprehensive genomic landscape of alterations in skin

melanoma was developed based on multidimensional high-throughput data (19). The

substantial heterogeneity of tumor cells and their microenvironments is reflected in the




6

complex patterns of genomic, epigenomic, and transcriptomic alternations. With rapid

advances of immunotherapy in melanoma and other types of cancers, we urgently need to

discover diagnostic and prognostic markers that could be applied in clinical settings. In this

study, we further utilized datasets generated for melanoma tumors by The Cancer Genome

Atlas (TCGA) to investigate ESRP1-based cell type plasticity in melanoma and its implication in

melanoma biology and treatment.




7

MATERIALS and METHODS

Samples and Datasets

TCGA RNA-Seq expression and methylation (HumanMethylation450 probes) data and

corresponding clinical metadata were accessed from TCGA public access data portal released

before 01-27-2015 (https://tcga-data.nci.nih.gov/tcga/dataAccessMatrix.htm). Exon level

mapping files generated for Cancer Cell Line Encyclopedia (CCLE) RNA-Seq gene expression

were accessed through the ArrayStudio OncoLand portal (http://www.omicsoft.com). Cap

analysis gene expression (CAGE) data were queried from FANTOM5

(http://fantom.gsc.riken.jp). Other RNA-Seq data including melanocyte cell lines (GSM1138580,

GSM819489), shMITF knock-down experiments (SRP048577), mouse melanocyte and

melanoma samples (SRX478034, SRX478033, ERX386690, SRX475297) were downloaded from

NCBI’s Short Reads Archive. Somatic point mutation data were accessed from GDAC Firehose

(http://gdac.broadinstitute.org/).

The melanocyte cell line used in real-time PCR was purchased from SicenCell Research

Laboratory, Inc in 2004. Other melanoma cell lines, either commercially available or established

from low passage culture of cutaneous melanoma lesion and authenticated by branches of

Ludwig Cancer Research, were acquired between 1998 and 2013. Specifically, Hs294T was

acquired from ATCC. T618A, Me246, Me260 and Me275 were established and authenticated at

the Ludwig Institute for Cancer Research, Lausanne Branch. The SK-MEL series of melanoma cell

lines were established and authenticated at Ludwig Institute for Cancer Research, New York

branch at Memorial Sloan Kettering Cancer Center. LM-MEL-62 was established and




8

authenticated at Ludwig Institute for Cancer Research Melbourne, Austin Branch at Melbourne

Australia. Cells lines were usually cultured for a maximum of three passages.

Defining ESRP1 groups based on exon expression

Calculation of exon expression is based on exon quantification file; gene expression is based on

normalized gene expression values in RSEM (RNA-Seq by Expectation-Maximization). The

ESRP1-low cutoff is defined by ESRP1 gene expression less than 125 RSEM after examination of

the ESRP1 expression distribution in all samples. Among the rest that have ESRP1 gene

expression > 125 RSEM, samples with an exon truncation ratio >= 0.65 are defined as ESRP1-

truncated; samples with a truncation ratio smaller than 0.65 are grouped as ESRP1-full length.

Considering that exon 14 and exon 15 are alternatively expressed exons, the exon ratio used in

assigning ESRP1-based subgrouping is defined as: sum (exon13 + exon16) RSEM/sum (exon(1-

12) + exon13 + exon16) RSEM. The truncation ratio cutoff of 0.65 was defined after

examination of its distribution. The heatmap in Fig. 1 was generated without median removal.

Median removal was used in all other expression heatmaps.

Gene Expression Signatures

Cytolytic activity is calculated as the geometric mean of GZMA and PRF1 using log2 expression

values. We used normal tissue gene expression data obtained from GTEx portal

(http://www.gtexportal.org/home/) to identify two skin-specific genes (KRT2 and LOR). With

the highest KRT2/LOR expressing non-skin tissue, its median expression of KRT2/LOR plus 3x

standard deviation is lower than RPKM (Reads Per Kilobase of transcript per Million mapped




9

reads) 16. We therefore call melanoma samples with KRT2 or LOR expression above RPKM 16

as keratinocyte-contaminated.

Quantitative real-time reverse transcription-PCR

Analysis of cDNA samples was performed in duplicate for ESRP1 and for the reference gene

within each experiment using the CFX96 Real-Time PCR system (Biorad, Hercules, CA) and

Taqman platform (Applied Biosystems, Foster City, CA). TFRC was amplified as an internal

reference gene. The PCR primers and probes for ESRP1 (Hs00214472_m1, flanking exons 11-2;

Hs00936411_m1, flanking exons 13-14) and TFRC internal control gene (4326323E) were

purchased from Applied Biosystems. Primers used for PCR amplification were chosen to

encompass intron between exon sequences to avoid amplification of genomic DNA.

Cloning of full-length ESRP1 and Transfection into SKMEL28

PCR was undertaken with High Fidelity Taq polymerase (Invitrogen, Carlsbad, CA) using cDNA

from the BT20 cell line: Forward 5’-ATGACGGCCTCTCCGGATTACTTGGTG-3’ and Reverse 5’-

AATACAAACCCATTCTTTGGGT -3’. The PCR product was recovered and cloned in pCDNA

pcDNA™3.1/V5-His using the pcDNA™3.1⁄V5-His TOPO® TA Expression Kit (Invitrogen, Carlsbad,

CA). The correct full-length clone was determined by Sanger sequencing using the T7 promoter

and V5 reverse primer.

Transfection was performed using Effectene (Qiagen, Valencia CA) according to manufacturer’s

instructions. Western blotting was performed as previously described (15). The antibodies used

included: mouse monoclonals anti-V5, (clone 2F11F7; Life Technologies, Grand Island, NY) and




10

anti–ESRP-1/2 (clone 23A7.C9; Rockland Immunochemicals, Gilbertsville, PA) and rabbit

polyclonal anti-actin (20-33; Sigma-Aldrich, St. Louis, MO).

Statistical tests

Krustal-Wallis test (non-parametric ANOVA) is used for multigroup significance tests. Breslow

thickness was categorized in four levels as: I, < 1 mm; II, < 2 mm; III, < 4 mm; IV, 4+ mm. Fisher’s

exact test is used for testing sample distribution. Kaplan-Meier log-ranked test is performed for

survival benefits. All tests are done in R, Graphpad, SSPSv12 or ArrayStudio.




11

RESULTS

Inverse correlation of ESRP1 expression to tumor-associated immune cytolytic activity

The use of antibodies to CTLA-4 or PD-1 has induced remarkable and durable antitumor

responses in patients with melanoma and other types of cancers (20). However, only a minority

of patients treated achieve complete tumor regression (21, 22). Therefore, identifying

predictive immunotherapy biomarkers is critical for both selecting appropriate patients for

immunotherapy and for our complete understanding of the mechanism of action of these

agents. It has been reported that PD-L1 expression is regulated by microRNA-200/ZEB1 in lung

cancer (23), suggesting that tumor EMT status may be associated with immunotherapy

response. To examine the relationship between EMT and tumor immune cytolytic activity, we

interrogated multiple cancer types in in the TCGA database.

We used ESRP1 as a biomarker of EMT status because its expression is highly restricted to

epithelial cells and its level is tightly linked to the selective expression of epithelial or

mesenchymal-specific alternative splice forms of multiple genes such as FGFR2 (15, 24). We

also applied a two-gene expression signature (PRF1 and GZMA) of immune cytolytic activity

(25). These genes encode perforin and granzyme A proteins, which are specifically expressed

by CD8+ cytotoxic T cells upon activation. The two-gene signature significantly correlates with T-

cell markers, including cytotoxic T lymphocyte (CTL) markers, as well as with pan-cancer survival

benefits. As shown in Fig. 1, ESRP1 expression was inversely correlated to this signature of

cytolytic activity in many cancer types including lung, colon, prostate, breast, bladder, and

thyroid, with significant P values (< 1 x 10-10, Supplemental Table S1). Although there is a trend




12

of inverse correlation in other cancer types, the Pearson correlation coefficient has showed less

significance (Supplemental Table S1).

Tissue specific expression of truncated ESRP1 transcript in melanoma and normal melanocyte

Intriguingly, melanoma, a tumor of neural crest origin (26), had high ESRP1 expression

compared to other neural crest-derived tumors such as glioblastoma and low grade glioma

(Supplemental Fig. S1A). This was also observed in cancer cell lines (cancer cell line

encyclopedia, CCLE dataset), where ESRP1 was highly expressed in cells of epithelial origin, such

as most carcinoma cell lines, but not expressed in cells of mesenchymal origin, such as in

sarcomas and lymphomas, nor in other neuronal tumor cell lines (Supplemental Fig. S1B).

ESRP1 expression was high in cell lines of “skin” melanoma origin (61/62 CCLE skin cell lines are

from melanoma).

A close examination of ESRP1 expression at the exon level in melanoma revealed that a

majority of tumors do not express full-length ESRP1 transcript. Instead, only the last four exons

(exons 13-16) were highly expressed and presumably would not generate ESRP1 protein that

carries normal function. Based on the absolute ESRP1 expression level and the relative exon 13-

16 expression ratio (see Methods) we classified melanomas in three subgroups (Fig. 2A). In

approximately 20% of melanomas, designated ESRP1-low, ESRP1 was expressed at low levels

(RSEM value of less than 125). In approximately two-thirds of melanomas, the ESRP1 truncated

form was prominent (exon ratio above 0.65), whereas about 10% of all tumors express full-

length ESRP1 transcripts in substantial amounts (Table 1). Notably, the one normal control

sample in the TCGA melanoma dataset fell into the ESRP1-truncated group, suggesting that the




13

truncated transcript form was not tumor-specific, but rather produced during normal

melanocyte differentiation. We did not observe any aberrant change in the ESRP1 homolog,

ESRP2, which also has epithelial-specific expression, although higher ESRP2 expression was

associated with the ESRP1 full-length group, as expected (Fig. 2A).

When tumor sites were aligned to ESRP1 groups, we observed enrichment of primary tumors

inside the ESRP1 full-length group (Fig.2A and Table 1). This raised a concern of whether full-

length ESRP1 expression was from contaminating keratinocytes, which are often found in

primary melanomas. Using gene expression data from normal tissue, obtained from the GTEx

portal (http://www.gtexportal.org/home/) we identified two skin-specific genes (KRT2 and LOR)

with strong expression (Supplemental Fig. S2A), and used these two genes to estimate

keratinocyte contamination in TCGA samples. Indeed, about half of ESRP1 full-length tumors

were KRT2 and/or LOR positive. After removing these contaminated samples, a portion of

melanomas still expressed full-length ESRP1. These melanomas had been collected from

different tumor sites, including primary, regional subcutaneous, lymph node, and distant

metastasis sites, with no enrichment of any particular tumor site (Supplemental Fig. S2B).

Similar findings were observed for ESRP1 expression in the CCLE cell line database, where 4 out

of 53 melanoma cell lines had full-length ESRP1 expression and 10 cell lines had low ESRP1

expression (Fig. 2B). Therefore, although ESRP1 full-length expression in some samples may be

introduced by keratinocyte contamination, some melanoma tumors did express full-length

ESRP1. To avoid signals from contaminating keratinocytes, we discarded KRT2/LOR positive

samples from further analysis (Table 1).




14

We further validated our findings by real-time PCR with a separate collection of 42 melanoma

cell lines derived from cultures of primary tumors and a melanocyte cell line (see Methods). To

detect the truncated transcripts, we used two sets of PCR primers to amplify cDNA flanking

ESRP1 exon 11 and 12 or exon 13 and 14, respectively, and determine the relative abundance

of exon 13-14 vs. exon 11-12 products. In comparison with normal kidney and colon samples,

all melanoma cell lines except one (SKMEL128), as well as the normal melanocyte cell line

(HEM), exhibited an increased usage of exon 13-14, confirming that the truncated ESRP1

transcript predominates in the majority of melanomas (Fig. 2C). Since in the TCGA dataset we

only detected expression of this truncated form in melanoma, and the presence of this

particular transcript in other types of cancers is rare (Supplemental Fig. S1B), expression of the

truncated ESRP1 was apparently melanocyte-specific.

Mechanism of truncated ESRP1 expression in melanoma

To further investigate the truncated form of ESRP1, we performed additional analyses. First, we

tested its origin by cloning full-length cDNA of ESRP1 into an expression vector and transiently

transfecting into SKMEL28, a melanoma cell line which predominantly expresses the truncated

ESRP1 transcripts (Fig. 2C). Only full-length ESRP1 protein was detected in the transfected cell

lysate by Western blotting after 48 and 72 hrs (data not shown). This suggests that SKMEL28

cells could express and sustain expression of full-length ESRP1 and the truncated transcript was

not the post-transcriptional processed product from the full-length ESRP1. Since the region of

ESRP1 recognized by the monoclonal antibody raised against the full-length mouse Esrp1 is




15

unknown, we could not exclude the possibility that the truncated ESRP1 protein was also

produced in these cells.

We further hypothesized that an alternative transcriptional start site (TSS) could direct

expression of the truncated ESRP1 transcript. To test this assumption, we queried high-

throughput sequencing mapping outputs of CAGE (cap analysis gene expression) libraries,

which capture the 5’ end sequence of mRNAs in the FANTOM project

(http://fantom.gsc.riken.jp). Indeed, in two skin melanoma cell lines (COLO-679 and G-361),

most CAGE reads for ESRP1 were mapped to a region inside exon 13 (Fig. 3A). As a control,

CAGE reads were seen to be aligned at the 5’end of MLANA (the melanoma-specific melan-A

gene) promoter region, as expected. In other epithelial cell lines, CAGE reads were almost

exclusively mapped to ESRP1 5’ end promoter region. Thus, the truncated ESRP1 resulted from

alternative TSS usage at an approximate location of chr8:95690440 (hg19) at the start of exon

13 in melanoma. The two known functional domains (RNaseH and RRM domains) are missing

from the truncated ESRP1, so the product from this new isoform is unlikely to retain its normal

function (Fig. 3B).

Upstream sequence analysis identified a consensus E-box motif (CACGTG) located -57-bp

upstream of ESRP1 exon 13 (Fig. 3B), which is a known binding site for MITF, a master regulator

of melanocyte development and a known melanoma oncogene (4, 5). Several lines of evidence

support the idea that MITF regulated the expression of truncated ESRP1 through binding to the

E-box motifs inside intron 12 and initiated new transcription from within exon 13. First,

correlation of global gene expression to truncated ESRP1 expression resulted in MITF as the




16

most correlated gene, with a Pearson coefficient of 0.77 (Fig. 3C), and with many of the

remaining top correlated genes being MITF target genes. Second, the consensus E-box found in

human is conserved in monkey and ape but not in mouse and rat (Fig. 3B and Supplemental Fig.

S3). Consistently, we detected little mouse Esrp1 expression using mouse nevi and melanoma

RNA-Seq samples (see Methods). Third, knockdown of MITF by shRNA in 501MEL and Hermes

cell lines leads to reduced expression of MITF target genes (e.g. CDK2) and of truncated ESRP1

(Fig. 3D). Together, these results suggest that MITF regulates truncated ESRP1 expression in

melanomas.

Epithelial and mesenchymal cell phenotypes are associated with ESRP1 status in melanoma

We examined the expression of a set of epithelial and mesenchymal markers in the three ESRP1

subgroups after removing keratinocyte-contaminated samples (Fig. 4A). ESRP1-low tumors

exhibited a strong expression signature of mesenchymal markers like N-cadherin (CDH2) and

TWIST1. About half of melanomas with full-length ESRP1 expression displayed higher

expression of an epithelial marker panel including genes such as for keratin. This was not

restricted to primary tumors, but was also found in tumors from regional

cutaneous/subcutaneous locations, lymph nodes, and distant metastatic sites. Approximately

two-thirds of tumors expressing truncated ESRP1 seemed to reside in a state between epithelial

and mesenchymal, even though ESRP1 was functionally compromised in these tumors. This

suggested that loss of ESRP1 function per se is not sufficient to render a mesenchymal

phenotype, at least in melanoma. Surprisingly, E-cadherin (CDH1) had higher expression in both

ESRP1 full-length– and ESRP1-truncated groups. We also examined the isoform switch in FGFR2




17

gene, which showed a clear transition from the epithelial isoform (FGFR2-b) in ESRP1 full-length

tumors to the mesenchymal isoform (FGFR2-c) in tumors with truncated and low ESRP1 (Fig.

4B). This not only validated our computational prediction of ESRP1 full-length expression, but

also confirmed that truncated ESRP1 was unable to exert its normal function to induce isoform

switch in the FGFR2 gene.

Previously, several studies defined molecular subtypes of melanoma using gene expression

profiling (3, 27-29). Among those, Hoek et al. classified melanoma into “proliferative” and

“invasive” subtypes based on microarray profiling of 86 cultured melanomas (3). When we

compared the 105-gene signature from that study to our ESRP1 subgroups, we observed a good

correlation of the ESRP1-low group to the invasive subtype, as well as truncated-ESRP1 group to

the proliferative subtype (Fig. 4C). The ESRP1 full-length group, however, comprised samples

with both proliferative and invasive signatures. MITF is apparently a dominant factor in the

proliferative subtype since many MITF target genes were in the 105-gene list and highly

expressed in the proliferative subtype, whereas in the ESRP1-low/invasive group, MITF

expression was low (Fig. 4C). This implies that increased MITF level may actively block a

mesenchymal phenotype, in agreement with previous findings (3).

ESRP1-low melanomas are associated with increased immune cytotoxicity and favorable

patient survival

We examined immune cytolytic activity using cytotoxic T-cell marker genes and the two-gene

signature in three ESRP1-based melanoma subgroups after removing all primary melanoma

samples, because these are not particularly relevant to immune checkpoint therapy. This




18

showed a statistically significant increase of cytolytic activity in the ESRP1-low melanomas (Fig.

5A), which was consistent with our finding in other cancer types (Fig. 1). Predicted cytolytic

activity between the ESRP1 full-length and the ESRP1-truncated groups was not significantly

different, suggesting the correlation of cytolytic activity was more related to the mesenchymal

phenotype rather than to the epithelial phenotype. We next examined the expression of PD-1,

PD-L1, PD-L2, and CTLA-4 genes in ESRP1 subgroups (Fig. 5A and B). All these molecules, which

are targeted by immune checkpoint blockage antibodies, had increased expression in the

ESRP1-low tumors. We also examined the possible relationship of ESRP1 grouping to

mutational status and clinical parameters. No particular association was found between BRAF

and NRAS mutation and ESRP1 groups, although KIT mutations seem to be absent in ESRP1-low

tumors (Fig. 5A). The ESRP1 groups were also not associated with the total number of somatic

mutations. In the TCGA melanoma dataset, the ESRP1 grouping had a moderate association to

Breslow depth, with ESRP1-low tumors having the thinnest Breslow depth (Fig. 5B). Kaplan-

Meier survival analysis on TCGA melanoma patients stratified by ESRP1 status showed a trend

of more favorable survival of ESRP1-low tumors (P = 0.057, Fig. 5C), which is consistent with the

lower Breslow depth values and higher active immune signatures found within this group.

In summary, our data show an inverse correlation between ESPR1 expression and tumor-

associated immune cytolytic activity in multiple tumor types. Through the study of altered

ESRP1 transcription in melanoma, we gained further insights on the complex heterogeneity of

melanoma cell properties during tumor progression, and strengthen a link between tumor

intrinsic EMT status and tumor microenvironment in melanoma. Results from our study

highlight the potential utility of ESRP1 status in predicting response to checkpoint blockade




19

immunotherapy. The conceptual link between tumor EMT status and activated infiltrating

lymphocytes may have further implications in the immunotherapy field and will need further

elucidation.




20

DISCUSSION

Cancer immunotherapy by immune checkpoint inhibitors, adoptive T-cell therapy, and

therapeutic vaccines has advanced to the front line of treatments for many metastatic cancers,

especially melanoma (20, 30, 31). Contributing to this opportunity is the rich stromal cell–

orchestrated tumor microenvironment, particularly those tumors with high numbers of tumor-

infiltrating lymphocytes (TILs), like in melanoma. Here we show that melanoma mesenchymal-

like tumors were associated with enhanced immune cytolytic activity. Moreover, this

phenomenon was corroborated by a negative correlation between immune cytolytic activity

and epithelial phenotypes, and especially with the fact that ESRP1 expression was associated

with higher cytolytic activity in many other cancer types (Fig. 1). Renal cell carcinoma is another

cancer type that has shown relatively high sensitivity to immunotherapy (32). Previously, we

have demonstrated that renal cell clear cell carcinoma (ccRCC) has a more mesenchymal-like

phenotype (15). Our current results suggest that tumor cells of mesenchymal nature are able to

better acquire TILs and are well-suited to immunotherapy. With the success of immune

checkpoint blockage therapy (anti–PD1/PDL-1 and/or anti–CTLA-4) in some patients, an

important issue is why some patients are either not responsive or later develop resistance.

Among the many factors that contribute to tumor immunity, such as HLA abundance,

neoantigen load, and intrinsic properties, our findings suggests that the cellular state also has

an impact on immune response susceptibility.

In this study we have described the identification of a melanocyte-specific ESRP1 mRNA

transcript. This highly expressed isoform is a result of de novo transcription starting from exon




21

13, leading to a shorter mRNA (truncated ESRP1) that comprises of only the last four exons and

loses the region coding for the two functional domains of the protein. Although the TCGA

melanoma dataset contains only one normal control sample, which showed truncated ESRP1

expression, we did confirm this finding by RT-PCR in a normal melanocyte cell line (HEM, Fig,

2C). Additionally, publically accessible RNA-Seq data of independently derived melanocyte

specimens (NCBI GEO GSE46805 and GSE33092) all show truncated ESRP1 expression in

melanocytes (33, 34).

TCGA melanoma dataset is a heterogeneous collection of samples from primary tumors,

regional, lymph nodes, and distant metastases. Our initial findings that primary tumors were

significantly enriched in ESRP1 full-length tumors (Fig. 2A), raised the concern of keratinocyte

contamination as the cause of ESRP1 full-length expression. Using a two-gene signature

(KRT2/LOR), we were able to predict and remove a majority if not all keratinocyte

contaminated samples from our study. KRT2 encodes keratin 2E, an epidermal keratin

expressed largely in the upper spinous layer of epidermal keratinocytes. LOR encodes loricrin,

which is a major protein component of the cornified cell envelope found in terminally

differentiated epidermal cells. We show that expression of KRT2 and LOR are correlated and

highly skin-specific (Supplemental Fig. S2A), and the function of these genes suggests they are

authentic keratinocyte genes. Even after removal of contaminated samples, a small portion of

melanomas still expressed full-length ESRP1, which suggested that expression of full-length

ESRP1 could be an intrinsic tumor property.




22

Based on ESRP1 status we divided melanomas into three subgroups. Approximately two-thirds

of melanomas expressed the truncated ESRP1 form that was also observed in normal controls,

so this likely represents the default ESRP1 status. Based on the expression of EMT markers, the

state of these samples is neither distinctly mesenchymal nor epithelial. Compared with loss of

expression of other epithelial genes, E-cadherin (CDH1) gene is still highly expressed in this

subgroup. We have observed that some tumors lose ESRP1 expression and are mesenchymal,

and we show this may be linked to the loss of MITF expression. For other tumors, which have

epithelial characteristics, full-length ESRP1 is expressed. The underlying basis and mechanisms

for these alterations will need further investigation. However, our preliminary results revealed

loss of ESRP1 promoter methylation in the ESRP1 full-length group, indicating the involvement

of epigenetic regulation. Also, a few samples that expressed full-length ESRP1 did not highly

express epithelial markers. A closer examination of these individual samples identified at least

one sample that expressed another novel truncated form, starting from exon 3 of ESRP1, and

therefore had escaped our initial computational screen. Therefore, other factors may influence

the functional status of ESRP1. The ESRP1-low subgroup was associated with better TILs and

overall survival compared with the other two subgroups.

Identification of effective markers for diagnosis and predicting treatment response in cancer

immunotherapy are important to help guide effective intervention strategies for individual

patients. Our study indicates that ESRP1-low melanomas with greater immune cytolytic activity

have a higher probability of responding to immune checkpoint blockade therapy and suggests a

path toward the use of ESRP1 and other EMT markers as informative biomarkers for

immunotherapy.




23

REFERENCES

1. Hoek KS, Goding CR. Cancer stem cells versus phenotype-switching in melanoma.

Pigment cell & melanoma research. 2010;23:746-59.

2. Ghislin S, Deshayes F, Middendorp S, Boggetto N, Alcaide-Loridan C. PHF19 and Akt

control the switch between proliferative and invasive states in melanoma. Cell cycle.

2012;11:1634-45.

3. Hoek KS, Schlegel NC, Brafford P, Sucker A, Ugurel S, Kumar R, et al. Metastatic potential

of melanomas defined by specific gene expression profiles with no BRAF signature. Pigment cell

research / sponsored by the European Society for Pigment Cell Research and the International

Pigment Cell Society. 2006;19:290-302.

4. Levy C, Khaled M, Fisher DE. MITF: master regulator of melanocyte development and

melanoma oncogene. Trends in molecular medicine. 2006;12:406-14.

5. Strub T, Giuliano S, Ye T, Bonet C, Keime C, Kobi D, et al. Essential role of

microphthalmia transcription factor for DNA replication, mitosis and genomic stability in

melanoma. Oncogene. 2011;30:2319-32.

6. Carreira S, Goodall J, Denat L, Rodriguez M, Nuciforo P, Hoek KS, et al. Mitf regulation of

Dia1 controls melanoma proliferation and invasiveness. Genes & development. 2006;20:3426-

39.

7. Koludrovic D, Davidson I. MITF, the Janus transcription factor of melanoma. Future

oncology. 2013;9:235-44.




24

8. Grossmann AH, Yoo JH, Clancy J, Sorensen LK, Sedgwick A, Tong Z, et al. The small

GTPase ARF6 stimulates beta-catenin transcriptional activity during WNT5A-mediated

melanoma invasion and metastasis. Science signaling. 2013;6:ra14.

9. Bachmann IM, Straume O, Puntervoll HE, Kalvenes MB, Akslen LA. Importance of P-

cadherin, beta-catenin, and Wnt5a/frizzled for progression of melanocytic tumors and

prognosis in cutaneous melanoma. Clinical cancer research : an official journal of the American

Association for Cancer Research. 2005;11:8606-14.

10. Chien AJ, Conrad WH, Moon RT. A Wnt survival guide: from flies to human disease. The

Journal of investigative dermatology. 2009;129:1614-27.

11. Chien AJ, Moore EC, Lonsdorf AS, Kulikauskas RM, Rothberg BG, Berger AJ, et al.

Activated Wnt/beta-catenin signaling in melanoma is associated with decreased proliferation in

patient tumors and a murine melanoma model. Proceedings of the National Academy of

Sciences of the United States of America. 2009;106:1193-8.

12. O'Connell MP, Marchbank K, Webster MR, Valiga AA, Kaur A, Vultur A, et al. Hypoxia

induces phenotypic plasticity and therapy resistance in melanoma via the tyrosine kinase

receptors ROR1 and ROR2. Cancer discovery. 2013;3:1378-93.

13. Warzecha CC, Shen S, Xing Y, Carstens RP. The epithelial splicing factors ESRP1 and

ESRP2 positively and negatively regulate diverse types of alternative splicing events. RNA

biology. 2009;6:546-62.

14. Warzecha CC, Sato TK, Nabet B, Hogenesch JB, Carstens RP. ESRP1 and ESRP2 are

epithelial cell-type-specific regulators of FGFR2 splicing. Molecular cell. 2009;33:591-601.




25

15. Zhao Q, Caballero OL, Davis ID, Jonasch E, Tamboli P, Yung WK, et al. Tumor-specific

isoform switch of the fibroblast growth factor receptor 2 underlies the mesenchymal and

malignant phenotypes of clear cell renal cell carcinomas. Clinical cancer research : an official

journal of the American Association for Cancer Research. 2013;19:2460-72.

16. Theveneau E, Mayor R. Neural crest delamination and migration: from epithelium-to-

mesenchyme transition to collective cell migration. Developmental biology. 2012;366:34-54.

17. Acloque H, Adams MS, Fishwick K, Bronner-Fraser M, Nieto MA. Epithelial-mesenchymal

transitions: the importance of changing cell state in development and disease. The Journal of

clinical investigation. 2009;119:1438-49.

18. Shakhova O. Neural crest stem cells in melanoma development. Current opinion in

oncology. 2014;26:215-21.

19. Cancer Genome Atlas Network. Electronic address imo, Cancer Genome Atlas N.

Genomic Classification of Cutaneous Melanoma. Cell. 2015;161:1681-96.

20. Pico de Coana Y, Choudhury A, Kiessling R. Checkpoint blockade for cancer therapy:

revitalizing a suppressed immune system. Trends in molecular medicine. 2015;21:482-91.

21. Topalian SL, Hodi FS, Brahmer JR, Gettinger SN, Smith DC, McDermott DF, et al. Safety,

activity, and immune correlates of anti-PD-1 antibody in cancer. The New England journal of

medicine. 2012;366:2443-54.

22. Wolchok JD, Kluger H, Callahan MK, Postow MA, Rizvi NA, Lesokhin AM, et al. Nivolumab

plus ipilimumab in advanced melanoma. The New England journal of medicine. 2013;369:122-

33.




26

23. Chen L, Gibbons DL, Goswami S, Cortez MA, Ahn YH, Byers LA, et al. Metastasis is

regulated via microRNA-200/ZEB1 axis control of tumour cell PD-L1 expression and

intratumoral immunosuppression. Nature communications. 2014;5:5241.

24. Warzecha CC, Jiang P, Amirikian K, Dittmar KA, Lu H, Shen S, et al. An ESRP-regulated

splicing programme is abrogated during the epithelial-mesenchymal transition. Embo J.

2010;29:3286-300.

25. Rooney MS, Shukla SA, Wu CJ, Getz G, Hacohen N. Molecular and genetic properties of

tumors associated with local immune cytolytic activity. Cell. 2015;160:48-61.

26. Sommer L. Generation of melanocytes from neural crest cells. Pigment cell & melanoma

research. 2011;24:411-21.

27. Bittner M, Meltzer P, Chen Y, Jiang Y, Seftor E, Hendrix M, et al. Molecular classification

of cutaneous malignant melanoma by gene expression profiling. Nature. 2000;406:536-40.

28. John T, Black MA, Toro TT, Leader D, Gedye CA, Davis ID, et al. Predicting clinical

outcome through molecular profiling in stage III melanoma. Clinical cancer research : an official

journal of the American Association for Cancer Research. 2008;14:5173-80.

29. Winnepenninckx V, Lazar V, Michiels S, Dessen P, Stas M, Alonso SR, et al. Gene

expression profiling of primary cutaneous melanoma and clinical outcome. Journal of the

National Cancer Institute. 2006;98:472-82.

30. Rosenberg SA, Restifo NP. Adoptive cell transfer as personalized immunotherapy for

human cancer. Science. 2015;348:62-8.

31. Sharma P, Allison JP. The future of immune checkpoint therapy. Science. 2015;348:56-

61.




27

32. Yang JC, Hughes M, Kammula U, Royal R, Sherry RM, Topalian SL, et al. Ipilimumab (anti-

CTLA4 antibody) causes regression of metastatic renal cell cancer associated with enteritis and

hypophysitis. Journal of immunotherapy. 2007;30:825-30.

33. Flockhart RJ, Webster DE, Qu K, Mascarenhas N, Kovalski J, Kretz M, et al. BRAFV600E

remodels the melanocyte transcriptome and induces BANCR to regulate melanoma cell

migration. Genome research. 2012;22:1006-14.

34. Pawlikowski JS, McBryan T, van Tuyn J, Drotar ME, Hewitt RN, Maier AB, et al. Wnt

signaling potentiates nevogenesis. Proceedings of the National Academy of Sciences of the

United States of America. 2013;110:16009-14.




28

Table 1. Distribution of melanoma tumors on ESRP1 expression status and tumor site before and

after (before/after) removing potentially keratinocyte contaminated samples

ESRP1-low ESRP1-trun ESRP1-full length Total

Primary tumor 4***/3*** 69/56 32***/5 105/64

Regional lymph node 56/52 154/153 12/12 222/217

Cutaneous and subcutaneous 19/19 49/47 6/3 74/69

Distant metastasis 13/13 49/47 6/5 68/65

Total 92 321/303 56/25 469/415

*** P value < 0.0001 by Fisher’s exact test




29

FIGURE LEGEND

Figure 1. ESRP1 expression is inversely correlated with immune cytolytic activity in TCGA

carcinomas. Cytolytic activity measurement was undertaken as described in the Methods.x-axis,

ESRP1 expression in log2 scale; y-axis, cytolytic activity in log2 scale. Primary and metastatic

tumors have been included but samples that do not express ESRP1 (RSEM < 1) have been

removed. PAAD, pancreatic adenocarcinoma; LUSC, lung squamous carcinoma; COAD, colon

adenocarcinoma; BLCA, bladder urothelial carcinoma; BRCA, breast invasive carcinoma; THCA,

thyroid carcinoma.

Figure 2. Detection of truncated ESRP1 transcripts in melanoma. (A), ESRP1 expression at gene

and exon levels in melanoma (tumor samples, n = 471; normal melanocyte, n = 1). Melanoma

samples are grouped into three groups (see methods) and ordered by ESRP1 expression. ESRP1

exon expression heatmap is shown on the top followed by ESRP1 expression values in a barplot.

A truncation ratio of 0.65 was used to call full-length ESRP1 tumors (see methods). Position of

the normal sample is marked by a vertical yellow line. Tumor sites for primary, regional

subcutaneous, lymph node, and distant metastasis tumors are marked by dark-blue lines. The

“keratin” lane marks potential contamination of keratinocytes (see methods). (B), Expression

of ESRP1 at exon level in CCLE cancer cell lines. (C) Detection of low, truncated, and full-length

ESRP1 expression in melanoma cell lines by real-time PCR. Two probe sets amplify regions

flanking exon 11-12 and exon 13-14, respectively. Top panel: relative signal intensity of the two

probe sets normalized by normal kidney. Bottom panel: percentage of exon 13-14 amplicon out

of the total signal. HEM, Hermes cell line.




30

Figure 3. Melanomas express a novel transcriptional isoform of ESRP1. (A), Alternative TSS of

ESRP1. Top panel: CAGE libraries capture reads mapped to TSS sites at MLANA (top) and ESRP1

(bottom) gene loci. Depth of reads coverage is labeled on the right. Exons in alternative

transcripts are drawn in filled boxes. (B), ESRP1 coding structure. The E-box location is marked

out by a red box. Exon 13 is labeled to show the relative exon positions. Alternative TSS for the

truncated ESRP1 within exon13 is marked by a red arrow. Functional domains encoded by

ESRP1 including RNaseH-like domain and RRM (RNA recognition motif) are shown in colored

boxes in the gene structure. Sequence surrounding the junction of intron 12 and exon 13 is

shown below with comparison among other species. (C), Correlation between MITF and ESRP1

gene expression. Samples are categorized into ESRP1-low and ESRP1-trun groups. (D), shMITF

down-regulates expression of the truncated ESRP1. CDK2, a known MITF target and ACTB (Actin

beta) are used as positive and negative controls of the experiment, respectively.

Figure 4. ESRP1 subgroups are associated with epithelial to mesenchymal cellular properties.

(A), Expression heatmap of molecular markers for epithelial and mesenchymal cells. (B), FGFR2

expression at exon level shows the mesenchymal and epithelial forms are dominantly

expressed in non-ESRP1-full length and ESRP1-full length subgroups, respectively. (C), Heatmap

of the 105-gene signature and MITF expression levels (RSEM) are aligned to ESRP1 subgroups.

Samples in all heatmaps are in the same order as in Fig. 2.

Figure 5. Association of ESRP1 expression status with tumor associated cytolytic activity and

clinical parameters. (A), Comparison of immune cytolytic activity and related genes in ESRP1

subgroups. Top, heatmap of expression of immune checkpoint target genes and active T cell




31

markers. Bottom, alignment of mutations and clinical parameters to ESRP1 subgroups. (B),

Boxplot presentation of expression levels of PD-L2, CTLA-4, cytolytic activity, Breslow depth,

and tumor T stages in ESRP1 subgroups. (C), Kaplan-Meier survival analysis of TCGA melanoma

cases stratified by ESRP1 status.




Figure 1




Figure 2

A

B C




exon 13

ESRP1

MLANA

Figure 3

B RNase H RRM

1 190 210 500 681 aa ESRP1

E-box ESRP1-trun TSS

ESRP1 intron 12 exon 13

A

C D




Figure 4

A

C

B

low




Figure 5

A

C

B




Published OnlineFirst April 4, 2016.Cancer Immunol Res Jun Yao, Otavia L Caballero, Ying Huang, et al. tumor-associated immune cytolytic activitymelanoma correlates with epithelial-mesenchymal status and Altered expression and splicing of ESRP1 in malignant

Updated version

10.1158/2326-6066.CIR-15-0255doi:

Access the most recent version of this article at:

Material

Supplementary

http://cancerimmunolres.aacrjournals.org/content/suppl/2016/04/02/2326-6066.CIR-15-0255.DC1

Access the most recent supplemental material at:

Manuscript

Authoredited. Author manuscripts have been peer reviewed and accepted for publication but have not yet been

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected] at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://cancerimmunolres.aacrjournals.org/content/early/2016/04/02/2326-6066.CIR-15-0255To request permission to re-use all or part of this article, use this link



http://cancerimmunolres.aacrjournals.org/lookup/doi/10.1158/2326-6066.CIR-15-0255

http://cancerimmunolres.aacrjournals.org/content/suppl/2016/04/02/2326-6066.CIR-15-0255.DC1

http://cancerimmunolres.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://cancerimmunolres.aacrjournals.org/content/early/2016/04/02/2326-6066.CIR-15-0255


altered expression and splicing of esrp1 in malignant...

Documents