agrobacterium tumefaciens mediated genetic transformation of...
Post on 23-Jun-2020
10 Views
Preview:
TRANSCRIPT
i
Agrobacterium Mediated Genetic Transformation of Potato
By
WASEEM AHMAD
Department of Biochemistry Faculty of Biological Sciences Quaid-i-Azam University Islamabad, Pakistan
2010
ii
Agrobacterium Mediated Genetic Transformation of Potato
Submitted by
WASEEM AHMAD
Thesis Submitted to
Department of Biochemistry
Quaid-i-Azam University, Islamabad
In the partial fulfillment of the requirements for the degree of
Doctor of Philosophy
in
Biochemistry / Molecular Biology
Department of Biochemistry Faculty of Biological Sciences
Quaid-i-Azam University Islamabad, Pakistan
2010
iii
To my beloved brother Nadeem Ahmad
iv
Contents
Chapter 1
1.1
1.2
1.3
1.4
1.5
1.5.1
1.6
1.6.1
1.6.1.1
1.6.2
1.6.2.1
1.6.3
1.7
1.7.1
1.7.2
1.7.3
1.7.4
1.7.5
1.7.6
1.8
1.8.1
1.8.2
1.8.3
1.8.4
1.9
Acknowledgements
List of Tables
List of Figures
List of Abbreviations
Abstract
Introduction and Review of Literature
Uses of potato and its nutritional value
Production of potato
Diseases of potato
Measures for diseases control
In vitro regeneration
In vitro regeneration of potato
Genetic transformation
Biolistic transformation
Biolistic transformation of potato
Agrobacterium-mediated transformation
Agrobacterium mediated transformation of potato
Genetic modifications of potato for disease resistance
Defense mechanisms in plants
Hypersensitive response
Cell wall fortification
Pathogen related proteins
Salicylic acid and Benzoic acid
Phytoalexins
Phytoanticipins
Plant defense mechanisms and role of secondary
metabolites
Role of antimicrobials in plant defense
Role of antioxidants in plant defense
Role of phenolics in plant defense
Role of flavonoids in plant defense
rol genes of Agrobacterium rhizogenes
i
iii
iv
vii
ix
1
2
3
6
6
7
16
16
17
19
20
28
29
30
31
32
33
33
34
35
35
35
36
38
39
v
1.9.1
1.9.2
1.10
1.11
Chapter 2
2.1
2.2
2.3
2.3.1
2.3.2
2.3.3
2.3.4
2.4
2.4.1
2.4.2
2.4.3
2.4.4
2.4.5
2.4.6
2.5
2.5.1
2.5.2
2.6
2.7
2.7.1
2.7.2
2.8
2.8.1
2.9
Contents
Functions of rolA gene in transformed plants
Functions of rolC gene in transformed plants
rol genes and secondary metabolites production
Objectives
Materials and Methods
Glassware and chemicals
Plant material
In vitro regeneration
Callus induction
Shoot induction
Root induction
Plant acclimatization
Biolistic gene transfer
Agrobacterium maintenance and culture
Plasmid isolation
Preparation and coating of gold particles
Optimization of biolistic transformation
Effect of osmotic treatment
Histochemical gus assay
Agrobacterium mediated transformation
Optimization of Agrobacterium mediated transformation
Effect of antibiotics on explant survival
Agrobacterium mediated stable transformation with gus
gene
Stable transformation with rol genes
Gene sequencing
Agrobacterium mediated stable transformation of potato
with rolA and rolC gene
PCR analysis of the transformants
Agarose gel electrophoresis
Southern blot analysis
41
43
46
49
50
50
51
51
52
53
54
54
55
55
55
56
57
57
58
58
58
59
60
61
62
62
64
65
vi
2.9.1
2.9.2
2.9.3
2.9.4
2.9.5
2.10
2.11
2.12
2.13
2.14
2.15
Chapter 3
3.1
3.1.1
3.1.1.1
3.1.1.2
3.1.1.3
3.1.1.4
3.1.1.5
3.1.2
3.1.2.1
3.1.2.2
3.1.2.3
3.1.2.4
3.1.2.5
3.1.3
Contents
DNA restriction
Agarose gel electrophoresis
Transfer of restriction fragments to membrane
Labeling of DNA using [α-32 P]
Hybridization process
Extraction of transgenic plants
Antifungal activity
Antibacterial Activity
Determination of antioxidant activity
Determination of total phenolics
Determination of total flavonoids
Results
Optimization of in vitro culture system
Callus induction
Effect of medium on callogenesis
Effect of cultivar on callogenesis
Effect of explant on callogenesis
Effect of interaction among callus induction medium,
cultivar and explant type on percentage callus induction
Effect of Interaction among callus induction medium,
cultivar and explant type on number of days to form callus
Shoot induction
Effect of medium on shoot induction
Effect of cultivar on shoot induction
Effect of explant on shoot induction
Effect of interaction among shoot induction medium,
cultivar and explant type on percentage shoot induction
Effect of interaction among shoot induction medium,
cultivar and explant type on number of days to shoot
induction
Root induction
65
65
65
66
66
66
66
67
68
69
69
71
71
71
72
73
74
77
80
80
81
82
82
86
89
vii
3.1.3.1
3.1.3.2
3.1.3.3
3.1.4
3.2
3.2.1
3.2.2
3.2.3
3.2.4
3.2.5
3.2.6
3.2.7
3.3
3.3.1
3.3.2
3.3.3
3.3.4
3.3.5
3.3.6
3.3.6.1
3.3.6.2
3.4
3.4.1
3.4.2
Contents
Effect of media on root induction
Effect of cultivar on root induction
Effect of interaction between medium and cultivar on
initiation time, length and number of roots
Plant acclimatization
Optimization of transformation through biolistic gun
Effect of helium pressure on transient gus expression
Effect of target distance on transient gus expression
Effect of particle size on transient gus expression
Effect of explant type on transient gus expression
Effect of interaction among helium pressure, target
distance, particle size and explant type on transient gus
expression
Effect of osmotic treatment on percentage transient gus
expression
Effect of osmotic treatment on percentage callus formation
Optimization of Agrobacterium-mediated transformation
Effect of bacterial density on transient gus expression
Effect of inoculation time on transient gus expression
Effect of co-cultivation period on transient gus expression
Effect of explant type on transient gus expression
Effect of interaction among bacterial density, inoculation
time, co-cultivation period and explant type on transient
gus expression
Effect of antibiotics on explant survival
Effect of cefotaxime on explant survival
Effect of kanamycin on explant survival
Agrobacterium-mediated stable transformation of potato
with gus reporter gene
Histochemical gus assay of the putative transformants
Polymerase chain reaction (PCR) analysis of the putative
gus transformants
89
90
90
92
94
94
95
95
96
96
100
101
102
102
103
104
104
105
110
110
111
113
114
115
viii
3.5
3.5.1
3.5.1.1
3.5.1.2
3.5.2
3.5.2.1
3.5.2.2
3.6
3.7
3.8
3.9
3.10
Chapter 4
4.1
4.2
4.3
4.4
4.5
4.6
Contents
Agrobacterium-mediated stable transformation of potato
with rolA and rolC gene
Agrobacterium-mediated stable transformation of potato
with rolA gene
Polymerase chain reaction (PCR) analysis of the putative
rolA transformants
Morphological characteristics of rolA transgenic plants
Agrobacterium-mediated stable transformation of potato
with rolC gene
Polymerase chain reaction (PCR) analysis of the putative
rolC transformants
Morphological characteristics of rolC transgenic plants
Southern blot analysis of rolA, rolC and gus transformants
Antifungal activities of rolA and rolC transgenic lines of
potato
Antibacterial activities of rolA and rolC transgenic lines
Determination of antioxidant activity
Determination of total phenolics and flavonoids
Discussion
Optimization of in vitro regeneration
Optimization of biolistic gene transfer
Optimization of Agrobacterium mediated transformation
Agrobacterium mediated stable transformation of potato
Role of antimicrobials in rol gene transgenic plants
Role of antioxidants in rol gene transgenic plants
Conclusions and future strategies
References
Appendices
118
118
118
120
121
122
123
126
128
132
137
139
143
151
155
161
164
167
169
171
207
i
Acknowledgements
I am grateful to Almighty Allah, the Omnipotent and the most Merciful and
Beneficent, who is the Creator of universe, who blessed the man with the dare to
dream and with the courage to try. His blessings enabled me to achieve my goals.
Tremulous venerations are for His Holy Prophet Hazrat Mohammad (PBUH), who is
everlasting torch of guidance and knowledge for humanity.
It is a pleasure to express my sincere and deepest heartfelt gratitude to my
supervisor Dr. Bushra Mirza, Associate Professor, Department of Biochemistry,
Faculty of Biological Sciences, Quaid-i-Azam University Islamabad, Pakistan for her
dynamic supervision, continuous encouragement, illustrious advice and sincere
criticisms throughout the course of my research pursuits as well as during the write
up of my thesis.
I wish to express my most sincere thanks to Dr. Mir Ajab Khan, Dean Faculty
of Biological Sciences and Dr. Salman Akbar Malik, Chairman Department of
Biochemistry for extending the research facilities to accomplish this work. I am
obliged to Dr. Wasim Ahmad former Chairman of the department for his
encouragement, support and help during my research work.
I am extremely grateful to Dr. Mark Taylor, Plant Products and Food Quality
Department, for extending the facilities and invaluable supervision during my
research at Scottish Crop Research Institute (SCRI) Dundee, UK. I am also indebted
to my lab colleagues Dr. Laurence Ducreux, Dr. Wayne Morris, Dr. Danny Cullen
and Mr. Raymond Campbell at SCRI for their cooperation, support and useful
suggestions.
I would like to express my special thanks to all staff members and my
colleagues at Plant Molecular Biology Lab, Department of Biochemistry. Moreover, I
appreciate Mr. Waheed Arshad and Mr. Ihsan-ul-Haq for their constant support and
encouragement throughout my research work.
Here I would like to pay cordial thanks to Dr. Azad Hussain Shah, Assistant
Professor, School of Biological Sciences, University of the Punjab, Lahore, for
providing the facility and training of Gene Gun handling in his lab.
ii
I would also like to acknowledge Dr. Sarah R. Grant, The University of North
Carolina, Chapel Hill for proving gus gene construct p35SGUSint and Dr. David
Tepfer, Institute National de la Reserche Agronomique (INRA), Versailles 78026,
France for providing vectors pLBR29 and pLBR31 used in this research.
I am also thankful to Fisrt Culture Bank of Pakistan, Institute of Mycology
and Plant pathology, University of the Punjab, Lahore for providing the bacterial and
fungal cultures for this research.
I would like to acknowledge Higher Education Commission, Pakistan (HEC)
for providing the Indigenous and IRSIP scholarships and financial support during my
research in Pakistan and UK. I would also acknowledge the support of Higher
Education Department, Govt. of Punjab for granting me the study leave to complete
my PhD research and thesis.
I would like to pay very special tribute to my family who helped me and
guided me in every aspect of my life. I owe a non-payable debt to my sweet and
affectionate parents, whose wishes motivated me in striving for higher education. I
owe my loving thanks to my wife Sarwat Ahmad, my son Hayyan and daughter
Mahrosh. Without their encouragement and understanding it would have been
impossible for me to finish this work. My special gratitude is due to my brothers, my
sisters and their families for their loving support and positive criticism. My loving
thanks are due to Mr. and Mrs. Naeem Hassan as they let me own a happy family in
Scotland, UK.
Finally, I would like to thank everybody who was important to the successful
realization of thesis, as well as expressing my apology that I could not mention
personally one by one.
Waseem Ahmad
iii
List of Tables
No. Title Page no.
Table 1.1
Table 1.2
Table 1.3
Table 2.1
Table 2.2
Table 2.3
Table 2.4
Table 2.5
Table 3.1
Table 3.2
Table 3.3
Table 3.4
Table 3.5
Table 3.6
Table 3.7
Table 3.8
Table 3.9
Table 3.10
Table 3.11
Table 3.12
Table 3.13
Contents of 100 g of potato
Calendar of potato crop in Pakistan
Common diseases of potato
Composition of different callus induction media
Composition of different shoot induction media
Composition of different root induction media
Primers used for sequencing rolA and rolC gene
PCR conditions for the amplification of different genes
Effect of interaction among callus induction medium, cultivar
and explant type on percentage callus induction
Effect of interaction among callus induction medium, cultivar
and explant type on number of days to form callus
Effect of interaction among shoot induction medium, cultivar
and explant type on percentage shoot induction
Effect of interaction among shoot induction medium, cultivar
and explant type on number of days to shoot induction
Effect of interaction among helium pressure, target distance,
particle size and explant type on transient gus expression
Effect of interaction among bacterial density, inoculation
time, co-cultivation time and explant type on transient gus
expression
Summary of transformation using gus reporter gene
Summary of transformation with rolA gene
Summary of transformation with rolC gene
Antifungal activity of crude extracts of different transgenic
lines
Antibacterial activity of crude extracts of different transgenic
lines
Antioxidant activity, total phenolics and total flavonoids
Comparison of increase in total phenolics and flavonoids,
antioxidant and antimicrobial activities of different rol gene
transgenic lines
2
3
4
52
53
54
62
64
75
78
84
87
98
108
117
119
123
130
135
138
142
iv
List of Figures
No. Title Page no.
Fig 2.1
Fig 2.2
Fig 2.3
Fig 3.1
Fig 3.2
Fig 3.3
Fig 3.4
Fig 3.5
Fig 3.6
Fig 3.7
Fig 3.8
Fig 3.9
Fig 3.10
Fig 3.11
Fig 3.12
Fig 3.13
Fig 3.14
Fig 3.15
Fig 3.16
Fig 3.17
Fig 3.18
Map of p35SGUSint containing gus gene under 35S CaMV
promoter
Map of pLBR29 containing rolA gene under 70S CaMV
promoter
Map of pLBR31 containing rolC gene under 70S CaMV
promoter
Effect of media on callogenesis
Callus formation in different cultivars
Callus formation in different explant types
Effect of interaction among callus induction medium, cultivar
and explant type on percentage callus induction
Effect of interaction among callus induction medium, cultivar
and explant type on number of days to form callus
Effect of media on shoot induction
Shoot induction in different cultivars
Shoot induction from different explant types
Effect of interaction among shoot induction medium, cultivar
and explant type on percentage shoot induction
Effect of interaction among shoot induction medium, cultivar
and explant type on number of days to shoot induction
Effect of media on root induction
Root formation in different cultivars
Effect of interaction between medium and cultivar on days to
root initiation
Effect of interaction between medium and cultivar on root
length
Effect of interaction between medium and cultivar on number
of roots per plant
Different stages of in-vitro culture of potato cultivar Desirée
Acclimatization of potato (Desirée) plants
Effect of helium pressure on transient gus expression
54
61
61
72
73
73
76
79
81
81
82
85
88
89
90
91
91
92
93
93
94
v
No.
Fig 3.19
Fig 3.20
Fig 3.21
Fig 3.22
Fig 3.23
Fig 3.24
Fig 3.25
Fig 3.26
Fig 3.27
Fig 3.28
Fig 3.29
Fig 3.30
Fig 3.31
Fig 3.32
Fig 3.33
Fig 3.34
Fig 3.35
Fig 3.36
Fig 3.37
Fig 3.38
Fig 3.39
Fig 3.40
Fig 3.41
Fig 3.42
Fig 3.43
List of Figures
Title
Effect of target distance on transient gus expression
Effect of particle size on transient gus expression
Effect of explant type on transient gus expression
Transient gus expression in internodal segments through
Biolistic Gun
Effect of interaction among helium pressure, target distance,
particle size and explant type on transient gus expression
Effect of osmotic treatment on transient gus expression
Effect of osmotic treatment on percentage callus formation
Effect of bacterial density on transient gus expression
Effect of inoculation time on transient gus expression
Effect of co-cultivation period on transient gus expression
Effect of explant type on transient gus expression
Agrobacterium-mediated transient gus expression in explants
of potato
Effect of interaction among bacterial density, inoculation time,
co-cultivation period and explant type on transient gus
expression
Effect of cefotaxime on explant survival
Effect of kanamycin on explant survival
Effect of 100 mg/l kanamycin on explant survival
Different stages of Agrobacterium-mediated transformation of
potato
Stable gus expression in potato
PCR analysis of nptII gene from plants transformed with gus
PCR analysis of gus gene from plants transformed with gus
PCR analysis of rolA gene from plants transformed with rolA
rolA transgenic plant
PCR analysis of rolC gene from plants transformed with rolC
rolC transgenic plant
Tubers of potato cultivar Desirée
Page no.
95
95
96
96
99
100
102
103
103
104
105
105
109
111
112
113
114
115
116
117
119
121
122
124
125
vi
No.
Fig 3.44
Fig 3.45
Fig 3.46
Fig 3.47
Fig 3.48
Fig 3.49
Fig 3.50
Fig 3.51
Fig 3.52
Fig 3.45
List of Figures
Title
Mean number of tubers
Mean weight of tubers
Southern blot analysis of rolA, rolC and gus T0 plant of
Solanum tuberosum L. cultivar Desirée.
Relative growth suppression of different fungi against rolA and
rolC transgenic lines
Antifungal activity of rolC transgenic lines against Fusarium
solani
Relative growth suppression of different bacteria against rolA
and rolC transgenic lines
Antibacterial activity of rolC transgenic lines against P.
syringae
Relative increase in antioxidant activities of different rolA and
rolC transgenic lines
Total phenolics and total flavonoids in different rolA and rolC
transgenic lines
Relative increase in phenolics and flavonoids in different rolA
and rolC transgenic lines
Page no.
126
126
127
131
131
136
136
139
141
141
vii
List of Abbreviations
2,4–D
abs
AQ
BA
BA
BAC
BAP
CaMV
CDPKs
CIM
CME
crtB
DMSO
DNA
DPPH
EMBOSS
GA
gus
HR
HYG
IAA
IAA-AA
IBA
IC50
INRA
iP
LB
LSD
luc
mRNA
MS Medium
NAA
2,4 Dichlorophenoxy acetic acid
Absorbance
Anthraquinone
Benzyl Adenine
Benzoic Acid
Bacterial Artificial Chromosome
Benzyl Amino Purine
Cauliflower Mosaic Virus
Ca2+/calmodulin-dependent protein kinases
Callus Induction Medium
Crude Methanolic Extract
Phytoene synthase gene
Dimethyl Sulfoxide
Deoxyribonucleic Acid
2,2-diphenyl-1-picryl-hydrazyl
European Molecular Biology Open Software Suite
Gibberellic Acid
β-glucuronidase gene
Hypersensitive Response
Hygromycin gene
Indole Acetic Acid
3-Indoleacetyl-DL-aspartic acid
Indole Butyric Acid
Inhibitory Concentration at fifty percent
Institut National de la Recherche Agronomique
Isopentenyladenine
Luria Bertini
Least Significant Difference
luciferase gene
Messenger Ribonucleic Acid
Murashige and Skoog Medium
Naphthalene Acetic Acid
viii
List of Abbreviations
NARC
nptII
OD
ORF
PCR
PDA
PEG
PG
PLRV
PR
psi
PVX
R
Ri
RIM
RM
RNA
rol
ROS
SA
SAR
SASA
SCRI
SDS
SE
Ser
SIM
Thr
Ti
uidA
UV
vir
National Agriculture Research Centre
Neomycin phosphotransferase gene
Optical Density
Open Reading Frame
Polymerase Chain Reaction
Potato Dextrose Agar
Polyethylene Glycol
Polygalacturonase
Potato Leaf Roll Virus
Pathogen Related Protein
Pounds per square inch
Potato Virus X
Single Resistance Gene
Root inducing
Root Induction Medium
Regeneration Medium
Ribonucleic Acid
root oncogenic loci
Reactive Oxygen Species
Salicylic Acid
System Acquired Resistance
Science and Advice for Scottish Agriculture
Scottish Crop Research Institute
Sodium Dodecyl Sulphate
Standard Error
Serine
Shoot Induction Medium
Threonine
Tumor inducing
Gene Encoding β-glucuronidase
Ultraviolet
Virulence
ix
Abstract
Potato (Solanum tuberosum L.) is one of the most economically important food crops
worldwide for both consumers and farmers. The key objective of this work was to
transform potato plants with rolA and rolC genes and to study the defense response of
these rol transgenic plants by determining their antifungal, antibacterial and antioxidant
activities. Stable transformation of potato genotype Desirée with rol genes was achieved
by Agrobacterium mediated transformation. In order to accomplish this, an efficient,
rapid and reproducible in vitro regeneration system was developed as a pre-requisite for
genetic transformation. In vitro regeneration of internodal segments, leaf strips and
microtuber discs from three important potato genotypes viz. Diamant, Desirée and
Altamash have been compared to select the best explant type from one of the three
genotypes for further gene manipulation experiments. In an attempt to select the best
combination of callus, shoot and root induction media, six callus induction and shoot
induction media (CIM and SIM respectively) while three root induction media (RIM)
reported earlier, having different types and combinations of plant growth hormones for
tissue culture of potato were evaluated. Internodes of Desirée proved to have a higher
potential for callus formation (96.11%) on MS medium supplemented with 0.2 mg/l NAA
+ 0.02 mg/l GA3 + 2.5 mg/l zeatin riboside (CIM3) in 12.67 days. Similarly, the highest
percentage of shooting (95.55%) was observed from the internodal calli of Desirée on MS
medium containing 0.02 mg/l NAA + 0.02 mg/l GA3 + 2 mg/l zeatin riboside (SIM3) in
20.33 days. Finally, best rooting was achieved on ½ MS + 1.0 mg/l IBA (RIM2). Based
on the protocol developed for in vitro regeneration of potato cultivar Desirée, biolistic
gene transfer and Agrobacterium mediated transformation were optimized and compared
using plasmid vector p35SGUSint containing gus reporter gene. Optimization of transient
gus expression for biolistic transformation showed that helium pressure of 1100 psi, 6 cm
target distance and 1.0 µm gold particle size was the best combination for transforming
internodal explants while, the use of different osmoticum treatments had a little effect on
transient gus expression and callus formation. In case of Agrobacterium-mediated
transformation bacterial density of OD600 1.0, inoculation time of 15 minutes and co-
cultivation duration of 48 hours for internodal explants proved to be the best combination
of variables which produced highest transformation efficiency on the basis of transient
gus expression. The final concentration of 500 mg/l cefotaxime for elimination of
Agrobacterium and 50 mg/l kanamycin to select transgenic explants were used in CIM3.
The comparison of biolistic gene transfer and Agrobacterium mediated transformation
x
demonstrated that the later method remained more suitable for potato transformation and
was further employed to produce rolA and rolC transgenic plants of potato cultivar
Desirée using vectors pLBR29 and pLBR31 respectively under the transcriptional control
of 70S promoter. Transformation efficiencies of 34.17%, 28.00% and 36.00% were
recorded for gus, rolA and rolC genes on the basis of polymerase chain reaction (PCR).
Southern blotting revealed the insertion of one or two copies of transgenes into the
genome of transgenic plants. All the rolA and rolC transgenic plants exhibited distinct
morphological characteristics as compared to the control plants. The shape, number and
weight of tubers harvested from rolA and rolC transgenic plants also differed from the
control plants. Both the rolA and rolC transgenic plants were evaluated for their
antifungal, antibacterial and antioxidant activities in addition to the determination of total
phenolic and flavonoid contents. Antifungal assay of crude methanolic extracts of rol
transgenic plants showed that all the rolA and rolC transgenic lines gave antifungal
activities better than gus gene transformed plants and untransformed wild type Desirée
plants used as control. The rolC transgenic lines gave higher activities against Fusarium
solani as compared to rolA transgenic lines whereas both rolA and rolC lines were
equally active against Alternaria solani. Antibacterial assay revealed that most of the rolA
and rolC transgenic lines proved better than both gus gene transformed plants and
untransformed wild type Desirée plants. Among all the transgenic lines, rolC lines largely
produced promising inhibitory result against bacterial strain Pseudomonas syringae when
compared with rolA. However, the overall effectiveness of rolC transgenic lines was
almost similar with that of rolA against Agrobacterium tumefaciens strain AT 10.
Moreover, the activities of rolA lines remained lowest against Xanthomonas compestris as
compared to the rolC lines. Antioxidant assay exhibited better free radical scavenging
activity of all the rol transgenic lines as compared to the control plants. Antioxidant
activity of transgenic lines revealed a maximum relative increase of 75.35% and 61.58%
in the free radical scavenging for rolA and rolC transgenic lines respectively. An overall
increase in total phenolics of rolA transgenic lines was almost three folds higher than rolC
transgenic lines while, a comparable overall increase in total flavonoid contents was
observed for both rolA and rolC transgenic lines. These studies suggest that the enhanced
production of phenolics and flavonoids in rol gene transformants increased the
antimicrobial and antioxidant activities which synergistically could improve the plant
defense response.
1
Introduction and Review of Literature
Potato (Solanum tuberosum L.) belongs to the Solanaceae (Nightshade) family
and it comprises of about 150 tuber bearing species. The origin of cultivated potato
could be traced for more than 8000 years from many wild varieties of Solanum spp. in
the highlands of South America. In the 16th century potato was taken to Europe from
South America by Spanish conquerors that entered Peru and from here it spread all
over the world by the 19th century. Potatoes are grown on well-drained, slightly acidic
loamy soils (pH<5.2). Maximum tuber formation can be achieved with uniform
supply of water at soil temperatures between 15-21°C. The potato plants are
vegetatively propagated from tubers assuring genetic uniformity. The cultivated
potato is an autotetraploid with 48 chromosomes (4x). Solanum tuberosum is a widely
cultivated crop in Pakistan with a special association to the hilly tracts and high
moisture areas having soil rich in organic matter. The plant is generally an erect
perennial herb, usually robust, 50 to 90 cm tall, glabrous or rarely pubescent with
simple and glandular short hair. Underground stem in the form of white, yellow, red
or purplish tubers, having various shapes and sizes ca. 3 to 10 cm in diameter. Tubers
fleshy, usually round, globose, oblate, obovate or elliptic in shape. Leaves typically
imparipinnate, with 6 to 8 pairs of leaflets and unequal interstitial leaflets, petiole 3 to
6 cm long, with oblong to ovate leaflets, narrowly pilose in outline. Inflorescence in
the form of terminal few-flowered, paniculate cymes. Flowers usually light purple or
pink to whitish.
1.1 Uses of potato and its nutritional value
Potato is a very significant crop of the world for its nutritional value. Potato
has a great prospective to minimize the pressure of food requirement on cereal crops.
The food produced from this crop is more than the cereals produce per unit area. The
tubers contain starch, proteins, minerals and vitamin C (Table 1.1) which are very
vital for the human health (Akhtar et al., 2006; Ducreux et al., 2005). Potatoes are
cooked, boiled, mashed, fried and processed as chips for human consumption for their
high carbohydrate and protein content.
2
Table 1.1: Contents of 100 g of potato
Energy 97 kcal Phosphorus 25 mg
Water 75.0 g Calcium 5 mg
Carbohydrate 22.0 g Iron 0.35 mg
Protein 2.0 g Magnesium 0.35 mg
Fat 0.1 g Vitamin B1 (Thiamin) 13 mg
Fiber 1.5 g Vitamin C 5 mg
Sodium 391 mg Vitamin B2 (Riboflavin) 0.1 mg
Potassium 50 mg Niacin 0.02 mg
1.2 Production of potato
Potato is one of the most significant dicotyledonous vegetable crop in the
whole world and the fourth most cultivated food crop after wheat, rice and maize
(Solomon-Blackbourn and Barker, 2001). Its production is rising rapidly worldwide
for increasing food dependence on potatoes. The production of potato in developing
countries of Asia, Africa and Latin America has boosted from 30 million tons to 85
million tons in the last four decades. If this progress continues, these developing
countries will be the major supplier of world’s potato in coming years. Potato
cultivation in North America, Europe, South Africa, Australia and Japan has remained
constant for the last thirty years. The total area of the world under potato cultivation in
2007 was about 18531.19 thousand hectares producing almost 309344.24 thousand
tonnes with an average yield of 16.69 tonnes/Ha (FAO Stat, 2009).
Potato was cultivated in subcontinent from the early 17th century but over the
years, it has become the fastest growing staple food crop for both consumers and
farmers in Pakistan. At the time of independence in 1947 its cultivation was limited to
a few thousand hectares with less than 30,000 tonnes total annual output but presently
the local harvest of potatoes is sufficient for house hold consumption and 99% of seed
potatoes are also produced locally. It is projected that the overall annual potato
production in Pakistan reaches to 2581.5 thousand tonnes from the 131.9 thousand
hectares of land under potato cultivation yielding 19.57 tonnes/Ha in 2007 of which
3
10% is used as seed and the rest is available for consumption (FAO, 2009). Punjab
shares the major annual production of more than 86% coming from autumn and
spring crops followed by NWFP which account for 7.2% of the country’s production
from all the three crop seasons. Baluchistan contributes 4.2% from one summer crop
while 0.3% potato crop is harvested from Sindh province annually.
The potato crop is cultivated throughout the year in three different seasons
(Table 1.2) due to diverse environmental conditions of the country.
Table 1.2: Calendar of potato crop in Pakistan
Crop Season Sowing Percentage Production
Summer March 16-22%
Autumn September 70-76%
Spring January 7-12%
Several cultivars are available for farmers commercially which vary in many
characteristics like flesh and skin color, carbohydrate content, resistance to pathogens,
tuber shape, eye depth and number, usage, dormancy, shelf life, storage and yield.
The major varieties like Diamont, Cardinal, Desirée, Altamash, Raja and Santé grown
in Pakistan are well adapted due to prevailing environmental conditions. Most of
these varieties are oval in shape with light yellow to yellow in flesh color.
1.3 Diseases of potato
The current increase in potato production has been achieved by introducing
the crop in new areas as well as strengthening the areas already under cultivation.
Intensification and inexperience of farmers lead to fungal, bacterial and viral diseases
that affect potato crop production causing serious economic losses annually. Usually
soil born diseases are caused by monocropping and unplanned rotation of crops in
hilly areas of Pakistan. In areas with high relative humidity and temperature between
10°C to 25°C diseases like late blight (Phytophthora infestans) are of common
occurrence. Some diseases may arise due to lack of disease resistant clones and non-
availability of proper germplasm. The most common bacterial and fungal diseases of
potato are given in table 1.3.
4
Table 1.3: Common diseases of potato
No.
Disease
Causal Organism
Organs Affected
Symptoms
1.
Lat
e B
light
Phytophthora infestans
Tub
ers
and
folia
ge
Irre
gula
r an
d de
pres
sed
patc
hes
of
brow
n to
pu
rplis
h co
lor
on t
uber
ski
n. B
row
n to
pur
plis
h bl
ack
lesi
ons
with
chl
orot
ic h
alo
on l
eave
s an
d st
em.
2.
Ear
ly B
light
Alternaria solani
Tub
ers
and
folia
ge
Dar
k su
nken
le
sion
s w
ith
rais
ed
mar
gins
on
tu
bers
. D
ark
brow
n to
bl
ack
lesi
ons
with
co
ncen
tric
rin
gs o
n ol
der
leav
es.
3.
Pow
dery
Sca
b Spongospora subterranea
Tub
ers,
sto
lons
an
d ro
ots
Rai
sed
pinh
ead
lesi
ons
of p
urpl
ish-
brow
n co
lor
on
tube
rs
whi
ch
form
s sp
ores
up
on
mat
urity
. T
hese
sca
bs s
tart
fro
m r
oots
and
sto
lons
whi
ch
mov
e to
war
ds th
e tu
bers
.
4.
Pink
Rot
Phytophthora erythroseptica
Tub
ers
and
folia
ge
Bro
wn
to b
lack
sto
lons
or
root
s. W
ilted
, st
unte
d an
d ch
loro
tic
leav
es.
Rot
ted
tube
rs
with
da
rk
brow
n ey
es
that
tu
rn
pink
af
ter
slic
ing
and
even
tual
ly b
lack
ens.
5.
Fusa
rium
Dry
R
ot
Fusarium
spp
. T
uber
s W
rink
led
or s
unke
n pa
tche
s on
tub
ers
with
pin
k or
whi
tish
fung
al g
row
th d
evel
opin
g cr
umbl
y dr
y de
cay
inte
rnal
ly.
6.
Whi
te M
old
Sclerotinia sclerotiorum
Stem
s W
ater
-soa
ked
lesi
ons
of w
hite
col
or o
n w
ilted
st
ems.
B
lack
sc
lero
tia
deve
lop
on
deca
ying
st
ems.
7.
Gra
y M
old
Botrytis cinerea
Tub
ers
and
folia
ge
Unc
omm
on
gray
co
lor
rots
of
tu
bers
du
ring
st
orag
e. G
rayi
sh m
old
on m
argi
ns o
r tip
s of
low
er
leav
es w
ith c
once
ntri
c ch
loro
tic le
sion
s.
5
8.
Bla
ck D
ot
Colletotrichum coccodes
Tub
ers
and
folia
ge
Lar
ge d
isco
lora
tion
of g
ray
or b
row
n co
lor
with
bl
ack
dots
th
at
ultim
atel
y pr
oduc
e sc
lero
tia.
Folia
ge tu
rns
yello
w a
nd w
ilts
in la
te s
umm
er.
9.
Ver
ticill
ium
W
ilt (E
arly
D
ying
)
Verticillium dahliae
and
Verticillium albo-atrum
Tub
ers
and
folia
ge
Lig
ht b
row
n st
reak
s of
va
scul
ar t
issu
e at
the
te
rmin
al p
art o
f the
tube
r cl
oser
to s
tem
. Irr
egul
ar
chlo
rosi
s an
d w
iltin
g of
lea
ves
on o
ne s
ide
of
petio
le c
ausi
ng e
arly
sen
esce
nce.
10.
Rhi
zoct
onia
C
anke
r (B
lack
Sc
urf)
Rhizoctonia solani
Tub
ers,
sto
lons
an
d st
ems.
Net
ted
or
scur
fy
scle
rotia
or
bl
ack
spot
s on
de
shap
ed o
r cr
acke
d tu
bers
. Su
nken
les
ions
of
brow
n to
bla
ck c
olor
on
stem
s an
d st
olon
s.
11.
Silv
er S
curf
Helminthosporium solani
Tub
ers
Circ
ular
sp
ots
with
in
dist
ingu
isha
ble
mar
gins
, lig
ht b
row
n in
col
or g
ivin
g si
lver
y sh
ine
whe
n w
et.
12.
Pyth
ium
Lea
k Pythium
spp
. T
uber
s W
ater
y an
d sp
ongy
rot
ted
tissu
es v
aryi
ng in
col
or
from
gra
y, b
row
n or
bla
ck w
ith d
istin
ct m
argi
ns.
13.
Com
mon
Sca
b Streptomyces scabies
Tub
ers
Rai
sed,
ci
rcul
ar
to
irre
gula
r le
sion
s br
own
in
colo
r w
ith c
orky
are
as w
hich
dev
elop
int
o da
rk
brow
n to
bla
ck s
cabs
.
14.
Rin
g R
ot
Corynebacterium
sepedonicum
Tub
ers
and
folia
ge
Che
esy
rots
of
yello
w t
o br
own
colo
r de
velo
p in
th
e va
scul
ar r
ing
of t
uber
s w
ith d
ry,
sunk
en a
nd
crac
ked
area
s of
th
e ou
ter
surf
ace
of
tube
rs.
Nec
rosi
s an
d ch
loro
sis
of
leav
es
alon
gwith
w
iltin
g of
ste
m.
15.
Bla
ck L
eg a
nd
Soft
Rot
Erwinia carotovora
Tub
ers
and
stem
s
Wat
er–s
oake
d, s
light
ly s
unke
n br
owni
sh r
otte
d ar
eas
on th
e tu
bers
. Lea
ves
beco
me
chlo
rotic
with
up
war
d cu
rlin
g of
mar
gins
and
wilt
s. I
nky
blac
k de
cay
of s
tem
s th
at b
egin
s fr
om d
ecay
ing
seed
s.
6
1.4 Measures for diseases control
Different strategies were developed to alleviate the potato crop loss caused by
various pathogens and to ensure the steadiness and ample supply of food. Different
chemicals (pesticides, fungicides) have been developed to control the pathogens and
prevent disease occurrence in potato crop. However, these chemicals are costly and
also results in environmental pollution because of their toxic nature (Dempsey et al.,
1998). The high cost of fungicides along with increasing awareness of health and
environmental risks stressed to reduce the use of chemicals (Rauscher et al., 2006).
The most efficient method could only be the development of resistant host (Grunwald
et al., 2001). Disease resistance can be introduced in a crop through conventional
plant breeding very efficiently. However, it takes many years to develop a new
resistant variety through conventional breeding. Traditional breeding has also
limitations due to interspecies sterility. Modern molecular biology techniques such as
genetic engineering have the potential to solve these problems by direct introduction
and expression of cloned resistant gene into a plant. The greatest benefit of this
technique is its capability to trounce the problem of fertility obstacle for the
distribution of genes originating from different species. Similarly, multiple genes can
be inserted simultaneously through genetic transformation methodology (Campbell et
al., 2002). Genetic transformation is considered as most efficient option to war
against pathogens (Iovene et al., 2004). However, crop improvement through genetic
transformation usually requires an efficient system of in vitro regeneration of plants
through tissue culture.
1.5 In vitro regeneration
In vitro regeneration of plants or micropropagation achieved by tissue culture
is the fundamental tool for crop improvement through genetic transformation. The
development of a reliable, rapid and efficient system of tissue culture for plant
regeneration has been a foremost prerequisite. Plant tissue culture technique
comprises of selection and isolation of plant tissue, maintenance of aseptic conditions
during and after manipulation, and in vitro maintenance of the cultured tissues / cells
in controlled environment. Three different approaches are usually adopted for
regenerating plants through culturing of tissues viz. 1) use of apical meristem or shoot
primordia, 2) direct organogenesis from explant or through callogenesis, and 3)
somatic embryogenesis. Plant regeneration is controlled by many factors mainly
7
including cultivar, explant source and culture medium along with growth hormones.
The regeneration of plants through tissue culture is mainly divided into three steps: 1)
shoot induction and multiplication, 2) shoot elongation and 3) in vitro rooting from
the shoots to from stably growing plantlets. Tissue culture techniques for plant
regeneration has numerous advantages like simple and rapid propagation of wide
range of species, development of true to type plants, a small explant can be grown
into a complete plant, controlled physical, chemical and environmental factors etc.
Moreover, it can be employed in gene manipulation and plant transformation systems.
1.5.1 In vitro regeneration of potato
In vitro regeneration response is generally species and often cultivar specific.
Huge differences in the shoot formation efficiency among commercial cultivars of
potatoes have been reported (Hussey and Stacey, 1981; Bajaj, 1981; Miller et al.,
1985). In two different independent studies, an efficient single step regeneration
protocol for Agrobacterium mediated transformation and a rapid in vitro
multiplication system for mass multiplication of healthy stock were developed for an
important potato variety Desirée (Tavazza et al., 1988; Rabbani et al., 2001).
Similarly, regenerative capacity of three potato varieties viz. Desirée, Russet Burbank,
Superior and one potato line FL 1607 was evaluated in a two step regeneration
method. Callus production was maximum in FL 1607 followed by Desirée, Superior
and Russet Burbank. Subsequent transferring of the callus to shoot regeneration
medium resulted in shoot formation after 2 weeks in FL 1607 and 4 weeks for other 3
varieties (Wenzler et al., 1989). Multiple shoot regeneration was observed with
varying efficiency levels among four commercial cultivars of potato. Lemhi and
Russet Burbank responded best for shoot regeneration on medium containing the
higher ratios of cytokinin and auxin whereas Yankee Chipper formed maximum
number of shoots at the lower ratio of cytokinins and auxins. Shoot regeneration was
much faster in Lemhi and Yankee Chipper as compared to Russet Burbank or
Wauseon (Snyder and Belknap, 1993). In the same way shoot regeneration response
of varying level was observed in 17 potato cultivars out of 34 tested while
adventitious shoots were achieved from all 12 varieties used to evaluate their capacity
of regeneration (Dale and Hampson, 1995). Later on three commercially important
cultivars Desirée, Bintje and Kaptah Vandel were regenerated from longitudinally cut
internodal explants (4–6 mm) successfully on MS medium with different hormonal
8
combinations, by using three step method of regeneration. Shoot regeneration
efficiency was highest for Bintje (95%), followed by Desirée (89%) and Kaptah
Vandel (74%) and also large number of regenerated buds (7- 9 buds per explant) were
observed within 3 weeks of culturing (Beaujean et al., 1998).
In vitro plantlet regeneration of seven potato cultivars was assessed from
petioles with intact leaflet. Almost 100% shoot regeneration rates from callus with up
to 20 shoots per callus in Desirée, Kennebec, Niska and Lenape whereas relatively
lower regeneration rates (48%, 50% and 94%,) were noted for other three cultivars
Chieftain, Shepody and Russet Burbank, respectively (Yee et al., 2001). Production of
nodular embryogenic and compact callus was reported from potato cultivar Joythi
using leaf explants on different media (Jayasree et al., 2001). In another study three
potato varieties Desirée, Diamont and Patrones were examined for their tuber
formation potential. Patrones expressed highest tuber formation (56%) followed by
50% in Desirée and 44% in Diamont, suggesting a cultivar dependant tuberization
response (Abbasi, 2001). Shoot regeneration potential of two potato cultivars, Lal
Pakri and Jam Alu, was determined at different hormonal concentrations. Lal Pakri
proved better by producing higher shoot number per explant, more nodes per shoot
and greater length of shoots than Jam Alu (Sarker and Mustafa, 2002). Regenerative
ability of a potato cultivar Sputna was significantly decreased in terms of reduction in
stem and internodal length of regenerated shoots by increasing concentrations of BA
and kinetin in regeneration medium (Shibli et al., 2002). Potato cv. Desirée was used
for in vitro production of virus free plantlets on medium with three different growth
regulators (Ghaffoor et al., 2003). Similarly, higher percentages of in vitro
regeneration of potato cultivars Diamont and Cardinal were obtained by using
different hormonal combinations (Khatun et al., 2003; Yasmin et al., 2003).
Somaclonal variations were also observed for plant height, leaf number, tuber number
and tuber weight per plant between the Multa and Diamont cultivars of potato,
regenerated though callus (Nasrin, 2003).
In vitro regeneration was studied from stem segments of four potato cultivars
including two cultivars of Solanum tuberosum (Desirée and Maris Piper) and two wild
species of potato (S. commersonii and S. acaule) in addition to tuber explants of two
cultivars of S. tuberosum. Shoot regeneration was quickest in Maris Piper followed by
9
Desirée and S. commersonii, however, S. acaule failed to regenerate (Anjum and Ali,
2004a, b). Two potato cultivars viz. Desirée and Maris Piper and their transgenic lines
were compared for their in vitro callus formation capacity. Significant differences in
callus regeneration were observed between parent cultivars and their transgenic lines.
Desirée and its transgenic line performed better than that of Maris Piper (Turhan,
2004). Later, Hussain et al. (2005) investigated the in vitro response of 3 different
potato cultivars for shoot regeneration. Cardinal variety performed best for shoot
regeneration from different explants followed by Diamont and Altamash,
respectively. In vitro regeneration system was developed by using various explants for
potato cv. Shepody (Gustafson et al., 2006), potato sub sp. Andigena line 7540
(Banerjee et al., 2006) and Desirée (Farhatullah et al., 2007). Successful in vitro
microtuberization was achieved economically by using low level of BAP for potato
cultivar Kuroda (Kanwal et al., 2006). A simple and efficient direct regeneration
protocol for six potato cultivars i.e. Diamont, Cardinal, Desirée, Adora, Dura and
Burna was developed for virus free seed production of potato in different agro
ecological zones of the Pakistan. Maximum shoot regeneration was recorded in
Cardinal (77%), followed by Burma (73%), Desirée (71%), Diamont (70%), Dura
(62%) and Adora (61%), respectively (Akhtar et al., 2006). Similarly, explants of four
different cultivars of potato viz. Spunta, Nicola, Hermes and Lady Rosetta were
exercised for in vitro regeneration. Response to callus induction and regeneration was
found to be cultivar-dependent. Lady Rosetta cultivar gave best response for callus
induction (92.3%) followed by Spunta (80.9%), Nicola (72.0%) and Hermes (39.9%)
after two weeks of culturing while Spunta cultivar showed maximum percentage of
shoot regeneration (82.6%) when compared with Lady Rosetta (68.0%), Nicola
(60.3%) and Hermes (40.5%), respectively (Badr et al., 2008).
Callus induction and subsequent plant regeneration is highly dependant on
interaction between naturally occurring endogenous plant growth hormone and
exogenous growth hormones supplemented in tissue culture medium. Changes in
composition and concentration of exogenously supplied growth regulator in medium
for callus induction, plant regeneration and microtuberization often depend upon the
explant type and conditions of culture used. Many authors worked to standardize the
optimum concentrations of different growth regulators for in vitro regeneration from
different explants of potato such as tuber discs, petioles with intact leaflets, leaves,
10
meristems, anthers, nodal or internodal segments of stem. In past, regeneration of
plantlets from the callus was not achieved for many years and was considered to be
somewhat complicated. Multiple shoot regeneration from tuber discs of potato was
first achieved by Lam (1975) on slightly changed MS medium supplemented with 0.4
mg/l BAP and 0.8 mg/l kinetin. Subsequent studies indicated the formation of fully
developed shoots by using zeatin in the culture medium (Lam, 1977). Adventitious
shoot formation from tuber discs of 8 cultivars had also been reported on MS medium
supplemented with NAA, BAP and GA3 (Jarret et al., 1980). Later, Kikuta and
Okazawa (1982) also regenerated shoots from tuber discs by using MS with 0.5 mg/l
zeatin and 0.1 mg/l IAA. Sheerman and Bevan (1988) developed a rapid and direct
regeneration system from potato tuber discs showing highly prolific shoot
regeneration in four weeks from different positions on the tuber explants by using
3C5ZR medium comprised of MS supplemented with 0.5 mg/l nicotinic acid, 0.5 mg/l
pyridoxine HCI and 1 mg/l thiamine HCI, 3% sucrose, 3 µM IAA aspartic acid and 5
µM zeatin riboside. Tuber age was a critical factor i.e. compact immature tubers gave
better results, while soft and old tubers produced shoots infrequently on the above
medium (Sheerman and Bevan, 1988). A continuous and slow release of free plant
growth regulators by their conjugates in the 3C5ZR medium resulted in better in vitro
regeneration response (Hangarter et al., 1980).
Various levels of zeatin riboside (3-10 µM) and 3-indoleacetyl-DL-aspartic
acid (0.3-3.0 µM) were used for tissue culture from microtubers of four different
potato cultivars. Multiple shoot regeneration started directly from the somatic portions
of tuber as well as from callus, especially on medium with high concentration (10
µM) of zeatin riboside with all IAA concentrations. Combinations with low
concentrations of zeatin riboside and IAA-AA resulted in increased growth of friable
callus with reduced somatic shoot regeneration from tuber (Snyder and Belknap,
1993). Three types of media were compared for shoot regeneration from tuber and
tuber derived callus. Direct shoot regeneration from tuber slices occurred in less time
on medium of Ahloowalia (1982) containing 1 mg/l zeatin and 0.5 mg/l 2,4–D
followed by medium of Iapichino et al. (1991) which was supplemented with 2 mg/l
zeatin and 1mg/l IAA. Conversely, shoot induction from tuber derived callus was
much faster on medium of Iapichino et al. (1991). Similarly, the shoot formation
frequency and shoot number from each explant was higher for tuber explant and tuber
11
derived callus on medium of Iapichino et al. (1991) when compared with that of
Ahloowalia (1982). No regeneration from tuber discs was observed on the medium of
Jarret et al. (1980) which contained,0.5 mg/l GA3, 0.03 mg/l NAA and 3 mg/l BAP
(Anjum and Ali, 2004a, b).
Direct regeneration of shoots was attained from potato leaf explants on MS
basal medium supplemented with 10 mg/l GA3, 1 mg/l IAA and 1 mg/1 BAP. Roots
were then produced from these shoots on simple MS medium without hormones. At
the same time callus formation from leaf and petioles was achieved on MS medium
with 5 mg/l 2, 4-D and 0.25 mg/l kinetin (Tavazza et al., 1988). However, healthy,
compact, yellow green colored callus formation from leaf tissues was observed after
12 days of incubation on stage I medium consisting of MS, 10 mg/l GA3, 2.24 mg/l
BAP and 0.2 mg/l NAA (Wenzler et al., 1989). Subsequent transferring of the callus
to stage II medium (same as stage I but without auxin) resulted in shoot regeneration
after 2 weeks. Shoot regeneration was noticed within two weeks from calli on MS
medium with 0.1-1.0 mg/l IAA and 2-10 mg/l BAP (Islam and Riazuddin, 1993).
Yadav and Sticklen (1995), Alphonse et al. (1998) and Hamdi et al. (1998) observed
that leaf was the best explant for regeneration. Jayasree et al. (2001) also reported the
induction of nodular embryogenic calli from leaf cultures on MS media supplemented
with BA + 2, 4-D and compact callus formation on media containing NAA + BA.
Further treatment of these calli with zeatin and BA resulted in development and
maturation of somatic embryos from meristematic regions on nodular tissue and
complete plantlets were developed on hormone free MS medium. However, Yee et al.
(2001) used potato petioles with intact leaflet for plantlet regeneration on MS basal
medium and 1 mg/l GA3 and 3 mg/l BAP, with or without silver thiosulphate or
thidiazuron at two concentrations (0.5 or 2 mg/l) of the IAA. Silver thiosulphate
decreased the regeneration frequency and number of shoots per callus but no such
affects were observed with thidiazuron. Presence of 2 mg/l IAA resulted in higher
shoot regeneration frequency with more number of shoots per callus than 0.5 mg/l
IAA without thiosulphate or thidiazuron. Sarker and Mustafa (2002) used different
concentrations of BAP, kinetin and GA3 for regeneration from leaf, nodal and
internodal explants of two potato cultivars and obtained highest regeneration from
leaf explants followed by nodal and internodal segments. BAP showed better response
as compared to kinetin in terms of increased shoot length, number of leaves, nodes
12
and shoots in both cultivars. Increasing the BAP concentrations from 1.0 to 1.5 mg/l
increased the shoot and node number per plantlet. However, higher concentrations
upto 4.0 mg/l of both these hormones resulted in decrease of these characters.
Maximum shoot regeneration was seen on semi-solid MS medium supplemented with
0.1 mg/l GA3 and 1.0 mg/l BAP. Excised shoots rooted best on half strength MS
supplemented with 0.1 mg/l IAA.
Later, Yasmin et al. (2003) observed the effect of various concentrations of
NAA and BAP on callus formation and shoot regeneration from internodal and leaf
explants of potato and reported that amount of callus induction increased with
increasing concentrations of NAA and BAP which was similar to the results of Martel
and Carcia (1992). MS medium containing 2.5 mg/l NAA + 2 mg/l BAP produced
highest percentage of callus (95%) in minimum time (8.13 days) and highest
percentage for shoot regeneration (80%) was also observed on same hormonal
concentrations. Leaf showed better performance for callus induction and plantlet
regeneration as compared to internodal segments. It was also observed that callus
derived from leaf produced plantlets in a shortest period of time (23.68 days)
compared to that from stem (28.96 days). Anjum and Ali (2004b) compared different
media for shoot regeneration from leaf callus. Earliest shoot initiation from leaf calli
was observed on medium of Iapichino et al. (1991; 2 mg/l zeatin and 1mg/l IAA)
followed by that of Lam (1977; 0.1 mg/l NAA, 0.05 mg/l IAA, 0.5 mg/l BAP, 0.2
mg/l GA3, 0.2 mg/l kinetin and 0.5 mg/l zeatin) while medium of Ahloowalia (1982;
1.0 mg/l zeatin and 0.5 mg/l 2,4-D) took longest time for initiation of shoots. The
frequency of shoots per callus and shoots producing calli were higher on medium of
Iapichino as compared to that of Ahloowalia.
Ducreux et al. (2005) compared leaf, petioles and internodal explants of
Solanum phureja by culturing on MS basal medium with 7.10 mM zeatin riboside,
0.06 mM GA3 and 1.07 mM NAA. All these explants showed callus induction in 12
days which were then shifted to medium containing 7.10 mM zeatin riboside, 0.06
mM GA3 and 0.11 mM NAA for shoot regeneration within 8–12 weeks of culturing.
Petioles showed high regeneration potential as compared to internodal and leaf
segments. Similarly, Gustafson et al. (2006) reported that MS supplemented with 1
mg/l NAA and 1 mg/l trans-zeatin showed maximum regeneration (71%) with 3.6
13
shoot per explant for leaf explants while Banerjee et al. (2006) obtained highest callus
formation (86%) from leaf explants after seven days of incubation on MS basal
medium with NAA at 5.0 mg/l and BAP at 0.1 mg/l. Optimum shoot production
(58%) upto 4 shoots per explants was achieved after 4 weeks on MS basal medium
supplemented with 0.02 mg/l NAA, 0.15 mg/l GA3 and 2.2 mg/l zeatin riboside. This
was also coupled with the reduction in additional growth of callus. Normal and
healthy roots were formed after 5 days on simple MS basal medium with the addition
of 20g/l sucrose. Moreover, Shirin et al. (2007) reported that internodal segments had
more potential for callus induction and plant regeneration than leaf explants. Best
callusing response of both explant types was observed on MS medium containing 2,4-
D while combinations of kinetin + NAA were found more effective for shoot
regeneration from internodal explant derived calli and leaf explant derived calli
regenerated better on BA + NAA combinations. They observed maximum callus
formation on MS medium supplemented with 2, 4-D (3.0 mg/l) alone while highest
shoot production was recorded on MS medium containing 0.5 mg/l NAA + 4 mg/l
kinetin for both explant types in most of the varieties. Excised shoots were rooted
successfully (100%) in 2 weeks on MS medium without any growth hormone.
Different parts of potato stem such as shoot meristems, nodal and internodal
segments were also used for regeneration studies by using different growth hormones.
Wang and Huang (1975) regenerated plantlets from stem and shoot tip derived callus
by using kinetin and IAA in MS medium. Patrascu (1981) used zeatin alone in
modified MS medium for shoot induction while Ahloowalia (1982) used zeatin along
with 2,4-D in half strength MS medium and obtained multiple shoot primordia in the
proliferating calli that stayed regenerative for more than 3 year with routine
subculturing but developed to shoots only after transferring to hormone free medium.
Later, Maroti et al. (1982) regenerated plantlets from shoot segments of four cultivars
of potato and obtained highest number of plantlet formation on MS medium
supplemented with kinetin and NAA. Austin and Cassells (1983) obtained shoot
regeneration from stem derived callus culture whereas Lindeque et al. (1991)
regenerated plantlets from suspension cultures, established by inoculating friable
callus of stem internodal segments of potato in liquid MS medium supplemented with
NAA, kinetin and 2, 4-D. Stem explants showed better and early response for shoot
regeneration on medium of Iapichino et al. (1991) by direct shoot formation while on
14
medium of Jarret et al. (1980) shoot regeneration occurred only after formation of
callus.
In vitro multiplication of potato from nodal and stem explants was achieved on
different concentration of GA3 and BAP. Nutrient medium supplemented with GA3
along with lower concentrations of other PGRs like kinetin, BA and IAA enhanced
shoot growth with multiple shooting (Novak et al., 1980), increased number of leaves
per plantlet (Webb et al., 1983) and increased variability in root growth than in shoot
growth (Simko, 1990). Higher shoot length were obtained on 4-5 mg/l GA3 in MS
medium (Ahmed et al., 1993; Rabbani et al., 2001) or on 0.25 mg/l GA3 (Farhatullah
et al., 2007). BAP bring significant improvement in multiple shoot induction when
used in moderate concentration and maximum shoot number from each explant was
obtained at 2 mg/l BAP (Rabbani et al., 2001). Healthy potato plantlets were
produced from meristems cultured on MS medium with 0.1-1 mg/l BA and 0.1 mg/l
NAA by Shakya et al. (1992). Similarly, Merja and Stasa (1997) studied regeneration
through potato meristem cultures on five different media and obtained regeneration on
media supplemented with NAA, IAA and kinetin. Yousef et al. (1997) found that
BAP at 0.5 mg/l + NAA at 2 mg/l gave the longest main shoot (22 cm), highest node
number (23) and leaf numbers (25) while 0.1 mg/l NAA and 2 mg/l BAP gave the
largest number of axillary shoots per main shoot. Sucrose at 40 g/l in combination
with 0.1 mg/l BAP was most favorable for obtaining maximum number of
microtubers. Largest microtuber weight and size was recorded in media containing
sucrose (80 g/l) and BAP (0.1 mg/l). Zaman et al. (2001) observed maximum shoot
length (8.3 cm), highest node (7.3) and leaf number per plantlet (8.9) by the addition
of NAA at 0.5 mg/l followed by 1mg/l IBA and maximum root length (3.5 cm) at
0.25 mg/l of IAA by using meristem cultures of potato whereas Shah (2002) reported
that maximum number of leaves (6.143), root length (4.429) and number of roots per
plantlet (17.43) were obtained at 0.25 mg/l of IAA.
Three important potato cultivars were regenerated in vitro from their
internodal explant on MS medium with different hormonal combinations, by using
three step method of regeneration. Callus formation was noted within 9 days culturing
longitudinally cut internodal explants of 5-6 mm on callus induction medium
containing MS + 2 mg/l 2, 4-D + 0.8 mg/l zeatin riboside and high shoot regeneration
15
response with large number of regenerated buds (7-9 buds per explant) was observed
on subsequent shifting of callus to shoot initiation medium comprised of MS basal
medium with 2 mg/l GA3 + 0.8 mg/l zeatin riboside within 3 weeks of culturing.
Elongated shoots were successfully rooted in one week on MS basal medium + 0.1
mg/l IAA (Beaujean et al., 1998). On the other hand, Khatun et al. (2003) obtained
highest percentage of callus formation (90%) from explants prepared from nodes on
MS semi solid medium + 2.5 mg/l 2,4-D while highest shoot formation was observed
on MS fortified with 0.1 mg/l IBA + 5.0 mg/l BAP. Maximum rooting was recorded
on half strength MS + 1.0 mg/l IBA. Similarly, Nasrin (2003) observed highest callus
development on MS basal medium + 1.0 mg/l NAA + 1.0 mg/l BA for nodal and 1.0
mg/l NAA + 0.5 mg/l BA for internodal explants of potato. Best response of shoot
regeneration from calli of both explants was achieved on MS medium containing 1.5
mg/l NAA and 3 mg/l kinetin. Ghaffoor et al. (2003) studied the effect of three
different growth regulators on meristem culture of potato for in vitro plantlets
production and observed maximum plantlet height (9 cm) with NAA (0.15 mg/l);
higher number of nodes per plantlet (9.714) with IBA (0.35 mg/l); maximum number
of leaves per plantlet (6.143), highest roots length (4.42 cm) and maximum number of
roots per plant (17.43) with IAA (0.25 mg/l).
Turhan (2004) compared three media with different hormonal combinations
for callogenesis from stem explants and observed best callus formation response (light
green, large sized, friable callus) on MS medium supplemented with 5 mg/l NAA and
0.5 mg/l kinetin. Hussain et al. (2005) investigated the morphogenic response of
various explant types and reported that explant source had significant effect on direct
regeneration. Interaction between media and explant type was noted to be highly
significant. Nodal explants exhibited maximum regeneration potential (17.6 shoots
per explant) followed by shoot apices (6.3 shoots per explant) on MS medium
supplemented with 0.5 mg/l IAA and 2 mg/l BAP. However, Kanwal et al. (2006) got
best results with relatively low concentration of BAP (0.75 mg/l) in cotton based
liquid MS medium using nodal explant, whereas Gustafson et al. (2006) reported that
the combination of trans-zeatin (0.1 mg/l) and IAA (0.1 mg/l) was best for highest
regeneration (67%) from stem explants with 2.7 shoot per explant. Badoni and
Chauhan (2009) used different combinations of GA3, NAA, and kinetin in MS
medium for in vitro propagation of potato through meristem culture. Among all the
16
combinations tested, lower auxin concentration (0.01 mg/l NAA) with GA3 (0.25
mg/l) produced best results for plantlet development in terms of maximum shoot
length (8.28 cm), maximum root length (11.9 cm) and nodes per plantlet (9.4).
1.6 Genetic transformation
Genetic transformation of plants plays a significant role in addressing the
increased dependence of mankind on crops with more yield and nutritional value.
Modern plant biotechnology uses genetic transformation as a vital research tool
(Birch, 1997). This method involves the transfer and expression of genes from one
organism to another even with diverse backgrounds. Incorporation of gene into the
recipient organism genome is the first step towards gene transformation after its
insertion in cells. This is followed by the gene expression in recipient organism and
its inheritance in the next progeny. An efficient, dependable and reproducible plant
transformation system is a prerequisite for genetic engineering of plants. It includes
(a) an efficient plant regeneration system from cells or tissues (b) means of gene
delivery into these cells or tissues (c) selection and regeneration of cells with foreign
gene to develop whole plant with new expression (Hewezi et al., 2002). To date
several monocot and dicot species have been engineered genetically due to the
significant developments in the gene transformation technology. Genetic engineering
has been employed to improve the traits such as nutritional contents, yield, disease
resistance, insect resistance, pesticide resistance in crops of economic importance.
Genetic transformation of plant could be used as a useful tool to study the unanswered
questions of plant physiology (Coruzzi and Puigdomenech, 1994).
A number of methods like Agrobacterium-mediated transformation, Particle
bombardment, Microinjection, Electroporation and Chemical methods using
polyethylene glycol (PEG) are being employed for transferring the novel foreign
genes into plant cells but the most common approaches used for genetic
transformation are as follows:
1.6.1 Biolistic transformation
Particle bombardment, microprojectile bombardment, Gene Gun or Biolistic
method has been an efficient system of plant transformation applied in agriculture and
gene expression studies. This system was introduced in 1980’s by Sanford and
17
developed successfully for transformation of different plant species. Pressurized
helium or CO2 gas is used for the acceleration of sub-cellular size particles of gold or
tungsten in a gene gun. These microprojectiles coated with DNA (foreign gene) when
accelerated at high velocity could deliver the gene and transform the target cells. A
range of plant tissues like whole plant, organs, tissues, cell suspension or explants
could be directly targeted for particle bombardment resulting in transformation. The
biological barriers present in others methods of transformation are less in Biolistic
method of transformation. Gene silencing resulting from integration and interaction of
more than one copies of gene usually occurs in addition to gene fragmentation
associated with this method (Reddy et al., 2003).
1.6.1.1 Biolistic transformation of potato
Agrobacterium mediated transformation is considered as a preferred
technology for transforming potato plants for a single gene trait. However, particle
bombardment would be the method of choice for transformation with multigenic traits
which require synchronized combination and expression of several genes. Successful
transformation with particle bombardment depends on several physical (helium
pressure, target distance, vacuum pressure, type and size of microparticles, etc.) and
biological factors (cultivar, age and type of explant, osmoticum treatment, etc.).
Romano et al. (2001) first time developed a gene gun mediated protocol for
transient and stable transformation of potato cultivar 1024-2. Tuber slices, internodes
and leaves were bombarded to investigate the influence of various physical and
biological parameters on transformation efficiency. uidA and luc genes were used for
optimization of various factors though transient transformation while nptII gene was
used as selectable marker for stable transformation. Better distribution of
microparticles was achieved when explants were placed at 9 cm distance from syringe
filter and 0.2 mm size stopping screen was positioned 6 cm on the top of plant tissue.
Bombardment of explants twice under 7 or 8 bars vacuum pressure gave higher gus
expression for all the explants irrespective of other factors. Osmoticum treatment (24
hours pre and post bombardment) was more effective for leaf (1058 blue spots with
osmoticum vs. 626 blue spots without osmoticum) but no such effect was observed on
internodes. In stable transformation experiments leaf, internodal segments and tuber
discs were bombarded twice with DNA coated gold particle to determine the effect of
18
the different helium pressure, donor plant growth period before bombardment, and
osmoticum treatments. Explants were shifted to the selection medium supplemented
with 100 mg/l kanamycin after 24 hours of bombardment. Significant difference was
noted for overall transformation efficiencies between different explant types. Highest
number of transformants were produced from internodal segments (31%
transformation frequency) followed by microtuber discs (4% transformation
frequency) and leaves (2% transformation frequency), respectively. Leaves and
internodal explants exhibited maximum transformation efficiency when explants
obtained from 9 weeks old donor plants were bombarded twice at the helium pressure
of 8 bars with pre and post-bombardment treatment of 0.1 M mannitol. However, for
tubers the best combination was 8 bar helium pressure, with 0.1 M sorbitol
osmoticum plus 0.1 M mannitol.
In their subsequent studies, Romano et al. (2003) described an efficient
particle bombardment method for co-transformation of potato internodes with genes
present on two different plasmids or gene cassettes. Twenty-eight out of 62 (45%)
transgenic plants were co-transformed with one selected (nptII) and one non-selected
(gusA) gene if separate plasmids were used for transformation. When gene cassettes
(PCR fragments comprising promoter gene and terminator) were used, eight out of 11
plants were co-transformed. Moreover, when three genes (only one of which was
selected) were delivered in three separate plasmids, 11 out of 65 plants (17%) were
co-transformed with all genes. when two genes were delivered into plants through a
single plasmid, 90% transgenic plants showed co expression of those two integrated
transgenes. However 75-80% co-transformants expressed genes when separate
plasmids or gene cassettes were used to deliver those genes.
Ercolano et al. (2004) introduced large DNA fragment from the 106 kb BAC
plasmid BA87d17 to clone the R1 gene by biolistic transformation into the genome of
potato for resistance against Phytophthora infestans. Detached leaves of Desirée were
bombarded with gold particles coated with BAC plasmid BA87d17 carrying R1 gene.
BioRad PDS-1000/He machine driven by helium under 27.5 inches of mercury
vacuum pressure using rupture discs of 1100 psi strength was used for biolistic
transformation. The distance between target leaf tissue and stopping screen was
adjusted to 6 cm. Out 31 kanamycin resistant plants, 13 showed the symptoms of
19
hypersensitive response such as necrotic lesions upon infection with Phytophthora
infestans. PCR and southern blot analysis of transformants indicated the integration of
DNA fragments or constructs into their genome.
Craig et al. (2005) used particle bombardment and PEG-mediated
transformation methods to transform potato cv. Desirée. Transformants were
produced effectively by using both the methods compared in the study. In particle
bombardment method using a PDS-1000/He device, potato leaflets were placed on
medium containing 0.2 M mannitol and either bombarded immediately or after 24
hours incubation on this medium. Gold particle (0.6 µm) coated with DNA of vector
pGUS-HYG were delivered into the leaf tissue with helium pressure of 1100 psi and 6
cm target distance for explants. Regeneration of transformants was carried out at 10
mg/l hygromycin while rooting was done at 15 mg/l hygromycin. Osmoticum
treatment (24 h pre bombardment) resulted in higher transformation efficiency when
compared with bombardment without preculture.
1.6.2 Agrobacterium-mediated transformation
Agrobacterium tumefaciens is a gram-negative soil-dwelling bacterium that
infects the plant at the site of wounds and causes crown gall disease in various plant
species. A. tumefaciens possesses a tumor inducing (Ti) plasmid which stimulates
tumor formation by transferring a fragment of its DNA, known as transfer DNA (T-
DNA) to the host cell after infection and incorporate into the genome of plant (Zupan
and Zambryski, 1995). The bacterial genes in T-DNA are expressed in the plant cell
and activate the production of phytohormones like auxins and cytokinins that initiate
the growth of plant cells in an uncontrolled manner resulting in the formation and
proliferation of tumors. Arginine derivatives called opines usually octopine or
nopaline are synthesized in these tumors and serve as a source of energy for
Agrobacterium. Tumor forming genes are removed and the foreign gene of interest
may be introduced into the T-DNA of Ti plasmid for its transformation into the plant
DNA (Sheng and Citovsky, 1996). A. tumefaciens strain carrying such a Ti plasmid
without tumor inducing oncogenes is called disarmed strain (Klee et al., 1987). The
size of Ti plasmid is about 23 kb and T-DNA is a small segment of this plasmid
flanked by direct repeats of 25 bp called as T-DNA borders. The endonucleases
expressed by vir genes recognize these borders of T-DNA for excision (Webb and
20
Morris, 1992). A 35 kb region called virulence (vir) region is also a part of Ti plasmid
which comprises of 7 loci including virA, virB, virC, virD, virE, virG, and virH.
These genes synthesize proteins called virulence proteins in response to chemical
signals produced at the site of wound and mediate the transmission of T-DNA into
infected cell. Vir genes assist the movement of T-DNA into the host plant cell. Helper
plasmids carrying vir genes have been develop to maintain their function in plant
transformation with T-DNA carrying gene of interest and use disarmed
Agrobacterium strains (Hood et al., 1993). Simple vectors with gene of interest
expressed under promoter from plant, bacteria or virus are used for plant
transformation. Promoters may be used for constitutive expression in the plants or a
tissue specific promoter for expression in desired tissues is coupled with foreign gene
(Walden and Wingender, 1995). Reporter genes like β-glucuronidase gene (gus) are
used for the analysis of gene expression while, antibiotic resistance genes e.g.
neomycin phosphotransferase II (nptII) gene is used for selecting the transgenic cells
(McElroy and Brettel, 1994).
Agrobacterium-mediated transfer of genes is the commonly employed method
for gene transformation in plants as it has the potential to generate transformed plants
at higher frequency. This is a preferred system as one or a few copies of genes even
with relatively larger size can be transformed without undesired gene silencing and
fragmentation of the foreign gene (Hadi et al., 1996; Kohli et al., 1999; Murray et al.,
2004). This system is comparatively simple, efficient and cost effective in most of the
cases (Walden and Wingender, 1995).
1.6.2.1 Agrobacterium mediated transformation of potato
Genetic transformation of potato for its improvement in yield and quality
holds special significance for mankind to meet the ever increasing food demand
worldwide. Traditional breeding methods for potato improvement are less effective
due to high levels of heterozygosity along with tetraploidy and sterility in potato
(Beaujean et al., 1998). Therefore, alternative approach utilizing the tissue culture
technique such as genetic transformation is used for improving the potato cultivars.
The era of plant genetic transformation started in 1980s with the advent of
Agrobacterium mediated gene delivery mechanism and production of first potato
plants carrying foreign gene (Ooms et al., 1983; Horsch et al., 1984).
21
Agrobacterium mediated genetic transformation is one of the most commonly
used and preferred technique for potato genetic engineering. Earlier efforts to
transform genes using Agrobacterium tumefaciens (Ooms et al., 1983 and 1985)
produced morphologically abnormal plants. However, the use of disarmed A.
tumefaciens for plant transformation led to the production of morphologically normal
plants of several North American and European potato cultivated varieties (Shahin
and Simpson, 1986; Twell and Ooms, 1987; Ooms et al., 1987; Sheerman and Bevan,
1988; De Block, 1988; Tavazza et al., 1988; Stiekema et al., 1988; Hoekema et al.,
1989). Moreover, successful transformation efficiency depends on several parameters
including age, type, wounding and pre-culture of explants, inoculation period, co-
cultivation period, Agrobacterium strain/vector combination, Agrobacterium density,
hormonal composition of culture medium and the type and concentration of selection
agents.
Leaves of in vitro grown potato plantlets have been used as explants source in
many transformation studies. An et al. (1986) described the successful gene
transformation of two cultivars of potato which involved a two days co-cultivation of
carefully wounded explants of leaves with disarmed A. tumefaciens strain having a
binary plasmid vector pGA472 and a helper plasmid pAL4404 or pTiBo542, and
subsequent selection of transformed cells on medium supplemented with 500 mg/l of
carbenicillin and 200 mg/l kanamycin which took 5 months for shoot regeneration
after co-cultivation. Two years later, Tavazza et al. (1988) developed a quick method
for potato cv. Desirée transformation with a disarmed Agrobacterium tumefaciens
strain LBA4404. Approximately 6 mm diameter leaf discs were precultured for one
day on feeder culture plates before their inoculation with LBA4404 for three
different periods of incubation (1, 5 and 10 minutes). Transformed shoots with
neomycin phosphotransferase II gene (nptII) were obtained on selection medium with
200 mg/l vancomycin, 100 mg/l kanamycin and 200 mg/l cefotaxime. They observed
a reduction in transformation efficiency by increasing the incubation period from 1 to
10 minutes. Transformation frequency of about 23% was noted with 1-2 min
incubation period, on the basis of regenerated shoot on kanamycin.
Similarly Wenzler et al. (1989) co-cultivated leaf explants of four potato
cultivars namely Desirée, Russet Burbank, Superior and FL1607 with A. tumefaciens
22
LBA4404 (> 109 bacterial cells/ml) harboring nptII and gus genes and selected the
transformed explants on medium with 500 mg/1 carbenicillin and different
concentrations (25, 37.5, 50, 62.5 and 75 mg/1) of kanamycin sulfate. Shoot
regeneration efficiency at 50 mg/l kanamycin concentration was highest in FL1607
(400-500 shoots/100 explants) followed by Desirée (20 shoots/100 explants) and
superior (9 shoots/100 explant) whereas Russet Burbank showed no regeneration. In
addition to that, maximum number of gus positive shoots (65%) was observed at both
50 and 75 mg/l kanamycin, although at latter concentration the shoot regeneration was
delayed by 2-3 weeks. Only 10% shoots were gus positive at 25 mg/l kanamycin.
Successful transformation and shoot regeneration of Russet Burbank has also been
reported from leaf discs (De Block, 1988).
Trujillo et al. (2001) inoculated leaf explants of two cultivars of Andean
potato viz. Diacol Capiro and Parda Pastusa with Agrobacterium strain LBA4404
(OD600= 0.6), carrying vector pBI121 with gus and nptII genes, for 10 minutes and
then co-cultivated those explants on plates with their abaxial side in contact with
regeneration medium for three days in dark. Pre-culturing of explants on feeder
culture plates was not practiced. Shoot regeneration occurred after 5–8 weeks on a
selection medium with 500 mg/l carbenicillin and 100–150 mg/l kanamycin.
Histochemical gus assays, PCR and southern blot analysis proved that 51% of
kanamycin-resistant plantlets of Diacol Capiro and 13% of those of Parda Pastusa
were transformed with respective gene. Sarker and Mustafa (2002) used two
Agrobacterium strains viz. EHA105 carrying pCAMBIA1301 plasmid and LBA4404
harboring pBI121 to transform two potato varieties i.e. Lal Pakri and Jam Alu. They
inoculated leaf, internodal and nodal segments with Agrobacterium suspension of
various densities for different time periods and co-cultivated those explants in dark for
three days and then selected on regeneration medium supplemented with kanamycin
and cefotaxime. Histochemical gus assay of explants showed that infection period of
50 minutes with bacterial cells at optical density (OD600) of 0.8-1.0 produced
maximum transformation events in both varieties. Highest transformation efficiency
was observed in leaf explants followed by internodal and nodal segments. They
observed that Agrobacterium strain LBA4404 performed better than EHA105 in terms
of transient gus expression efficiency while potato cultivar Lal Pakri showed better
transformation ability when compared to Jam Alu.
23
Banerjee et al. (2006) reported that healthy, vigorous explant source; specific
and even wounding of the midrib of leaf explant are very important factors for
development of an efficient transformation protocol. They eliminated the pre culture
step before inoculation of explant with Agrobacterium. Leaf explants of S. tuberosum
ssp. Andigena line 7540 were precisely wounded at the midrib region and inoculated
for 15 minutes with A. tumefaciens strain GV2260 (OD600= 0.8-1.0) containing binary
vector pCB201 harboring StBEL5 gene and then placed adaxial side down on the
regeneration medium without selective agents for 48 hours co-cultivation. Explants
were then shifted to shoot regeneration medium containing 250 mg/l cefotaxime and
50 mg/l kanamycin. Screening of regenerated shoots on rooting medium
supplemented with 75 mg/l kanamycin resulted in root formation in about 91%
shoots. Removal of steps such as pre incubation and explant washing make this
protocol simple and easy with a final transformation efficiency of 35.6 % on the basis
of number of root producing shoots on RM (MS medium with 75 mg/l kanamycin).
Previous studies revealed that unnecessary wounding of explants significantly
decreased the regeneration and transformation frequency (De Block, 1988) whereas
concentration of kanamycin lower than 75 mg/l resulted in more shoot regeneration
but also increased the chance of escapes (Wenzler et al., 1989).
In another study leaf explants of potato variety Shepody were inoculated for 2
minutes with LBA4404 suspension (OD600=0.6) containing 72.5 mg/l
Acetosyringone. Infected explants were co-cultivated for two days on callus induction
medium and later shifted to same medium with 300 mg/l cefotaxime and 100 mg/l
kanamycin for selection. Kanamycin concentration was reduced to 50 mg/l in shoot
regeneration medium after 20 days while rooting was induced on kanamycin free
medium. Approximately 60% shoot regeneration was recorded while 47.1% of these
were positive for nptII gene when tested through PCR amplification. Thus a
confirmed transformation frequency of 28 % was finally achieved after PCR analysis
(Gustafson et al., 2006). Similarly, leaf explants of four varieties of potato namely
Spunta, Nicola, Hermes and Lady Rosetta were transformed by using Agrobacterium
strain LBA4404 with gus and nptII genes (Badr et al., 2008). Three inoculation times
(10, 20 and 30 min) were tested along with 72 hours of co-cultivation period.
Selection of transformed explants was carried out at 500 mg/l carbenicillin with 50
mg/l kanamycin and shoots started to develop under selection for 8 weeks after
24
inoculation. Thirty minutes inoculation of leaf explants resulted in highest gus
expression percentage in all four varieties tested. gus assay showed maximum
transformation efficiency (92.8%) in Lady Rosetta followed by 90% in Spunta, 82.1%
in Nicola and 40% in Hermes, respectively after 30 minutes inoculation time.
Transformation and regeneration potential of tuber discs from both field
grown tubers and in vitro grown microtubers was evaluated for transforming different
potato cultivars. Evidences showed less somaclonal variations in plants regenerated
from tuber discs in contrast to those regenerated from various other somatic tissues
(Sheerman and Bevan, 1988; Hoekema et al., 1989). Sheerman and Bevan (1988)
developed an efficient Agrobacterium mediated transformation protocol for potato by
using field grown tubers as explant source. Tuber discs of five potato cultivars namely
Desirée, Pentland Dell Golden wonder, Maris Piper and Maris Bard were inoculated
for 20 minutes with LBA4404 carrying a disarmed kanamycin resistance binary
vector pBin6. After 20 minutes inoculation, explants were shifted to regeneration
medium with tobacco feeder layer for 48 hours and then transferred to same medium
without tobacco feeder cells but containing kanamycin (100 mg/l) for selection of
transformed tissue and carbenicillin (500 mg/l) for Agrobacterium elimination.
Concentration of carbenicillin antibiotic was reduced to 200 mg/l in subsequent
culture medium. Shoot regeneration percentage after 4 weeks on kanamycin was
highest in Golden Wonder (3.11%) followed by Desirée (20%) and Pentland Dell
(6%) while Maris Piper and Maris Bard did not produced any transformed shoot.
Similarly more than 50% regenerated Desirée discs exhibited multiple shooting. This
protocol resulted in rapid production of transformed shoots directly from the tuber
tissues infected with Agrobacterium within 4-6 weeks as compared to 8-16 weeks
time reported in previous methods like Ooms et al. (1987).
Ishida et al. (1989) reported a transformation protocol for two potato cultivars
Russet Burbank and Lemhi Russet by using in vitro grown microtubers as explant
source. Tuber discs were inoculated with Agrobacterium strain PC2760 by picking a
bacterial colony from plate and spreading on the upper cut surface of tuber discs.
After a two day co-cultivation, tuber discs were shifted to selective medium with 200
mg/l cefotaxime and 50 mg/l kanamycin for shoot and root regeneration. After the
removal of primary shoots, new shoots emerged from same region of tuber disc.
25
Selection of transformed plants was performed at higher level of kanamycin (200
mg/l) and through gus assay for β-glucuronidase activity. Results indicated that
primary shoots were regenerated from untransformed apical meristems mainly due to
dormancy break while transformed cells around those apical meristems become active
only after removal of those primary shoots.
In 1993 Snyder and Belknap used in vitro grown microtubers from four potato
varieties, Russet, Russet Burbank, Wauseon, and Yankee Chipper to produce
transgenic plants by using Agrobacterium tumefaciens PC2760 with a binary vector
pCGN1547, containing nptII and gus reporter gene. Microtuber discs were infected
for 5 -15 minutes with Agrobacterium cells resuspended in liquid MS. After two days
co-cultivation the microtuber discs were shifted to stage I medium with different
combinations of zeatin riboside and 3- indoleacetyl-DL-aspartic acid for regeneration
and supplemented with 200 mg/l cefotaxime and 50 mg/l kanamycin. After 4-6
weeks, discs from microtubers were shifted to stage II medium having 500 mg/l
carbenicillin and 100 mg/l kanamycin. Later, gus activity of the shoots rooted on 200
mg/l kanamycin was checked. Lemhi Russet and Yankee Chipper showed higher
transformation percentage than Russet Burbank and Wauseon. Transgenic shoots
produced only from those discs which contained the cortex and epidermal tissue with
eyes while the tuber blocks with medullary area did not regenerate on kanamycin.
Northern blot analysis with uidA probe confirmed the successful integration and
expression of gene.
Kumar et al. (1995) used a disarmed Agrobacterium strain, C58 carrying the
co-integrate plasmid vector pGV3580::pKU2 having hptII and genes nptII as selection
markers, to produce putative transformants from microtubers of five wild Solanum
species grown in vitro. Tuber discs were inoculated for 30 minutes with
Agrobacterium and then co-cultivated for 2 days in selection free regeneration
medium. The selection of the putative transformants was done on the medium
supplemented with 250 mg/l cefotaxime and 150 mg/l kanamycin. The transformation
was confirmed by PCR analysis and dot blot assay for nptII gene. The frequency of
transformation for all these five Solanum species was extremely inconsistent and
remained between 2-9%.
26
Internodal stem segments were also used in potato transformation by many
workers. Internodal segments are much easier to manipulate during tissue culture than
leaf explants. Moreover, internodal explants proved less susceptible to the physical
damages during different steps of manipulation when compared with leaf explant
(Beaujean et al., 1998). Complete internodes were utilized in majority of the protocols
used for internode based transformation of potato (Ooms et al., 1987; Visser et al.,
1989). Newell et al. (1991) inoculated the internodal explants of three potato cultivars
i.e. Russet Burbank, Desirée and Kennebec with A. tumefaciens carrying vector
pMON 9809, co-cultivated for 48 hours on regeneration medium simultaneously with
feeder layer of tobacco cell and subsequently regenerated and selected the
transformants on medium with 500 mg/l carbenicillin and 100 mg/l kanamycin along
with 100 mg/1 cefotaxime. Absence of tobacco feeder layer in co-cultivation media
resulted in 64% callus induction but no shoot regeneration whereas feeder cells
enhanced both callus inductions (83%) and shoot regeneration (11%). Based on the
recallusing assay on kanamycin, varying levels of transformation frequency were
observed. Maximum transformation frequency was reported for Kennebec (14%),
followed by Desirée (13%) and Russet Burbank (2%), respectively.
However, Beaujean et al. (1998) developed a transformation protocol in which
they utilized the longitudinally divided parts of internode (4-6 mm) from three potato
cultivars, Bintji, Desirée and Kaptah Vandal, for inoculation with A. tumefaciens
strain C58C1Rif harboring gus reporter and nptII selectable marker gene. After 30
minutes inoculation, explants were co-cultivated for three days on CIM and then
cultured for 28-30 days on same medium with 300 mg/l cefotaxime and 125 mg/l
kanamycin. Calli were then transferred to shoot regeneration medium with same
selective agents. On the basis of percentage of regenerated internodal segments after 3
weeks on shoot regeneration medium, Bintji showed highest transformation efficiency
(95.2% with 9.3 buds/explant) followed by Desirée (88.7% with 6.8 buds/explant) and
Kaptah Vandal (74.7% with 8.2 buds/explant). Approximately 7-9 shoots per explant
were produced with the transformation efficiency of 90% within 7-8 weeks time.
Stable transformation and transgene expression was confirmed by histological and
molecular analysis such as flow cytometry, gus assay, PCR assay and northern
blotting.
27
Later, Heeres et al. (2002) evaluated 16 varieties of potato for their
transformation efficiency by using two different protocols i.e. protocol I described by
Visser (1991) and protocol II by Edwards et al. (1991). Internodal explants were
precultured for one day before inoculation with A. tumefaciens LBA4404 having
pKGBA50 construct with kanamycin resistant gene. After a 2 day co-cultivation
period, explants were shifted to different selection and regeneration media according
to two protocols used along with 100 mg/l kanamycin monosulphate and 200 mg/l
cefotaxime. Shoots were considered transgenic after they rooted on MS medium
containing 3% sucrose, 100 mg/l kanamycin and 200 mg/l cefotaxime. Some
varieties performed better with protocol I while others with protocol II. Large
differences in transformation efficiency varying from 1% to 23.3% were observed
among different cultivars. Ducreux et al., (2005) successfully produced transgenic
population of Solanum phureja cv. Mayan Gold by using LBA4404 strain harboring a
phytoene synthase gene (crtB). The leaf and internodal explants of 8 weeks old in
vitro plants were inoculated with Agrobacterium cells (OD600 = 0.8) for 5-10 minutes
and plated on medium for 48 hour co-cultivation, then shifted to regeneration medium
with cefotaxime for 12 days. Selection of the transformed explants was done on
regeneration medium supplemented with both 50 mg/l kanamycin and 500 mg/l
cefotaxime. Calli were produced after 10 weeks of culturing explants, which further
produced shoots after 4-8 weeks on selective medium. With this method they obtained
30 independent transgenic lines out of 1000 explants, with 1-5 transgene copy number
as confirmed by southern analysis. Internodal segments showed better transformation
ability than leaf explants. Moreover, leaf explants were found more sensitive to
mechanical injuries during manipulation when compared to internodal segments.
Badr et al. (2008) used stem as explant source to transform four potato
cultivars by infecting internodal segments with Agrobacterium strain LBA4404 for
different inoculation times (10, 20 and 30 minutes). Inoculation time of 30 minutes
resulted in maximum gus expressing transgenic plants in all four cultivars ranging
from 91.6% for Lady Rosetta to 33.3% for Hemes, respectively. Shoot regeneration
percentage on kanamycin selection medium was highest (21.8%) for both Lady
Rosetta and Nicola after 30 minutes inoculation treatment while Spunta showed 15%
shoot regeneration at 10 and 20 minutes inoculation and 18.5% at 30 minutes.
28
Minimum shoot regeneration percentages of 0.0, 7.7 and 7.9% were recorded for
variety Hemes at 10, 20 and 30 minutes inoculation, respectively.
1.6.3 Genetic modifications of potato for disease resistance
Genetic modification of potato is performed routinely for the development of
disease and stress resistant varieties, for the improvement of nutritional value by
physiological modifications or studying the expression of foreign genes in this model
plant. Moreover, potato plants are modified genetically for the production of vaccines
and other biomaterials.
The genetic modification of potato through transformation could be used to
tackle the most common diseases affecting the potato crop including bacterial wilt,
late blight and viral disease. Transgenic potato plants expressing antibacterial genes
SB-37 and cecropin B coding for antibacterial peptides attacins and cercropins
respectively offered more resistance against black leg and soft rot disease (Arce et al.,
1999). Transformation of potato with lysozyme genes from chicken (chly) or phage
(T4 lysozyme) resulted in moderately or completely resistant plants against these
bacterial pathogens. The spread of infection is controlled by the hydrolysis of
bacterial wall which is catalyzed by these lysozymes (Serrano et al., 2000; Ahrenholtz
et al., 2000).
Viral disease resistance might be established by the triggering of viral genes
for non structural proteins, coat protein, ribozymes, and antisense RNAs (Chakravarty
et al., 2007). Transgenic potato plants expressing viral coat proteins were more
resistant to the potato leaf roll virus (PLRV) in comparison to the control plants
(Kawchuk et al., 1990). Transformed plants resistant to potato virus X (PVX) and
potato mop top virus have also been developed by transforming potato with coat
protein (Doreste et al., 2002). It has been proposed that increased resistance against
viruses in the transgenic plants involved the mechanisms of gene-silencing. Likewise,
proteinase gene encoded by virus and disease resistance protein (Rx) when used for
transforming potato resulted in plants exhibiting increased resistance to viral
infections (Hefferon et al., 1997; Bendahmane et al., 1999). Virus replicase gene has
also been used for developing viral disease resistant potato transgenic lines (Ehrenfeld
29
et al., 2004). Hence, it may be concluded that potato transgenic lines expressing coat
and other viral proteins present more resistance against the development of disease.
Late blight is one of the most damaging potato disease caused by a fungus
Phytophthora infestans. Many attempts have been made for the management of this
disease involving genetic transformation. Glucose oxidase gene upon expression
increases the levels of hydrogen peroxide and gluconic acid by the catalysis of β-D-
glucose in the presence of O2 in the tissues of transformed plants and restricts the
growth of fungi by elevating the level of ROS thus increasing the defense response of
transgenic potato plants (Zhen et al., 2000). The resistance against late blight has also
been increased by the introduction of tobacco class II catalase gene as it triggers
salicylic acid signaling which is involved in natural disease response (Yu et al., 1999).
Another naturally occurring antimicrobial peptide gene Temporin A has been shown
to produce resistant potato plants against blight caused by Phytophthora infestans and
Phytophthora erytroseptica and a bacterium Erwinia carotovora that causes wet rot
disease in potato (Osusky et al., 2004). Defensin gene isolated from the seeds of
Medicago sativa increases the defense response in the transformed plants. Defensin
gene transgenic potatoes were produced for increased resistance against another
fungal pathogen Verticillium (Gao et al., 2000). Endochitinase gene that hydrolyzes
the fungal cell wall and confers resistance against several pathogenic fungi has also
been transformed in potato (Lorito et al., 1998) in an attempt to develop disease
resistant transgenic potato lines. Fungal infections can also be controlled in the
transgenic potato plants by the expression of ac2 gene isolated from Amaranthus
caudatus. The product of this gene binds to the chitin of fungal cell wall resulting in
the restrained growth of infecting fungi (Liapkova et al., 2001; Selitrennikoff, 2001).
Broad spectrum single resistance (R) gene has also been introduced in transgenic
potato lines to enhance the resistance against various pathogens (Song et al., 2003).
All the above studies have revealed that the foreign gene expression in transgenic
potato plants could be employed as a useful strategy for the development of disease
resistant potato lines.
1.7 Defense mechanisms in plants
Plants are always challenged by the invasion of pathogenic microbes but the
disease does not arise all the time. The disease develops only if the existing defense
30
responses are improper, the pathogen is not detected or the stimulated responses are
not successful (Hammond-Kosack and Jones, 1996). Plants exhibit a wide range of
defense reactions to limit and avoid microbial infections and growth. Defense
reactions like hypersensitive responses (HR), cell wall fortification, production of
pathogen related proteins (PR), generation of reactive oxygen species (ROS);
synthesis of benzoic acid, salicylic acid and phytoalexins are initiated upon the
invasion of pathogen while certain phytoanticipins are present in plants as preformed
defense compounds. These defense apparatus often localize the invading pathogen
but usually a few cells die at the site of infection (Bolwell and Wojtaszek, 1997).
1.7.1 Hypersensitive response
The hypersensitive response (HR) may be defined as the plant cell death
shortly after the invasion of pathogen (Agrios, 1988). HR may occur in a single cell or
form necrotic areas with partial colonization of pathogen. The form of hypersensitive
response also depends on the environment and can be changed at higher humidity
(Hammond-Kosack and Jones, 1996). The hypersensitive response plays a
fundamental role in imparting resistance against disease (Heath, 1980). HR causes
cell death in plants resulting in the culmination of nutrition uptake by haustoria of
obligate biotrophic pathogens. The function of HR is not clear in the interactions of
necrotrophic and hemibiotrophic pathogens that obtain energy from dead cells of the
plants. However, cellular isolation by necrosis could release the detrimental
compounds that are already accumulated in the plant cell vacuole (Osbourn, 1996). It
is suggested that cell death may also occur either by the production of toxic
compounds and free radicals causing necrosis or genetically programmed cell death of
the host plant cells is triggered upon recognition of pathogen (Dangl et al., 1996).
The generation of reactive oxygen species (ROS) is a fundamental
characteristic of living cells and plays a vital role during HR in defending plants
against pathogens. The initiation of HR is often triggered by the generation of ROS as
the initial response in many incompatible plant pathogen interactions (Hammond-
Kosack and Jones, 1996; Bolwell and Wojtaszek, 1997). ROS including hydrogen
peroxide (H2O2), the superoxide radical (•O2−) and the hydroxyl radical (•OH) are
derivatives produced as a result of one-electron reductions of molecular oxygen (O2)
in normal circumstances. The appropriate shielding mechanisms that use
31
compartmentalized isoenzymes of peroxidase, superoxide dismutase or catalase
maintain the low levels of ROS in the cells (Bolwell and Wojtaszek, 1997). In a
number of cases under stressed environment, this shielding mechanism is dominated
by abrupt and short-lived production of high ROS levels raising the concentration of
H2O2 upto 1M in about 13 minutes. This phenomenon of sudden ROS elevation
related with cell’s exocellular matrix is known as Oxidative Burst and regulated by
wounding, hormones and light (Lane, 1994; Jacks and Davidonis, 1996). This
oxidative burst activates the hypersensitive response leading to the death of invaded
cells resulting in successful defense response against infecting pathogens (Jabs et al.,
1996).
Elevated levels of ROS defend plants against pathogens in many ways. The
higher levels of H2O2 produces as a result of oxidative burst may prove toxic directly
to microbes (Peng and Kuc, 1992). Peroxidase activity of H2O2 synthesizes precursors
for the development of lignin polymer in plant cell wall that may supplement the
reinforcement of cell wall (Bolwell et al., 1995). The cell wall glycoproteins like
hydroxyproline and proline are cross-linked by oxidation and makes the cell wall
inflexible thus decreasing infiltration of microbes and intricate for cell wall degrading
enzymes (Brisson et al., 1994). H2O2 also increases the lipid peroxides and signaling
of benzoic acid-2 hydroxylase activity resulting in the raised biosynthesis of salicylic
acid (Léon et al., 1995). ROS alters the Redox balance in the cells and regulates the
stable levels of mRNA related to defense reactions (Mehdy, 1994). The altered Redox
balance stimulates the production of enzymes involved in radical scavenging and
repair activities.
The ROS production considerably damages both plant and pathogen and thus
the activation of certain defending mechanisms are required by plant cells for their
own protection (Hammond-Kosack and Jones, 1996).
1.7.2 Cell wall fortification
The plant cell wall and cuticle are the natural barriers to stop the invading
pathogens but microbes usually gain entry through natural openings or wounds.
Augmentation of cell wall avoids the microbial infections in various ways thus
increasing the resistance. The availability of nutrients to pathogens is reduced by
32
slowing down the leakage of cell contents by sealing the cell wall. Whereas, decrease
in transfer of toxic compounds and cell wall hydrolyzing enzymes of pathogen lead to
the retarded growth of fungal hyphae. The phenolic precursors and free radicals
produced during cell wall lignification may damage membranes of pathogens or
inactivate their toxins and enzymes. Sometimes the fungal hyphae get lignified
resulting in loss of their function (Mauch-Mani and Slusarenko, 1996). Enzymes such
as cellulases, pectinases and polygalacturonases (PGs) produced by microbes
hydrolyze the cell walls of the plant resulting in its fragmentation. Consequently,
galacturonic acid oligomers are produced which confer responses of defense or
strengthen the existing ones (Levine et al., 1994). Formation of papillae at the site of
fungal infection is also a type of cell wall strengthening. These papillae formed under
the penetration peg of fungal hyphae physically obstruct the penetration of fungi
inside the infected cells of host plant (Bayles et al., 1990). In some cases callose is
deposited quickly at the site of microbial infection in the cell wall. The
plasmodesmata are usually blocked physically with this deposition of callose
providing a barrier for the movement of viruses from one cell to the other (Beffa et
al., 1996).
1.7.3 Pathogen related proteins
Pathogen related (PR) proteins could be defined as the intracellular and
extracellular localized proteins produced by the plant tissues in response to the
pathogen attack (Bowles, 1990). This response against pathogen attack is called as
System Acquired Resistance (SAR). These PR proteins include glucanases, chitinases
and the proteins that tether chitin. They usually degrade the chitin present in the cell
wall of fungi or change the cell wall structure by making a bond with the cell wall
resulting in the retardation of fungal growth thus exhibiting antifungal activity
(Melchers et al., 1994). Research has shown that transgenic plants expressing PR
proteins were more resistant to some pathogenic fungi (Liu et al., 1994). It has been
suggested that several PR proteins are expressed simultaneously in vacuole to control
the disease effectively and target the pathogenic biotrophs once the infected cells are
isolated by hypersensitive response (Zhu et al., 1994). However, the activation of
cytoplasmic PR proteins is much rapid after the treatment with elicitor showing their
role in primary defense (Hahlbrock et al., 1995). Thionins rich in cysteine possessing
33
antimicrobial activities are produced during plant pathogen interactions and function
like PR proteins (Bohlmann, 1994).
1.7.4 Salicylic acid and Benzoic acid
The production of Salicylic Acid (SA) and Benzoic Acid (BA) and their
conjugates is stimulated by the infecting fungi, bacteria or viruses. The hypersensitive
response induces the production of SA and BA with relatively much higher
concentrations at the site of infection (Ryals et al., 1996). SA synthesis from
phenylpropanoid biosynthetic pathways in response to plant defense is relatively well
studied but it may regulate differently in diverse plant species. An existing BA
conjugate releases BA which further induces the production of P450 monoxygenase
(BA2-H), a cytochrome that in turn changes BA into SA (Léon et al., 1995). The
activity of catalase is subdued by high concentration of salicylic acid resulting in
increased oxidative stress by the accumulation of more ROS (Conrath et al., 1995).
Peroxidases and catalases interact with SA and also form free radicals of SA which
could lead to lipid peroxidation (Durner and Klessig, 1996). The antimicrobial
properties of SA and BA have also been reported as a direct response against
pathogen (Klessig and Malamy, 1994). Studies have shown that the PR gene
expression in many plants have been induced by exogenous application of SA (Ryals
et al., 1996). Expression of wound-induced gene may be inhibited by the altered
jasmonic acid biosynthesis caused by elevated levels of SA (Farmer, 1994).
1.7.5 Phytoalexins
“Phytoalexins are low molecular weight, lipophilic, antimicrobial compounds
that accumulate rapidly around sites of incompatible pathogen infections and in
response to an extensive array of biotic and abiotic elicitors” (Smith, 1996).
Phytoalexins are usually toxic to specific pathogens and exhibit antimicrobial activity.
The enzymes divert the precursors of primary metabolic pathways to initiate the
production of phytoalexins from the secondary metabolic pathway upon infection
(Dixon and Paiva, 1995). However, the successful defense response in infected cells
is achieved by the coordination of numerous signaling events for the production of
phytoalexins (Hahlbrock et al., 1995). S8 (cyclo-octasulphur), a type of elemental
sulphur is also reported to be highly antifungal phytoalexin (Cooper et al., 1996).
Anthocyanidins are synthesized in endoplasmic reticulum and are effective fungi-
34
toxic phytoalexins (Snyder and Nicholson, 1990). An isoflavonoid phytoalexin,
Pisatin isolated from Pea is synthesized as a defense response in infected cells (Preisig
et al., 1989). Resveratol, a phytoalexin when expressed constitutively in transformed
tobacco exhibited increased fungal resistance. Secondary infections and the spread of
fungi are greatly reduced by the increased production of phytoalexins (Hain et al.,
1993).
1.7.6 Phytoanticipins
Phytoanticipins play an important role in plant defense like phytoalexins.
These compounds are not stimulated by the infecting agents and are already exists in
the tissues of plant before infection and are broadly termed as preformed
antimicrobial metabolites. Therefore, such preformed metabolites (Phytoanticipins)
comprise the passive defense mechanism and are defined as “low molecular weight,
antimicrobial compounds that are present in plants before challenge by
microorganisms or are produced after infection solely from preexisting constituents”
(VanEtten et al., 1994). Phytoanticipins exhibits toxicity against wide range of
bacteria and fungi but these compounds are relatively less toxic than phytoalexins.
Phytoanticipins are present at various levels in all plants and facilitate the plants to
protect against less destructive pathogens.
Chlorogenic acid is a less toxic phytoanticipin and effectively resists the
growth of potato pathogen Streptomyces scabies that causes potato scab. The presence
of this compound has been reported in the periderm tissue of potato tubers (Kojima
and Kondo, 1985). Chlorogenic acid is also observed in the xylem and phloem cells
preventing the growth of Verticillium alboatrum in potato plants (Dao and Friedman,
1994). Another most commonly occurring phytoanticipin is protocatechuic acid
present in onions with red or yellow skin. This preformed compound confers passive
resistance and avoids the germination of Colletotrichum circinans spores thus
obstructing the penetration of fungi in the cells (Vermerris and Nicholson, 2006).
Tuliposides are preformed compounds present in tulips. Aglycones resulting from the
hydrolysis of tuliposides synthesize butyrolactones which inhibit the growth of
infecting fungi (Vermerris and Nicholson, 2006).
35
1.8 Plant defense mechanisms and role of secondary metabolites
A large number of low molecular weight natural plant products also termed as
secondary metabolites are involved in plant defense against pathogen attack. These
secondary metabolites could be differentiated from primary metabolites as they are
generally not necessary in primary metabolism of plants. The biosynthesis of these
secondary metabolites through complex enzymatic pathways is more understandable
by the utilization of advance molecular biology technology developed recently.
Similarly, the role of secondary metabolites in plant defense is more evident by the
application of various genetic approaches. Moreover, disease resistance in plants is
augmented by metabolic engineering of pathways involved in production of these
secondary metabolites (Dixon, 2001). Secondary metabolites that occur naturally in
plants also have antioxidant activities. A large number of aromatic compounds mainly
phenols and their derivatives are synthesized by the plants as secondary metabolites
including phenolic acid, flavonoids, flavones, flavonols, quinones, tannins, alkaloids
and terpenoids (Cowan, 1999).
1.8.1 Role of antimicrobials in plant defense
A wide range of antimicrobial compounds are produced by various plant
species. Some compounds confer defense response in plants of related families while
others have a broad spectrum activity in diverse plant species. For example
sesquiterpenes and isoflavonoids are produced in Solanaceae and Leguminosae,
respectively whereas; phenylpropanoid derivatives are produced as a defense response
in number of plants across taxa. The effectiveness of antimicrobials produced by host
plant is verified by the amount of detoxification caused by the enzymatic machinery
of the infecting pathogen. The production of antimicrobial secondary metabolites like
phenolics, flavonoids, isoflavonoids, terpenoids, benzoxazinone and indole have been
reported in corn, rice, soya bean, Arabidopsis and Medicago (Dixon, 2001).
1.8.2 Role of antioxidants in plant defense
Plant defense responses that restrict the invasion of pathogens also change the
oxidative metabolism in the cells. Production of toxic active oxygen species, reactive
quinones and free radicals of phenolic compounds coupled with such defense
reactions are usual by-products and are also detrimental to plant cells
(Hammerschmidt, 2005a). Hydrogen peroxide, hydroxyl radicals and superoxide
36
radical anion inactivate enzymes and harm vital cellular machinery. Moreover, the
formation of highly reactive singlet oxygen produces lipid hydroperoxides and lipid
peroxy radicals as a consequence of peroxidation of lipids. The formation of these
derivatives of oxygen under conditions of stress is a universal phenomenon.
Therefore, it is essential that the toxicity of defensive reactions must be alleviated by
the plant (Foyer et al., 1994).
A wide range of antioxidants and enzymes involved in the antioxidant defense
mechanism scavenge these active oxygen species which are produced more than their
requirement in metabolism or signal transduction. These defense reactions are present
in intracellular compartments and to some extent in the apoplast. The catalysis of
superoxide (•O2−) to molecular oxygen and hydrogen peroxide (H2O2) is modulated
by metalloenzymes like superoxide dimutases (Scandalios, 1993). The formation of
superfluous hydroxyl radical from •O2− is decreased by the efficient removal of
superoxide through superoxide dimutases. These hydroxyl radicals act as strong
oxidizing agents and can damage important molecules like DNA, carbohydrates and
proteins and instigate lipid peroxidation. Superoxides, hydroxyl radicals and singlet
oxygen are also scavenged by α-tocopherol and ascorbic acid. Additionally, the
singlet oxygen concentration is reduced by carotenoids which too absorb the surplus
energy of excitation from chlorophyll. Thiols present on different enzymes are
protected by glutathione which recycle ascorbic acid and react with hydroxyl radicals
and singlet oxygen (Foyer et al., 1994).
Plants with higher level of antioxidants have increased resistance to the
oxidative damages caused by active oxygen species. The extent of oxidative damage
by active oxygen species in plants is controlled by the competence of its antioxidant
system. The most important components of metabolic compound antioxidant defense
system includes phenolics, flavonoids, alkaloids, carotenoids, α-tocopherols,
ascorbate, glutathione, polyamines and various other compounds (Mullineaux et al.,
1997).
1.8.3 Role of phenolics in plant defense
Phenolics are the secondary metabolites that either imparts flavor, odor and
pigment to the plant or toxicity to the organisms feeding upon these plants. These
37
diverse groups of compounds take active part in defense reactions against
phytopathogens as phytoanticipins, phytoalexins and structural barriers and activate
genes related to plant defense (Hammerschmidt, 2005b).
Rapid and sudden increases of phenolic compounds occur in the infected cells
of resistant plants that result in the isolation of pathogen (Fry, 1987). Such responses
are of physical nature and may include thickening of cell walls, formation of papillae
and isolation of vascular tissues by the formation of a polymeric phenol, lignin.
Increased phenols in cell wall provide a physical barrier to stop the penetration of
fungal hyphae and offer an increased resistance against the hydrolytic enzymes
secreted by fungi. Phenolics like simple phenols, phenolic acid, flavonols and some
isoflavones are synthesized in uninfected healthy plants and may function to inhibit
the fungal growth as preformed antimicrobial compounds, phytoanticipins. However,
phenols including isoflavonoids, flavans, phenanthrenes, stilbenes and furocoumarins
are synthesized in response to the infection as phytoalexins (Lattanzio et al., 2001).
During hypersensitive reactions of the host plant in response to infection, the
phenols are oxidized that lead to the browning of tissues (Heath, 1998). This
oxidation of phenolic compounds results in the formation of quinones and free
radicals of phenol which in turn inactivate the enzymes secreted by the pathogen
resulting in a successful defense response (Appel, 1992). Moreover, these oxidized
phenols also have increased antimicrobial activities and thus function directly in
eliminating the pathogen (Urs and Dunleavy, 1975).
Active oxygen species toxic to both infecting pathogen and plant, are also
produced in plant-pathogen reactions as a consequence of defense reactions (Baker
and Orlandi, 1995). It is proposed that anthocyanins are accumulated around the site
of infection and may scavenge active oxygen species functioning like antioxidants
and hence shield the host cells from damage (Kangatharalingam et al., 2002).
Polyphenols have the capacity of scavenging free radicals and prove more efficient
antioxidants than ascorbate and tocopherols. Polyphenols are highly reactive
antioxidants as they donate hydrogen or electron and chelate transition metal ions.
The radicals derived from polyphenols also delocalize and stabilize the unpaired
electrons (Rice-Evans et al., 1997). Reports have suggested that the phenolic
38
compounds also scavenge the surge of hydrogen peroxide in plant tissues (Takahama
and Oniki, 1997) thus proving that phenolic compounds have an extraordinary
structural chemistry for their antioxidant activities.
1.8.4 Role of flavonoids in plant defense
Flavonoids comprise a broad range of secondary metabolites and present in
majority of plants. Numerous biological activities are associated with the secondary
metabolites (Parr and Bolwell, 2000) like flavonols, flavanols, flavones, flavanones,
dihydroflavonols, chalcones, dihydrochalcones and anthocyanidins, included in
different subgroups of flavonoids. They are physiologically active compounds and
advantageous for plants as they impart a significant role in plant resistance against
disease and stress. Moreover, flavonoids from medicinal plants demonstrate
antimicrobial activities (Yilmaz and Toledo, 2004).
Plant defense related flavonoids may be divided into phytoanticipins or
phytoalexins. Phytoanticipins are usually stored at important locations where they
impart their function in signaling or plant defense or both, while phytoalexins are
induced after the invasion of pathogen or pest. A number of preformed flavonoids
have been reported to show antifungal activities (Grayer and Harborne, 1994). Studies
have shown in barley mutants that proanthocyanidins and small quantities of
dihydroquercetin are capable of presenting defense response against Fusarium
species. It has been suggested that flavonoids crosslink microbial enzymes, inhibit
the activities of microbial cell wall degrading enzymes, chelate metal ions and form a
hard crystalline structure that act as a physical barrier (Skadhauge et al., 1997).
Flavonoids are accumulated in specialized cells from where they may permeate and
block the infected cells like xylem vessels showing their involvement in HR and
apoptosis as the system of defense against pathogens (Beckman, 2000). In vitro
studies have revealed that narengenin, a flavonoid inhibits the germination of spores
of Xanthomonas oryzae pv. Oryzae which causes bacterial blight (Padmavati et al.,
1997). The growth of Neurospora crassa has also been inhibited by quercetin and its
derivatives (Parvez et al., 2004). Anthocyanin is produced as a phytoalexin in the
epidermal cells of cotton leaves after the infection of Xanthomonas compestris pv.
Malvacearum indicating that these cells are resistant to bacterial blight
(Kangatharalingam et al., 2002). Flavonols are accumulated in the margins of wound
39
accompanied by formation of wound periderm in response to the Cytonaema sp.
infection in Eucalyptus globulus (Eyles et al., 2003). Chitosan when applied to rice
plants activated the synthesis of an antifungal flavonoid sakuranetin in addition to
other phytoalexins (Agrawal et al., 2002).
The physiological role of flavonoids as antioxidants compounds have also
been discovered (Rice-Evans and Miller, 1998) in addition to their activities in plant
defense. The oxidative stress caused by ultra violet light is alleviated by the shading
effect of phenylpropanoid compounds. A high intensity of defense against the harmful
oxidizing agents generated by heat or light is provided by the light-filtering capability
of flavonoids (Caldwell et al., 1983). Moreover, in vitro studies have shown that
anthocyanins and flavonoids also function as antioxidants (Kubo et al., 1999). Lipid
peroxidation initiated by peroxyl radicals can be inhibited by flavonoids which
intercept peroxy radicals in the membranes of root nodule (Moran et al., 1997) thus
performing as an antioxidant agent. Polyunsaturated fatty acids are converted to their
oxygen-containing derivatives by the oxidative activity of prostaglandin synthetase
and lipoxygenase. The function of these enzymes is inhibited by flavonoids like
luteolin and 3, 4 -dihydroxy flavone (Rosahl, 1996).
1.9 rol genes of Agrobacterium rhizogenes
Agrobacterium rhizogenes is a rod-shaped, gram negative soil dwelling
bacterium of the genus Agrobacterium. This bacterium identified to cause hairy-root
syndrome was first reported more than seven decades ago. Hairy-root disease
differentiates the plant cells to form hairy roots by stimulating the neoplastic growth.
This disease is characterized by branched root system having long, increased number
of roots with excessive root hair. Even though the roots are functional and
differentiated but their rapid growth is comparable to a callus (Flores et al., 1999;
Veena and Taylor, 2007). The hairy roots induced by A. rhizogenes could be grown in
the absence of growth hormones and could be used as for the production of secondary
metabolites and understanding gene function in vitro (Rao and Ravishankar, 2002). A.
rhizogenes is related to extensively studied A. tumefaciens which is the causative
agent for crown gall disease in plants. The process of infection in both the species of
Agrobacterium is generally considered similar. The wounded site of the plant tissue
produces phenolic compounds that attract the bacteria by chemotaxis towards the
40
injured cells. The T-DNA of A. rhizogenes when incorporated into plant genomic
DNA induces the hairy root syndrome. The development of the modified root system
in the plants is stimulated by genes of T-DNA (Veena and Taylor, 2007).
Prolific growth and the mechanism of root induction in the formation of hairy-
root syndrome are not well understood. The T-DNA of Ri plasmid of Agrobacterium
rhizogenes carries the “rol genes (root oncogenic loci genes)” responsible for hairy
root formation (Hansen et al., 1994). Auxin biosynthesis genes (iaaM or aux1 and
iaaH or aux2) may be present on a second T-DNA along with some genes of unknown
function in the agropine strains of A. rhizogenes. Such Ri plasmids with right (TR)
and left (TL) T-DNAs are called as “split” T-DNA. Both TR and TL of split T-DNA
ranges in size from ~15–20 kb each, having their own right and left border. The
transport and incorporation of both TR-DNA and TL-DNA occur independently into
the plant genomic DNA. The TL-DNA carrying rol genes when transferred to the host
plant induce the hairy-root syndrome (Sevón and Oksman-Caldentey, 2002). The
genes which produce agropine and auxin are present on the TR-DNA (Cardarelli et
al., 1985).
The TL-DNA of agropine-type Ri plasmid carries four rol genes viz. rolA,
rolB, rolC and rolD (Slightom et al., 1986). These rolA, rolB, and rolC genes could
collectively produce hairy-root phenotype to a varying extent in different plant
species. The ability of these three genes to stimulate fast growing roots is comparable
with the roots induced by the entire TL-DNA (Spanò et al., 1988). The genes on TR-
DNA are not obligatory for hairy-root production (Vilaine et al., 1987) but participate
in secondary function for the stimulation of hairy roots (Cardarelli et al., 1987a, b).
The mannopine or cucumopine producing strains of A. rhizogenes do not possess aux
genes and carries only one T-DNA having rolA, rolB and rolC genes, thus resembles
with TL-DNA of agropine strain but lacking rolD gene (Christey, 2001). The transfer
of T-DNA from these mannopine or cucumopine strains is considered sufficient for
the formation of hairy-root phenotype. The T-DNA genes of these A. rhizogenes have
been characterized by the study of transgenic plants and roots. Dwarf plants with short
internodes, reduced apical dominance, curled leaves and hairy roots produced when
plants were transformed with wild-type Agrobacterium rhizogenes and described as
“hairy-root phenotype” (Tepfer, 1983 and 1984). Slightom et al. (1986), identified 18
41
ORF after sequencing the agropine-type TL-DNA of Ri plasmid in which rolA, rolB,
rolC, and rolD corresponds to ORF 10, 11, 12, and 15, respectively. In view of the
fact that rol genes are necessary in the initiation of hairy roots scientist have focused
the research on characterization of rol genes (White et al., 1985).
Plant architecture, a characteristic of commercial importance, may be altered
using rol genes. An increase or decrease in apical dominance may change the produce
and ornamental quality of the crop (van der Salm et al., 1996). Improvement of
floricultural crops could be achieved by altering plant phenotype, regulation of
flowering and floral characteristics. rol gene transformation in floricultural crops
produces desirable traits, including bushy phenotypes and dwarfism, increased
number of flowers and early flowering (Cassanova et al., 2005). The pleiotropic side
effects of rol genes in transformants usually hinder the desired results. rol gene under
tissue or organ specific promoters leads to more distinct gene expression with less
pleiotropic effects. Alternatively, the introduction of one or few rol genes
demonstrated reduced pleiotropic effects.
1.9.1 Functions of rolA gene in transformed plants
In transgenic tobacco plants, rolA gene has been characterized by the
formation of highly wrinkled leaves with reduced proportion of length and width,
short internodes showing stunted growth producing large flowers in compact
inflorescences (Schmülling et al., 1988; Sinkar et al., 1988). A similar phenotype was
observed in stable transgenic plants of tobacco, potato and tomato presenting
extremely abnormal phenotype. The dwarf or semi-dwarf plants with intense dark
green wrinkled leaves with delayed senescence have also been observed (van Altvorst
et al., 1992; Schmülling et al., 1993). Tobacco plants of normal size bearing wrinkled
leaves were produced when rolA was used for transformation under its own promoter
(Schmülling et al., 1988), while dwarf plants bearing dark and wrinkled leaves were
produced when the rolA expression was directed under CaMV 35S promoter (Dehio
et al., 1993). It has been reported that tissue specific rolA expression in stem is much
stronger than in leaves and roots (Schmülling et al., 1988 and 1989; Carneiro and
Vilaine, 1993). Mutations studies in the rolA locus resulted in a conclusion that
expression of rolA could produce wrinkled phenotype (Sinkar et al., 1988), possibly
as a result of differential growth of leaf tissues (Michael and Spena, 1995). Small
42
flowers with greatly reduced female and male fertility having modified petals and
anthers were produced in rolA transformed tobacco plants after a delay of 3-4 weeks
(Sun et al., 1991a, b; Michael and Spena, 1995). The changes in flowers were more
distinct in transformants with rolA expression under CaMV 35S promoter that
resulted in shortened styles (Dehio et al., 1993). Transformation with rolA in tomato
also affected fertility forming reduced flowers with short styles and protruded pistils,
however, enhanced flower production was observed. Less pollen production with low
viability resulted in decreased male fertility, while the female fertility appeared
normal (van Altvorst et al., 1992). Agrobacterium rhizogenes induced roots in
kalanchoe were thick, curled and stunted as compared to the roots produced in the
absence of rolA (White et al., 1985). Introduction of rolA gene does not form an
improved root system and the rooting has been greatly reduced in rolA transformed
tomato plants (van Altvorst et al., 1992). Root formation on leaf discs of tobacco was
initiated with rolA when kept on hormone free medium (Carneiro and Vilaine, 1993).
The rolA gene sequence from different strains of Agrobacterium rhizogenes
have been reported to vary in length from 279 to 423 bp. The rolA protein may belong
to DNA-binding proteins and function as a transcription factor (Rigden and Carneiro,
1999; Meyer et al., 2000). Studies have shown that this protein alters the hormonal
physiology of the transformed plants primarily reducing the gibberellin content
(Dehio et al., 1993; Dehio and Schell, 1993; Schmülling et al., 1993; Prinsen et al.,
1994). A phenotype similar to rolA transgenic plants was obtained by inhibiting the
synthesis of gibberellins in wild type plants that may possibly elucidate the dwarf
nature of rolA transgenic plants (Dehio et al., 1993). However, the phenotype like
normal plants was not restored completely when exogenous gibberellins were applied
to such plants (Schmülling et al., 1993). The rolA transgenic plants exhibit increased
sensitivity to phytohormones like auxins that could be linked with the potential
difference associated with H+ATPase activity across plasma membrane (Vansuyt et
al., 1992). It was suggested that rolA protein also inhibits the conjugation of
polyamines consequently altering their metabolism (Sun et al., 1991a; Martin-Tanguy
et al., 1996).
43
1.9.2 Functions of rolC gene in transformed plants
Phenotypic changes including dwarfness, decreased apical dominance,
increased branching and early flowering have been observed in rolC transformed
plants belonging to various genera (Altamura, 2004). The gene expression of rolC
was first studied in rolC-transformed plants of tobacco. The altered phenotype of
these rolC-tobacco plants was characterized by lanceolate leaves with reduced leaf
area, short internodes resulting in dwarf plants, increased number of branches, early
flower initiation, smaller flower size, less viable pollen and seeds. Pale green leaves
and male sterility were also reported when rolC was expressed under 35SCaMV
promoter (Scorza et al., 1994). The constitutive expression of rolC in diploid and
tetraploid potato lines revealed extreme abnormal development including dwarfism,
increased number of branches and altered leaf morphology. Exogenously applied
plant growth hormones showed that the rolC gene product modify the hormonal
balance of the transformed plants. An increase in number of tubers from plants of
both diploid and tetraploid transgenic lines was observed in comparison with their
respective control plants. The tuber yield and number was higher in growth chamber
as compared to those grown in greenhouse. These tubers from rolC transgenic plants
were longer in size with much high eye number (Fladung, 1990). The influence of day
length on morphology, physiology and yield was also studied in tetraploid potato lines
(Fladung and Ballvora, 1992). rolC gene under patatin promoter in transgenic potato
plants altered tuber morphology, increased the number of tillers and enhanced root
growth with a higher biomass (Romanov et al., 1998). The effect of rolC gene on the
starch grain formation in microtubers of rolC-potato plants was demonstrated by
Gukasyan et al. (2001). An increased size of the parenchyma cells in the pith was
observed in microtubers of these rolC transformed plants. The average area and size
of starch grains in these parenchyma cells decreased considerably while an increased
number of starch grains were observed.
rolC gene has been employed extensively in transformation of ornamental
plants for its capacity to alter the growth habit producing dwarf plants with reduced
apical dominance, early flowering and improved rooting (Casanova et al., 2005). The
flower architecture and plant morphology was changed remarkably in Atropa
belladonna, Chrysanthemum morifolium and Salpiglossis sinuate (velvet trumpet
flower) that displayed reduced apical dominance and short internodes resulting in
44
dwarf plants with increased lateral branches exhibiting compact bushy phenotype.
The increased number of small sized flowers with wider petals was observed in
comparison with the control plants (Kurioka et al., 1992; Lee et al., 1996;
Mitiouchkina and Dolgov, 2000). In addition to the dwarf phenotype, some of the
rolC transgenic lines of Rosa hybrida produced normal flowers with anomalous
sexual organs while in other transgenic lines small sized flowers with sterile pistils
were developed (Souq et al., 1996). Similar morphological changes were observed in
Petunia the most common ornamental plant, transformed with CaMV35S-rolC.
Increased number of leaves, early flowering, reduced pollen viability and female
fertility was also reported. However, the number of flowers was not improved in
comparison with the control plants (Winefield et al., 1999). Improvement of trait like
increased number of flower producing shoots has been observed in rolC-carnation
plants (Zuker et al., 2001). The rolC expression under CaMV35S promoter in
transgenic carnation increased the shoot regeneration from petal explants upto 18
times while the formation of adventitious shoots in the leaf explants was also
accelerated (Casanova et al., 2003 and 2004). The Dubonnet cultivar of Pelargonium
domesticum (Regal pelargonium) when transformed with rolC gene under CaMV35S
promoter also presented dwarf phenotype along with reduced leaf size. Early initiation
of higher number of small sized flowers with reduced diameter and petal area was
also observed (Boase et al., 2004).
Tobacco leaves when transformed with CaMV35S-rolC gene produced roots
that were highly branched, nevertheless no such increased root branching was
reported in the leaves of kalanchoe (Spena et al., 1987; Schmülling et al., 1988). Root
growth was retarded in kalanchoe when transformation was done with A. rhizogenes
carrying mutated rolC gene which suggested its involvement in hairy-root growth.
Later, the root length of potato and tobacco rolC transgenic plants showed no
difference with their respective controls (Fladung, 1990; Schmülling et al., 1993;
Scorza et al., 1994). A reduced root system in rolC transgenic roses was observed that
was highly susceptible to diseases and insects (Souq et al., 1996). The rooting ability
of Japanese persimmon and trifoliate orange stem cuttings was increased with the
introduction of rolC gene (Kaneyoshi and Kobayashi, 1999; Koshita et al., 2002).
Moreover, rooting ability of carnation plants was also increased significantly (Zuker
et al., 2001; Casanova et al., 2003 and 2004).
45
The 540 bp rolC gene sequences from the T-DNA of various Agrobacterium
rhizogenes strains are same in size and codes for a protein of 179- to 181-amino acids
having the molecular mass of 20.1 kDa (Slightom et al., 1985; Meyer et al., 2000).
The rolC codes for cytokinin-β-glucosidase which increase the level of available
cytokinins by hydrolyzing the conjugated cytokinin glucosides. Such rolC-transgenic
plants exhibit the cytokinin like effects with altered plant phenotype showing
dwarfing, decreased apical dominance and chlorophyll content (Estruch et al., 1991a,
b). Similar phenotypic changes like decreased apical dominance and increased
branching were also noticed by Schmülling et al. (1988) and Zuker et al. (2001) in
rolC-transgenic tobacco and carnation plants indicating the increased cytokinin like
function. Levels of cytokinin when quantified in petals of rolC-carnation showed the
excessive presence of isopentenyladenine (iP), one of most common occurring
cytokinin in petals (Casanova et al., 2004). Much higher levels of cytokinins like
zeatin and zeatin riboside were recorded during flowering in the apices of rolC
transformed chrysanthemum plants (Mitiouchkina and Dolgov, 2000). The level of
zeatin riboside was increased in rolC transgenic hybrid aspen plants (Nilsson et al.,
1996a; Fladung et al., 1997a, b) whereas, the overall increased levels of free
cytokinins were not observed in rolC-transgenic plants suggesting that this gene has
no role in the hydrolysis of cytokinin glucosides (Nilsson et al., 1993a, b and 1996b;
Faiss et al., 1996). The fractions from gel permeation experiments containing 20 kDa
molecular mass proteins confirmed that the activity of β-D-glucosidase was absent
(Bulgakov et al., 2002a). Therefore, it was proposed that the rolC gene product might
be a very specific and uncharacterized form of glucosidases (Bulgakov, 2008).
The rolC expression in transgenic plants considerably reduces the levels of
ethylene, polyamine, and abscisic acid (Martin-Tanguy et al., 1993; Nilsson et al.,
1996b). The measurement of gibberellins level in rolC transgenic potato, tobacco and
hybrid aspen tissues showed a reduction in GA1 level, one of the most active
gibberellin (Schmülling et al., 1993; Nilsson et al., 1993b and 1996a). The early
flowering caused by decreased levels of gibberellins was not reversed completely by
the treatment with exogenous gibberellins (Schmülling et al., 1993). Conversely,
GA19 concentration in rolC transformed tobacco leaves was unpredictably higher
when compared with leaves of untransformed plants (Nilsson et al., 1993b). Improved
shoot and root regeneration in rolC transgenic carnation explant represents the auxin-
46
like activity of rolC gene product (Casanova et al., 2003). However, the quantification
of auxin levels showed that the concentration of IAA in rolC transformed potato,
tobacco and carnation plants remain unchanged when compared with control plants
(Schmülling et al., 1993; Nilsson et al., 1993b; Casanova et al., 2004). Such auxin-
like effect could be related to the increased auxin sensitivity as revealed by the
increased polarization of transmembrane potential in rolC-tobacco protoplasts
(Maurel et al., 1991).
1.10 rol genes and secondary metabolites production
It has been reported that individual rol genes in transformed plant cells act as
the elicitor of secondary metabolism, thus altering the metabolic pathways. Plant cell
cultures could be manipulated by genetic transformation of rol genes to synthesize
great quantities of secondary metabolites. Once the biochemical function of rol genes
is clearly understood their effects on secondary metabolism could be explained on the
basis of the biochemistry of gene product and mechanism of hormone metabolism and
may be further used for crop improvement (Bulgakov, 2008).
The rolA gene appears to stimulate the secondary metabolism in transgenic
plants and cell cultures (Bulgakov, 2008). It has been shown that the production of
nicotine is increased by the introduction of rolA gene in tobacco plants (Palazón et al.,
1997). The rolA transgenic callus of Rubia cordifolia produced almost three times
greater concentration of anthraquinones (AQs) in comparison to control callus. These
calli remarkably produced stable level of increased AQs for over a period of seven
years, while the growth of callus was also stimulated simultaneously by the
expression of rolA gene (Shkryl et al., 2007).
The rolC gene might be involved in signaling the secondary metabolic
processes in transformed cell cultures and plants. The enhanced production of
secondary metabolites like alkaloids, anthraquinones (AQ) and ginsenosides could be
correlated with the increased expression of rolC gene (Bulgakov, 2008). It has been
hypothesized that the increased alkaloid production from rolC-transgenic roots could
be the result of indirect stimulation of growth rather than a direct increase of
biosynthetic activity by rolC gene (Palazón et al., 1997). Later, the transformed roots
produced from leaf explants of Nicotiana tabacum were analyzed to study the
47
correlation between rolC gene expression, growth rate and nicotine production. The
changes in expression of rolC gene related positively with the growth of roots and
nicotine production (Palazón et al., 1998a). Conversely, it is suggested that the
enhanced production of indole alkaloids from rol-C transgenic roots of Catharanthus
roseus correlated with the increased expression of rolC gene (Palazón et al., 1998b).
The rolC gene expression in transformed calli of Rubia cordifolia stably increased the
anthraquinone (AQ) production upto 1.8 fold as compared to the non transformed
calli (Bulgakov et al., 2002b). Recently, Shkryl et al. (2007) reported that the AQ
production may possibly be dependent on the expression of rolC gene and suggested
that increasing the rolC expression might stimulate the production of AQs at higher
levels. The production of ginsenosides from Panax ginseng was estimated from the
rolC transformed roots and the roots established from transformed calli. The extent of
ginsenoside biosynthesis was comparable and an increase upto three fold was
observed in both types of roots which revealed that the stimulation of ginsenoside
production was not dependent on cell growth; but it was controlled by the rolC gene
expression (Bulgakov et al., 1998).
The rolC gene expression in transformed cells initiates plant defense reactions,
like enhanced production of AQ phytoalexin and increased synthesis of pathogenesis-
related proteins (Kiselev et al., 2006; Bulgakov et al., 2008). The defense reactions of
plants are controlled by three important plant defense hormones viz. salicylic acid,
ethylene and methyl jasmonate. The synthesis of AQ by rolC gene expression is not
dependent on methyl jasmonate (MeJA) mediated pathways (Bulgakov et al., 2004).
Similarly, the production of phytoalexin is not stimulated by ethylene in control cells
as well as cells transformed with rolC. Conversely, salicylic acid and rolC gene
expression increases the stimulation of phytoalexin which suggests that the AQ
production is controlled by more than one signaling pathway and moreover,
accelerated by rolC gene expression (Bulgakov et al., 2002b).
The synthesis of pathogen related PR-2 proteins could be triggered when rolC
gene is expressed constitutively in transformed plant cells (Kiselev et al., 2006).
Protein kinases like calcium-dependent protein kinases and Ca2+/calmodulin-
dependent protein kinases (CDPKs) regulate Agrobacterium/plant relationship
(Gargantini et al., 2006) and control signaling pathways (Harper and Harmon, 2005).
48
The modified expression of CDPK genes has been recently shown in rolC
transformed cells of Vitis amurensis, Panax ginseng and Eritrichium sericeum. The
origin of these new transcripts comprising altered sequences correlated with the
catalytic activity of Ser/Thr kinase subdomains (Kiselev et al., 2008; Bulgakov et al.,
2008). The biochemical processes related to increased pathogen resistance caused by
rolC gene in transformed cells could be explained by the modified expression and
activity of CDPKs (Bulgakov et al., 2008).
Reactive oxygen species (ROS) imparts a significant function in plant defense
reactions. It has been established that rolC gene expression activates secondary
metabolite like phytoalexin production (Bulgakov et al., 2004) and pathogenesis-
related protein synthesis (Kiselev et al., 2006; Bulgakov, 2008). Therefore, it was
expected that the defense mechanism in rolC transformants could also be associated
with ROS elevation by rolC expression (Bulgakov, 2008; Bulgakov et al., 2008).
However, studies have shown the suppressed levels of ROS in rolC transformed cells
under both stressed and unstressed condition. It was observed that the steady-state
levels of ROS remained low in rolC expressing cells in comparison to untransformed
cells of Rubia cordifolia. ROS inducers like Paraquat caused considerable increase of
ROS in control cells, but a slight effect on ROS elevation was observed in cells
transformed with rolC (Bulgakov et al., 2008). It has been reported that increased
levels of ROS stimulated by light is alleviated in the rolC transformed cells as
compared to the controls. Similarly, these rolC transformed cells displayed two to
three times more tolerance to the stress induced by salt and varying temperature
treatments proving the suppression of ROS in transformed cells (Bulgakov et al.,
2008).
49
1.11 Objectives
The objectives of the present study were:
1. To compare six already reported in vitro regeneration protocols for selecting
the most efficient and reproducible tissue culture system for three
economically important cultivars of potato.
2. To develop an efficient system of genetic transformation for potato by
optimizing the Biolistic and Agrobacterium mediated transformation.
3. To transform potato plants with rolA and rolC genes and to confirm
transformation by molecular analysis.
4. To study the defense response of rol transgenic potato plants by determining
their antimicrobial and antioxidant activities.
50
Materials and Methods
The details of materials and methods used in the present study are described in
this chapter. All the research work has been carried out at Plant Molecular Biology
Lab, Department of Biochemistry / Molecular Biology, Quaid-i-Azam University
Islamabad, Pakistan and Plant Products and Food Quality Department, Scottish Crop
Research Institute (SCRI) Scotland, UK.
2.1 Glassware and chemicals
Glassware used in all the experiments was made up of borosilicate (Pyrex).
All the glassware was cleaned by boiling in a saturated solution of sodium
bicarbonate for 1 hour followed by repeated washing in tap water. Thereafter, these
were immersed for 30 minutes in 30% HNO3 solution followed by repeated wash in
tap water. Washed glassware was further washed with distilled water and then dried at
200°C in an oven. Test tubes and flasks were plugged with absorbent cotton.
Autoclaving of the glassware was carried out at 121°C, 15 lbs psi for 30 minutes.
Chemicals used in all the experiments of tissue culture study were of
analytical and molecular biology grade procured from Sigma Chemical Co., USA.
Growth regulators and antibiotics (except cefotaxime) were also obtained from Sigma
Chemical Co., USA and Melford Laboratories Ltd, UK. Molecular biology products
were purchased from Sigma, Invitrogen and Fermentas while kits used were obtained
from Qiagen, Promega and MultiTarget Pharmaceuticals. Cefotaxime, sucrose,
glucose, gelling agent (gelrite), agar-agar and Hi-Media Bacto-Agar for microbial
work were procured from “DIFCO” laboratories, USA.
2.2 Plant material
In vitro plants of three potato cultivars viz. Diamant, Desirée and Altamash
were provided by National Agriculture Research Centre (NARC) Islamabad, Pakistan
and Desirée plants used for the study at SCRI were obtained from Science and Advice
for Scottish Agriculture (SASA) Scotland, UK and maintained at SCRI, UK. The
plant material was grown on Murashige and Skoog (1962) medium supplemented
with 20 g/l sucrose in ventilated Magenta Boxes (Sigma) and propagated by in vitro
multiplication. The plant material was kept in growth room at 18±2°C with 16 hour
51
light at 110 µmol m2 /s and 8 hour dark cycle. For the production of microtubers the
plants were cultured on MS medium supplemented with 9% sucrose.
2.3 In vitro regeneration
In vitro regeneration studies of potato were carried out to select the most
suitable combination of media, cultivar and explant type. Six different callus
induction (CIM) and shoot induction media (SIM) in addition to three root induction
media (RIM) were compared for the regeneration of three potato cultivars viz.
Diamant, Desirée and Altamash by using microtuber discs, leaf strips and internodal
segments as explant source.
2.3.1 Callus induction
A number of reports are available for callus induction from different potato
explants of various cultivars. Therefore, six different CIM reported earlier in different
protocols of potato regeneration and transformation were compared in order to select
the best medium for callus induction. The aim of the experiment was to select the best
combination of medium, cultivar and explant. Six different callus induction media
(CIM) tested are given in table 2.1. The media were prepared by adding 4.4g of MS
stock and 3% sucrose in 1 liter of deionized distilled water. The pH of the medium
was adjusted at 5.8 by adding 0.1N KOH or HCl. The medium was heated in oven for
even mixing of agar and finally autoclaved in flask at 121°C temperature and 15 lbs
psi pressure for 20 minutes. After autoclaving the medium was cooled to 50°C and
filter sterilized growth hormones (using 0.22 mm syringe filter) were added in the
respective medium. Approximately 30-40 ml of each medium was finally poured in
petri plates (9 cm diameter) and allowed to set. The petri plated were then sealed with
parafilm.
Three explant types including leaf strips (5 mm), internodal segments (5-10
mm) and microtuber discs (3-4mm) from the eight week old stock plants of the three
cultivars were prepared carefully using scalpel and kept in liquid MS under aseptic
conditions in a laminar flow hood. Sixty explants each of leaves, internodes and
microtuber discs from the three cultivars were cultured on the six different CIM
already poured in petri plates. The plates were sealed with parafilm and a 2 cm vent
was created for gas exchange by excising the parafilm seal and the excision was
52
covered by using a Micropore tape. These petri plates were kept in growth room at 15
µmol m2/s light intensity at 22±2°C constant temperature. The explants were
subcultured on the respective medium every two weeks. The data for number of days
to form callus was recorded when 50% of the explants formed calli while the
percentage callus formation was calculated on the observations made up to eight
weeks. The experiment was performed as a randomized complete block design and
each treatment comprised of 180 explants (3 replicates of 60 explant each).
Table 2.1: Composition of different callus induction media
No. Medium MS + Hormonal Composition Reference
1 CIM1 2.5 mg/l 2,4-D Khatun et al. (2003)
2 CIM2 2.5 mg/l NAA + 2 mg/l BAP Yasmin et al. (2003)
3 CIM3 0.2 mg/l NAA + 0.02 mg/l GA3 + 2.5
mg/l zeatin riboside Ducreux et al. (2005)
4 CIM4 3 mg/l BAP + 1 mg/l GA3 Yee et al. (2001)
5 CIM5 0.8 mg/l zeatin riboside + 2 mg/l 2, 4-D Beaujean et al. (1998)
6 CIM6 1 mg/l BAP + 0.1 mg/l GA3 Sarker and Mustafa
(2002)
2.3.2 Shoot induction
The experiment was carried out to study the development of shoot formation
from callus produced earlier on six different CIM. In continuation of the previous
experiment the calli produced from various explants of different varieties were further
cultured on six respective SIM. The SIM used for shoot regeneration were selected
from the same reports from where CIM were picked. The aim of this experiment was
to study the best combination of medium, cultivar and explant source for potato in
vitro shoot regeneration from callus. The media were prepared as described
previously in section 2.3.1. The composition of these six SIM is listed in table 2.2.
The embryogenic calli generated from internodal segments and leaf strips each
were cultured on six different SIM separately in order to study shoot induction from
calli of three potato cultivars. While, the callus generated form potato microtuber disc
53
explants were not exercised further due to poor quality and low percentage. The plates
were sealed as described previously for callus induction and kept in growth room at
22±2°C at 110 µmol m2/s light intensity. The explants were transferred to fresh media
after every two weeks. The percentage shoot induction was calculated after eight
weeks whereas the number of days taken for shoot induction was noted when
shooting was obvious in half of the calli. The experiment was conducted as a
randomized complete block design with three replicates of 30 calli each.
Table 2.2: Composition of different shoot induction media
No. Medium MS + Hormonal Composition Reference
1 SIM1 5 mg/l BAP + 0.1 mg/l IBA Khatun et al. (2003)
2 SIM2 2.5 mg/l NAA + 2 mg/l BAP Yasmin et al. (2003)
3 SIM3 0.02 mg/l NAA + 0.02 mg/l GA3 +
2 mg/l zeatin riboside Ducreux et al. (2005)
4 SIM4 3 mg/l BAP + 1 mg/l GA3 + 2 mg/l
IAA Yee et al. (2001)
5 SIM5 0.8 mg/l zeatin riboside + 2 mg/l
GA3 Beaujean et al. (1998)
6 SIM6 1 mg/l BAP + 0.1 mg/l GA3 Sarker and Mustafa (2002)
2.3.3 Root induction
Well developed shoots (3-5 cm in length) were excised carefully from the calli
of different explants and transferred to three different RIM. Three media were chosen
from the same reports from where CIM and SIM were selected. The compositions of
RIM are summarized in table 2.3. The shoots on RIM were kept in growth room at
22±2°C at 110 µmol m2/s light intensity. These media were investigated for number
of days taken to form roots, number of roots per plant and root length. The number of
days to initiate root was noted when root primordia was induced in 50% shoots
though the root length and number of roots were recorded after two weeks of
transferring the shoots to rooting medium. Randomized complete block design with
three replicates of 10 shoots each was used to analyze the results statistically.
54
Table 2.3: Composition of different root induction media
No. Medium Hormonal Composition Reference
1 RIM1 MS + 20 g/l sucrose Ducreux et al. (2005)
2 RIM2 ½ MS + 1.0 mg/l IBA Khatun et al. (2003)
3 RIM3 MS + 0.1 mg/l IAA Sarker and Mustafa (2002)
2.3.4 Plant acclimatization
The root producing plants were taken out from the medium and thoroughly
rinsed under tap water. These plants were transferred to vermiculite in plastic pots and
shaded with transparent polythene bag to retain moisture. These pots were placed in
growth room for one week. The plants were watered with Hoagland solution when
required. After one week polythene was gradually removed and finally the plants
were shifted to pots containing compost. The plants were raised in a green house
where most plants were grown to maturity.
2.4 Biolistic gene transfer
The transformation of potato cultivar Desirée was carried out by using
Biolistic® PDS-1000/He particle delivery system to bombard the DNA coated gold
microcarriers following the protocol of Sanford et al. (1993). Biolistic gene transfer
was optimized to study the different factors affecting the gene transformation
efficiency by using p35SGUSint containing gus reporter gene driven by 35S CaMV
promoter (Fig 2.1), gifted by Dr. Sarah R. Grant, The University of North Carolina at
Chapel Hill.
Fig 2.1: Map of p35SGUSint containing gus gene under 35S CaMV promoter
LB: Left border; NOS PRO: Nopaline synthase promoter; nptII: Neomycin phosphotransferase gene; NOS TER: Nopaline synthase terminator; CaMV 35S P: Cauliflower Mosaic Virus 35S promoter; int: intron; GUS: β- glucuronidase gene; RB: Right border
LB NOS PRO nptII NOS
TER CaMV 35S P int GUS NOS
TER RB
55
2.4.1 Agrobacterium maintenance and culture
The cultures of Agrobacterium tumefaciens LBA4404 strain were maintained
on Luria Bertini (LB, Appendix-I) agar plates supplemented with 100 µg/ml each of
rifampicin and kanamycin. A single colony of Agrobacterium was inoculated in LB
broth and kept on shaker (225 rpm) at 28°C. The cells were harvested by
centrifugation and used in transformation experiments. To prepare LB medium 1.25 g
LB broth (Sigma) was dissolved in 50 ml distilled water in 100 ml conical flask. pH
was adjusted at 7.0 and the medium was autoclaved.
2.4.2 Plasmid isolation
The plasmid DNA from Agrobacterium strain LBA4404 harboring the
plasmid p35SGUSint was extracted by using the alkaline lysis method of Maniatis et
al. (1982). The bacteria were grown in LB medium at 28°C overnight then
centrifuged and resuspended in 200 µl of 50 mM Tris-HCl (pH 8.0) and 10 mM
EDTA. A volume of 400 µl of 0.2N sodium hydroxide and 1% SDS (w/v) were
added. The resulting solution was mixed gently by inverting a few times and
incubated at room temperature for 5 minutes. About 300 µl pre-chilled solution of
potassium acetate (3M, pH 5.0) and 1.8M formic acid were added, thoroughly mixed
and kept on ice for 5 minutes. Centrifugation was carried out at 14,000 rpm for 5
minutes and the supernatant was pipetted out to a fresh tube. About 400 µl of
isopropanol was added and gently mixed by inverting the tube. Centrifugation at
14,000 rpm was carried out for 30 minutes at room temperature. The supernatant was
drained and the pellet was washed twice with ethanol (70% v/v). The pellet was
finally air dried and resuspended in 20-30 µl of TE buffer. The quantity and quality of
plasmid DNA was checked both by spectrophotometer and agarose gel
electrophoresis.
2.4.3 Preparation and coating of gold particles
Gold particles were prepared using 500 µg of gold microcarriers for 120
bombardments by following the method of Sanford et al. (1993). A quantity of 30 mg
of gold particles was weighed in 1.5 ml microcentrifuge tube for each preparation.
Added 1 ml of 70% ethanol (v/v) to the tube and particles were vigorously vortexed
for 5 minutes. Gold particles were allowed to settle down for 15 minutes and then
centrifuged at 14,000 rpm for 5 seconds. Ethanol was drained and 1 ml of sterile
56
distilled water was added for washing. Particles were vortexed for 1 minute and then
allowed to settle for another minute. The particles were pelleted by centrifugation and
water was taken out. This washing was repeated thrice and the particle were
resuspended in 50% (v/v) glycerol (500 µl) after the final wash and kept at -20°C with
a final concentration of 60 mg/ml.
Aliquots of 3 mg (50 µl) gold particles were divided in 1.5 ml microcentrifuge
tube prior to performing the bombardment. A volume of 5 µl of plasmid DNA with a
final concentration of 1 µg/µl, 50 µl of CaCl2 (2.5M) and 20 µl of spermidine (0.1M)
were added sequentially while vortexing continuously to precipitate DNA uniformly
onto the gold particles. The centrifuge tubes were vortexed again for 5 minutes and
left for one minute on ice to allow the particles to settle. The particles were spin down
by centrifugation at 14,000 rpm for 2 seconds and the liquid was removed by
pipetting. A volume of 140 µl of ethanol (70% v/v) was added for washing the gold
particles. The particles were washed again with 100% ethanol and finally resuspended
in 48 µl of 100% ethanol. The particles were kept on ice and used within 1 hour after
DNA coating. An aliquot of 6 µl was pipetted out, loaded on the macrocarrier and left
for 10 minutes in laminar flow hood to dry before bombardment.
2.4.4 Optimization of biolistic transformation
Different physical parameters like helium pressure, target distance and size of
gold microcarriers were optimized for leaf and internodal explants in an effort to
increase the transformation efficiency with minimum damage of the explants. All the
above parameters were studied in combinations to finally select the most suitable
parameters for biolistic transformation. The explants were prepared as described
earlier (section 2.3.1) and 30 explants of leaf strips or internodal segments were
placed in the centre (4 cm diameter) of a petri plate on a sterile filter paper. The effect
of different parameters including helium pressure for particle acceleration (900, 1100
and 1350psi), target distance (6 and 9 cm) and gold microparticle size (0.6 and 1.0
µm) were studied in various combinations in order to transform the leaf and internodal
explants. Bombarded explants were cultured on CIM3 and kept in growth room at
22±2°C at 15 µmol m2/s light intensity. These explants were subjected to
histochemical gus assay after 48 hours. The experiment was performed as randomized
complete block design with three replicates of 30 explants each.
57
2.4.5 Effect of osmotic treatment
The effect of different osmotic treatments on transient gus expression and
callus formation were studied by adding 0.1M mannitol, 0.1M sorbitol and 0.1M
mannitol + 0.1M sorbitol in CIM3 in three different set of experiments. A 24 hour
pre- and post-treatment was given to the internodal explants bombarded in each
experiment to study the effect of osmoticum on transient gus expression.
Bombardment was performed on 30 explants by following the conditions optimized in
earlier section. Transient gus expression of the tissues bombarded was analyzed after
24 hours of incubation on CIM3 with different concentration of osmoticum.
The effect of osmotic treatments on percentage callus formation was
determined by bombarding the explants as described above with DNA coated gold
particles. A pre- and post-bombardment treatment of different osmoticum types were
given for 24 hours and the explants were further transferred to CIM3. The explants
were kept in growth room at 22±2°C at 110 µmol m2/s light intensity for callogenesis.
Percentage callus formation was calculated after four weeks. The experiment was
performed as randomized complete block design with three replicates of 30 explants
each.
2.4.6 Histochemical gus assay
Histochemical activity of β-glucuronidase (gus) was assayed according to the
protocol of Jefferson et al. (1987). Explants were immersed in gus solution and
vacuum was applied for 10 minutes at 200 mbar for infiltration. The explants were
incubated in this solution for 8-12 hours in dark at 37°C. gus solution was drained and
70% ethanol was added to remove chlorophyll. In order to completely bleach the
explants 70% ethanol was then replaced with 96% ethanol. The explants revealed the
gus gene expression in tissues. Both stable and transient expression of gus gene could
be studied by using this assay. The composition of gus solution is given in Appendix-
II.
58
2.5 Agrobacterium mediated transformation
Agrobacterium mediated transformation was developed by optimizing the
parameters like density of bacterial culture, duration of inoculation and co-cultivation
periods on transformation efficiency in leaf and internodal explants of Solanum
tuberosum cultivar Desirée. These parameters were assessed on the basis of transient
gus expression by using p35SGUSint containing gus reporter gene driven by 35S
CaMV promoter (Fig 2.1) in Agrobacterium strain LBA4404.
2.5.1 Optimization of Agrobacterium mediated transformation
Different parameters affecting Agrobacterium mediated transformation like
density of bacterial cells; inoculation time and co-cultivation duration were optimized
for leaf and internodal explants in an effort to increase the transformation efficiency.
To determine effect of bacterial density, overnight grown culture was diluted with MS
liquid medium to adjust optical density at three different levels 0.5, 1.0 and 1.5 at
OD600. The leaf and internodal explants of Desirée were infected at these three
bacterial densities for two different infection times (15 and 30 minutes). After
infection, these explants were blotted on sterile filter paper to remove excessive
Agrobacterium and finally cultured on co-cultivation medium for three different
durations (24, 48 and 72 hours). During co-cultivation the explants were kept on
CIM3 at 22±2°C at low light intensity of 15 µmol m2/s light. After the completion of
co-cultivation period these explants were analyzed for transient gus expression by
histochemical gus assay (section 2.4.6). The experiment was carried out to study the
interaction of different parameters as a multifactorial randomized complete block
design with three replications of 30 explants each.
2.5.2 Effect of antibiotics on explant survival
Cefotaxime is a broad spectrum antibiotic used for the elimination of
Agrobacterium cells from the explants and media after co-cultivation period. The
effect of cefotaxime on explant survival and callus formation was studied in an
attempt to optimize the right concentration of this antibiotic without affecting the
explant regeneration. The untransformed explants were cultured on CIM3
supplemented with different concentrations of cefotaxime (0, 125, 250, 375, 500, 750
and 1000 mg/l) to study callogenesis. CIM3 was prepared as described earlier and
then the filter sterilized antibiotic was added to this medium upon cooling. The media
59
was poured in petri plate and allowed to settle. Thirty internodal explants were
cultured on these different concentrations of cefotaxime and data for callus formation
was recorded after eight weeks. The explants were transferred to the same fresh media
containing the similar concentration of cefotaxime every two weeks. The experiment
was repeated three times.
The T-DNA of the vectors used in this study contained nptII gene as a
selectable marker. The concentration of kanamycin was also optimized in order to
select the proper dosage of this antibiotic to efficiently kill the untransformed explants
/ callus. Higher concentration of kanamycin could affect the regeneration potential of
the transformed explants therefore; the minimum concentration of kanamycin was
optimized by studying its effect on explant survival and number of days taken for
callus initiation. Five different concentrations (0, 25, 50, 75 and 100 mg/l) of filter
sterilized kanamycin were added to autoclaved CIM3 under aseptic conditions in a
laminar flow hood. Internodal explants were prepared as mentioned earlier and
cultured on these plates supplemented with different kanamycin concentration.
Explants were transferred to their respective fresh media every two weeks. The data
was taken for number of days to form callus for each kanamycin concentration and
percentage callus formation was calculated on the basis of data recorded after eight
weeks. The experiment was repeated thrice with 30 explants each.
2.6 Agrobacterium mediated stable transformation with gus gene
The most suitable conditions optimized for Agrobacterium mediated
transformation during previous experiments were identified and selected for
transformation of potato cultivar Desirée using internodal explants. The conditions
employed for stable transformation included Agrobacterium cell density of 1.0 at
OD600, infection time of 15 minutes and co-cultivation for 48 hours. 50 mg/l
kanamycin was added in the selection medium (CIM3) for selecting the transformed
explants while 500mg/l cefotaxime was included in this medium for the elimination of
excessive growth of Agrobacterium. Initially the transformation was performed with
Agrobacterium strain LBA4404 harboring p35GUSint to confirm the efficiency and
reproducibility of this optimized transformation protocol. Transformation was
performed as follows:
60
One ml of Agrobacterium preserved in glycerol stock was inoculated in 5 ml
of LB broth containing 50mg/l kanamycin. The culture was shaken overnight on an
orbital shaker at 225 rpm at 28°C. Later 5 ml overnight culture was diluted in 100 ml
LB broth containing kanamycin (50mg/l) and incubated at 28°C on a shaker for six
hours to harvest the log phase cultures. Centrifugation was performed and LB
medium was discarded while the cell pellet was resuspended in MS liquid and the
OD600 was adjusted to 1. A number of 120 internodal explants were prepared as
described earlier and kept in MS liquid medium. The explants were then transferred to
Agrobacterium suspension (OD600 = 1.0) and left for 15 minutes inoculation time. The
explants were then blotted on an autoclaved filter paper and cultured on co-cultivation
medium (CIM3). The plates were sealed, vented and incubated as described earlier.
After 2 days of co-cultivation the explants were transferred to selection media (CIM3
+ antibiotics) and kept in growth room. Once the shoots appeared and attained the
length of 2-3 cm, they were excised and transferred to SIM3. Selection on shoot
induction medium supplemented with antibiotics was performed twice. The shoots
exhibiting proper rooting from the excised end (Ducreux et al., 2005) were selected
finally and transferred to RIM1 for rooting. The media at every stage was changed
after every 15 days until the well rooted plantlets were developed. The plants were
acclimatized as described earlier in section 2.3.4.
2.7 Stable transformation with rol genes
Once the Desirée plants were successfully transformed with gus gene, further
transformation studies using the similar conditions and parameters were carried out
with Agrobacterium tumefaciens strain LBA4404 possessing vectors pLBR29 (Fig
2.2) and pLBR31 (Fig 2.3) harboring rolA and rolC gene respectively under the
transcriptional control of two 35S CaMV promoters (70S). Neomycin
phosphotransferase (nptII) selectable marker gene for kanamycin resistance was also
present in these vectors. These vectors were gifted by Dr. David Tepfer, Institut
National de la Recherché Agronomique (INRA), Versailles 78026, France. The
sequencing of rolA and rolC gene was carried out before starting the transformation
experiments to make sure that the correct sequences of these genes were cloned in the
respective construct.
61
Fig 2.2: Map of pLBR29 containing rolA gene under 70S CaMV promoter
Fig 2.3: Map of pLBR31 containing rolC gene under 70S CaMV promoter
LB: Left border; 35S P: Cauliflower Mosaic Virus 35S promoter; nptII: Neomycin phosphotransferase gene; 35S TER: Cauliflower Mosaic Virus 35S terminator; CaMV 35S P: Cauliflower Mosaic Virus 35S promoter; RB: Right border
2.7.1 Gene sequencing
Plasmid extraction for rolA and rolC gene sequencing was performed
following the protocol described in section 2.4.2. The sequencing of rolA and rolC
from the constructs pLBR29 and pLBR31 respectively was performed bidirectionally
using forward and reverse primers for both strands using two set of primers (Table
2.4). The bidirectional sequencing of rolA and rolC gene was carried out using ABI
PRISM® BigDyeTM Terminator Cycle Sequencing kit (Applied Biosystems, USA).
The chromatograms obtained were viewed in sequence alignment editor, BioEdit
(Tom Hall, Ibis Biosciences, USA). Alignments of the nucleotide sequences were
executed using WATER by European Molecular Biology Open Software Suite
(EMBOSS) at http://bioinfo.hku.hk/EMBOSS. Sequence comparisons were done by
searching the NCBI GenBank database (www.ncbi.nlm.nih.gov).
LB nptII 35S TER
CaMV 35S P rolA RB
CaMV 35S P 35S P
KpnI PstI HindIII XbaI
35S TER
LB nptII 35 S TER
CaMV 35S P rolC RB
CaMV 35S P 35S P
KpnI PstI HindIII XbaI
35S TER
62
Table 2.4: Primers used for sequencing rolA and rolC gene
Gene Primers
rolA
Forward 1 5´-(TGATTTGCAGCGGCCGTACCGG)-3´
Reverse 1 5´-(CCGGTACGGCCGCTGCAAATCA)-3´
Forward 2 5´-(TTGCGCTGGTAGAACGACTCGG)-3´
Reverse 2 5´-(CCGAGTCGTTCTACCAGCGCAA)-3´
rolC
Forward 1 5´-(TCAAAGTGGAGGATGTGACAAG)-3´
Reverse 1 5´-(CTTGTCACATCCTCCACTTTGA)-3´
Forward 2 5´-(GTACCAGCATGATGTGACTCTC)-3´
Reverse 2 5´-(GAGAGTCACATCATGCTGGTAC)-3´
2.7.2 Agrobacterium mediated stable transformation of potato with rolA and
rolC gene
In this experiment, the transformation protocol optimized for producing gus
transgenic plants (section 2.6) was applied on internodal explants of Desirée to
produce rolA and rolC transgenic plants. A total of 530 and 470 internodal explants
were co-cultivated with Agrobacterium LBA4404 harboring rolA and rolC gene
respectively in five replicates. The explants survived and regenerated on kanamycin
were labeled according to the following key:
RxByPzCna, b where R = rol, B = batch, P = plate, C = callus of respective plate, a
and b = shoot originating from same callus. Moreover, x could be rolA or rolC gene
while y, z and n indicate any numerical value. The transformed plants were
acclimatized and grown to maturity as described in section 2.3.4. Molecular analyses
of rolA and rolC transgenic plants were performed to confirm the stable
transformation.
2.8 PCR analysis of the transformants
The genomic DNA from leaves was extracted from gus, rolA and rolC the
transformed plants by using AquaGenomic® kit (MultiTarget Pharmaceuticals)
63
following the recommendations of the manufacturer or using the following
methodology:
A small piece of leaf (1 cm2) was excised and transferred to a 1.5 ml eppendorf tube.
Added 50 µl of DNA extraction buffer (100 mM Tris-HCl, 100 mM EDTA, 250 mM
NaCl) and macerated using a hand operated plastic homogenizer. The volume was
made up to 250 µl by the addition of DNA extraction buffer. Added 20% SDS (25 µl)
and the tube was vigorously shaken for 30 seconds on a vortexer. The tube was then
incubated in a water bath at 65°C for 20-60 minutes for complete cell lysis. Following
the incubation 250 µl of phenol : chloroform : isoamyl alcohol (25:24:1; v/v/v) was
added to the tube. The tubes were inverted several times to thoroughly mix the
organic and aqueous phases. The tubes were centrifuged for 7 minutes at 14,000 rpm
to separate the two phases. The upper aqueous phase was collected into a new tube
carefully to avoid mixing and hydrated ether (250 µl) was added. The tubes were
shaken vigorously to dissolve the impurities which form a layer at the interface of two
phases. The tubes were again centrifuged for 1 minute at 8,000 rpm and the upper
organic phase was discarded. This step was repeated twice to remove al the impurities
in the DNA preparation. Ether was removed by air drying for 10 minutes at 35°C.
The DNA was quantified using spectrophotometer and agarose gel
electrophoresis was performed as described earlier to check the quality of DNA. PCR
reaction mix (50 µl) was prepared as below:
10X PCR Buffer 5 µl
10mM dNTP mix 1 µl
50 mM MgSO4 2 µl
Primers (10 µM each) 2 µl
Template DNA 2 µl (50-100ng)
Taq polymerase 0.2 µl
PCR H2O 35.8 µl
Amplification of nptII, gus, rolA and rolC genes was carried out using the primers and
conditions given in table 2.5. Genomic DNA extracted from non-transformed plant
was used as negative control and plasmids (p35SGUSint, pLBR29 and pLBR31) as
positive control in respective reactions.
64
Table 2.5: PCR conditions for the amplification of different genes
Gene Gene size Primer sequence
PCR
Product
PCR Conditions
Temp Time Cycle
rolA 297
5'- AGAATGGAATTAGCCGGACTA-3'
5'-GTATTAATCCCGTAGGTTTGTT-3'
308
94C 5min 1
94C
53C
72C
35 sec
35 sec
45 sec
35
72C 10 min 1
rolC 537
5'-GAAGACGACCTGTGTTCTC-3'
5'-CGTTCAAACGTTAGCCGATT-3'
547
94C 5min 1
94C
54C
72C
35 sec
35 sec
45 sec
35
72C 10 min 1
gus 1800
5´-AACGGCAAGAAAAAGCAGTC-3'
5´-GAGCGTCGCAGAACATTACA-3
895
94C 5min 1
94C
56C
72C
35 sec
35 sec
45 sec
35
72C 10 min 1
nptII 1016
5´-AAGATGGATTGCACGCAGGTC-3´
5´GAAGAACTCGTCAAGAAGGCG-3´
781
94C 5min 1
94C
54C
72C
35 sec
35 sec
45 sec
35
72C 10 min 1
2.8.1 Agarose gel electrophoresis
The product amplified as a result of PCR were mixed with 6X loading dye,
(Invitrogen) and were analyzed on 1% (w/v) agarose gel using horizontal
electrophoresis apparatus. The agarose gel was prepared in TE buffer (0.045 M Tris
base and 0.001 M EDTA) pH 8.0. 40 µl/l of 0.1% (w/v) ethidiumbromide was added
65
in the gel to visualize the DNA bands. Electrophoresis was performed in 1X TBE
buffer at 50 mA. After 1 hour the gel was visualized on a UV transilluminator.
2.9 Southern blot analysis
Southern blot analysis of some representative T0 transformants was performed
by extracting the genomic DNA from the plant leaves by using AquaGenomic® kit
(MultiTarget Pharmaceuticals). The DNA was digested and agarose gel
electrophoresis was carried out and the separated DNA fragments were transferred to
a positively charged nylon membrane. The probe was prepared and hybridization of
membrane carrying plant DNA was done with the probe. Finally the membrane was
placed over an x-ray film for exposure.
2.9.1 DNA restriction
Digestion restriction was carried out by using restriction endonuclease under
conditions recommended by the manufacturer (Promega). Approximately 50 µg of
genomic DNA isolated from both transformed and untransformed plants were
digested with KPNI in 10 µl reaction:
DNA 50 µg
KPNI (1 U/µl) 0.2 µl
10X Buffer 1 µl
PCR H2O to 10 µl
The digestion mixture was incubated at 37 °C for 2 hours in 10 µl reaction. The DNA
was subsequently precipitated with ethanol and sodium acetate, resuspended in 15 µl
TE buffer after washing with 70% ethanol.
2.9.2 Agarose gel electrophoresis
DNA loading buffer (5 µl) was added to each sample and separation of
digested DNA was carried on 0.8% (w/v) TBE agarose gel containing 0.5 µg/ml (w/v)
ethidium bromide. Electrophoresis was carried out for 16 hours at 40mA constant
current.
2.9.3 Transfer of restriction fragments to membrane
66
The agarose gel containing the separated DNA fragments was treated for 15
min. in 0.25 M HCl at RT, and then shaken for 30 min. in denaturing solution
(Appendix-V) and for another 30 min. in neutralizing solution (Appendix-V). The
DNA fragments were transferred from the gel to the Hybond-N+ nitrocellulose
membrane overnight with 20 X SSC buffer. For fixation of the DNA fragments, the
membrane was exposed to UV light for 5 min. and baked at 80°C for 2 h.
2.9.4 Labeling of DNA using [α-32 P]
The DNA probe (full length nptII PCR product) was labeled with [α-32 P]-
dCTP using the "Random primed hexalabeling DNA Kit". Mixed 15 µl probe in 25µl
sterile distilled water and 10 µl hexanucleotide in a total volume 50 µl and incubated
for 5 min. at 95°C for denaturation, then quick chilled in ice. Finally, 3 µl mix i.e. 2 µl
[α-32 P] –dCTP and 1 µl Klenow enzyme (5 U/µl), were added and incubated for 10
min. at 37°C. After incubation, 4 µl dNTPs was added and reincubated for 5 min. at
37°C. The reaction was stopped with 50 µl TE buffer; pH 8 and the probe were
allowed to pass through a sephadex column (to clean the probe). Before using the
probe, it was incubated at 95°C for 5 min. for denaturation and quick chilled on ice.
2.9.5 Hybridization process
The pre-hybridization was performed at 65°C in 50-100 ml hybridization
solution (Appendix-V) without adding labeled DNA. After 3 hours the hybridization
solution was discarded and replaced with the fresh solution, added labeled DNA
probe and hybridization was performed overnight at 65°C. Washing of the membrane
was carried out thrice with 50 ml washing buffer at 65°C for 20 minutes. Finally,
Kodak hyper-film (X-ray) was exposed with the hybridized membrane for 3-5 days at
-70°C.
2.10 Extraction of transgenic plants
The transgenic plants of Desirée transformed with rolA, rolC and gus genes
were harvested upon maturity. Ariel parts were freeze dried and ground in a mortar
and 25 g of rolA, rolC and gus transformed in addition to untransformed plants were
extracted by maceration in 500 ml of methanol for 5 days. The solvent was
evaporated at temperature below 50°C by applying vacuum and the extracts were
preserved by freeze-drying until further analysis.
67
2.11 Antifungal activity
The plant extracts were assayed for antifungal activity against the fungal strain
Fusarium solani and Alternaria solani obtained from First Fungal Culture Bank of
Pakistan at Institute of Mycology and Plant Pathology, University of the Punjab
Lahore. These fungi were grown on PDA plate at 28°C and maintained with periodic
sub-culturing at 4°C.
The crude methanolic extracts (CME) of rol gene transgenic plants were
screened for antifungal activity by agar well diffusion method (Perez et al., 1990)
with sterile cork borer of size 8.0 mm. The cultures of 48 hours old grown on potato
dextrose agar (PDA) were used for inoculation of fungal strain on PDA plates. An
aliquot (0.02ml) of inoculum was introduced to molten PDA and poured in to a petri
dish by pour plate technique. After solidification, the appropriate wells were made on
agar plate by using cork borer. In agar well diffusion method 1mg/well of methanolic
extracts of different plant were introduced serially after successful completion of one
plant analysis. As all the concentrations were prepared in dimethyl sulfoxide (DMSO)
therefore pure DMSO was used as negative control, while solutions of standard
antifungal compounds Terbinafine and Clotrimazole, 0.5mg/well each in DMSO,
were used for positive control. Incubation period of 24 to 48 hours at 28°C was
maintained for observation of antifungal activity of plant extracts. The antifungal
activity was evaluated by measuring zones of inhibition of fungal growth surrounding
the plant extracts. The complete antifungal analysis was carried out under strict
aseptic conditions. The experiment was carried out in triplicates. The zones of
inhibition were measured with antibiotic zone scale in mm and relative suppression
activity of each transgenic line was calculated by using the following formula:
Relative suppression (%) = [(sample zone – control zone) / control zone] * 100
2.12 Antibacterial Activity
The antibacterial assay was carried out against three bacterial strains
Agrobacterium tumefaciens (AT 10), Xanthomonas compestris pv Vesicatoria and
Pseudomonas syringae pv Syringae obtained from First Fungal Culture Bank of
Pakistan at Institute of Mycology and Plant Pathology, University of the Punjab
Lahore. These bacteria were maintained on LB agar plates with periodic subculturing.
68
Antibacterial assay was performed by agar well diffusion method. Three plant
pathogenic strains of bacteria, Agrobacterium tumefaciens (AT 10), Xanthomonas
compestris pv Vesicatoria and Pseudomonas syringae pv Syringae were used in this
assay. Bacterial strains from 24 hours old culture in nutrient broth (MERK) were
mixed with sterile physiological saline (0.9% NaCl) to match Mac Farland turbidity
standard of 0.5 [106 colony forming unit (CFU) per ml]. One ml of this standardized
suspension of bacteria was used for seeding 100 ml of the nutrient agar (MERK).
Petri plates of (14 cm) were prepared by pouring 75 ml of seeded nutrient agar and
solidified. Ten wells each having diameter of 8.0mm were made in each Petri plate
with the cark borer. The wells were sealed with nutrient agar and marked, followed by
the addition of 100ul of CME at a final concentration of 1mg/ml into their respective
wells. As all the concentrations were prepared in dimethyl sulfoxide (DMSO)
therefore pure DMSO was used as negative control, while solutions of antibiotics
Roxithromycin and Cefixime-USP, 0.1mg/ well each in DMSO, were used for
positive control. All the plates were incubated at 37°C in incubator (YAMATO IC83)
for 24 hrs while AT10 was incubated at 28°C. The susceptibility of each
microorganism to the sample CME was determined by measuring the size of
inhibitory zones around each well. All of the experiments were performed in
triplicate. The zones of inhibition were measured with antibiotic zone scale in mm and
relative suppression activity of each transgenic line was calculated by using the
following formula:
Relative suppression (%) = [(sample zone – control zone) / control zone] * 100
2.13 Determination of antioxidant activity
The antioxidant activity of the plant extracts was measured by 2, 2-diphenyl-1-
picryl-hydrazyl (DPPH) free radical scavenging activity following the modified
protocol of Obeid et al. (2005). Dissolved 3.2 mg of DPPH in 100 ml of methanol
(82%) to prepare DPPH solution. Added 2800 µl of this DPPH solution and 200 µl of
crude plant extract sample (20, 50 and 100 µg/ml each) to glass vials. The mixtures
were thoroughly mixed and kept for one hour at room temperature in dark.
Spectrophotometer was used to measure the absorbance at 517 nm. Mixture of 82%
methanol (2800 µl) and 100% methanol (200 µl) was used as blank while 2800 µl
69
DPPH and 200 µl methanol was used as negative control. The experiment was
repeated thrice and percentage scavenging was measured by the following formula:
Scavenging (%) = [(Abs. of f ve control f Abs. of test sample) / Abs. of f ve control] *
100
where abs = absorbance
The calculation of IC50 values were performed by using graphical method.
Moreover, the relative increase in antioxidant activity of each transgenic line was
calculated by using the following formula:
Relative increase (%) = [(IC50 value of control – IC50 value of sample) / IC50 value of
control] * 100
2.14 Determination of total phenolics
Determination of total phenolics was performed by using Folin Ciocalteu
reagent (McDonald et al., 2001). Plant extracts were diluted to 1:10 g/ml and then 0.5
ml each was mixed with 4 ml of 1M Na2CO3 and 5 ml of Folin Ciocalteu reagent
diluted (1:10) with distilled water. After 15 minutes of incubation at room
temperature the colorimetric determination of total phenolics was carried out at 765
nm using a spectrophotometer. Different concentrations of gallic acid (0, 50, 100,
150, 200, 250 mg/l) a commonly used reference compound, dissolved in methanol
and water (50 : 50 v/v) were used to prepare the standard curve. Finally, the values of
total phenolics are expressed in terms of reference compound gallic acid equivalent
(mg/g of dry mass) using the standard curve (y = 0.1397x + 0.0416, R2= 0.9915).
Moreover, the relative increase in total phenolics of each transgenic line was
calculated by using the following formula:
Relative increase (%) = [(total phenolics of sample – total phenolics of control) / total
phenolics of control] * 100
2.15 Determination of total flavonoids
Total flavonoids were determined by colorimetric method using aluminum
chloride (Chang et al., 2002). Plant extracts were diluted in methanol to 1:10 g/ml and
0.5 ml each was mixed with 100% methanol (1.5 ml), 10% aluminum chloride (0.1
ml), 1 M potassium acetate (0.1ml) and distilled water (2.8 ml). Incubated the reaction
mixture for 30 minutes at room temperature and the colorimetric determination of
70
total flavonoids was carried out at 415 nm using a spectrophotometer. Different
concentrations (12.5 to 100 g/ml) of quercetin (standard flavonoid) solution in
methanol were used for the preparation of standard curve. The total flavonoids were
calculated as standard flavonoid quercetin equivalent (mg/g of dry mass) by using the
standard curve equation: y = 0.1551x + 0.049, R2 = 0.9997.
Moreover, the relative increase in total flavonoids of each transgenic line was
calculated by using the following formula:
Relative increase (%) = [(total flavonoids of sample – total flavonoids of control) /
total flavonoids of control] * 100
71
Results
3.1 Optimization of in vitro culture system
The main aim of these experiments was to establish a protocol for high
frequency regeneration of potato plants which may further be used for transformation
studies. The internodal segments, leaf strips and discs of microtubers from three
potato cultivars viz. Diamant, Desirée and Altamash were screened for their response
on different regeneration media. Six callus induction and shoot induction media (CIM
and SIM respectively) while three root induction media (RIM) reported earlier, having
different types and combinations of plant growth hormones for tissue culture of potato
were evaluated in an attempt to select the best combination of callus, shoot and root
induction media.
3.1.1 Callus induction
Six different callus induction media (CIM1-6) reported earlier for potato tissue
culture were formulated to produce highest number of embryogenic calli in least
number of days by selecting the best suitable combination of plant growth hormones
for callogenesis. Callus induction response from three explant types i.e. internodal
segments, leaf strips and discs from microtubers, was noticed in all the six CIM
tested, but there was a wide range of variation in percentage of callus formation and
days to initiate callus. The data of number of days to form callus was taken when 50%
of the explants induced calli while the percentage callus formation was considered on
the basis of observations after eight weeks. It was established after great deal of
experimentation that the potential of callus production varied with cultivar, explant
origin and growth medium.
3.1.1.1 Effect of medium on callogenesis
The callus induction percentage for each CIM has been calculated as an
average value of all the callus induction percentages of three different explant types
from three potato cultivars. It was evident that all the six callus induction media
initiated prolific calli but the CIM3 proved exceptionally good giving highest
response of callus induction (69.13%). The percentage callogenesis on CIM5
remained 59.69% while the reasonable callus formation percentages of 58.58% and
55.07% were noted on CIM4 and CIM1 respectively. Furthermore, callus formation
72
was also more than 50% on CIM2 where the callus initiation was 53.95% whereas,
the least percentage of callus induction was recorded on CIM6 (49.26%). The callus
induction was seen on CIM3 in the minimum number of days (20-23) while 24-29
days were used by CIM1, CIM2 and CIM4 to initiate callus. The slowest response for
callus formation was observed in 30-35 days on CIM5 and CIM6 (Fig 3.1).
0
20
40
60
80
CIM1 CIM2 CIM3 CIM4 CIM5 CIM6
Callus Induction Media
Days to Callus Formation Percentage Callus Formation
B cBc aC Ab db AB
Fig 3.1: Effect of media on callogenesis
Each value is the mean of three replicates. Any two means having a common alphabet are not significantly different at p = 0.05 using LSD. Vertical bar represents the standard error of the 3 means.
3.1.1.2 Effect of cultivar on callogenesis
The callus induction percentage for each potato cultivar has been calculated as
an average value of all the callus induction percentages from the three explant types
on six different callus induction media. The callus initiation response was not very
different among the cultivars and varied insignificantly between 56 and 59%. The
highest callogenesis was recorded for Altamash producing 58.48% calli in 26-29
days. Almost a similar number of calli (57.81%) were observed for Diamant utilizing
maximum number of days (27-30) for callus initiation. The explants from Desirée
took least number of days (24-26) yielding 56.54% calli (Fig 3.2).
73
0
20
40
60
80
Diamant Desiree Altamash
Potato cultivars
Days to Callus Formation Percentage Callus Formation
aBaCaA
Fig 3.2: Callus formation in different cultivars
Each value is the mean of three replicates. Any two means having a common alphabet are not significantly different at p = 0.05 using LSD. Vertical bar represents the standard error of the 3 means.
3.1.1.3 Effect of explant on callogenesis
The callus induction percentage for each explant type has been calculated as
an average value of all the callus induction percentages from three different cultivars
on six different callus induction media. The explants from internodal segments and
leaf strips had a higher potential for callus formation, while explants from the
microtuber discs were less efficient for production of calli (Fig 3.3). The percentages
of callus formation from internodal and leaf explants were almost same and found to
be 69.23% and 67.28% respectively. The calli from internodal explants were formed
in 18-20 days while leaf explants took 24-26 days for callus production. The discs
from microtubers proved to be the explant taking maximum time of 35-38 days and
showed minimum number of calli (36.32%).
0
20
40
60
80
Tuber Leaf Internode
Explant Type
Days to Callus Formation Percentage Callus Formation
aCaBbA
Fig 3.3: Callus formation in different explant types
Each value is the mean of three replicates. Any two means having a common alphabet are not significantly different at p = 0.05 using LSD. Vertical bar represents the standard error of the 3 means.
74
3.1.1.4 Effect of interaction among callus induction medium, cultivar and explant
type on percentage callus induction
The callus induction response was noticed in all the different combination of
media, cultivars and explants but with variations in percentage when any of the three
parameters was changed (Fig 3.4). Maximum percentage of callus formation
(96.11%) was observed in internodal segments of Desirée on CIM3 followed by the
same explant of Diamant (89.99%) and Altamash (88.89 %). Internodal segments of
Desirée, Diamant and Altamash when cultured on CIM6 produced the least number of
calli i.e. 55.55%, 56.66% and 57.22% respectively. When leaf strips of Altamash as
explants were used maximum callus production efficiency of 73.89% was seen on
CIM1 followed by leaf strips of Diamant (73.33%) on CIM2 and Desirée (71.10%) on
CIM4. Least values of callus formation from leaf strip were observed on CIM6
(59.44%) for Diamant, CIM2 (60.55%) for Desirée and 62.77% for Altamash on
CIM2. Among all the explant types, tuber discs proved to have the lowest potential of
callus formation on all the media used. Maximum percentages of 51.11%, 47.78%
and 44.44% were recorded in Altamash, Diamant and Desirée respectively, on CIM3
from the microtuber discs. The poorest response of callus initiation was observed
when Desirée produced 28.33% calli on CIM1 whereas; Diamant and Altamash
formed 29.44% and 30.55 % calli on CIM6 from the microtuber explants (Table 3.1;
Fig 3.4).
In conclusion, internodes of Desirée proved to have a higher potential for
callus formation on CIM3 and hence all these three in combination were used for
callus induction in succeeding experiments.
75
Table 3.1: Effect of interaction among callus induction medium, cultivar and explant type on percentage callus induction
Cultivar Media Tuber Discs Leaf Strips Internodal Segments
CIM1 36.11 ±2.78 64.44 ±3.09 66.22 ±3.47
CIM2 32.77 ±2.42 73.33 ±4.41 64.44 ±1.47
CIM3 47.78 ±1.47 64.99 ±5.09 89.99 ±3.85
CIM4 35.55 ±2.22 67.77 ±7.47 68.33 ±0.96
CIM5 43.88 ±1.47 68.88 ±3.64 70.55 ±2.78
CIM6 29.44 ±2.42 59.44 ±2.94 56.66 ±4.19
CIM1 28.33 ±2.55 68.33 ±4.19 61.66 ±3.47
CIM2 29.44 ±2.42 60.55 ±1.11 62.22 ±2.78
CIM3 44.44 ±3.89 70.55 ±2.22 96.11 ±1.47
CIM4 29.44 ±2.42 71.1 ±1.47 70.55 ±1.47
CIM5 40.55 ±2.94 69.44 ±3.09 68.33 ±2.55
CIM6 28.89 ±2.42 62.22 ±2.01 55.55 ±3.78
CIM1 31.66 ±3.47 73.89 ±4.55 64.99 ±0.96
CIM2 34.99 ±3.47 62.77 ±2.94 65.00 ±2.88
CIM3 51.11 ±3.09 68.33 ±1.92 88.89 ±2.00
CIM4 44.44 ±1.47 69.99 ±2.54 69.99 ±2.54
CIM5 34.44 ±2.94 71.66 ±3.85 69.44 ±0.56
CIM6 30.55 ±2.78 63.33 ±2.55 57.22 ±3.64
Each value is the mean of three replicates.
DIAMANT
DESIRÉE
ALTAMASH
76
0102030405060708090100
CIM
1C
IM2
CIM
3C
IM4
CIM
5C
IM6
CIM
1C
IM2
CIM
3C
IM4
CIM
5C
IM6
CIM
1C
IM2
CIM
3C
IM4
CIM
5C
IM6
Dia
man
tD
esire
eA
ltam
ash
Percentage Callus InductionT
uber
Dis
csLe
af D
iscs
Inte
rnod
al s
egm
ents
Fig 3.4: Effect of interaction among callus induction medium, cultivar and explant type on percentage callus induction
Eac
h va
lue
is th
e m
ean
of th
ree
repl
icat
es. V
ertic
al b
ar re
pres
ents
the
stan
dard
err
or o
f the
3 m
eans
.
77
3.1.1.5 Effect of interaction among callus induction medium, cultivar and explant
type on number of days to form callus
A wide range of response was recorded from three types of explants of
different cultivars on six different callus induction media for the number of days to
produce calli. Internodal segments of Desirée utilized minimum number of days
(11.33) to initiate calli on CIM4 while 12.67 days were taken to produce calli from
internodes of Diamant, Desirée and Altamash on CIM4, CIM3 and CIM5
respectively. Maximum number of days was taken by internodal segments of Diamant
(30.33 days) on CIM5, Altamash (30 days) on CIM4 and Desirée (28.33 days) on
CIM5. In case of leaf strips an average minimum number of 15.33 and 17.67 days
were taken by Desirée and Altamash on CIM1 while Diamant took 18.33 days on
CIM2 respectively, to produce calli. The maximum number of 38.67 days was
recorded for callus formation from leaf strips of Altamash on CIM4 whereas,
Diamant and Desirée initiated calli in 38.00 and 37.33 days respectively, on CIM5.
Tuber discs proved less efficient in producing calli on all the tested media. A
minimum of 26.33 and 28.33 days were observed for Altamash and Diamant on
CIM3 while Desirée took 27 and 28.67 days to produce calli from tuber discs on
CIM3 and CIM4 respectively. The tuber discs of Diamant, Altamash and Desirée on
CIM6 were found to produce calli taking a maximum time of 49.67, 48 and 44.67
days. Explants of tubers of all the cultivars also showed very slow response on CIM1
and CIM5 (Table 3.2; Fig 3.5).
In conclusion, internodes of Desirée initiated calli in 11.33 days on CIM4 and
12.67 days on CIM3, but those formed on CIM3 were 25% higher in number when
compared with those on CIM4. The difference in the above mentioned days was
insignificant therefore; the internodes from Desirée were cultured on CIM3 for callus
production.
78
Table 3.2: Effect of interaction among callus induction medium, cultivar and explant type on number of days to form callus
Media Tuber Discs Leaf Strips Internodal Segments
CIM1 33.00 ±1.15 GHI 34.00 ±2.08 FGH 19.00 ±1.53 STUVWX
CIM2 47.0 ±1.53 AB 18.33 ±2.33 TUVWX 18.00 ±1.15 TUVWXY
CIM3 28.33 ±0.88 IJKLMN 26.00 ±2.08 LMNOPQ 19.00 ±2.65 STUVWX
CIM4 30.67 ±1.45 HIJKL 22.00 ±1.73 PQRSTU 12.67 ±0.88 Z[
CIM5 40.33 ±1.20 CDE 38.00 ±1.53 DEFG 30.33 ±1.20 HIJKL
CIM6 49.67 ±2.91 A 25.00 ±1.53 MNOPQR 26.33 ±1.20 KLMNOPQ
CIM1 43.00 ±2.08 BCD 15.33 ±0.88 XYZ[ 16.33 ±1.20 VWXYZ[
CIM2 32.00 ±2.08 HIJ 26.67 ±2.03 KLMNOP 15.67 ±1.20 WXYZ[
CIM3 27.00 ±1.00 JKLMNOP 24.00 ±2.08 NOPQRS 12.67 ±0.88 Z[
CIM4 28.67 ±1.20 IJKLMN 21.33 ±2.33 QRSTUV 11.33 ±1.45 [
CIM5 41.00 ±1.73 CDE 37.33 ±2.33 EFG 28.33 ±2.02 IJKLMN
CIM6 44.67 ±2.60 ABC 20.67 ±0.67 RSTUVW 26.67 ±1.45 KLMNOP
CIM1 45.00 ±3.21 ABC 17.67 ±2.33 UVWXYZ 18.67 ±0.67 TUVWX
CIM2 31.33 ±2.73 HIJK 27.67 ±2.91 JKLMNO 16.33 ±1.20 VWXYZ[
CIM3 26.33 ±1.20 KLMNOPQ 26.33 ±1.20 KLMNOPQ 13.00 ±1.00 YZ[
CIM4 40.33 ±1.20 CDE 38.67 ±1.20 DEF 30.00 ±1.15 HIJKLM
CIM5 30.67 ±1.45 HIJKL 22.00 ±1.73 PQRSTU 12.67 ±0.88 Z[
CIM6 48.00 ±1.53 AB 23.00 ±2.08 OPQRST 24.00 ±1.73 NOPQRS
Each value is the mean of three replicates. Any two means having a common alphabet are not significantly different at p = 0.05 using LSD.
DIAMANT
DESIRÉE
ALTAMASH
79
01020304050
CIM
1C
IM2
CIM
3C
IM4
CIM
5C
IM6
CIM
1C
IM2
CIM
3C
IM4
CIM
5C
IM6
CIM
1C
IM2
CIM
3C
IM4
CIM
5C
IM6
Dia
man
tD
esire
eA
ltam
ash
Days for Callus Induction
Tub
er D
isc
Leaf
Dis
cIn
tern
odal
Seg
men
ts
Fig 3.5: Effect of interaction among callus induction medium, cultivar and explant type on number of days to form callus
Eac
h va
lue
is th
e m
ean
of th
ree
repl
icat
es. V
ertic
al b
ar re
pres
ents
the
stan
dard
err
or o
f the
3 m
eans
.
80
3.1.2 Shoot induction
Experiments were conducted to investigate the ability of calli from different
explants sources (internodal segments and leaf strips) to develop shoots. The calli
from microtuber discs were not used in these experiments for their incalcitrant
behavior, slow response and lower percentage. In these experiments screening of
Solanum tuberosum cultivars (Diamant, Desirée and Altamash) were performed using
six shoot induction media (SIM1, SIM2, SIM3, SIM4, SIM5 and SIM6) either with
calli from leaf strips or internodal segments. It was revealed that the shooting
percentage, from calli previously produced on callus induction media, altered with
explant origin, cultivar and growth media. Keeping in view the percentage of shoot
forming calli and days to shoot initiation, one simple but efficient shoot induction
medium was selected finally from all the six media for final experiments. The
percentage shoot formation was calculated after eight weeks of observation whereas
the number of days to form shoot was recorded when half of the calli induced shoots.
3.1.2.1 Effect of medium on shoot induction
The shoot induction percentage for each SIM has been calculated as an
average value of all the shoot induction percentages of two different explant types
from three potato cultivars. A 76.29% shooting was obtained on SIM3 which was
highest among all the media tested. The shooting percentage on all the other media
remained 63.15% (SIM1), 62.02% (SIM2), 66.31% (SIM4), 65.18% (SIM5) and
63.70% (SIM6). When all the media were compared for number of days to form
shoot, it was seen that the calli formed shoots in minimum number of days (27.22) on
SIM3 and this was followed by SIM6 on which the number of days remained 32.67.
The calli on SIM4 and SIM5 were formed in 35.56 and 36.83 days respectively. The
shoots from calli on SIM2 and SIM1 responded at the end taking 38.67 and 40.50
days respectively (Fig 3.6).
81
0
20
40
60
80
SIM1 SIM2 SIM3 SIM4 SIM5 SIM6
Shoot Induction Media
Days to Shoot Init iat ion Percentage Shoot Forming Calli
DCCaEcBbcA
bc
bc
bc
Fig 3.6: Effect of media on shoot induction Each value is the mean of three replicates. Any two means having a common alphabet are not
significantly different at p = 0.05 using LSD. Vertical bar represents the standard error of the 3 means.
3.1.2.2 Effect of cultivar on shoot induction
The shoot induction percentage for each potato cultivar has been calculated as
an average value of all the shoot induction percentages from two explant types on six
different shoot induction media. When the three varieties of potato were compared for
percentage shoot formation and number of days for shoot initiation, it was seen that
Desirée gave shooting percentage of 68.79% in 32.58 days. The calli of Diamant
formed 64.81% shoots in 35.31 days followed by a similar percentage of Altamash
which produced 64.80% shoots in 37.83 days (Fig 3.7).
0
20
40
60
80
Diamant Desiree Altamash
Potato Genotypes
Days to Shoot Initiation Percentage Shoot Forming Calli
bab ACB
Fig 3.7: Shoot induction in different cultivars
Each value is the mean of three replicates. Any two means having a common alphabet are not significantly different at p = 0.05 using LSD. Vertical bar represents the standard error of the 3 means.
82
3.1.2.3 Effect of explant on shoot induction
The shoot induction percentage for each explant type has been calculated as an
average value of all the shoot induction percentages from three different cultivars on
six different shoot induction media. It was observed that the shoots from internodal
calli were formed in 33.91 days and their percentage was much higher (71.10%),
whereas, the calli from leaf explants produced 61.17% shoots in 36.57 days (Fig 3.8).
It was clear that the shooting percentage from internodal calli was better and required
shorter time when compared with the calli of leaf explants which produced shoots in
lower percentage taking more number of days.
0
20
40
60
80
Internode Leaf
Explant Type
Days to Shoot Initiation Percentage Shoot Forming Calli
baB A
Fig 3.8: Shoot induction from different explant types Each value is the mean of three replicates. Any two means having a common alphabet are not
significantly different at p = 0.05 using LSD. Vertical bar represents the standard error of the 3 means.
3.1.2.4 Effect of interaction among shoot induction medium, cultivar and explant
type on percentage shoot induction
The highest percentage of shooting was observed from the internodal calli
(95.55%) of Desirée followed by the internodal calli of Diamant (82.22%) and
Altamash (79.99%) on SIM3. The percentage shooting from internodal calli of
Diamant, Desirée and Altamash on SIM1 remained 76.66%, 71.1% and 58.88%
respectively. The calli of internodes on SIM2 produced 57.77%, 67.77% and 71.11%
shoots from Diamant, Desirée and Altamash. The percentages of 67.77%, 75.55% and
68.88% were recorded from the internodal calli of Diamant, Desirée and Altamash on
SIM4. The callus from the internodes on SIM5 produced 68.88% (Diamant and
Altamash) and 65.55% (Desirée) shoots. The percentages of shooting induction on
83
SIM6 from the internodal calli remained 66.66% (Diamant), 67.77% (Desirée) and
68.88% (Altamash).
When the three varieties were compared for shoot formation from the leaf strip
calli, it was found that Desirée produced maximum shooting (74.44%) on SIM3. A
percentage shooting of 68.88% was recorded on SIM5 from the explants of Desirée.
The shooting percentage on SIM4 and SIM6 remained 64.44% and 63.33% from the
leaf explants of Desirée. The leaf explants of Desirée produced 59.99% shoots on
SIM1 whereas, the least number of shooting calli from leaf explants was recorded on
SIM2 (50.99%). Not much variation was seen among the results when shoot
formation from the calli of leaf explants in Diamant were compared for the six shoot
induction media. The highest percentage of 63.33% was recorded on SIM3 and SIM4
followed by SIM2 and SIM6 (61.11% each). The least number of shoot producing
calli from leaf strips of Diamant were recorded on SIM2 and SIM5 (54.44% each).
The percentage of shooting from the calli of leaf explants of Altamash also remained
low on all the six shoot induction media. A highest percentage of 64.44% was
recorded on SIM5 while the lowest percentage was found to be 54.44% on SIM6. The
percentage shoot induction on SIM2 and SIM3 remained 63.32% and 62.21%
respectively. A percentage of 57.77% (SIM1) and 58.88% (SIM4) were recorded for
shoot inducing calli of leaf strips of Altamash (Table 3.3; Fig 3.9).
In conclusion, internodal calli of Desirée proved to have a higher potential for
shoot induction on SIM3 and hence used in later experiments.
Table 3.3: Effect of interaction among shoot induction medium, cultivar and explant type on percentage shoot induction
Cultivar Media Leaf Strips Internodal Segments
SIM1 54.44 ±4.00 76.66 ±1.92
SIM2 61.1 ±2.93 57.77 ±2.22
SIM3 63.33 ±5.02 82.22 ±1.11
SIM4 63.33 ±3.33 67.77 ±2.22
SIM5 54.44 ±2.93 68.88 ±4.84
SIM6 61.11 ±4.84 66.66 ±5.09
SIM1 59.99 ±3.84 71.1 ±2.93
SIM2 50.99 ±3.02 67.77 ±1.11
SIM3 74.44 ±2.22 95.55 ±1.11
SIM4 64.44 ±5.87 75.55 ±4.00
SIM5 68.88 ±7.77 65.55 ±4.84
SIM6 63.33 ±3.85 67.77 ±1.11
SIM1 57.77 ±4.00 58.88 ±1.11
SIM2 63.32 ±6.66 71.11 ±4.84
SIM3 62.21 ±2.93 79.99 ±1.92
SIM4 58.88 ±6.76 68.88 ±6.18
SIM5 64.44 ±2.93 68.88 ±4.00
DIAMANT
DESIRÉE
ALTAMASH
84
SIM6 54.44 ±2.93 68.88 ±4.00
Each value is the mean of three replicates.
85
0102030405060708090100
SIM
1SI
M2
SIM
3SI
M4
SIM
5SI
M6
SIM
1SI
M2
SIM
3SI
M4
SIM
5SI
M6
SIM
1SI
M2
SIM
3SI
M4
SIM
5SI
M6
Dia
man
tD
esire
eA
ltam
ash
Percentage Shoot InductionLe
af D
isc
Inte
rnod
al s
egm
ents
Fig 3.9: Effect of interaction among shoot induction medium, cultivar and explant type on percentage shoot induction
Eac
h va
lue
is th
e m
ean
of th
ree
repl
icat
es. V
ertic
al b
ar r
epre
sent
s th
e st
anda
rd e
rror
of t
he 3
mea
ns.
86
3.1.2.5 Effect of interaction among shoot induction medium, cultivar and explant
type on number of days to shoot induction
When the calli from internodal explants were compared for shoot induction, it
was seen that all the three varieties responded to SIM3 in minimum number of days.
The calli of Desirée produced shooting in 20.33 days followed by Diamant (25 days)
and Altamash (26 days) on SIM3 which proved to be an excellent medium for shoot
induction. The calli of internodes induced shooting in 49.33 days (Altamash), 47.33
days (Desirée) and 40.66 days (Diamant) on SIM1 proving to be the least responsive
media for internodal explants of all the varieties. SIM2 was also not different from
SIM1 producing shoots from internodes in 40 days (Diamant), 38 days (Desirée) and
43 days (Altamash). The internodal explants of Altamash took 34.66 days to initiate
shooting followed by Diamant (31.66 days) and Desirée (30.33 days) on SIM4. The
shoots were initiated on SIM5 in 35 days (Altamash), 33 days (Diamant) and 28.33
days (Desirée) from the explants of the internodes. SIM6 remained the second best
option for shoot initiation from internodal explants of Desirée as it took only 24.33
days, whereas, 30.66 and 32.66 days were utilized for shoot formation in Diamant and
Altamash respectively, on this media from the same explants.
The calli of leaf strips when compared with internodal explants showed slower
response for shooting on all the media. The leaf explants of Altamash was the slowest
in shoot formation on SIM5 taking 47.33 days followed by Diamant (42.66 days),
while these explants of Desirée initiated shooting in 34.66 days on the same medium.
SIM3 again remained the best medium for the leaf calli of the three varieties
producing shoots in 26.66 days (Desirée) and 32.66 days (Diamant and Altamash).
The explants of leaf strips of Desirée produced shoots in 33.33 days followed by
35.33 days (Diamant) and 37 days (Altamash) on SIM1. The response of explants
from the three varieties was almost similar on SIM2 and SIM4 forming shoots in 36-
40 days. The number of days for shooting on SIM6 remained 36, 33 and 39.33 for
Diamant, Desirée and Altamash respectively (Table 3.4; Fig 3.10).
In conclusion, internodal calli of Desirée induced maximum number of shoots
in 20.33 days on SIM3; hence, this medium was used for shoot induction from
internodal calli of Desirée in the subsequent experiments.
87
Table 3.4: Effect of interaction among shoot induction medium, cultivar and explant type on number of days to shoot induction
Cultivar Media Leaf Strips Internodal Segments
SIM1 35.33 ±0.33 GHIJ 40.66 ±0.88 BCD
SIM2 37.66 ±1.76 DEFGHI 40.00 ±1.52 BCDE
SIM3 32.66 ±1.20 JKL 25.00 ±1.00 NO
SIM4 38.33 ±1.76 DEFGH 31.66 ±1.45 KLM
SIM5 42.66 ±1.33 BC 33.00 ±1.15 JKL
SIM6 36.00 ±1.00 FGHIJ 30.66 ±1.20 LM
SIM1 33.33 ±1.45 JKL 47.33 ±0.88 A
SIM2 36.00 ±1.52 FGHIJ 38.00 ±1.73 DEFGHI
SIM3 26.66 ±1.20 NO 20.33 ±1.20 P
SIM4 38.66 ±0.88 DEFG 30.33 ±1.45 LM
SIM5 34.66 ±1.66 IJK 28.33 ±1.20 MN
SIM6 33.00 ±1.52 JKL 24.33 ±1.45 O
SIM1 37.00 ±0.57 EFGHI 49.33 ±1.20 A
SIM2 37.33 ±1.66 DEFGHI 43.00 ±1.52 B
SIM3 32.66 ±0.88 JKL 26.00 ±1.52 NO
SIM4 39.66 ±1.45 BCDE 34.66 ±0.88 IJK
SIM5 47.33 ±0.66 A 35.00 ±1.15 HIJK
SIM6 39.33 ±0.66 CDEF 32.66 ±0.66 JKL
Each value is the mean of three replicates. Any two means having a common alphabet are not significantly different at p = 0.05 using LSD.
DIAMANT
DESIRÉE
ALTAMASH
88
01020304050
SIM
1SI
M2
SIM
3SI
M4
SIM
5SI
M6
SIM
1SI
M2
SIM
3SI
M4
SIM
5SI
M6
SIM
1SI
M2
SIM
3SI
M4
SIM
5SI
M6
Dia
man
tD
esire
eA
ltam
ash
Days for Shoot Induction
Leaf
dis
cin
tern
odal
seg
men
ts
Fig 3.10: Effect of interaction among shoot induction medium, cultivar and explant type on number of days to shoot induction
Eac
h va
lue
is th
e m
ean
of th
ree
repl
icat
es. V
ertic
al b
ar re
pres
ents
the
stan
dard
err
or o
f the
3 m
eans
.
89
3.1.3 Root induction
The well developed elongated shoots of each variety were excised from the
callus and cultured on three different Root Induction Media (RIM) to induce rooting
for two weeks. The rooting was achieved in all the three varieties and on all the three
media, and the days to root initiation, root length and number of roots per plant was
recorded. The experiment was repeated three times. The number of days to initiate
root was noted when root primordia was induced in 50% shoots though number of
roots and root length were recorded after two weeks of transferring the shoots to
rooting media.
3.1.3.1 Effect of media on root induction
The data for number of roots, root length and number of days for root
induction on each RIM has been calculated as an average value from three potato
cultivars. It was evident that all the three media significantly differed from each other
in terms of number of roots, length of roots and number of days to root formation.
Results showed that the mean number of roots per regenerated shoots was 12.78 on
RIM2 whereas; root number was 11.23 on RIM3 followed by 8.31 on RIM1. RIM2
increased the root length to 4.37 cm in two weeks while the root length on RIM3
remained 4.00 cm followed by 2.80 cm on RIM1. The shoots on RIM2 took minimum
number of days (5.85) to form root primordia on RIM2. The roots were initiated in
6.52 days on RIM3, while 8.41 days were taken on RIM1 for root production (Fig
3.11).
0
2
4
6
8
10
12
14
RIM1 RIM2 RIM3
Root Induction Media
Days to Root Init iat ion Root Length Number of Roots per Plantlet
βαγ bac BBA
,
Fig 3.11: Effect of media on root induction
Each value is the mean of three replicates. Any two means having a common alphabet are not significantly different at p = 0.05 using LSD. Vertical bar represents the standard error of the 3 means.
90
3.1.3.2 Effect of cultivar on root induction
The data for number of roots, root length and number of days for root
induction for each cultivar has been calculated as an average value from three
different root induction media. All the three varieties did not vary significantly from
each other in days taken to initiate rooting, root length and number of roots per
plantlet. The maximum number of days (7.32) taken to form rooting primordia was
observed in Desirée, which was followed by Altamash (6.88 days) and Diamant (6.57
days). The mean root length of the three varieties remained 3.60 cm (Diamant), 3.78
cm (Altamash) and 3.79 cm (Desirée). The difference in average number of roots of
the three varieties was also not significant and remained 11.02 roots for Desirée,
10.75 for Diamant and 10.55 for Altamash (Fig 3.12).
0
2
4
6
8
10
12
14
Diamant Desiree AltamashPotato Cultivars
Days to Root Initiation Root Length (cm) Number of Roots per Plantlet
Fig 3.12: Root formation in different cultivars Each value is the mean of three replicates. Values not significantly different at p = 0.05 using LSD.
Vertical bar represents the standard error of the 3 means.
3.1.3.3 Effect of interaction between medium and cultivar on initiation time,
length and number of roots
The interaction between root induction media and cultivars was non
significant as all the three varieties behaved similarly on each medium. Shoots from
Diamant took minimum days on RIM2 (5.51) for root induction while the maximum
days noted for this variety remained 8.06 on RIM1. A similar pattern was recorded for
Desirée as the roots were produced on RIM2 in minimum number of days (6.49)
while 8.18 days were taken by this variety for rooting on RIM1. The same response of
Altamash was observed on RIM2 (5.54) and RIM1 (9) for number of days to root
91
initiation. The number of days taken by Diamant, Desirée and Altamash were 6.14,
7.3 and 6.11 respectively, on RIM3 (Fig 3.13).
0
2
4
6
8
10
12
RIM1 RIM2 RIM3
Root Induction Media
Num
ber o
f day
s
Diamant Desiree Altamash
Fig 3.13: Effect of interaction between medium and cultivar on
days to root initiation Each value is the mean of three replicates. Values not significantly different at p = 0.05 using LSD.
Vertical bar represents the standard error of the 3 means.
The interaction of medium and variety was insignificant for root length.
Maximum root length was observed on RIM2 in all the three varieties viz. Diamant
(4.18 cm), Desirée (4.4 cm) and Altamash (4.52 cm). A similar pattern was recorded
for RIM1 in which the minimum lengths of 2.71 cm (Diamant), 2.81 cm (Desirée) and
2.87 cm (Altamash) were recorded (Fig 3.14). The length of the roots on RIM3
remained almost between the lengths noted for RIM1 and RIM2, for the three
cultivars.
0
1
2
3
4
5
RIM1 RIM2 RIM3
Root Induction Media
Roo
t len
gth
(cm
)
Diamant Desiree Altamash
Fig 3.14: Effect of interaction between medium and cultivar on root length
Each value is the mean of three replicates. Values not significantly different at p = 0.05 using LSD. Vertical bar represents the standard error of the 3 means.
92
The values for interaction between media and varieties differed insignificantly
for number of roots produced. The maximum number of roots was recorded on RIM2
(12-14) followed by RIM3 (10-12) and the minimum number was produced on RIM1
(7-9), in all the three varieties. The maximum number of 13.14 roots was noted in
Desirée on RIM2 while 8.46 was the minimum number in Diamant on RIM1 (Fig
3.15).
0
5
10
15
RIM1 RIM2 RIM3
Root Induction Media
Num
ber o
f roo
ts
Diamant Desiree Altamash
Fig 3.15: Effect of interaction between medium and cultivar on
number of roots per plant Each value is the mean of three replicates. Values not significantly different at p = 0.05 using LSD.
Vertical bar represents the standard error of the 3 means.
3.1.4 Plant acclimatization
Finally, in vitro regenerated Solanum tuberosum L. (cultivar Desirée)
elongated plantlets with well developed root system (Fig 3.16 A-D) were transplanted
in pots containing compost. Plants were raised in a green house after being transferred
to soil and most plants were grown to maturity (Fig 3.17).
93
A B
C D
Fig 3.16: Different stages of in-vitro culture of potato cultivar Desirée
A. Internodal explants B. Callus induction C. Shoot induction D. Root induction
Fig 3.17: Acclimatization of potato (Desirée) plants
94
3.2 Optimization of transformation through biolistic gun
A range of factors affecting the efficient transfer of DNA through biolistic gun
were optimized to increase the transformation efficiency and minimize the damage of
explants. The plasmid p35SGUSint containing gus gene driven by the CaMV 35S
promoter was used as a reporter marker to study the transient gus expression.
Parameters like different Helium pressures for microcarrier acceleration (900, 1100
and 1350 psi), distances between target plate carrying explants and macrocarrier
assembly (6 and 9 cm) and particles sizes of gold microcarriers (0.6 and 1.0 µm) were
optimized on the basis of percentage transient gus expression and compared for the
two type of explants (internodes and leaf strips). A protocol for Biolistic gene transfer
was developed for the production of transgenic potato plants by optimizing the
different parameters.
3.2.1 Effect of helium pressure on transient gus expression
Three different pressures of Helium gas i.e. 900, 1100 and 1350 psi were used
to accelerate the gold microcarriers coated with plasmid DNA for transformation. A
helium pressure of 1100 psi showed the highest gus expression in which 47.73%
explants were positive for transient gus expression. The percentage of explants giving
transient gus expression dropped to 23.72% when the helium pressure was increased
to 1350 psi and this percentage is almost half of the value recorded at 1100 psi. The
lowest percentage of gus expressing tissues (14.76%) was noted when the helium
pressure of 900 psi was used for accelerating the gold particles (Fig 3.18).
0
10
20
30
40
50
60
900 psi 1100 psi 1350 psiHelium Pressure
Perc
enta
ge T
rans
ient
gu
s E
xpre
ssio
n
bac
Fig 3.18: Effect of helium pressure on transient gus expression Each value is the mean of three replicates. Any two means having a common alphabet are not
significantly different at p = 0.05 using LSD. Vertical bar represents the standard error of the 3 means.
95
3.2.2 Effect of target distance on transient gus expression
The explants were bombarded by keeping them at two different distances (6
and 9 cm) from the macrocarrier assembly. The percentage of explants showing
transient gus expression remained 31.86% when they were kept at a distance of 6 cm
while this percentage dropped to 25.62% when the distance of target explants from
the macrocarrier assembly was increased to 9 cm (Fig 3.19).
0
10
20
30
40
6 cm 9 cm Target Distance
Perc
enta
ge T
rans
ient
gu
s E
xpre
ssio
n
ba
Fig 3.19: Effect of target distance on transient gus expression Each value is the mean of three replicates. Any two means having a common alphabet are not
significantly different at p = 0.05 using LSD. Vertical bar represents the standard error of the 3 means.
3.2.3 Effect of particle size on transient gus expression
Two different sizes of gold microcarriers (0.6 and 1.0 µm) coated with
plasmid DNA were used for studying the effect of particle size on transient gus
expression (Fig 3.20). When the explants were exposed to 1.0 µm accelerating gold
microcarriers, 36.49% explants were found to be positive for transient gus expression.
The percentage transient gus dropped to 20.99% when 0.6 µm size gold particles were
used as microprojectiles.
0
10
20
30
40
50
0.6 um 1.0 umParticle Size
Perc
enta
ge T
rans
ient
gu
s E
xpre
ssio
n
ab
Fig 3.20: Effect of particle size on transient gus expression Each value is the mean of three replicates. Any two means having a common alphabet are not
significantly different at p = 0.05 using LSD. Vertical bar represents the standard error of the 3 means.
96
3.2.4 Effect of explant type on transient gus expression
The best suited explant type for Biolistic transformation was compared
through transient gus expression in internodes and leaf strips. The higher percentages
of histochemical gus activity (31.67%) was observed in the internodal explants while
the leaf strips showed only 25.81% transient gus expression when exposed to particle
bombardment (Fig 3.21 and 3.22).
0
10
20
30
40
Internode LeafExplant Type
Perc
enta
ge T
rans
ient
gu
s E
xpre
ssio
n
a b
Fig 3.21: Effect of explant type on transient gus expression Each value is the mean of three replicates. Any two means having a common alphabet are not
significantly different at p = 0.05 using LSD. Vertical bar represents the standard error of the 3 means.
Fig 3.22: Transient gus expression in internodal segments through Biolistic Gun
3.2.5 Effect of interaction among helium pressure, target distance, particle size
and explant type on transient gus expression
It was seen that the percentage transient gus expression increased with
increasing the helium pressure from 900 to 1100 psi independent of other parameters,
but this percentage was dropped if the pressure was further increased to 1350 psi. As
far as the target distance is concerned, increasing target distance from 6 cm to 9 cm
decreased the overall transient gus expression in all the treatments irrespective of
97
particle size and helium pressure. The maximum percentage transient gus expression
always resulted when the microcarriers of 1.0 µm were used despite of the helium
pressure and target distance. Moreover, internodes proved to be the better explant type
when compared with the leaf strips as the percentage transient gus expression always
remained higher in internodes regardless of the combination of different parameters.
When the helium pressure of 900 psi was maintained, the maximum transient
gus expression of 28.86% was observed in the internodes at a target distance of 6 cm
using 1.0 µm size gold microcarriers whereas, the leaf strips showed 18.87% transient
gus expression for the same set of conditions. Any change in the above set of
conditions decreased the percentage transient gus expression keeping helium pressure
of 900 psi constant. There was an overall increase in the values of transient gus
expression when the helium pressure was increased to 1100 psi and the gus activity
was noted to be a maximum of 79.92% in the internodes kept at a target distance of 6
cm bombarded with 1.0 µm size gold particles. The highest percentage of transient
gus expression (56.63%) in leaf strips was also noted with the same set of conditions.
When all the conditions which gave maximum transient gus expression were kept
constant and the helium pressure was increased from 1100 psi to 1350 psi the
transient gus expression was reduced to almost one half of the percentage recorded at
1100 psi and found to be 43.29% in the internodes and 29.97% in the leaf explants
(Table 3.5; Fig 3.23).
It was seen that increasing the target distance from 6 cm to 9 cm always
decreased the transient gus expression irrespective of particle size and helium
pressure. The histochemical gus activity of internodes and leaf strips which were
bombarded with 1.0 µm gold microcarriers at 1100 psi and 9 cm was more than 20%
lower than those bombarded with the same particles size and helium pressure at 6 cm.
This drop in the percentage transient gus expression at 9 cm target distance was not
compensated by increasing the helium pressure to 1350 psi for accelerating the
microcarriers and recorded to be 33.3% in internodes and 22.21% in leaf strips. The
lowest gus expression percentage of 9.99 and 7.77% was recorded in internodes and
leaf strips respectively, at a target distance of 9 cm, when 900 psi helium pressure and
0.6 µm particle size were used.
98
When the sizes of microcarriers were compared, it was seen that 1.0 µm size
particles gave higher percentage transient gus expression than 0.6 µm particles, in
both the explants. The maximum transient gus expression of 79.92% with 1.0 µm size
particles was dropped to 36.63% when particle size of 0.6 µm was used for
bombardment keeping other parameters constant. The minimum transient gus
expression of 9.99% and 7.77% were seen for internodes and leaf strips respectively,
when 0.6 µm size microcarriers were used (Table 3.5; Fig 3.23).
In conclusion, helium pressure of 1100 psi for acceleration, 6 cm target
distance and 1.0 µm gold particle size was found to be the best combination of
conditions for transforming internodal explants through biolistic gun.
Table 3.5: Effect of interaction among helium pressure, target distance, particle size and explant type on transient gus expression
Helium Pressure Target Distance Particle Size Internodes Leaf Strips
900 psi
6 cm 0.6 µm 13.32 ± 3.85 7.77 ± 2.94
1.0 µm 28.86 ± 4.00 18.87 ± 5.87
9 cm 0.6 µm 9.99 ± 3.85 7.77 ± 4.84
1.0 µm 19.98 ± 5.09 12.21 ± 1.11
1100 psi
6 cm 0.6 µm 36.63 ± 5.09 32.20 ± 4.84
1.0 µm 79.92 ± 5.09 56.63 ± 5.79
9cm 0.6 µm 23.31 ± 3.85 19.98 ± 3.85
1.0 µm 59.94 ± 6.93 33.30 ± 5.09
1350 psi
6 cm 0.6 µm 18.87 ± 4.84 16.65 ± 5.09
1.0 µm 43.29 ± 5.77 29.97 ± 5.09
9 cm 0.6 µm 13.32 ± 3.33 12.21 ± 4.44
1.0 µm 33.30 ± 5.77 22.21 ± 6.76
Each value is the mean of three replicates.
99
0102030405060708090
0.6
µm1.
0 µm
0.6
µm1.
0 µm
0.6
µm1.
0 µm
0.6
µm1.
0 µm
0.6
µm1.
0 µm
0.6
µm1.
0 µm
6 cm
9 cm
6 cm
9cm
6 cm
9 cm
900
psi
1100
psi
1350
psi
Percentage Transient gus Expression
Inte
rnod
esLe
af S
trip
s
Fig 3.23: Effect of interaction among helium pressure, target distance, particle size and explant type on transient
gus
expression
Eac
h va
lue
is th
e m
ean
of th
ree
repl
icat
es. V
ertic
al b
ar re
pres
ents
the
stan
dard
err
or o
f the
3 m
eans
.
100
3.2.6 Effect of osmotic treatment on percentage transient gus expression
The effect of osmotic treatment of internodal explants on transient gus
expression was studied by adding 0.1 M mannitol and 0.1 M sorbitol individually or
in combination in CIM3. Leaf explants were excluded from these experiments as they
exhibited lower gus expression in previous experiments compared with internodal
explants. A pre-treatment of these three osmoticum for 24 hours and a post-treatment
of 24 hours were given to the all explants bombarded in each set of experiment. The
bombardment was performed according to the conditions optimized in the previous
section. The use of 0.1 M mannitol in callus induction medium as osmoticum slightly
enhanced the percentage transient gus expression (78.33%) when compared with the
untreated control explants (76.33%). The expression of the gus gene was reduced to
72.67% when explants were pre- / post-treated for 24 hours with 0.1 M sorbitol. The
percentage transient gus expression (65.33%) was considerably lower as compared to
control when the explants were treated with same concentration of mannitol and
sorbitol in combination (Fig 3.24).
In conclusion, the use of different osmoticum treatments had a little effect on
the internodes as it was seen that the most effective treatment was 0.1 M mannitol
applied for 24 hours prior to bombardment and 24 hours after being bombarded.
However, this treatment was not significantly different from the control explants
which were not given any osmoticum.
0
20
40
60
80
100
Control 0.1 M Mannitol 0.1 M Sorbitol 0.1 M Mannitol+ 0.1 M Sorbitol
Osmotic Treatment
Perc
enta
ge T
rans
ient
gu
s E
xpre
ssio
n
a a b c
Fig 3.24: Effect of osmotic treatment on transient gus expression Each value is the mean of three replicates. Any two means having a common alphabet are not
significantly different at p = 0.05 using LSD. Vertical bar represents the standard error of the 3 means.
101
3.2.7 Effect of osmotic treatment on percentage callus formation
This parameter was optimized to compensate the cell and tissue damage
caused by vacuum pressure created inside bombardment chamber, negative effect of
accelerating helium gas and physical damage of explant during particle penetration.
In order to study the effect of osmotic treatment on percentage callus formation, the
internodal explants were bombarded with the DNA coated 1.0 µm gold particles under
1100 psi helium pressure at a target distance of 6 cm. These explants were kept on
CIM3 containing three different osmoticum i.e. 0.1 M mannitol, 0.1 M sorbitol and
0.1 M Mannitol plus 0.1 M sorbitol, for 24 hour pre- / post-bombardment. Two type
of control explants were used for comparison, one which were bombarded and not
given any treatment of osmoticum while the other control explants kept directly on
CIM3 were neither bombarded not given any osmotic treatment (Fig 3.25).
The best results among the treated explants were achieved when internodes
were placed for 24 hours pre-/ post-bombardment on CIM3 containing 0.1 M
mannitol. In this treatment 34.67% of the explants formed calli whereas, the
bombarded control explants gave only 27.67% calli when kept on CIM3. But these
percentages were far lower than the unbombarded control explants (86.33%) which
were not exposed to gene gun environment and placed directly on the callus induction
medium. A slight decline in the callus formation percentage was seen when 0.1 M
sorbitol was used as osmoticum under same conditions instead of 0.1 M mannitol.
Only 25.67% calli were formed when the osmoticum of 0.1 M sorbitol was applied. A
50% decline in callus formation percentage was noted when a combination of 0.1 M
mannitol plus 0.1 M sorbitol was used instead of 0.1 M mannitol and found to be only
18.33% which is also much lower as compared to the bombarded control explants
(Fig 3.25).
In conclusion, osmoticum treatment resulted only in 7% increase in callus
formation when compared with the bombarded control explants. It was also observed
that the callus formation percentage of these treated and untreated explants after
bombardment did not exceed more than 35% which is much lower in comparison to
the unbombarded control explants. Therefore, biolistic transformation methodology
was not carried forward for further stable transformation experiments as the damage
102
done by the vacuum, helium force and particle penetration to the explants was drastic
and they were partially able to recover from the physical injuries.
0
20
40
60
80
100
Control(unbombarded)
Control(bombarded)
0.1 M Mannitol 0.1 M Sorbitol 0.1 M Mannitol+ 0.1 M Sorbitol
Osmotic Treatments
Perc
enta
ge C
allu
s Fo
rmat
ion
cbcbbca
Fig 3.25: Effect of osmotic treatment on percentage callus formation Each value is the mean of three replicates. Any two means having a common alphabet are not
significantly different at p = 0.05 using LSD. Vertical bar represents the standard error of the 3 means.
3.3 Optimization of Agrobacterium-mediated transformation
An efficient and reliable system for Agrobacterium mediated transformation
was developed for Solanum tuberosum L. (Desirée) through transient gus expression.
Agrobacterium-mediated transient assays were used for the optimization of various
aspects of transformation in the efforts to improve the efficiency of transformation.
Hypervirulent Agrobacterium tumefaciens strain, LBA4404 harboring the
p35SGUSint plasmid containing gus gene driven by the CaMV 35S promoter was
used as a reporter marker to assess and optimize the performance of T-DNA delivery
for the transformation study. The effects of density of bacterial culture (OD), duration
of inoculation time and co-cultivation period on transformation efficiency in leaf and
internodal explants were evaluated. Therefore, by combining the best treatments; an
efficient and reproducible procedure of Agrobacterium-mediated transformation was
developed for the production of transgenic potato plants.
3.3.1 Effect of bacterial density on transient gus expression
Three different values of absorbance i.e. 0.5, 1.0 and 1.5 at OD600 were taken
to select the right bacterial density for inoculation of explants. Percentage transient
gus expression revealed that maximum explants were positive for gus expression at
OD600 value of 1.0 (72.54%) followed OD600 value of 0.5 (60.59%). The lowest
103
percentage of transient gus expression (40.67%) was recorded when the bacterial
density was further increased to OD600 value of 1.5 (Fig 3.26).
0
20
40
60
80
0.5 1 1.5
Bacterial Density (OD600)
Perc
enta
ge T
rans
ient
gu
s E
xpre
ssio
n
bab
Fig 3.26: Effect of bacterial density on transient gus expression Each value is the mean of three replicates. Any two means having a common alphabet are not
significantly different at p = 0.05 using LSD. Vertical bar represents the standard error of the 3 means.
3.3.2 Effect of inoculation time on transient gus expression
The explants were inoculated for two different durations with Agrobacterium
culture. The transient gus expression was noted to be 54.25% when the explants were
kept in Agrobacterium suspension for 15 minutes while the gus expression increased
upto 61.61% after 30 minutes incubation of Agrobacterium culture (Fig 3.27).
0
20
40
60
80
15 mins 30 minsInoculation Time
Perc
enta
ge T
rans
ient
gu
s E
xpre
ssio
n
b a
Fig 3.27: Effect of inoculation time on transient gus expression Each value is the mean of three replicates. Any two means having a common alphabet are not
significantly different at p = 0.05 using LSD. Vertical bar represents the standard error of the 3 means.
104
3.3.3 Effect of co-cultivation period on transient gus expression
The transient gus expression was carried out after three different durations of
co-cultivation. Maximum histochemical gus expression percentage (61.61%) was
observed when the explants were incubated for 48 hours after infection with
Agrobacterium. A slight decrease in percentage of gus expressing tissues (59.65%)
was observed when the co-cultivation time was increased to 72 hours while the least
percentage of gus expression (52.55%) in explants was observed for 24 hours of co-
cultivation time (Fig 3.28).
0
20
40
60
80
24 hrs 48 hrs 72 hrsCo-Cultivation Period
Perc
enta
ge T
rans
ient
gu
s E
xpre
ssio
n
aab
Fig 3.28: Effect of co-cultivation period on transient gus expression Each value is the mean of three replicates. Any two means having a common alphabet are not
significantly different at p = 0.05 using LSD. Vertical bar represents the standard error of the 3 means.
3.3.4 Effect of explant type on transient gus expression
The histochemical gus activity in leaf and internodes was compared through
transient gus expression to select the best explant type for Agrobacterium mediated
transformation. Higher percentages of transient gus expression (65.19%) was
observed in the internodal explants while the leaf strips showed only 50.68% transient
gus expression (Fig 3.29 and 3.30).
105
0
20
40
60
80
Leaf InternodeExplant Type
Perc
enta
ge T
rans
ient
gu
s E
xpre
ssio
nb a
Fig 3.29: Effect of explant type on transient gus expression
Each value is the mean of three replicates. Any two means having a common alphabet are not significantly different at p = 0.05 using LSD. Vertical bar represents the standard error of the 3 means.
A B
Fig 3.30: Agrobacterium-mediated transient gus expression in explants of potato
A. Internodal segments B. Leaf explants
3.3.5 Effect of interaction among bacterial density, inoculation time, co-
cultivation period and explant type on transient gus expression
The interaction of all the four variables was studied on the basis of transient
gus expression in order to select the best combination of bacterial density, inoculation
time and co-cultivation time for maximum transient gus expression in two explant
types. The percentage transient gus expression increased with increasing the bacterial
density from 0.5 to 1.0 (OD600) independent of other parameters, but this percentage
went down if the bacterial density was further increased to 1.5 (OD600). As far as the
inoculation time is concerned, increasing the inoculation time from 15 minutes to 30
106
minutes either increased the transient gus expression at bacterial density of 0.5 and
1.0 (OD600) or this percentage remained unchanged (1.5 OD). The maximum
percentage transient gus expression was seen when the explants were co-cultivated for
48 or 72 hours but at higher bacterial densities (1.5 OD) the results were better at 48
hours of co-cultivation time. Internodes invariably showed the higher percentage
transient gus expression when compared with the leaf strips independent of the other
factors (Table 3.6; Fig 3.31).
When the bacterial density of 0.5 (OD600) was maintained, the maximum
transient gus expression of 87.69% was observed in the internodes with inoculation
time of 30 minutes and co-cultivated for 72 hours while the leaf strips showed 73.28%
transient gus expression for the same set of conditions. Any decrease in the
inoculation or co-cultivation duration decreased the percentage transient gus
expression when this bacterial density was maintained. There was an overall increase
in the percentages of transient gus expression when the bacterial density was
increased to 1.0 (OD600) and the gus activity was noted to be a maximum of 88.80%
in the internodes inoculated for 15 minutes and kept for two days of co-cultivation.
Transient gus expression of 73.28% was also noted in leaf strips with the same set of
conditions. Further increase in either inoculation time or co-cultivation duration
decreased the transient gus expression upto 5%. A sudden decline of 10 to 45%
transient gus expression in both explant types for various combinations of inoculation
and co-cultivation time was recorded when the bacterial density was increased from
1.0 to 1.5 (OD600). This higher bacterial density led to the overgrowth of
Agrobacterium resulting in the loss of viable bacterial count and necrosis of the
explants at later stages (Table 3.6; Fig 3.31).
It was seen that increasing the inoculation time from 15 minutes to 30 minutes
increased the transient gus expression for all the three co-cultivation durations at a
bacterial density of 0.5 (OD600). At OD600 value of 1.0, the percentage transient gus
expression was almost same for both the inoculation time, and the percentages were
recorded to be 88.8% and 87.69% for 15 and 30 minutes respectively. But this
percentage started dropping when the inoculation time was changed from 15 to 30
minutes at a bacterial density of 1.5 (OD600).
107
When the durations of co-cultivation were compared for better percentage gus
expression it was seen that the percentage increased with increasing the co-cultivation
time from 24 to 72 hours at bacterial density of 0.5 (OD600). A maximum percentage
of 87.69% was recorded in internodes after 72 hours of co-cultivation at OD 0.5 for
30 minutes infection. 88.8% and 87.69% transient gus expression was seen in
internodes after 48 hours duration of co-cultivation for 15 and 30 minutes inoculation
time respectively, at OD600 value of 1.0. A lowest value of 37.76% and 27.76%
transient gus expression in internodes and leaf strips respectively were recorded for 72
hours of co-cultivation time and 30 minutes inoculation time at OD 1.5 (Table 3.6).
At lower bacterial density (OD 0.5) transient gus expression is directly
proportional to inoculation time and co-cultivation duration. It was seen that the
percentage transient gus expression was compensated by either increasing the
inoculation time or increasing the co-cultivation time at OD 0.5. At higher bacterial
densities (OD 1.0 and 1.5) inoculation time had almost negligible effect on transient
gus expression in both types of explants whereas, this percentage increased as the co-
cultivation time was increased from 24 to 48 hours but these values decreased by
further increasing the co-cultivation duration to 72 hours.
In conclusion, the best combination of all the variables proved to be the
bacterial density OD600 value of 1.0, inoculation time of 15 minutes and co-cultivation
duration of 48 hours for both type of explants. But the transient gus expression was
15% higher in the internodal explants when compared with leaf strips, therefore, the
internodal explants were used in stable transformation experiments with the above
treatments used in combination.
108
Table 3.6: Effect of interaction among bacterial density, inoculation time, co- cultivation time and explant type on transient gus expression
Bacterial Density (OD600)
Inoculation Time Co-cultivation Time Internodes Leaf Strips
0.5
15 mins
24 hrs 49.95 ± 5.09 35.52 ± 2.94
48 hrs 62.16 ± 4.00 44.40 ± 4.00
72 hrs 65.49 ± 5.87 45.51 ± 5.87
30 mins
24 hrs 71.04 ± 4.84 42.19 ± 4.83
48 hrs 82.14 ± 2.94 67.71 ± 4.00
72 hrs 87.69 ± 2.94 73.28 ± 6.93
1.0
15 mins
24 hrs 63.27 ± 5.09 45.51 ± 5.87
48 hrs 88.80 ± 2.94 73.28 ± 3.83
72 hrs 85.47 ± 2.94 70.04 ± 3.38
30 mins
24 hrs 72.26 ± 1.17 64.38 ± 2.94
48 hrs 87.69 ± 2.94 68.82 ± 4.84
72 hrs 82.14 ± 5.87 68.82 ± 2.94
1.5
15 mins
24 hrs 53.28 ± 5.77 38.86 ± 3.99
48 hrs 46.62 ± 5.77 38.85 ± 5.87
72 hrs 39.97 ± 5.08 31.86 ± 2.89
30 mins
24 hrs 51.06 ± 2.94 43.30 ± 6.92
48 hrs 46.62 ± 5.09 32.20 ± 4.84
72 hrs 37.76 ± 4.43 27.76 ± 4.01
Each value is the mean of three replicates.
109
020406080100
24 h
rs48
hrs
72 h
rs24
hrs
48 h
rs72
hrs
24 h
rs48
hrs
72 h
rs24
hrs
48 h
rs72
hrs
24 h
rs48
hrs
72 h
rs24
hrs
48 h
rs72
hrs
15 m
ins
30 m
ins
15 m
ins
30 m
ins
15 m
ins
30 m
ins
0.5
OD
1 O
D1.
5 O
D
Percentage Transient gus Expression
Inte
rnod
esLe
af S
trip
s
Fig 3.31: Effect of interaction among bacterial density, inoculation time, co-cultivation period and explant type
on transient gu
s expression
Eac
h va
lue
is th
e m
ean
of th
ree
repl
icat
es. V
ertic
al b
ar re
pres
ents
the
stan
dard
err
or o
f the
3 m
eans
.
110
3.3.6 Effect of antibiotics on explant survival
Another step before starting the stable transformation was to consider the
sensitivity of internodal explants to antibiotics. Non-transformed internodal explants
were cultured on CIM3 containing different concentrations of kanamycin or
cefotaxime, to study their effect on percentage of explant survival and callus
induction. The binary plasmid used for transformation harbored the neomycin
phosphotransferase (nptII) selection marker and kanamycin used in selection medium
was inactivated with nptII gene resulting in the selection of the transformed explants.
Cefotaxime is widely used antibiotic for Agrobacterium elimination after co-
cultivation period in transformation experiments. Once the effect of these antibiotics
was assessed, the right concentrations were then used in the selection medium for
subsequent transformation experiments.
3.3.6.1 Effect of cefotaxime on explant survival
Cefotaxime is a broad spectrum cephalosporin antibiotic and used to eliminate
the Agrobacterium from the explants after co-cultivation period in transformation
experiments. The right concentration of the antibiotic was selected by adding 0, 125,
250, 375, 500, 750 and 1000 mg/l of cefotaxime in CIM3 and then explants were
transferred onto this medium for regeneration. The experiment was replicated thrice
with thirty internodal explants in each treatment for each concentration of cefotaxime.
The calli formed in each concentration were counted after eight weeks.
The explants produced calli at a very high percentage of 92.19% in the control
treatment with no cefotaxime. Addition of cefotaxime at 125 mg/l dropped 10%
percent survival (82.14%) in relation to control explants. A further 5% decrease in
surviving explant (77.7%) was noted when the cefotaxime concentration was doubled
to 250 mg/l. When the cefotaxime concentrations of 375 and 500 mg/l were added to
the media, 75.48% and 73.26% explants survived to produce calli. Use of 750 mg/l of
cefotaxime decreased the percentage survival to 58.83%; on the other hand, the
percentage of surviving explants was dramatically decreased, reaching values of
39.96% by culturing explants on CIM3 containing 1000 mg/l cefotaxime (Fig 3.32).
The calli produced on these two high concentrations were not healthy and green and
their growth was very slow.
111
There was no obvious difference in the survival percentages of explants to
produce calli on 250, 375 and 500 mg/l concentrations of cefotaxime, and the
regenerated calli on these concentrations appeared healthy and green in color.
Therefore, the final concentration of 500 mg/l cefotaxime in CIM3 was selected for
the purpose of Agrobacterium elimination in later experiments of transformation.
0
20
40
60
80
100
0 125 250 375 500 750 1000Cefotaxime Concentration (mg/l)
Pern
enta
ge S
urvi
val
edcb c
ba b c
Fig 3.32: Effect of cefotaxime on explant survival Each value is the mean of three replicates. Any two means having a common alphabet are not
significantly different at p = 0.05 using LSD. Vertical bar represents the standard error of the 3 means.
3.3.6.2 Effect of kanamycin on explant survival
In order to select the proper concentration of antibiotic, internodal explants
were placed onto CIM3 containing kanamycin at 0, 25, 50, 75 and 100 mg/l. Thirty
internodal explants were placed in each treatment and replicated three times for each
concentration of kanamycin. The calli formed in each concentration were counted
every week for eight weeks. The percentage survival or callus formation percentage
from the explants was decreased as the concentration of kanamycin increased from
zero (control) to 100 mg/l. Maximum callus formation percentage (92.13%) was
observed in 15 days on the media with no kanamycin while the addition of 100 mg/l
kanamycin resulted in complete inhibition of explant growth forming no callus.
59.73% calli were recorded in 23 days on medium with 25 mg/l kanamycin while
13.89% calli were formed in 28 days on medium with 50 mg/l kanamycin. There was
a further distinct decline in percentage survival of explants as the concentration of
kanamycin was increased to 75mg/l producing only 6.23% calli in 43 days (Fig 3.33).
112
It was seen that increasing the kanamycin concentration decreased the explant
survival percentage and increased the number of days to form callus. It was also
observed that the induced calli either failed to grow completely or showed very slow
growth resulting in compact, yellowish calli at concentrations higher than 50 mg/l as
compared with the calli produced on media with no or lower kanamycin
concentrations (Fig 3.34).
In conclusion, the lowest concentration of kanamycin to kill more than 85%
explants in 28 days was 50 mg/l whereas, the higher levels of kanamycin had a
negative effect on explant regeneration. Therefore, a final kanamycin concentration of
50 mg/l was used to select transgenic explants after co-cultivation. The transformed
plants were finally selected on the basis of rooting as they produced roots right at the
base of the cut end of the shoot in the rooting media in contrast to the escapes (data
not taken).
0
20
40
60
80
100
0 25 50 75 100Kanamycin Concentrations (mg/l)
Percentage Survival Days to Callus Formation
a
D
A
CC
B
dc b
e
Fig 3.33: Effect of kanamycin on explant survival
Each value is the mean of three replicates. Any two means having a common alphabet are not significantly different at p = 0.05 using LSD. Vertical bar represents the standard error of the 3 means.
113
Fig 3.34: Effect of 100 mg/l kanamycin on explant survival
3.4 Agrobacterium-mediated stable transformation of potato with gus
reporter gene
All the parameters which were optimized earlier through transient gus
expression for Agrobacterium-mediated transformation were applied on the internodal
explants of Desirée to generate the transgenic plants (Fig 3.35). Initially the gus gene
was transformed successfully into the genome of potato cultivar Desirée to check the
reproducibility and dependability of this stable transformation method.
The density of Agrobacterium strain LBA4404 harboring the plasmid
p35SGUSint was maintained at a value of 1.0 at OD600 and the explants were
inoculated for 15 minutes. After 48 hours of co-cultivation period, explants were
transferred to CIM3 (Fig 3.35A) supplemented with 50 mg/l kanamycin for selection
of the transformed explants and 500 mg/l cefotaxime to avoid any excessive growth
of Agrobacterium. The calli once formed, were transferred to SIM3 containing
antibiotics for shoot induction (Fig 3.35B). The untransformed calli gave yellowish
brown appearance while those shoots which were not transformed were bleached
under selection pressure of kanamycin. The emerging shoots from the calli (Fig
3.35C) were carefully excised when their length reached 3-4 cm and then transferred
to RIM1 for further growth and root formation (Fig 3.35D). Rooting of the putative
transformed plants occurred in the selection medium RIM1 right at the base of the
114
excised end of the internode whereas in the untransformed escape plants roots
appeared from the nodes and therefore, these plants were discarded. The apices of
these putative transformed plants were then excised again and transferred to fresh root
induction media to further confirm the rooting behavior as observed earlier. This step
is repeated thrice before transferring these plants to Magenta boxes for three weeks
and then later transferred to compost and grown in a green house. The experiment was
carried out in four replicates of 30 explant each (total 120) out of which 53 explants
produced shoot forming calli. Histochemical gus assay and PCR analysis of these
plants were performed to estimate the percentage of stable transformation (Table 3.7).
Fig 3.35: Different stages of Agrobacterium-mediated transformation of potato
A. Co-cultivation B. Callus induction on selection medium C. Shoot induction D. Root induction
3.4.1 Histochemical gus assay of the putative transformants
Out of 120 Agrobacterium treated internodes, 53 regenerated plants were
selected which rooted on kanamycin according to the criteria discussed above.
Histochemical gus assay of tissues from each of the 53 plants was performed which
B
D C
A
115
revealed the presence of β-Glucuronidase (gus) reporter gene (Fig 3.36) in 41 plants
while, no gus expression was detected in the control plants. A transformation
percentage of 34.17% was estimated on the basis of plants positive for histochemical
analysis of gus gene (Table3.7).
Fig 3.36: Stable gus expression in potato
3.4.2 Polymerase chain reaction (PCR) analysis of the putative gus
transformants
DNA was isolated from fresh leaves of putative transgenic plants and a control
non-transgenic plant; and the plasmid p35GUSint was extracted from Agrobacterium
strain LBA4404. These DNA and plasmid were used as template for PCR
amplification of the nptII gene which confers kanamycin resistance. Primers were
designed to amplify the nptII gene within the coding sequences and the amplification
product of a 780 bp fragment in DNA samples from transformed plants confirmed the
incorporation of the nptII gene. The same amplification was also observed in the
plasmid DNA used as positive control whereas, the band of 780 bp from this
amplification was not observed in the untransformed control plants. Amplification of
nptII gene was performed (Fig 3.37) for 53 putative transgenic plants out of which 41
were positive for the presence of nptII gene (Table 3.7).
116
1 2 3 4 5 6 M +veC -veC
Fig 3.37: PCR analysis of nptII gene from plants transformed with gus Lane 1-6: gus transgenic lines (Lane 1: GB1 P1C4; Lane 2: GB1 P4C7; Lane 3: GB2 P3C5; Lane 4: GB3 P3C1; Lane 5: GB3 P6C4; Lane 6: GB4 P5C5); M: 100 bp marker DNA; +ve C: Plasmid; -ve C: Untransformed plants
PCR amplification of uidA (gus) gene was also performed on the DNA of 41
putative transgenic plants in which the integration of nptII gene was confirmed by
PCR (Fig 3.38). The presence of a band of 895 bp verified the amplification of uidA
(gus) gene from the DNA of these plants proving them to be transformed stably. A
similar size fragment was also amplified from the plasmid DNA used as positive
control while such amplification product was not seen from the DNA of the
untransformed plants. This product of 895 bp was amplified from the DNA of 41
plants tested for polymerase chain reaction of gus gene. The transformation
percentage of 34.17% was calculated on the basis of PCR of uidA (gus) gene (Table
3.7).
780 bp
117
1 2 3 4 5 6 M +veC -veC
Fig 3.38: PCR analysis of gus gene from plants transformed with gus Lane 1-6: gus transgenic lines (Lane 1: GB1 P1C4; Lane 2: GB1 P4C7; Lane 3: GB2 P3C5; Lane 4: GB3 P3C1; Lane 5: GB3 P6C4; Lane 6: GB4 P5C5); M: 100 bp marker DNA; +ve C: Plasmid; -ve C: Untransformed plants
Table 3.7: Summary of transformation using gus reporter gene
Construct p35SGUSint
Total no. of Explants 120
No. of Shoot Producing Calli 53
No. of Plants tested for gus Expression 53
No. of Plants Positive for gus Expression 41
Transformation Percentage on basis of gus expression* 34.17%
No. of PCR Positive Plants for nptII gene 41
No. of PCR Positive Plants for gus Gene 41
Transformation Percentage on the basis of PCR** 34.17%
* Transformation percentage was calculated by dividing the number of plants positive for gus expression divided by total number of explants cocultivated. ** Transformation percentage was calculated by dividing the number of plants positive for gus gene PCR divided by total number of plants tested for PCR
895 bp
118
3.5 Agrobacterium-mediated stable transformation of potato with rolA and
rolC gene
The same protocol used in gus transformation (3.4) was applied in
transformation of rolA and rolC gene. The rolA gene in plasmid pLBR29 and the rolC
gene in pLBR31 were confirmed by sequencing before plant transformation. The
nucleotide sequences for the two genes obtained from our sequencing results were
analyzed and the sequence data are provided in the Appendix-III and Appendix-IV.
3.5.1 Agrobacterium-mediated stable transformation of potato with rolA gene
In this experiment, the transformation protocol optimized for producing gus
transgenic plants was applied on 530 internodal explants of Desirée divided in five
replicates to produce the rolA transgenic plants. Agrobacterium strain LBA4404
carrying the plasmid pLBR29 harboring rolA gene and neomycin phosphotransferase
(nptII) gene as a selection marker was used for transformation. PCR analysis of the
transformants was carried out to confirm the successful gene transformation through
Agrobacterium-mediated transformation method. After co-cultivation, only 223 calli
of internodal explants produced shoots out of 530 explants used as the starting
material (Table 3.8). The phenotypic characteristics of these transformants were
recorded and the shoots from these transformants were subjected to PCR analysis for
amplification of nptII and rolA genes for the confirmation of integration of these
genes in genomic DNA.
3.5.1.1 Polymerase chain reaction (PCR) analysis of the putative rolA
transformants
Polymerase Chain Reaction was performed after extracting DNA from fresh
leaves of 12 weeks old putative rolA gene transformants and control untransformed
plant. A band of 780 bp in the agarose gel after electrophoresis confirmed the
transformation with nptII gene. The negative and positive control in PCR also gave
the expected results since no band was seen in the control plants although a band of
similar size was visualized in the plasmid control. A total of 50 putative transformants
were subjected to PCR analysis for amplifying nptII and rolA gene. The DNA from
14 putative transgenic plants was found positive for the presence of nptII gene after
PCR amplification. The confirmation of presence of rolA gene in these 50 DNA
samples was also done by PCR amplification. Out of these 50 plants 14 were also
119
positive for rolA gene giving the amplification product of 308 bp as expected (Fig
3.39). The number of plants positive for rolA gene was divided by the number of
plants tested for PCR to calculate the transformation percentage which was found to
be 28.0% (Table 3.8).
1 2 3 4 +veC -veC M
Fig 3.39: PCR analysis of rolA gene from plants transformed with rolA
Lane 1-4: rolA transgenic lines (Lane 1: RAB1 P10C4; Lane 2: RAB2 P7C9; Lane 3: RAB4 P1C1; Lane 4: RAB4 P7C8); +ve C: Plasmid; -ve C: Untransformed plants; M: 100 bp marker DNA
Table 3.8: Summary of transformation with rolA gene
Construct pLBR29
Total no. of Explants 530
No. of Shoot Producing Calli 223
No. of Plants tested for PCR 50
No. of PCR Positive Plants for nptII gene 14
No. of PCR Positive Plants for rolA Gene 14
Transformation Percentage on the basis of PCR* 28.00%
* Transformation percentage was calculated by dividing the number of plants positive for rolA gene PCR divided by total number plants tested for PCR.
308 bp
120
3.5.1.2 Morphological characteristics of rolA transgenic plants
All the plants transgenic with rolA exhibited distinct morphological
characteristics with moderate to severe wrinkling of leaves, altered length to width
ratio forming small, round and dark green leaves with downward curling of leaf
margin showing epinasty. The plants were dwarf due to reduced internodal distance
showing variable stunted growth habit. Some of these transformants were extremely
short while others were slightly longer than the other transformants. These plants had
a pronounced apical dominance showing no branching (Fig 3.40). A reduction in root
growth rate was observed which in turn affected the overall plant growth rate
resulting in low tuber yield and reduced plant biomass. The rolA transgenic potato
plants were harvested before senescence. Oval to round shaped phenotypically normal
tubers with little number of eyes were observed (Fig 3.43A). The yield was
determined on the basis of tuber number and weight. Total number of tubers and their
weight were calculated from 21 plants of 4 transgenic lines. A mean number of 5.27
tubers per plant were estimated for rolA transformants as compared to 8.17 and 9.46
tubers per wild type and gus transformed control plants (Fig 3.44). Similarly, these
tubers were weighed and 99.19 g was recorded as mean weight of tubers for each rolA
transgenic plant, whereas the control plants produced tubers weighing 163.5 g per
plant while the weight of tubers from gus transformed plants remained 151.7 g (Fig
3.45).
121
Fig 3.40: rolA transgenic plant
A. rolA transgenic plant B. Untransformed control
3.5.2 Agrobacterium-mediated stable transformation of potato with rolC gene
The optimized Agrobacterium-mediated transformation protocol for gus and
used earlier for rolA transformation was applied in this study to introduce rolC gene
in an effort to examine its effects on Solanum tuberosum cultivar Desirée.
Transformation experiments were performed using internodal explants and after co-
cultivation the plants were established in a manner discussed earlier. The experiment
was started with 470 explants distributed in five replicates out of which 268 shoot
producing calli were formed (Table 3.9). The morphological characteristics of these
plants were observed and the DNA from shoots was subjected to PCR analysis for
amplification of nptII and rolC gene to confirm the transformation of potato plants.
A B
122
3.5.2.1 Polymerase chain reaction (PCR) analysis of the putative rolC
transformants
DNA was extracted from the leaves of 12 weeks old rolC transformants to
perform PCR amplification of the rolC gene to confirm its presence in the genomic
DNA. The amplification product of nptII gene of 780 bp size was amplified using this
genomic DNA as template. 18 plants were positive for the occurrence of nptII gene
out of 50 putative transformants. Amplification of rolC gene by polymerase chain
reaction was also executed from these 50 DNA templates and 18 of them gave a PCR
product of 547 bp giving the transformation percentage of 36% on the basis of PCR
(Table 3.9). The negative and positive PCR controls showed the presence of rolC
gene in the transformants since no sequence was amplified from untransformed plants
whereas a similar product size (560 bp) was seen in the plasmid control (Fig 3.41).
1 2 3 4 5 6 M +veC -veC
Fig 3.41: PCR analysis of rolC gene from plants transformed with rolC
Lane 1-6: rolC transgenic lines (Lane 1: RCB1 P1C1; Lane 2: RCB1 PIC2b; Lane 3: RCB2 P10C7a; Lane 4: RCB2 P10C7b; Lane 5: RCB3 P10C4b; Lane 6: RCB5 P8C9); M: 100 bp marker DNA; +ve C: Plasmid; -ve C: Untransformed plants
547 bp
123
Table 3.9: Summary of transformation with rolC gene
Construct pLBR31
Total no. of Explants 470
No. of Shoot Producing Calli 268
No. of Plants tested for PCR 50
No. of PCR Positive Plants for nptII gene 18
No. of PCR Positive Plants for rolC Gene 18
Transformation Percentage on the basis of PCR* 36.00%
* Transformation percentage was calculated by dividing the number of plants positive for rolC gene PCR divided by total number plants tested for PCR.
3.5.2.2 Morphological characteristics of rolC transgenic plants
Transgenic plants with rolC gene displayed an increased leaf and leaflet
number along with changed morphology of leaves with narrower shape leading to
reduced leaf area. These rolC transformants were bushy in appearance with increased
lateral branching, dwarf having small sized internodes and reduced apical dominance
(Fig 3.42). rolC gene resulted in improved rooting system of the transformants with
an overall increase in rooting area due to increased lateral roots and root hairs in
comparison with the control plants. The rolC transgenic potato plants were also
harvested along with rolA and control plants. The shape of tubers from rolC
transgenic plants was longer with increased number of eyes (Fig 3.43B) as compared
to control plants (Fig 3.43 C, D). Total number of tubers and their weight were
calculated from 35 plants of 6 transgenic lines. An increase in mean number of tubers
per plant (12.44) was observed for rolC transformants as compared to 8.17 and 9.64
tubers per plant for wild type and gus transformed controls, respectively (Fig 3.44).
Although the number of tubers per plant was higher than control plants, their weight
(139.75 g) was noted to be less than the weight of the untransformed and gus
transformed control tubers (163.5 and 151.7 g/plant respectively, Fig 3.45).
124
Fig 3.42: rolC transgenic plant
A. rolC transgenic Plant B. Untransformed control
A B
125
Fig 3.43: Tubers of potato cultivar Desirée
A: rolA transgenic lines B: rolC transgenic lines C: gus transformed D: Wild type Desirée Plants
A
B
C
D
126
0
2
4
6
8
10
12
14
Control gus rolA rolC
Mea
n nu
mbe
r of t
uber
s pe
r pla
ntacb b
Fig 3.44: Mean number of tubers
Each value is the mean of three replicates. Any two means having a common alphabet are not significantly different at p = 0.05 using LSD. Vertical bar represents the standard error of the 3 means.
0
40
80
120
160
200
Control gus rolA rolC
Mea
n w
eigh
t of t
uber
s pe
r pla
nt (g
)
bca a
Fig 3.45: Mean weight of tubers
Each value is the mean of three replicates. Any two means having a common alphabet are not significantly different at p = 0.05 using LSD. Vertical bar represents the standard error of the 3 means.
3.6 Southern blot analysis of rolA, rolC and gus transformants
Southern blot analysis of T0 Desirée plants, already screened by PCR for nptII
and respective gene, was carried out to confirm the stable integration of nptII gene
into the genome of the plants using the DNA template of two transformed plants each
of rolA, rolC and gus gene. In addition non-transformed plant sample was also used as
a control. PCR product of the full length nptII gene of 1016 bp size used as a probe
was labeled with [α-32 P] –dCTP using the “Random primed hexalabeling DNA Kit”.
The presence of nptII gene fragment into the genome of six independent T0
plants of gus, rolA and rolC (2 each) was confirmed by southern blot analysis after
digesting genomic DNA of these transformants with restriction enzyme KPN1 (Fig
3.46, lane 1-7). Two or single hybridizing bands (lane 1a and 2a) of nptII gene were
observed in two plants RAB4 P7C8 and RAB2 P7C9 which were transformed with
rolA gene. Similarly, the rolC transgenic lines RCB1 P1C2b and RCB3 P10C4b had
two (lane 3a) and one copy (lane 4a) of nptII gene respectively. Two insertion events
with single copy of nptII gene were observed in the gus transgenic lines GB1 P4C7
and GB4 P5C5 (lane 5a and 6a). This proves the stable integration of the nptII gene
into the plants transformed with rolA, rolC and gus gene. These results also
confirmed the integration of the T-DNA region in the transgenic plant genome already
screened by means of PCR. The full length PCR product of nptII gene used as probe
was hybridized with the same product of nptII gene used as positive control showed
the expected band at 1016 bp (lane Ca) whereas no band was observed in case of
untransformed control (lane 7a).
M 1 2 3 4 5 6 7 C 1a 2a 3a 4a 5a 6a 7a Ca
5 kb
4 kb
3 kb
2 kb
127
Fig 3.46: Southern blot analysis of rolA, rolC and gus T0 plant of Solanum tuberosum L. cultivar Desirée. Genomic DNA was digested with KPN1 (lane 1-7) and hybridized with 32P-labelled probe corresponding to full length PCR product of nptII gene. Lane 1a-2a: rolA transgenic lines (1a: RAB4 P7C8; 2a: RAB2 P7C9); Lane 3a-4a: rolC transgenic lines (3a: RCB1 P1C2b; 4a: RCB3 P10C4b); Lane 5a-6a: gus transgenic lines (5a: GB1 P4C7; 6a: GB4 P5C5); Lane 7a: untransformed control plant; M: 1 kb marker DNA; Ca: PCR product of nptII as control.
1 kb
128
3.7 Antifungal activities of rolA and rolC transgenic lines of potato
Antifungal assay was performed by well diffusion method on crude extracts
from 4 transgenic lines of rolA and 6 transgenic lines of rolC against Fusarium solani
and Alternaria solani. The selection of the transgenic lines for analysis was based on
the clone size of 4 or more plants survived after acclimatization. Untransformed wild
type and gus gene transformed Desirée plants were also assayed for comparison with
rolA and rolC transgenic lines. A concentration of 0.5 mg Terbinafine and
Clotrimazole per well was used as standard drugs. The zones of inhibition were
measured for different extracts of rol transgenic lines and relative suppressions of
fungal growth with respect to control plants of wild type Desirée were calculated (Fig
3.47). The data revealed a significant reduction in growth of both F. solani and A.
solani for extracts of all rolA and rolC transgenic lines. In general, extracts of both
rolA and rolC transgenic lines showed higher activity against fungal strain F. solani
as compared to A. solani (Table 3.10). The extracts of plants transformed with gus
gene showed a slight increase in relative growth suppression of 9.52% and 6.66%
against F. solani and A. solani respectively, as compared to the untransformed
control. No inhibition zone was recorded for DMSO against any of the fungal strain
(Fig 3.48).
Among all the rolA transgenic lines, maximum antifungal activity against F.
solani was recorded for RAB4 P7C8 which gave the maximum relative growth
suppression of 31.43% showing 13.8 mm zone of inhibition followed by transgenic
line RAB1 P10C4 with 29.52% relative suppression of growth having 13.6 mm zone
of inhibition (Table 3.10). The transgenic lines RAB2 P7C9 and RAB4 P1C1 differed
significantly from the untransformed control but varied insignificantly with each other
having relative growth suppression of 23.81% (13.0 mm) and 21.90% (12.8 mm). The
maximum antifungal activity of the rolA transgenic lines against A. solani was
recorded for RAB4 P7C8 (16.0 mm) and RAB1 P10C4 (15.7 mm) with relative
growth suppression of 33.33% and 30.83%, respectively (Fig 3.47). These two
transgenic lines showed comparable antifungal activities against A. solani whereas a
higher significant difference of these lines was observed with respect to both gus
transformed and untransformed controls. The relative growth of A. solani was
suppressed up to 12.50% with the extracts of RAB2 P7C9 showing the inhibition zone
of 13.5 mm. The least growth suppression (9.66%) of this fungus was observed for
129
RAB4 P1C1 (13.1 mm) relative to the control. Among all the rolA transgenic lines
RAB4 P7C8 performed better by showing higher relative growth suppression values
against both the fungal strains.
The overall relative growth suppression values of F. solani were almost three
to four folds higher as compared to A. solani for the extracts of rolC transgenic lines
(Fig 3.47). The rolC transgenic line RCB1 P1C2b exhibited maximum growth
inhibition (19.6 mm) with relative growth suppression of 86.67% followed by RCB2
P10C7b showing 18.6 mm inhibition zone with 77.14% relative suppression of F.
solani growth (Table 3.10). Significantly higher fungal growth suppression values of
69.52% and 61.90% were recorded for RCB2 P10C7a (17.8 mm) and RCB3 P10C4b
(17.0 mm), respectively, as compared to the gus transformed and untransformed
controls. The transgenic line RCB5 P8C9 inhibited 44.76% growth of F. solani (15.2
mm) followed by RCB1 P1C1 which showed the least relative growth suppression
value of 36.19% (14.3 mm). The extracts of all the rolC transgenic lines were also
significantly different from controls and were active against A. solani. Maximum
suppression of growth (30.83%) was observed for the extract of RCB1 PIC2b having
a zone of 15.7 mm followed by RCB2 P10C7a and RCB2 P10C7b with a similar
relative growth suppression value of 22.5% and inhibition zone of 14.7 mm each.
Almost similar growth suppression values of 16.67% and 15.0% were noted for rolC
transgenic lines RCB3 P10C4b and RCB5 P8C9 having the inhibition zones of 14.0
mm and 13.8 mm respectively. The extract of RCB1 P1C1 displayed least relative
growth suppression (7.54%) with 12.9 mm zone of inhibition for A. solani. Among all
the rolC transgenic lines RCB1 P1C2b showed highest relative growth suppression
values against both the fungal strains (Table 3.10; Fig 3.47).
In general, all the rolC transgenic lines showed higher activities against F.
solani as indicated by increased relative growth suppression values when compared
with that of rolA lines. However, both the rolA and rolC lines exhibited almost similar
values of growth suppression for A. solani.
130
Table 3.10: Antifungal activity of crude extracts of different transgenic lines
Transgenic Lines
Fusarium solani Alternaria solani
Zone of inhibition (mm)
Relative Suppression
(%)
Zone of inhibition (mm)
Relative Suppression
(%)
rolA
RAB1 P10C4 13.6 ±0.44 I 29.52 15.7 ±0.17 C 30.83
RAB2 P7C9 13.0 ±0.29 J 23.81 13.5 ±0.50 EFG 12.50
RAB4 P7C8 13.8 ±0.33 HI 31.43 16.0 ±0.50 C 33.33
RAB4 P1C1 12.8 ±0.17 J 21.90 13.1 ±0.60 FG 9.66
rolC
RCB1 P1C1 14.3 ±0.44 H 36.19 12.9 ±0.44 G 7.54
RCB1 P1C2b 19.6 ±0.17 C 86.67 15.7 ±0.17 C 30.83
RCB2 P10C7a 17.8 ±0.29 E 69.52 14.7 ±0.17 D 22.50
RCB2 P10C7b 18.6 ±0.60 D 77.14 14.7 ±0.73 D 22.50
RCB3 P10C4b 17.0 ±0.17 F 61.90 14.0 ±0.29 DE 16.67
RCB5 P8C9 15.2 ±0.33 G 44.76 13.8 ±0.33 EF 15.0
Control
gus transformed 11.5 ±0.17 K 9.52 12.8 ±0.73 G 6.66
Wild type Desirée 10.5 ±0.29 L -- 12.0 ±0.50 H --
Terbinafine 36.2 ±0.17 A -- 38.5 ±0.29 A --
Clotrimazole 25.3 ±0.17 B -- 36.3 ±0.17 B --
DMSO -- -- -- -- -- -- -- --
Each value is the mean of three replicates. Any two means having a common alphabet are not significantly different at p = 0.05 using LSD.
131
0102030405060708090
100
RA
B1P
10C4
RA
B2P
7C9
RA
B4P
7C8
RA
B4P
1C1
RCB
1P1C
1
RCB
1P1C
2b
RCB
2P10
C7a
RCB
2P10
C7b
RCB
3P10
C4b
RCB
5P8C
9gu
s-tra
nsfo
rmed
Wild
type
Des
irée
rolA rolC ControlTransgenic Lines
Rel
ativ
e Su
ppre
ssio
n (%
)
F. solani A. solani
Fig 3.47: Relative growth suppression of different fungi against rolA and rolC transgenic lines
Fig 3.48: Antifungal activity of rolC transgenic lines against Fusarium solani
T: Terbinafine C: Clotrimazole W: Wild type control
gus: gus control 1-8: rolC extracts
T C
DMSO
WT
gus
1 2
3
4
5
6 7
8
132
3.8 Antibacterial activities of rolA and rolC transgenic lines
Antibacterial assay was carried out by well diffusion method on crude extracts
from transgenic lines of rolA and rolC (previously analyzed for antifungal assay)
against Agrobacterium tumefaciens (AT 10), Xanthomonas compestris pv. vesicatoria
and Pseudomonas syringae pv. syringae. The assay of gus transformed and
untransformed wild type Desirée plants were also performed as control for
comparison with rolA and rolC transgenic lines. Roxithromycin and Cefexime were
used as standard antibacterial drugs at the concentration of 0.1 mg per well. The
relative growth suppression values and zones of inhibition of gus transformed plants
(control) against AT 10, X. compestris and P. syringae remained 1.69% (12 mm),
2.08% (9.8 mm) and 0% (9.3 mm) respectively (Fig 3.49), which were significantly
lower than most of the rolA and rolC transgenic lines. DMSO was found to be
inactive against all the three bacterial strains (Fig 3.50). Significant differences were
observed among most of rolA and rolC transgenic lines against the three bacterial
strains tested (Table 3.11).
In general, rolA transgenic lines showed better antibacterial activities against
P. syringae and AT 10 as compared to X. compestris. The crude extracts of rolA
transgenic lines exhibited significant differences in growth inhibition against P.
syringae as compared to the control (Fig 3.49). Maximum relative growth suppression
of 25.81% was observed for RAB4 P7C8 with 11.7 mm zone of inhibition against P.
syringae. Moreover, other three rolA lines viz. RAB1 P10C4, RAB2 P7C9 and RAB4
P1C1 also differed significantly, giving the inhibition zones of 11.2 mm, 10.5 mm and
9.7 mm with relative suppression values of 20.43%, 13.54% and 4.23% respectively.
Among all the rolA transgenic lines, maximum antibacterial activity against AT 10 in
terms of relative growth suppression was noted for RAB4 P7C8 (16.82%) followed
by RAB1 P10C4 (14.41%) and RAB2 P7C9 (12.71%) with 13.7 mm, 13.5 mm and
13.3 mm zones of inhibition respectively. The transgenic line RAB4 P1C1 was least
active against AT 10 by showing 13.0 mm zone of inhibition with 10.17% relative
suppression of growth. Comparatively lower activities of all the rolA transgenic lines
were observed against X. compestris. The rolA transgenic line RAB4 P7C8 exhibited
maximum relative growth suppression (12.87%) having 10.8 mm zone of inhibition
followed by RAB1 P10C4 (11.46%), RAB2 P7C9 (9.37%) and RAB4 P1C1 (5.08%)
with inhibition zones of 10.7 mm , 10.5 mm and 10 mm respectively. Among all the
133
rolA transgenic lines RAB4 P7C8 performed better by showing higher relative growth
suppression values against all the three bacterial strains (Table 3.1; Fig 3.49).
The pattern of antibacterial activities of rolC transgenic lines differed with that
of rolA lines as rolC was most effective against P. syringae followed by X. compestris
and AT 10. Crude extracts of most of the rolC transgenic lines were most active
against P. syringae (Fig 3.49). The highest value of relative growth suppression
(36.56%) against P. syringae was observed for rolC transgenic line RCB1 P1C2b
giving the zone of inhibition of 12.7 mm followed by RCB2 P10C7b exhibiting
23.66% growth suppression along with 11.5 mm zone of inhibition. Two rolC
transgenic lines i.e. RCB2 P10C7a and RCB3 P10C4b differed insignificantly with
each other but showed significantly higher relative growth suppression values of
20.43% and 18.28% showing 11.2 mm and 11.0 mm zones of inhibition, respectively
when compared with gus transformed control. The transgenic line RCB5 P8C9 gave
9.8 mm inhibition zone with 4.93% relative growth suppression followed by RCB1
P1C1 with 2.15% relative suppression having 9.5 mm inhibition zone which differed
insignificantly with both type of controls for P. syringae. Crude extracts of rolC
transgenic lines also showed considerable growth inhibition activities against X.
compestris. Among rolC lines, RCB1 PIC2b and RCB2 P10C7b exhibited highest
level of relative suppression (30.41% and 25.09% respectively) against X. compestris
giving the inhibition zones of 12.5 mm and 12.0 mm respectively. Almost similar
zones of inhibition (11.0 mm and 10.8 mm) were noticed for crude extracts of RCB2
P10C7a and RCB3 P10C4b with the relative growth suppression values of 14.85%
and 12.35% respectively (Fig 3.49). A value of 9.76% relative growth suppression
was observed for transgenic line RCB5 P8C9 having 10.5 mm inhibition zone
followed by RCB1 P1C1 (9.8 mm) with relative growth suppression value of 2.18%
which differed insignificantly with gus transformed control. Crude extracts of some of
the rolC transgenic lines were moderately active against the bacterial stain AT 10.
The rolC transgenic line RCB1 P1C2b showed maximum relative growth suppression
(24.83%) giving the inhibition zone of 14.7 mm followed by 20.59% growth
suppression for RCB2 P10C7b (13.3 mm) against the bacterial strain AT 10. Relative
growth suppression values of 12.47%, 7.83% and 4.53% were calculated for RCB2
P10C7a (13.3 mm), RCB3 P10C4b (12.7 mm) and RCB5 P8C9 (12.3 mm)
respectively. Among all the rolC lines, RCB1 PIC1 showed minimum relative growth
134
inhibition (1.96%) having 12.0 mm zone of inhibition against AT 10 and differed
insignificantly from both gus transformed and untransformed controls. It is evident
from the data that the rolC transgenic line RCB1 P1C2b proved most effective against
all the three bacterial strains tested (Table 3.11; Fig 3.49).
Among all the transgenic lines, rolC lines largely produced promising
inhibitory result against bacterial strain P. syringae when compared with rolA against
the same strain. However, the overall effectiveness of rolC transgenic lines was
almost similar with that of rolA lines against AT 10. Moreover, the activities of rolA
lines remained lowest against X. compestris as compared to the rolC lines.
135
Table 3.11: Antibacterial activity of crude extracts of different transgenic lines
AT 10
X. c
ompe
stris
P. syringa
e
Transgenic lines
Zone
of i
nhib
ition
(m
m)
Rel
ativ
e Su
ppre
ssio
n (%
) Zo
ne o
f inh
ibiti
on
(mm
) R
elat
ive
Supp
ress
ion
(%)
Zone
of i
nhib
ition
(m
m)
Rel
ativ
e Su
ppre
ssio
n (%
)
rolA
RA
B1
P10C
4 13
.5
±0.2
9 E
F 14
.41
10.7
±0
.44
DE
F 11
.46
11.2
±0
.44
DE
20
.43
RA
B2
P7C
9 13
.3
±0.6
0 E
FG
12.7
1 10
.5
±0.2
9 D
EFG
9.
37
10.5
±0
.29
EF
13.5
4
RA
B4
P7C
8 13
.7
±0.4
4 D
E
16.8
2 10
.8
±0.1
7 D
E
12.8
7 11
.7
±0.1
7 C
D
25.8
1
RA
B4
P1C
1 13
.0
±0.5
0 FG
10
.17
10.0
±0
.44
EFG
5.
08
9.7
±0.3
3 FG
4.
23
rolC
RC
B1
P1C
1 12
.0
±0.1
7 I
1.96
9.
8 ±0
.50
FG
2.18
9.
5 ±0
.50
G
2.15
RC
B1
P1C
2b
14.7
±0
.29
C
24.8
3 12
.5
±0.2
9 C
30
.41
12.7
±0
.44
B
36.5
6
RC
B2
P10C
7a
13.3
±0
.33
EFG
12
.47
11.0
±0
.17
D
14.8
5 11
.2
±0.1
7 D
E
20.4
3
RC
B2
P10C
7b
14.2
±0
.29
CD
20
.59
12.0
±0
.29
C
25.0
9 11
.5
±0.5
0 D
23
.66
RC
B3
P10C
4b
12.7
±0
.29
GH
7.
83
10.8
±0
.17
DE
12
.35
11.0
±0
.44
DE
18
.28
RC
B5
P8C
9
12.3
±0
.44
HI
4.53
10
.5
±0.3
3 D
EFG
9.
76
9.8
±0.3
3 FG
4.
93
Control
gus
trans
form
ed
12.0
±0
.17
I 1.
69
9.8
±0.3
3 FG
2.
08
9.3
±0.4
4 G
0
Wild
type
Des
irée
11
.8
±0.1
7 I
--
9.6
±0.6
7 G
--
9.
3 ±0
.33
G
--
Rox
ythr
omyc
in
20.6
±0
.67
B
--
35.8
±0
.60
A
--
12.5
±0
.29
BC
--
Cef
ixim
e 28
.5
±0.2
9 A
--
20
.2
±0.7
2 B
--
21
.8
±0.6
0 A
--
DM
SO
--
--
--
--
--
--
--
--
--
--
--
--
Eac
h va
lue
is th
e m
ean
of th
ree
repl
icat
es. A
ny tw
o m
eans
hav
ing
a co
mm
on a
lpha
bet a
re n
ot s
igni
fican
tly d
iffer
ent a
t p =
0.0
5 us
ing
LSD
.
137
0
5
10
15
20
25
30
35
40
RA
B1P
10C4
RA
B2P
7C9
RA
B4P
7C8
RA
B4P
1C1
RCB
1P1C
1
RCB
1P1C
2b
RCB
2P10
C7a
RCB
2P10
C7b
RCB
3P10
C4b
RCB
5P8C
9
gus-
trans
form
edW
ild ty
pe D
esiré
e
rolA rolC Control
Transgenic Lines
Rel
ativ
e Su
ppre
ssio
n (%
)
AT 10 X. compestris P. syringae
Fig 3.49: Relative growth suppression of different bacteria against rolA and rolC transgenic lines
Fig 3.50: Antibacterial activity of rolC transgenic lines against P. syringae
R: Roxithromycin C: Cefexime W: Wild type control
gus: gus control 1-10: rolC extracts
C R
DMSO
gus W
1
2
3
4
5 6
7
8
9
10
138
3.9 Determination of antioxidant activity
The antioxidant activity of crude extracts from plants or purified compounds
could be determined by DPPH free radical scavenging method. A violet colored
solution in ethanol produced by stable free radical DPPH is reduced by the
antioxidant molecules present in the extract or compound which give rise to colorless
ethanol solution. Thus, this method provides a rapid and easy approach to estimate the
antioxidant activity by using spectrophotometer.
Antioxidant activity was determined using crude extracts from aerial parts of
different rolA and rolC transgenic potato plants previously tested for their
antimicrobial activities. Potato plants transformed with gus gene and wild type
Desirée plants were used as a control. Free radical scavenging activity of extracts
from wild type Desirée plants was estimated to be IC50 = 201.69 µg/ml while slightly
higher activity with a relative increase of 6.13% (IC50 = 189.32 µg/ml) was noted for
gus transformed plants with respect to untransformed wild type Desirée plants. Crude
extract of different transgenic lines of both rolA and rolC gene exhibited effective free
radical scavenging activity as determined by DPPH assay. Among all the rolA
transgenic lines, crude extract of RAB4 P7C8 showed maximum relative increase in
antioxidant activity (75.35%) with IC50 value of 49.71 µg/ml followed by RAB1
P10C4 showing a relative increase of 61.61% (IC50 = 77.42 µg/ml). The rolA
transgenic line RAB2 P7C9 exhibited an increase of 57.70% in its antioxidant activity
having an IC50 of 85.30 µg/ml. The minimum increase (18.62%) in antioxidant
activity was observed for RAB4 P1C1 having an IC50 value of 164.13 µg/ml (Table
3.12; Fig 3.51).
The highest antioxidant activity among the rolC transgenic lines was observed
for RCB1 PIC2b (IC50 = 77.48 µg/ml) with a relative increase of 61.58% than control.
A relative increase of 56.86% (IC50 = 86.99 µg/ml) was recorded for RCB2 P10C7b.
The transgenic lines RCB2 P10C7a (IC50 = 112.45 µg/ml) and RCB3 P10C4b (IC50 =
123.01 µg/ml) showed the relative increase of 44.24% and 39.01% in their antioxidant
activities, respectively. Moreover, RCB5 P8C9 exhibited a relative increase of
27.70% with an IC50 value of 145.81 µg/ml while the least relative increase (12.29%)
was observed for transgenic line RCB1 P1C1 having an IC50 value of 176.89 µg/ml
139
(Table 3.12; Fig 3.51). The overall antioxidant activity of crude extracts from rolA
transgenic lines was higher than that of rolC transgenic lines.
Table 3.12: Antioxidant activity, total phenolics and total flavonoids
Transgenic Lines
Antioxidant Activity Phenolics Flavonoids
IC50 (µg/ml)
Relative Increase
(%)
Total (mg/g)
Relative Increase
(%)
Total (mg/g)
Relative Increase
(%)
rolA
RAB1 P10C4 77.42 61.61 37.5 ± 1.0 cde 12.27 36.7 ± 0.2 A 28.78
RAB2 P7C9 85.30 57.70 43.9 ± 1.0 b 31.44 29.9 ± 1.2 D 4.91
RAB4 P7C8 49.71 75.35 47.0 ± 1.0 a 40.72 31.8 ± 0.7 C 11.58
RAB4 P1C1 164.13 18.62 38.5 ± 0.0 cd 15.27 29.9 ± 0.6 D 4.91
rolC
RCB1 P1C1 176.89 12.29 33.9 ± 1.0 h 1.65 28.9 ± 0.1 EF 1.47
RCB1 P1C2b 77.48 61.58 37.2 ± 1.0 de 11.38 36.8 ± 0.9 A 29.12
RCB2 P10C7a 112.45 44.24 36.7 ± 1.0 ef 9.99 32.5 ± 0.5 C 13.78
RCB2 P10C7b 86.99 56.86 38.7 ± 0.0 c 15.72 33.8 ± 0.5 B 18.66
RCB3 P10C4b 123.01 39.01 35.5 ± 0.0 fg 6.29 31.7 ± 0.2 C 11.49
RCB5 P8C9 145.81 27.70 34.3 ± 0.0 gh 2.59 29.6 ± 0.2 DE 3.73
Control
gus transformed 189.32 6.13 33.9 ± 1.0 h 1.50 28.9 ± 0.1 EF 1.40
Wild type Desirée 201.69 -- 33.4 ± 1.0 h -- 28.5 ± 0.4 F --
Each value of phenolics and flavonoids is the mean of three replicates. Any two means having a common alphabet are not significantly different at p = 0.05 using LSD.
140
01020304050607080
RA
B1
P10C
4
RA
B2
P7C
9
RA
B4
P7C
8
RA
B4
P1C
1
RCB
1 P1
C1
RCB
1 P1
C2b
RCB
2 P1
0C7a
RCB
2 P1
0C7b
RCB
3 P1
0C4b
RCB
5 P8
C9gu
s tra
nsfo
rmed
Rel
ativ
e In
crea
se (%
)
Fig 3.51: Relative increase in antioxidant activities of different rolA and rolC transgenic lines
3.10 Determination of total phenolics and flavonoids
The total phenolics and flavonoids from crude extracts of transgenic plants
(used earlier for assays) were estimated by spectrophotometric analysis using the
standard curves (Appendix-VI). Total phenolic and flavonoid compounds in crude
extract of wild type Desirée plants used as control were estimated to be 33.4 mg/g and
28.5 mg/g respectively (Table 3.12; Fig 3.52). The gus transformed Desirée plants
showed a relative increase of 1.5% (33.9 mg/g) in total phenolic contents which
differed non-significantly with the wild type control while, 1.4% relative increase in
the total flavonoid contents (28.9 mg/g) was observed for these gus transformed
plants (Fig 3.53). A significant increase in total phenolic contents was observed in all
the transgenic lines of both rolA and rolC.
Among all the rolA transgenic lines, the maximum relative increase of 40.72%
in total phenolics (47.0 mg/g) was observed for RAB4 P7C8 followed by RAB2 P7C9
which showed 31.44% relative increase in its phenolic contents (43.9 mg/g). A
relative increase of 15.27% in the total phenolic contents (38.5 mg/g) was noted for
RAB4 P1C1, while the least increase of 12.27% was recorded in the total phenolic
contents (37.5 mg/g) of RAB1 P10C4. Moreover, these rolA transgenic lines also
showed a significant increase in their total flavonoid contents with respect to gus
transformed and untransformed controls. A maximum relative increase of 28.78% in
total flavonoids (36.7 mg/g) occurred in rolA transgenic line RAB1 P10C4 followed
141
by an increase of 11.58% in total flavonoids (31.8 mg/g) of RAB4 P7C8. Estimations
showed a significant relative increase of 4.91% in the flavonoid contents (29.9 mg/g)
of RAB2 P7C9 and RAB4 P1C1 each (Fig 3.52 and 3.53).
A significant increase in the total phenolic and flavonoid contents of different
rolC transgenic lines was also observed (Table 3.12; Fig 3.52). The rolC line RCB2
P10C7b showed a maximum relative increase of 15.72% in the total phenolics (38.7
mg/g) followed by RCB1 P1C2b which showed a significant increase of 11.38% in its
phenolics (37.2 mg/g). An increase of 9.99% and 6.29% was estimated for rolC lines
RCB2 P10C7a and RCB3 P10C4b with total phenolic contents of 36.7 mg/g and 35.5
mg/g respectively. A comparatively less significant increase of 2.59% in phenolics
(34.3 mg/g) occurred in transgenic line RCB5 P8C9. Least increase of 1.65% in total
phenolics (33.9 mg/g) was noted for RCB1 P1C1 which differed non-significantly
with both types of control. Nearly all of the rolC lines also exhibited a significant
increase in their flavonoid contents. The most significant relative increase of 29.12%
in total flavonoid contents (36.8 mg/g) was recorded for rolC line RCB1 P1C2b. The
flavonoid contents increased upto 18.66% (33.5 mg/g), 13.78% (32.5 mg/g) and
11.49% (31.7 mg/g) in transgenic lines RCB2 P10C7b, RCB2 P10C7a and RCB3
P10C4b respectively. The results revealed a slight significant increase of 3.73% in
flavonoid contents (29.6 mg/g) of RCB5 P8C9 while, a non significant increase
(1.47%) in flavonoids (28.9 mg/g) of rolC line RCB1 P1C1 was observed (Table
3.12; Fig 3.52 and 3.53).
An overall increase in total phenolics of rolA transgenic lines was almost three
folds higher than rolC transgenic lines while, a comparable overall increase in total
flavonoid contents was observed for both rolA and rolC transgenic lines as compared
to both gus transformed and untransformed controls. The results of antifungal,
antibacterial and antioxidant assays revealed an increase in these activities of different
rol gene transgenic lines. Moreover, an overall increase in the secondary metabolites
like phenolics and flavonoids were also observed for these transgenic lines. These
results have shown that the antimicrobial and antioxidant activities of transgenic lines
were significantly enhanced with the increased levels of total phenolics and
flavonoids (Table 3.13).
142
0
10
20
30
40
50
60
RA
B1P
10C
4
RA
B2P
7C9
RA
B4P
7C8
RA
B4P
1C1
RC
B1P
1C1
RCB
1P1C
2b
RCB
2P10
C7a
RC
B2P
10C
7b
RC
B3P
10C
4b
RC
B5P
8C9
gus-
tran
sfor
med
Wil
d ty
pe D
esiré
e
rolA rolC Control
Transgenic Lines
Con
cent
rati
on (m
g/g)
Phenolics Flavonoids
Fig 3.52: Total phenolics and flavonoids in different
rolA and rolC transgenic lines Each value is the mean of three replicates. Vertical bar represents the standard error of the 3 means.
05
1015202530354045
RA
B1P
10C4
RA
B2P
7C9
RA
B4P
7C8
RA
B4P
1C1
RCB
1P1C
1
RCB
1P1C
2b
RCB
2P10
C7a
RCB
2P10
C7b
RCB
3P10
C4b
RCB
5P8C
9gu
s-tra
nsfo
rmed
Wild
type
Des
irée
rolA rolC Control
Transgenic Lines
Rel
ativ
e In
crea
se (%
)
Phenolics Flavonoids
Fig 3.53: Relative increase in phenolics and flavonoids in different
rolA and rolC transgenic lines
143
Table 3.13: Comparison of increase in total phenolics and flavonoids, antioxidant and antimicrobial activities of
different rol gene transgenic lines
Phenolics +
Flavonoids
Antioxidant
activity
Antifungal Activity
(Rel
ativ
e Su
ppre
ssio
n Antibacterial Activity
(Rel
ativ
e Su
ppre
ssio
n)
Transgenic Lines
(Rel
ativ
e In
crea
se)
(Per
cent
age
Incr
ease
) Fus
arium
solani
) Alte
rnaria
solani
Agrob
acterium
tumefac
iens AT10
Xan
thom
onas
compe
stris
Pseud
omon
as
syring
ae
rolA
RA
B1
P10C
4 41
.05
61.6
1 29
.52
30.8
3 14
.41
11.4
6 20
.43
RA
B2
P7C
9 36
.35
57.7
0 23
.81
12.5
0 12
.71
9.37
13
.54
RA
B4
P7C
8 52
.3
75.3
5 31
.43
33.3
3 16
.82
12.8
7 25
.81
RA
B4
P1C
1 20
.18
18.6
2 21
.90
9.66
10
.17
5.08
4.
23
rolC
RC
B1
P1C
1 3.
12
12.2
9 36
.19
7.54
1.
96
2.18
2.
15
RC
B1
P1C
2b
40.5
61
.58
86.6
7 30
.83
24.8
3 30
.41
36.5
6
RC
B2
P10C
7a
23.7
7 44
.24
69.5
2 22
.50
12.4
7 14
.85
20.4
3
RC
B2
P10C
7b
34.3
8 56
.86
77.1
4 22
.50
20.5
9 25
.09
23.6
6
RC
B3
P10C
4b
17.7
8 39
.01
61.9
0 16
.67
7.83
12
.35
18.2
8
RC
B5
P8C
9 6.
32
27.7
0 44
.76
15.0
4.
53
9.76
4.
93
Control
gus
trans
form
ed
2.9
6.13
9.
52
6.66
1.
69
2.08
0
Eac
h va
lue
is th
e m
ean
of th
ree
repl
icat
es.
144
Discussion
Potato is a very significant crop of the world for its nutritional value. It has a
great prospective to minimize the pressure of food requirement on cereal crops as it is
the fourth most cultivated food crop. Intensification and inexperience of farmers lead
to fungal, bacterial and viral diseases that affect potato crop production causing
serious economic losses annually. Some diseases may arise due to lack of disease
resistant clones and non-availability of proper germplasm. Genetic modification of
potato is performed routinely for the development of disease and stress resistant
varieties, for the improvement of nutritional value by physiological modifications or
studying the expression of foreign genes in this model plant. An efficient in vitro
regeneration system is a pre-requisite for such genetic modifications. It has been
reported that individual rol genes act as activators of secondary metabolism in
transformed plant cells, thus altering the metabolic pathways. The effects of rol genes
on secondary metabolism could be explained after understanding their biochemical
function and may be used for crop improvement. These rol genes were introduced in
the potato plant through Agrobacterium mediated genetic transformation method for
evaluating the function of rol genes in plant defense. The results of antimicrobial and
antioxidant activities of rol genes transformed plants revealed their possible role in
plant defense.
4.1 Optimization of in vitro regeneration
Crop improvement through genetic transformation requires the development
of an efficient and reliable system for in vitro regeneration of plants. In vitro
regeneration is controlled by many factors including culture medium, growth
hormones, genotype and explant source.
Comparison of six already reported callus inducing media was carried out to
find the best medium for efficient callus induction in three potato cultivars in
minimum possible time. Results indicated that all the six media induced callusing
with varying efficiencies ranging from 69.13% on CIM3 in 22.51 days to 49.26% on
CIM6 in 32 days. Five out of six callus induction media showed more than 50 %
callus induction efficiency with CIM3 (MS basal medium with 7.10 µM zeatin
riboside, 1.07 µM NAA and 0.06 µM GA3) being the best callusing medium
145
producing an overall 69.13% callus induction frequency followed by 59.69% on
CIM5 (MS medium containing 2 mg/l 2, 4-D and 0.8 mg/l zeatin riboside). CIM1,
CIM2 and CIM4 varied insignificantly for their rate of callus formation. Lowest
callusing frequency (49.26%) was recorded for CIM6 (MS medium supplemented
with 1.0 mg/l BAP and 0.1 mg/l GA3). Higher callusing frequencies on CIM3 and
CIM5 may be associated with the presence of zeatin riboside which was considered
an important factor in controlling the development of organogenic microcalli
(Beaujean et al., 1998). Our results are in agreement with previous findings in which
zeatin riboside produced best callus regeneration response when used in combination
with NAA and GA3 in Solanum phureja (Ducreux et al., 2005), with 2, 4-D (Beaujean
et al., 1998) or with IAA (Trujillo et al., 2001) in Solanum tuberosum.
Results for main effect of genotype showed that three potato cultivars differed
insignificantly for the callus induction frequency while significantly for days taken for
callus induction. Overall mean callus formation rates of 58.48, 57.81and 56.54% were
recorded for Altamash, Diamant, and Desirée respectively. However cultivar Desirée
took minimum average time of 25 days to induce calli followed by Altamash and
Diamant with mean 27.5 and 29.45 days respectively. These genotypic differences
with respect to callus initiation were also observed in many other plants (Lee et al.,
2004; Wang et al., 2004; Burbulis et al., 2007). Our results are supported by previous
studies showing that response to callus induction was often genotype dependant
(Wenzler et al., 1989; Turhan, 2004; Badr et al., 2008).
Various parts of potato plant e.g. root, stem, leaf and tuber have been used
successfully for callus induction (Ahloowalia, 1982; Austin and Cassels, 1983; Osifa,
1989). The anatomical structure of explant seems to play a significant role in
determining its callus formation efficiency. Variation in callus forming ability of
different explant types has been reported in many others plants (Ishii et al., 2004;
Zouine and El hadrami, 2004). In present study three types of explants i.e. microtuber
discs, leaf explants and internodal segments were cultured on different callus inducing
media to choose most responsive explant type for further manipulation. Differences
were observed among three explant types for percentage callus induction and the
number of days taken to produce callus. Highest rates for callus induction were
observed in internodal segments followed by leaf and microtuber discs on all the
146
media and varieties used in this study. The potential of callus induction from different
explants is dependent on hormonal sensitivity of explants, endogenous hormonal
levels, genetically controlled cellular meristematic activity and genes controlling
morphogenesis of plants (Ezhova, 2003). Internodal segments showed highest mean
value for callus formation efficiency (69.23%) in minimum average time period of 19
days followed by the leaf discs (67.28%) in 25 days. Microtuber discs produced least
number of calli (36.32%) in maximum time (37 days). These results depicted that
callus induction is largely dependant upon the source of explant or explant type.
Callogenesis specificity of explant type would be explained by their differential
reactivity to media components (Zouzou et al., 1997; Ikram, 2005). Our results are in
accordance with findings of Beaujean et al. (1998), Turhan (2004) and Shirin et al.
(2007) who reported that internodal segments of potato stem were more responsive to
callus induction than leaf explants. In potato regeneration studies, callus formation
from explants of diverse origins other than internodal segments was reported by
various researchers (Tavazza et al., 1988; Wenzler et al., 1989; Snyder and Belknap,
1993; Jayasaree et al., 2001; Banerjee et al., 2006). While comparing different
explant sources Sarker and Mustafa (2002) obtained highest callus induction response
from leaf explants followed by nodal and internodal segments while according to
Yasmin et al. (2003) leaf explants performed better for callus formation as compared
to internodal segments.
Similarly the results propose that in addition to the positive effect of individual
factors on callogenesis; parameters such as rate of callus induction and time taken for
callus initiation were also influenced by the interaction among all these. Moreover,
the interaction (genotype x media x explant type) would be more decisive and helpful
to choose a combination involving the right media with a totipotent tissue of a specific
genotype under optimum growth conditions which produced highest rate of callus
induction with in minimum period of time. This hypothesis was supported by
different researchers reporting the development of efficient callusing and regeneration
system by combining well defined medium with particular responsive explant tissue
for specific genotypes (Finer, 1987; Burrus et al., 1991; Wingender et al., 1996;
Henn et al., 1998; Berrios et al., 1999; Müller et al., 2001; Yordanov et al.,
2002). Although internode as explant has been proven best explant for callus
147
induction in previous studies and in this study but genotype dependency and
nutritional status (media) also play vital role to envisage callus induction response in
minimum time period. Results of interaction between different factors for callus
induction showed that maximum percentage of callus formation was produced by the
internodal explants of Desirée on CIM3 followed by Diamant and Altamash on same
CIM3 medium. At the same time the internodes of Desirée induced to form callus in
shortest time (11.33 days) on CIM4 as compared to 12.67 days on CIM3. However,
this increase in the time taken for callus induction on CIM3 by the internode of
Desirée was compensated by almost 26% increase in callus induction percentage on
CIM3 when compared to CIM4. Therefore interaction of internodal explants of
Desirée on CIM3 medium was considered as most callus responsive combination in
this study. Relatively lower callus induction frequencies with more number of days
were obtained with leaf and microtuber discs of all varieties on most of media in
present study. In conclusion cultivar Desirée showed best callogenic response from
internodal explants when cultured on CIM3 as compared to other genotypes and even
explants type and therefore this combination was selected for callus induction in the
succeeding experiments.
Callus derived from internodal and leaf explants of potato cultivars Diamant,
Desirée and Altamash were cultured on six respective shoot induction media to assess
their shoot regenerative ability. Tuber derived callus was excluded in these
experiments as they proved very slow and recalcitrant in nature during callogenesis.
Plant regeneration is highly dependant on interaction between naturally occurring
endogenous plant growth hormone and exogenous growth regulators supplemented in
the culture medium. In present study shoot formation was achieved from both explant
derived calli on all the six shoot induction media. Significant differences were
observed between various media regarding the parameters like shoot induction
percentage and time taken for shoot regeneration. Highest mean shoot regeneration
frequency among all calli was 76.29% on SIM3. SIM4, SIM5, SIM6 and SIM1 did
not differ significantly for their shoot regeneration potential while SIM2 yielded
lowest overall shoot induction percentage. Shoot induction media also showed
variable response for mean number of days to form shoots ranging from minimum
27.22 days on SIM3 to a maximum 40.50 days on SIM1. Similar findings were
reported by Anjum and Ali (2004a, b) when they observed highest shooting frequency
148
with earliest shoot induction response from calli of diverse origins on medium of
Iapichino et al. (1991) followed by that of Lam (1977) and Ahloowalia (1982) while
comparing shoot regeneration potential of different media. Significant variations
occurred for plant regeneration after callogenesis due to nature and concentration of
cytokinins and auxins in the culture medium (Yasmin et al., 2003). In the present
study SIM3 proved best medium for shoot induction as it produced highest percentage
of shoot producing calli in minimum time duration irrespective of explant and
genotype. SIM3 is similar in its composition to CIM3 except that it contained lower
concentrations of auxin NAA. Lowering the concentration of NAA from 1.07 µM to
0.11 µM in the presence 7.10 µM zeatin riboside and 0.06 µM GA3 in SIM3 enhanced
the shoot regeneration efficiency of all the calli cultured on this medium irrespective
of genotype or explant. Zeatin riboside was reported by many researchers as an
important cytokinin with high shoot regeneration ability when used alone or in
combination with some auxins in the culture medium (Sheerman and Bevan, 1988;
Snyder and Belknap, 1993; Beaujean et al., 1998; Trujillo et al., 2001; Ducreux et al.,
2005; Banerjee et al., 2006).
Three potato varieties used for shoot regeneration varied significantly for the
percentage of calli inducing shoots and number of days taken for the shoot induction.
Among three varieties of potato tested for shoot induction efficiency on different
media, calli of Desirée exhibited highest mean value of 68.79% for shoot induction
frequency in 32.58 days followed by Diamant with 64.81% shoot induction in 35.31
days and Altamash with 64.80% shoots in 37.83 days. In this study Desirée proved
best cultivar which showed maximum shoot regeneration percentage within minimum
period of time. In vitro regeneration response is generally species and often genotype
specific. Higher shoot regeneration response of Desirée compared to other genotypes
of potato might be attributed to the difference in level of sensitivity of tissue to the
shoot induction medium. Our results are in accordance with previous findings of
different scientists who reported large variations in the efficiency of shoot formation
between different potato genotypes (Hussey and Stacey, 1981; Bajaj, 1981; Miller et
al., 1985; Badr et al., 2008). Similarly, several authors described the influence of
genotype in potato shoot regeneration (Wenzler et al., 1989; Dale and Hampson,
1995; Beaujean et al., 1998; Yee et al., 2001; Hussain et al., 2005).
149
Selection of a well responsive explant source serves as an important factor in
the development of a successful in vitro regeneration system. Potato plantlet
regeneration after callusing was reported from various explant types such as tuber
discs (Lam, 1977; Jarret et al., 1980; Kikuta and Okazawa, 1982; Sheerman and
Bevan, 1988; Snyder and Belknap, 1993), petioles (Yee et al., 2001; Ducreux et al.,
2005), leaf (Wenzler et al., 1989; Yadav and Sticklen, 1995; Alphonse et al., 1998;
Hamdi et al., 1998; Jayasree et al., 2001; Banerjee et al., 2006), internodal and
nodal segments (Austin and Cassells, 1983; Sarker and Mustafa, 2002; Nasrin, 2003;
Khatun et al., 2003; Hussain et al., 2005) etc. In the present study shoot regeneration
was observed from calli of both leaf and internodal segments. Significant differences
were observed between two explant types for percentage callus induction and the
number of days taken to produce callus. Internodal derived calli produced higher
mean shoot induction value of 71.10% in shorter time (33.91 days) as compared to
61.17% shoot induction by leaf calli in 36.57 days. Such variations in shoot
regeneration efficiency among various explant sources were reported by many
researchers in potato and other plants. These variations seem to be related with
structural differences at cellular level among various explant sources. Our results are
in agreement with other results published by different authors who reported that
internodal segments are more responsive to shoot regeneration than leaf or other
explant types (Austin and Cassells, 1983; Nasrin, 2003; Shirin et al., 2007). A large
number of previous reports, contradictory to our findings are also available regarding
the shoot regeneration response of the different explant types. callus derived from leaf
showed higher percentage for plantlet regeneration in shorter duration as compared to
nodal and internodal segments of potato (Sarker and Mustafa, 2002; Yasmin et al.,
2003; Gustafson et al., 2006) while in another study Ducreux et al. (2005) observed
high regeneration potential in petioles as compared to internodal and leaf segments in
Solanum Phureja.
Successful shoot regeneration depended on optimum interaction between
different factors such as genotype, explant type and composition of the culture
medium. Variations were observed for both percentage shoot induction and time taken
for shoot induction in different explant types. These variations were associated with
the genotype and growth hormones in the culture medium. Internodal calli gave
higher percentages for shoot induction in relatively lesser time when compared with
150
leaf calli on all six media for all three genotypes. This means that internodal calli had
better potential for shoot regeneration on all the media used in this study. Shirin et al.
(2007) also reported similar results while studying the shoot regeneration from
different explants derived calli of four potato cultivars on various growth hormonal
combinations. Similarly, the response of variety changed with the type of explant.
When internodal calli were used as explant, Desirée showed higher shoot induction
percentage on SIM2, SIM3 and SIM4 while Diamant gave better response on SIM1
and SIM5. On the other hand when leaf derived calli were used as explant relatively
lower shoot induction percentages with increased time for shoot initiation were
obtained on all the media, with Desirée showing highest response followed by
Altamash and Diamant. Such explant based variations among different potato
genotype on different culture media were also reported previously by Anjum and Ali
(2004a, b). Shoot regeneration studies revealed that both leaf and internodal calli
responded best on SIM3 from all three varieties, however internodal calli were
superior to leaf calli as they took less time to regenerate in higher frequencies.
Internodal calli of Desirée when cultured on SIM3 produce maximum shoot induction
frequency in minimum time and this was selected as best combination for shoot
regeneration. The present investigation revealed that factors like explant source,
variety, media composition and their interaction influence the plant regeneration
efficiency. These revelations are in accordance with that of Islam et al. (2005) and
Pandey et al. (1994).
The well developed elongated shoots of each variety were excised from the
callus and cultured on three different root induction media to induce rooting. Root
induction medium was supplemented with either IAA or IBA or without any
hormone. Significant differences were observed between these three media for
number of roots, root length and number of days taken for root initiation. Root
formation on auxin free medium (RIM1) might be attributed to auxin already present
in the in vitro shoots (Minocha, 1987). Banerjee et al. (2006) also reported successful
root induction from potato shoots on hormone free MS medium with 20 g/l sucrose.
The results of the present study showed that addition of 1 mg/l IBA in ½x MS basal
medium (RIM3) enhanced the rooting efficiency of in vitro regenerated shoots of
potato. Among three rooting media RIM2 (½x MS basal medium with 1 mg/l IBA)
performed best by inducing highest number of roots per shoot (12.78) with highest
151
root length (4.37 cm) in minimum number of days (5.85 days). Our results are
supported by various researchers who reported induction of higher number of roots
with increased root length in a shorter time from potato shoots on medium with 1 mg/l
IBA (Marani and Pisi, 1977; Kayim and Koc, 1992; Zaman et al., 2001). Nagib et al.
(2003) reported highest root formation for potato by using 0.5 mg/l IBA in MS
medium while Elaleem et al. (2009) observed most root formation from callus derived
shoots of potato on half-strength MS medium containing 0.5 mg/l IBA. IBA is a
potential auxin that induced rooting in in vitro regenerated shoots of several other
plants such as Dendrobium moniliforms (Lim et al., 1985), Swaisona formosa
(Jusaitis, 1997) Cunila galoides (Fracro and Echeverrigaray, 2001), lentil (Sarker et
al., 2003), Tylophora indica and Rauvolfia tetraphylla (Faisal et al., 2005) and
Dendrobium orchid (Aktar et al., 2007). Comparison of potato genotypes showed that
genotype main effect was insignificant for root length, number of roots per plantlet
and mean days taken for root induction. Mean root length and number of roots per
plantlet was highest in Desirée, while average time for root induction was lowest in
Diamant. Statistically non significant interaction effect of genotypes with root
induction media for root length, number of roots per plantlet and time taken for root
induction indicated the high level similarity in root induction capacity among the
three genotypes on these rooting media.
Root formation occurred in minimum time (5.51 days) in Diamant shoots on 1
mg/l IBA (RIM2) while highest time (9 days) was observed in Altamash shoots on
MS medium with 2% sucrose but without any growth hormone (RIM1). Similar
results were found by Talukder et al. (2002) who reported minimum number of days
for root induction in Dendrobium orchid by using 1 mg/l IBA. Largest roots (4.52 cm)
were recorded in Altamash shoots on 1 mg/l IBA (RIM2) while shortest roots
(2.71cm) for Diamant on MS medium with 2% sucrose but without any growth
hormone (RIM1). Elaleem et al. (2009) obtained best results for root length at ½ MS
with 0.5 mg/l IBA in case of potato cv. Diamant shoots. Similarly Talukder et al.
(2002) and Akhter et al. (2007) got roots with highest length on MS medium with 1
mg/l IBA in different Dendrobium spp. Maximum number of roots per shoot (13.14)
was recorded at RIM2 in Desirée while minimum (8.46) roots on RIM1 for variety
Diamant. Maximum number of roots/explant in callus derived potato shoots were
152
reported by Elaleem et al. (2009) with half strength MS basal medium supplemented
with 0.5 mg/l IBA.
In conclusion, regeneration of internodes of potato cultivar Desirée on CIM3
achieved maximum callus induction frequency in least number of days. The highest
shoot induction percentage in minimum time was observed in the internodal calli of
Desirée on SIM3. Although, RIM2 increased the root induction frequency and root
length of the transplanted shoots and this media also decreased the number of days to
form roots but RIM1 was used for growing transformed shoots as the rol genes have
similar effects on rooting. These media proved to be the best combination for
producing well developed plants regenerated through tissue culture.
4.2 Optimization of biolistic gene transfer
The study was carried out to establish the conditions optimum for genetic
transformation of potato using Biolistic Gene Gun. A number of factors have already
been reported to control the effectiveness of gene transfer through particle
bombardment such as helium pressure for particle acceleration, target distance,
particle size, number of bombardments, genotype, explant type and osmoticum
(Parveez et al., 1998; Rasco-Gaunt et al., 1999; Romano et al., 2001; Bhat et al.,
2001; Bhatnagar et al., 2002; Tadesse et al., 2003; Janna et al., 2006; Lee et al.,
2007). In an attempt to develop the protocol for transient transformation of potato
using microprojectile bombardment through gene gun, the parameters like
acceleration pressure, target distance, particle size, explant type and osmoticum were
optimized using gus reporter gene.
In the present study three different pressures of helium used for particle
acceleration were studied to select the most favorable pressure for particle
bombardment. Results have shown that the at lower pressure, the gus expression was
low while the percentage of transient gus expression remained highest at 1100 psi
which is in accordance with the results of Ercolano et al. (2004) and Craig et al.
(2005) who used the same pressure for bombardment of potato explants. Similarly,
Parveez et al. (1998); Janna et al. (2006) and Lee et al. (2007) reported comparable
helium pressures for acceleration in different plant species. An increase in this
pressure beyond 1100 psi resulted in the decrease of gus expression which might be
153
due to more cell damage cause by a rapid influx of helium pressure. Several scientists
have reported the results analogous to our findings (Rasco-Gaunt et al., 1999; Bhat et
al., 2001; Bhatnagar et al., 2002; Tadesse et al., 2003) suggesting that the viability of
cells were influenced by the higher pressures of helium.
The explants were placed at two different target distances for gene transfer
through bombardment. Higher gus expression was obtained at the target distance of 6
cm as compared to 9 cm regardless of the other parameters. Better distribution of
microparticles was achieved when explants were placed at 6 cm distance whereas; the
particles were dispersed in a larger area at the distance of 9 cm leaving a considerable
number of explants unbombarded. At the same time previous studies in line with the
present results used the same target distance for potato explants (Romano et al., 2001;
Ercolano et al., 2004; Craig et al., 2005). Conversely, certain workers used different
distances for target explants of other plant species (Parveez et al., 1998; Janna et al.,
2006; Lee et al., 2007).
Two different sizes of particles were used for carrying foreign DNA to the
target tissue. The results obtained showed that the maximum gus expression resulted
when 1.0 µm gold microcarriers were used. These observations were in agreement
with the reports by Xiao and Ha (1997), Schopke et al. (1997), Parveez et al. (1997
and 1998) and Kamo and Blowers (1999) who bombarded tissues of different plants
with the similar size of gold microparticles. On the other hand, different researchers
used 0.6 µm size of microparticles in their experiments (Yang et al., 1999; Craig et
al., 2005; Lee et al., 2007) for potato and different crops. Lower gus transformation
efficiencies with 0.6 µm particles might be attributed to the lower concentration of
foreign DNA coated on these small sized particles.
Internodal and leaf explants were bombarded in order to select the better
explant type for biolistic transformation. Post-bombardment histochemical gus
analysis revealed the higher percentage of internodal explants exhibiting gus activity
when compared with the leaf explants. The present findings are in line with the report
of Romano et al. (2001) who suggested that the type of explant employed as a starting
material for biolistic transformation proved to be a significant factor in the variation
of transformation efficiencies. Variation in percentage gus expression in different
154
tissue types have also been reported by Miki et al. (1993). Moreover, the effect of
explant type on transient or stable expression of gus has not been studied vastly
(Parveez et al., 1998).
The interaction of helium pressure x target distance x particle size x explant
type was analyzed to study the effect of various conditions on transient gus
expression. The highest values of transient gus expression in the internodes were
obtained when helium pressure of 1100 psi, target distance of 6 cm and particle size
of 1.0 µm were used in combination. Changes in any of the three parameters resulted
in lower transient gus expression. When the helium pressure was increased or
decreased keeping the other variables constant a decline in gus expression was
observed. Low helium pressure results in reduced penetration of the microparticles in
the explant that in turn results in lower gus expression. Moreover, increasing the
penetration force by increasing the helium pressure damages the tissue leading to low
gus expression (Janna et al., 2006). Similarly, when the target distance was increased
while other condition remained optimum as above the transient gus expression also
dropped. This drop in gus expression was not compensated by increasing the helium
pressure as tissue injury is caused at high pressures of helium. These results are also
parallel to the findings of Janna et al. (2006). The longer flight distance might reduce
the velocity of microparticles giving reduced force for penetration (Janna et al.,
2006). The effect of increased target distance resulting in decreased gus expression
has also been reported by Oard et al. (1990) and Parveez et al. (1997). The overall
effect of reduced particle size remained unchanged independent of other factors. Any
increase or decrease in helium pressure or target distance did not increase the
percentage gus expression in explants bombarded with 0.6 µm as compared to 1.0 µm.
Similarly, the internodal explants showed results better than leaves for all the
combination of parameters which suggested that leaf explants being more delicate
were prone to injury during particle penetration and the vacuum pressure created
inside the chamber reduced the cell viability due to rapid loss of moisture (McCabe
and Christou, 1993).
Three different osmotic treatments were given to internodal explants 24 hours
before and after particle bombardment. The results revealed that the percentage of
explants exhibiting expression of gus was increased with the addition of 0.1 M
155
mannitol as compared to control explants. A similar effect of addition of 0.1 M
mannitol has already been reported by Romano et al. (2001) for potato internodes
which gave better transformation efficiencies. Conversely, Craig et al. (2005) added
0.2 M mannitol as osmoticum for leaf explants of potato and observed higher
transformation efficiencies. The use of mannitol had also been reported by Parveez et
al. (1998) to influence the transformation efficiencies. Studies have proved that the
transformation rates could be influenced by the concentration, type and duration of
osmoticum (Perl et al., 1992; Vain et al., 1993).
The change in capacity of internodal explants to form callus after
bombardment was also determined at different osmoticum concentrations and types.
The present investigation showed a slight increase in the percentage of calli formed
on callus induction medium when explants were given a 24 hour pre- / post
bombardment osmoticum treatment of 0.1 M mannitol. Cell destruction and
accumulation of ethylene are a consequence of microparticle penetration that causes
the disruption of intracellular lipid membrane (Imaseki, 1986). The present study
confirms that the application of osmotic treatment is essential to minimize wounding
and tissue damage and to enhance the viability of explants (Perl et al., 1992; Ye et al.,
1994) resulting in an increased regeneration capacity of explants.
In conclusion, helium pressure of 1100 psi for acceleration, 6 cm target
distance and 1.0 µm gold particle size were found to be the best combination of
conditions for transforming internodal explants through biolistic gun. Moreover, the
use of different osmoticum treatments had a very little effect on the internodes and
only 7% increase in callus formation was observed when compared with the
bombarded control explants. It was also observed that the callus formation percentage
of these treated and untreated explants after bombardment did not exceed more than
35% which is much lower in comparison to the unbombarded control explants.
Therefore, biolistic transformation methodology was not carried forward for further
stable transformation experiments as the damage done by the vacuum, helium force
and particle penetration to the explants was drastic and they were partially able to
recover from the physical injuries.
156
4.3 Optimization of Agrobacterium mediated transformation
An efficient and reproducible system of plant transformation is based on a
reliable in vitro plant regeneration system, DNA delivery into totipotent cells and
selection of stably transformed cells expressing the foreign DNA (Hewezi et al.,
2002). Agrobacterium mediated transformation and gene transfer through Biolistic
Gun were compared on the basis of transient gus expression in our study. The
conditions for T-DNA delivery has been optimized for both these transformation
methods. The development of an efficient system for Agrobacterium mediated
transformation depends on optimization of certain parameters like cell density of
Agrobacterium culture, inoculation time, co-cultivation duration and type of explant.
Transient gus expression studies were undertaken for the selection of optimum
conditions that in turn present guidelines for the accomplishment of Agrobacterium
mediated stable transformation of Potato cultivar Desirée.
The effect of three different Agrobacterium cell densities (OD600 value of 0.5,
1.0 and 1.5) were studied to determine the suitable bacterial cell concentration that
present maximum transient gus expression. In the present study maximum transient
gus expression was obtained at OD600 = 1.0. When bacterial density lower than 1.0
(OD600 = 0.5) was used lower transient gus expression was observed whereas,
increasing the value of OD600 upto 1.5 also resulted in reduction of transient gus
expression associated with hypersensitivity response of explants to Agrobacterium
infection. Similar results with higher bacterial cells densities have been reported for
sweet orange and safflower, citrange and larch by Orlikowska et al. (1995), Changhe
et al. (2002) and Ismail et al. (2004), respectively. In the present study a decrease in
percentage transient gus expression was recorded at lower cell density, however,
various researchers obtained better transformation efficiencies at bacterial densities
lower than OD600 value of 1.0. Trujillo et al. (2001) and Gustafson et al. (2006)
inoculated leaf explants of potato with Agrobacterium strain LBA4404 having OD600
= 0.6. Moreover, Ducreux et al. (2005) used the optical density of 0.8 for potato
transformation. It is well known that lower cell densities of Agrobacterium lead to
lower transient gus expression, while cell densities more than OD600 = 1.0 result in
necrosis or wilting of explants (Wroblewski et al., 2005). Higher bacterial densities
also lead to overgrowth of Agrobacterium and its uncontrolled growth in successive
cultures (Humara et al., 1999). Thus OD600 = 1.0 was found to be the most suitable
157
bacterial density without compromising transient gus expression and avoiding
Agrobacterial overgrowth in subsequent cultures. The findings of the present study
are in accordance with the protocol of Wenzler et al. (1989) who inoculated potato
leaf explants with A. tumefaciens strain LBA4404 having > 109 bacterial cells/ml ~
OD600 = 1.0. Sarker and Mustafa (2002) and Banerjee et al. (2006) also reported A.
tumefaciens density of OD600 = 0.8-1.0 for infecting nodal, internodal and leaf
explants of potato. Similarly, OD600 value of 1.0 has also been used by Laparra et al.
(1995), Gutiérrez et al. (1997), Bond and Roose (1998), Lucas et al. (2000) and
Müller et al. (2001) in transformation experiments of different plant species.
Internodal explants of potato cultivar Desirée were immersed for two different
durations in Agrobacterium suspension for infection. These results suggested that an
overall increase in the duration of inoculation from 15 to 30 minutes independent of
other variables gave higher percentages of transient gus expression. Similar
inoculation time has already been reported by Kumar et al. (1995) and Beaujean et al.
(1998) for potato transformation. Badr et al. (2008) also recommended that
inoculation time of 30 minutes resulted in maximum gus expression in potato while
the inoculation time of 10 and 20 minutes resulted in lower gus activity which
supports the present findings. Researchers have also reported different durations of
infection for potato transformation. Sheerman and Bevan (1988) while developing a
transformation protocol for potato kept explants for 20 minutes in Agrobacterium cell
suspension. Tavazza et al. (1988) inoculated explants for three different incubation
periods (1, 5 and 10 minutes) and observed a decline in transformation efficiency by
increasing the inoculation time from 1 to 10 minutes. The explants were infected for 5
to 15 minutes with Agrobacterium cells by Snyder and Belknap (1993). Trujillo et al.
(2001) inoculated leaf explants for 10 minutes while Banerjee et al. (2006) applied the
inoculation time of 15 minutes with A. tumefaciens for leaf explants of potato. Sarker
and Mustafa (2002) optimized the inoculation duration for potato explants and found
that 50 minutes of inoculation exhibited maximum gus expression. Gustafson et al.
(2006) transformed potato plants by using inoculation time of two minutes. The
variation in gus expression and transformation efficiencies at different inoculation
times could be associated with type of explants, Agrobacterium strains and density,
infection medium and co-cultivation durations.
158
Once the inoculation process was completed the co-cultivation duration was
optimized for succeeding transformation experiments. Co-cultivation is a critical step
during Agrobacterium mediated transformation and leads to gene transfer after
induction of virulence, therefore, transient expression of gus could be observed from
the explants of potato after this period. While assessing the duration of co-cultivation
it was observed that the co-cultivation duration of 48 hours gave maximum
percentage of transient gus expression hence, a better choice over 24 or 72 hours. Co-
cultivation period of 24 hours resulted in least percentage transient gus expression
while, a slight decline in number of explants showing gus expression was also
observed after co-cultivation duration of 72 hours. Additionally, uncontrolled
overgrowth of Agrobacterium was also witnessed after 72 hours which is harmful to
explants. Therefore, in the present study, 48 hours was preferred as the co-cultivation
time for gene transfer in potato. The co-cultivation period of 48 hours for potato
transformation has already been documented in earlier investigations supporting the
present study. Successful transformation was achieved after 48 hours of co-cultivation
in experiments by An et al. (1986), Tavazza et al. (1988) and Banerjee et al. (2006)
using leaf explants. Similarly, Sheerman and Bevan (1988), Ishida et al. (1989),
Snyder and Belknap (1993) and Kumar et al. (1995) incubated potato tuber discs for
48 hours. In addition, internodal explants were also co-cultivated for 48 hours by
Newell et al. (1991) and Heeres et al. (2002) while, Ducreux et al. (2005) and
Gustafson et al. (2006) reported the co-cultivation period of 48 hours for various
explants of potato. Different researchers have reported the co-cultivation period of 72
hours or more using a variety of potato explants (Wenzler et al., 1989; Beaujean et
al., 1998; Trujillo et al., 2001; Sarker and Mustafa, 2002; Badr et al., 2008) which are
contradictory to our results. It has been established that the infection and T-DNA
transfer depends on various parameters like bacterial concentration, method of tissue
injury and co-cultivation duration (Humara et al., 1999). Xing et al. (2007) also
suggested that different co-cultivation durations could be used for different explants
and species.
Leaf and internodal segments from in vitro potato plants were compared on
the basis of transient gus expression for the selection of one explant in succeeding
stable transformation experiments. Internodal segments presented the higher
percentages of gus expression as compared to explants derived from leaves.
159
Therefore, based on the present findings internodal explants were used for stable
transformation experiments. A number of protocols have been reported earlier which
utilized the internodal explants for successful potato transformation (Ooms et al.,
1987; Visser et al., 1989; Newell et al., 1991; Heeres et al., 2002). In addition,
Beaujean et al. (1998) used split internodes from three potato cultivars by dissecting
them longitudinally and suggested that internodal explants were easier to work with as
they were less sensitive to mechanical injuries when compared with explants derived
from leaves. Ducreux et al. (2005) maintained that leaves were not a valuable explant
source being more liable to injury during handling whereas internodal segments were
less prone to damage. Badr et al. (2008) indicated that explants from stem produced
more callus with higher regeneration efficiency after co-cultivation and selection as
compared to leaf explants. On the other hand, several reports were published using
leaves as explant source for successful potato transformation experiments (An et al.,
1986; Tavazza et al., 1988; Wenzler et al., 1989; Trujillo et al., 2001; Sarker and
Mustafa, 2002; Gustafson et al., 2006; Badr et al., 2008). Banerjee et al. (2006)
suggested that vigorous explant source with precise and even wounding in midrib of
leaf were most important factors for transformation using leaf explants. Although
earlier study has shown that excessive wounding of leaf explant considerably reduced
the transformation and regeneration frequencies (De Block, 1988). The inconsistency
in different reports using explants from various sources is dependent on genotype and
composition of media for specific genotype. Visser (1991) suggested that before
selecting any of these explants, the conditions should be optimized for both leaf and
stem explants.
Based on the above observations, the interaction of bacterial density x
inoculation time x co-cultivation duration x explant type was studied in order to find
the right set of conditions for transforming potato cultivar Desirée. The effect of
interaction between variables was studied on the basis of transient gus expression for
different combinations of conditions. Meanwhile, the present data based on transient
gus expression revealed that the internodes consistently proved better explant than the
leaves. The inoculation and co-cultivation time at lower bacterial density were
directly proportional to the transient gus expression. The increase in inoculation time
and decrease in co-cultivation time or vice versa had almost similar results. Therefore,
any set of conditions using low Agrobacterium density could be used depending on
160
the specific requirements of the transformation experiment. In the current study
maximum transient gus expression at OD600 = 0.5 was achieved in internodes when
inoculated for 30 minutes and co-cultivated for 72 hours. These conditions were in
line with those reported by Beaujean et al. (1998) and Badr et al. (2008). When the
OD600 value was raised to 1.0 and inoculation time and co-cultivation time was
decreased to 15 minutes and 48 hours respectively, we achieved maximum transient
gus expression in the internodes. This combination proved ideal for transformation of
potato cultivar Desirée and was also used for microtuber disc and leaf disc
transformation by Snyder and Belknap (1993) and Banerjee et al. (2006), respectively.
When any one of the variable was changed from the above combination the transient gus
expression either decreased or remained unchanged. The transient gus expression for
both 15 and 30 minutes inoculation time was non significant at OD600 = 1.0 and
therefore, 15 minutes infection was carried out in subsequent experiments in order to
avoid and control Agrobacterial overgrowth.
The concentration of antibiotic in the selection medium controls the bacterial
overgrowth for efficient Agrobacterium mediated transformation. The antibiotics in
the selection medium usually had some negative effects on explant regeneration.
Therefore, the concentration of cefotaxime was optimized in order to eliminate
Agrobacterium completely without affecting the regeneration capacity of the explants
to form callus. The present study has shown that the addition of cefotaxime in the
callus induction medium had a negative effect on callus formation. It was observed
that a decrease in percentage callus formation resulted with the increase of cefotaxime
concentration. The maximum callus induction was observed in the control explants
which were not exposed to cefotaxime at all while the least number of calli were
produced in the medium with 1000 mg/l cefotaxime. Necrosis appeared in the
explants after about two weeks which resulted in low percentage of callus formation
at higher concentration. It has been suggested that the byproducts of antibiotics may
function as growth regulators and modify the tissue culture conditions (Holford and
Newbury, 1992; Lin et al., 1995). Another possible explanation of such a change in
explant response is that the antibiotics cause hypermethylation of DNA affecting the
gene expression that in turn modify plant development (Schmitt et al., 1997). The
percentage survival of explant at 250, 375 and 500 mg/l was not significantly different
and remained more than 73%. Therefore, 500 mg/l cefotaxime concentration was
161
finally selected to inhibit Agrobacterium growth effectively. Ducreux et al. (2005)
used the same concentration of cefotaxime in the selection medium to control the
bacterial growth. Various reports on the use of concentrations lower than 500 mg/l
confirmed that the Agrobacterium growth could effectively be inhibited by
cefotaxime (Tavazza et al., 1988; Ishida et al., 1989; Newell et al., 1991; Snyder and
Belknap, 1993; Kumar et al., 1995; Beaujean et al., 1998; Heeres et al., 2002; Gustafson
et al., 2006; Banerjee et al., 2006).
Selection markers are the fundamental requirement for plant transformation
protocols. Antibiotic (kanamycin) resistance for selection of transformants was used
as selectable marker in the present study. It is considered that the antibiotics like
kanamycin have an influence on callus induction and plant regeneration. The effect of
kanamycin was studied to determine its optimum concentration for selection of
transformed cells without affecting the regeneration potential of explants. The present
study revealed that the addition of kanamycin in the callus induction medium has
inhibitory effects on explant survival and callus induction. Callus induction was
decreased with the increase in concentration of kanamycin. Moreover, the time taken
to form callus was also influenced by the addition of kanamycin. Massive growth of
calli in short time was observed with more than 90% callus induction in the control
treatment without kanamycin, but callus induction was totally prevented by 100 mg/l
kanamycin concentration. Our observations indicate the detrimental effects of
kanamycin on explant and callus viability. Similar observations for different plant
species have also been reported by a number of researchers (Mante et al., 1991;
Escandón and Hahne, 1991; Laparra et al., 1995; De Bondet et al., 1996; Müller et
al., 2001; Alsheikh et al., 2002; Gould et al., 2002 Bhatnagar and Khurana, 2003;
Barik et al., 2005). Interestingly, at kanamycin concentration of 75 mg/l a number of
explants died after short time while other slowly produced yellowish calli which
turned brown at later stages. Moreover, delayed regeneration of transformed potato
shoots at 75 mg/l was also reported by Wenzler et al. (1989). The number of escapes
at low concentration of kanamycin (25 mg/l) was much higher. It was noticed that 50
mg/l kanamycin proved to be the most suitable dosage for selection of transformants
in less time without many escapes. Such escapes on the selection medium were also
noticed by Wenzler et al. (1989) on 50 mg/l kanamycin and Tamura et al. (2003) at
concentrations upto 200 mg/l. Unlike escapes, the transformed plants produce roots
162
clearly at the base from the cut end of shoots when transferred to the rooting media
(Ducreux et al., 2005), which might be helpful in selecting the transformants. The use
of 50 mg/l kanamycin concentration in the selection medium has been reported earlier
for potato transformation by many scientists (Wenzler et al., 1989; Ishida et al., 1989;
Snyder and Belknap, 1993; Ducreux et al., 2005; Banerjee et al., 2006; Gustafson et
al., 2006; Badr et al., 2008).
In conclusion, the best combination of all the variables proved to be the
bacterial density OD600 value of 1.0, inoculation time of 15 minutes and co-cultivation
duration of 48 hours for both type of explants. But the transient gus expression was
15% higher in the internodal explants when compared with leaf discs, therefore, the
internodal explants were used in stable transformation experiments with the above
treatments used in combination. The final concentration of 500 mg/l cefotaxime in
CIM3 was selected for the purpose of Agrobacterium elimination in later experiments
of transformation. Similarly 50 mg/l kanamycin was used to select transgenic explants
after co-cultivation. The transformed plants were finally selected on the basis of
rooting as they produced roots right at the base of the cut end of the shoot in the
rooting medium in contrast to the escapes.
4.4 Agrobacterium mediated stable transformation of potato
Comparison of two methods for potato transformation on the basis of transient
gus expression revealed that Agrobacterium mediated transformation is a method of
choice for gene transfer in potato. The transformation efficiencies based on transient
gus expressions and explant viability were much higher in Agrobacterium mediated
transformation as compared to particle bombardment. Therefore, the parameters
optimized for A. tumefaciens mediated transformation discussed earlier were
employed for the generation of stably transformed potato plants with gus, rolA and
rolC genes.
The successful production of potato plants expressing gus gene proved the
efficiency and reliability of the protocol for Agrobacterium mediated transformation
developed in the present study. Different gus transformed potato plants were analyzed
by histochemical gus assay for the presence of β-Glucuronidase (gus) reporter gene in
various plant tissues which resulted in 34.17% transformation efficiency. PCR
163
analysis for gus and nptII gene performed on the DNA isolated from plants exhibiting
gus expression also confirmed the presence of these genes in the genome of
transformants. Transformation efficiency of 34.17% was also calculated on the basis
of gus positive PCR plants. Different researchers have reported stable transformation
efficiencies in potato ranging from10 to 65% (De Block, 1988), 13 to 51% (Trujillo et
al., 2001) and 33.3 to 92% (Badr et al., 2008). The transformation efficiency was
calculated on the basis of both gus expression and gus positive PCR plants as a
percentage of total cocultivated explants.
The methodology used for transformation of gus gene in potato was further
employed to produce transgenic plants with rolA gene expressed under 70SCaMV
promoter. The sequence analysis rolA and rolC gene in the vectors pLBR29 and
pLBR31 revealed that the size of rolA and rolC gene were in accordance with the
reports of Slightom et al. (1986) and Meyer et al. (2000). Once the sequences were
confirmed Agrobacterium tumefaciens strain LBA4404 harboring pLBR29 (rolA) and
pLBR31 (rolC) was used for further plant transformation experiments. PCR analysis
of rolA transformants confirmed the successful integration of T-DNA carrying the
rolA gene in potato plants. The expected PCR products amplified from these
transgenic plants confirmed the presence of rolA and nptII genes. A transformation
efficiency of 28.0% was estimated on the basis of rolA PCR amplification results.
rolA transformants of potato were morphologically distinct from control plants.
Leaves were small and round in shape, dark green in color, showing moderate to
severe wrinkling with epinasty. Similar changes in leaf morphology due to rolA gene
were also reported in tobacco plant (Schmülling et al., 1988; Sinkar et al., 1988;
Dehio et al., 1993; Michael and Spena, 1995). Stunted growth habit was observed
with reduced internodal distance in rolA transformants of potato. Additionally no
lateral branches were developed indicating a high level of apical dominance. In earlier
studies by various researchers rolA gene was reported to induce dwarfness under
control of CaMV 35S promoter in stably transformed plants of potato, tobacco and
tomato (van Altvorst et al., 1992; Schmülling et al., 1993; Dehio et al., 1993). Most
of the rolA potato transformants showed a decreased efficiency in root development
resulting in smaller roots accompanied with overall slower growth rate of plant.
Similar changes in rooting system were also reported with rolA transgene in
kalanchoe and tomato (White et al., 1985; van Altvorst et al., 1992). In the present
164
study slower growth rate also resulted in lower tuber yield in terms of tuber number
and weight per plant in all the rolA transformants as compared to untransformed
control potato plants. It has been discussed earlier that lower tuber yield per plant was
attained with much variability than control in Ri-transformed plants (Ooms et al.,
1986; van de Geijn et al., 1988). Lower photosynthetic rate due to severely wrinkled
leaves and decreased water uptake due to reduced root area might be the possible
reasons of lower yield of potato tubers. Reduced photosynthetic activity and water
uptake has also been reported by van der Salm et al. (1996).
Potato cv. Desirée was also successfully transformed with rolC gene driven by
70S CaMV promoter using A. tumefaciens strain LBA4404 through previously
optimized protocol. Transformation was confirmed on the basis of PCR analysis of
nptII and rolC gene in the transformed potato plants and transformation frequency of
36.0 % was recorded as a percentage of number of plants tested for rolC PCR.
Expression of the introduced rolC gene altered the morphology of rolC transformed
potato plants. Leaves were narrower in shape with reduced leaf area, more in number
with increased number of leaflets per leaf. Similar altered leaf morphology was
observed in rolC transformants of tobacco under control of 35S CaMV promoter by
different researchers (Schmülling et al., 1988; Oono et al., 1990; Nilsson et al.,
1993b; Scorza et al., 1994). In present study rolC gene under 70S CaMV promoter
resulted in potato plants showing bushy phenotype due to decreased apical
dominance, increased lateral branching, short internodes and dwarfness. Various
scientists reported such phenotypic changes in morphology of transformed plant
associated with rolC gene in tobacco, potato, Atropa belladonna, Chrysanthemum
morifolium, Salpiglossis sinuate and Pelargonium domesticum (Schmülling et al.,
1988; Oono et al., 1990; Nilsson et al., 1993b; Scorza et al., 1994, Altamura, 2004;
Boase et al., 2004; Casanova et al., 2005). Significant improvements were observed
in root system of rolC transformed potato plants. Number of lateral roots and root
hairs were increased with increased root length in transformants as compared to the
control untransformed potato plants. rolC gene was reported to enhance rooting
ability in tobacco (Spena et al., 1987; Schmülling et al., 1988) trifoliate orange and
Japanese persimmon (Kaneyoshi and Kobayashi, 1999; Koshita et al., 2002) and
carnation plants (Zuker et al., 2001; Casanova et al., 2003 and 2004). However,
according to some reports root length of potato and tobacco rolC transgenic plants
165
showed no difference with their respective controls (Fladung, 1990; Schmülling et al.,
1993; Scorza et al., 1994) while a reduced root system in rolC transgenic roses was
observed that was highly susceptible to diseases and insects (Souq et al., 1996). In the
present study it was observed that rolC transgenic plants produced tubers with more
number of eyes and changed phenotype. Long branched tubers with increased number
of eyes were also observed by Fladung (1990) and Romanov et al. (1998) in rolC
transgenic potato plants. An increase in mean number of tubers and a decrease in
mean tuber weight per potato plant were observed in the present study. Similar
findings were also reported by Fladung (1990), Fladung and Ballvora (1992) and
Romanov et al. (1998). Fladung (1990) correlated such increase in number of tubers
with an increase in lateral appendages of stolon. It is therefore, suggested that the
increased number of tubers compete for nutrients resulting in reduced tuber weight.
Southern blot analysis of potato transformants with gus, rolA and rolC was
carried out in order to confirm the successful stable integration of nptII gene into the
genome of transformants. Southern blot analysis showed multiple gene insertion
ranging from single to two copies of the nptII gene into T0 plants of rolA, rolC and
gus transformants. This proves the stable integration of the nptII gene into the plants
transformed with rolA, rolC and gus gene. This insertion pattern of DNA is
comparable to the insertion patterns reported in potato by several other researchers
(Sheerman and Bevan, 1988; Tavazza et al., 1988; Wenzler et al., 1989; Fladung and
Ballvora, 1992; Trujillo et al., 2001; Ducreux et al., 2005) using the same
transformation method.
4.5 Role of antimicrobials in rol gene transgenic plants
Antimicrobial assays were carried out from the crude extracts of rolA and rolC
transgenic lines against two fungal strains (Fusarium solani and Alternaria solani)
and three bacterial plant pathogenic strains (Agrobacterium tumefaciens (AT10),
Xanthomonas compestris pv vesicatoria and Pseudomonas syringae pv syringae) in
order to study the effect of rol genes in plant defense after their transformation in
Desirée plants. A considerable increase in antifungal and antibacterial activities was
observed for all the transgenic lines. Natural plant products like phenols and
flavonoids impart a significant role in plant defense by their antimicrobial activities.
The determination of total phenolics and flavonoids from the crude extracts revealed
166
the enhanced production of these compounds in the rol gene transgenic lines as
compared to the untransformed control plants.
In present study rolA transgenic lines showed significant antimicrobial activity
against all fungal and bacterial strains used but most effective growth suppression was
observed for fungal strain F. solani and bacterial strain P. syringae. Significant
differences of relative growth suppression were observed within rolA transgenic lines.
Among all the rolA transgenic lines, RAB4 P7C8 showed maximum antifungal
activity against both A. solani and F. solani followed by RAB1 P10C4. Similarly,
RAB4 P17C8 showed promising antibacterial activity against bacterial strain P.
syringae and also exhibited significantly higher growth suppression against AT 10
and X. compestris among all the rolA lines. In the present study, estimation of total
phenolics and flavonoids revealed a positive correlation between microbial growth
suppression and enhanced productions of these compounds in the transgenic lines.
The synthesis of phenolics and flavonoids in uninfected healthy plants has already
been reported to inhibit the microbial growth as preformed antimicrobial compounds
(Lattanzio et al., 2001). Free radicals of phenol and quinones which are produced as a
result of oxidation of phenolic compounds inactivate the enzymes produced by
pathogens resulting in successful defense response (Appel, 1992). Flavonoids play an
important role in plant resistance against disease and stress. Moreover, antimicrobial
activities of flavonoids from plants have also been demonstrated (Grayer and
Harborne, 1994; Yilmaz and Toledo, 2004). In the present study an overall increase in
the phenolic and flavonoid contents in rolA transformed plants can be associated with
the change in secondary metabolism by rolA gene expression which in turn increased
the antimicrobial activities. The modified secondary metabolism of rolA transgenic
plants has also been reported by Bulgakov (2008). Reports on the increased
production of nicotine by the introduction of rolA gene demonstrated the altered
secondary metabolism in rolA transgenics (Palazón et al., 1997). A three fold
increased production of anthraquinones (AQs) in rolA transgenic Rubia cordifolia
calli was observed by Shkryl et al. (2007). AQs, a by product of phenol oxidation,
have been reported to exhibit plant defense reaction (Kiselev et al., 2006; Bulgakov et
al., 2008) by their activity against microbes.
167
The rolC transgenic lines also showed a significant increase in antimicrobial
activity against the range of fungal and bacterial strains. However, it was observed
that rolC transgenic lines confer maximum suppression in growth of fungal strain F.
solani and bacterial strain P. syringae. Different transgenic lines of rolC varied
among each other in their activities for fungal growth suppression. RCB1 P1C2b
exhibited maximum growth suppression of F. solani and A. solani followed by RCB2
P10C7b among all the transgenic lines of rolC. Likewise, RCB1 P1C2b was most
effective against P. syringae, X. compestris and AT 10 as it produced highest
suppression of growth of these three bacterial strains. When compared with rolA
transgenic lines, overall antifungal activity of rolC transgenic lines was nearly three
folds higher against F. solani than rolA lines while almost similar overall growth
suppression activities was observed for A. solani by both rolA and rolC lines. Among
all the transgenic lines, rolC lines largely produced promising inhibitory result against
bacterial strain P. syringae when compared with rolA against the same strain.
However, the overall effectiveness of rolC transgenic lines was almost similar with
that of rolA lines against AT 10. Moreover, the activities of rolA lines remained
lowest against X. compestris as compared to the rolC lines. Such enhanced level of
antimicrobial activity in rolC transgenic potato lines could be associated with increase
in total phenolics and flavonoids observed in the crude extracts of various rolC
transgenic lines. The role of secondary metabolites including phenolics and
flavonoids in imparting the antimicrobial activity and subsequently increasing the
defense response has already been studied extensively (Appel, 1992; Grayer and
Harborne, 1994; Lattanzio et al., 2001; Yilmaz and Toledo, 2004). It is suggested that
rolC gene might be involved in the activation of secondary metabolic processes
leading to the enhanced production of metabolites like AQs and ginsenosides in plants
(Bulgakov, 2008).
It is therefore, suggested that enhanced production of phenolics and flavonoids
in rol gene potato transformants in the present study might be involved in plant
defense reactions as revealed by the increased antimicrobial activities in addition to
the other gene dependant plant defense reactions involving PR proteins, calcium
dependent protein kinases, phytoalexins, salicylic acid and benzoic acid.
168
4.6 Role of antioxidants in rol gene transgenic plants
Oxidative metabolism in the cells alters with plant defense responses. Toxic
oxygen species, free radicals of phenolic compounds and reactive quinones are
usually produced in these defense reactions (Hammerschmidt, 2005a). The increased
level of ROS is also harmful for the plant cells and therefore, a competent antioxidant
system comprising phenolics, flavonoids, alkaloids, carotenoids, α-tocopherols,
ascorbate, glutathione, polyamines and various other compounds (Hammond-Kosack
and Jones, 1996; Mullineaux et al., 1997) should be present in plants to alleviate the
toxicity of such defensive reactions (Foyer et al., 1994). Crude extracts of rolA and
rolC transformed potato lines were analyzed for their antioxidant activity by using
DPPH free radical scavenging method. All the transgenic lines showed significantly
higher antioxidant activity as compared to gus transformed and untransformed control
Desirée plants. In the present study rolA transgenic lines have shown better
antioxidant activities than rolC transgenic lines by scavenging more free radicals. The
antioxidant activity of RAB4 P7C8 was highest among rolA transgenic lines giving a
75.35% increase than control while RCB1 PIC2b exhibited 61.58% higher antioxidant
activity than control among all the rolC transgenic lines. The results of estimation of
total phenolics and flavonoids in these rol genes transgenic lines revealed a significant
positive relation between higher antioxidant activity and increased secondary
metabolites including phenolics and flavonoids. Phenolic compounds have been
reported to scavenge the surge of ROS produced in plant tissues during stress or
pathogen attack (Baker and Orlandi, 1995; Takahama and Oniki, 1997; Rice-Evans et
al., 1997; Kangatharalingam et al., 2002). Similarly, in addition to the activities of
flavonoids in plant defense their physiological role as antioxidants compounds have
also been discovered (Caldwell et al., 1983; Rosahl, 1996; Moran et al., 1997; Rice-
Evans and Miller, 1998; Kubo et al., 1999). Present findings are also in line with the
observations of Bulgakov et al. (2008) who reported the suppressed levels of ROS as
a consequence of higher antioxidant activity in rolC transformed cells. Similarly, light
stimulated increased levels of ROS were suppressed in the rolC transformed cells as
compared to the controls (Bulgakov et al., 2008). Increased antioxidant activity of rol
gene transformants may improve the plant defense response by alleviating the
oxidative damages.
169
The results of antifungal, antibacterial and antioxidant assays revealed an
increase in these activities of different rol gene transgenic lines. Moreover, an overall
increase in the secondary metabolites like phenolics and flavonoids were also
observed for these transgenic lines. These results have shown that the antimicrobial
and antioxidant activities of transgenic lines were significantly enhanced with the
increased levels of total phenolics and flavonoids. The transgenic lines which
produced more phenolics and flavonoids also possessed higher antimicrobial and
antioxidant activities while, these activities remained lower for those lines which
showed comparatively less increase in their total phenolic and flavonoid contents.
These studies suggest that rol genes expression in transformed plants enhances the
production of secondary metabolites by altering the metabolism which in turn
increases the plant defense responses as indicated by their increased antimicrobial and
antioxidant activities.
170
Conclusions and Future Strategies
Following conclusions were drawn from the present study:
• All the three genotypes of potato (Diamant, Desirée and Altamash) have
shown variable regeneration responses but Desirée proved best for in vitro
regeneration.
• Factors like genotype, explant type and composition of medium affect the in
vitro regeneration ability.
• Among all the three explants (tuber discs, leaf strips and internodal segments)
used for in vitro regeneration, maximum callus and shoot formation were
observed in internodal segments followed by leaf strips.
• Highest callus induction was observed on MS + 0.2 mg/l NAA + 0.02 mg/l
GA3 + 2.5 mg/l zeatin riboside (CIM3).
• Maximum shoot regeneration was recorded on MS + 0.02 mg/l NAA + 0.02
mg/l GA3 + 2 mg/l zeatin riboside (SIM3).
• Rooting was observed on all the three root induction media (RIM) with slight
variations in root number, root length and time to form root primordia.
• Reporter gene like gus could be used effectively for optimizing protocol for
potato transformation on the basis of transient gus expression.
• Factors including helium pressure, target distance, particle size and osmoticum
have an effect on biolistic transformation of internodal and leaf explants of
potato.
• Agrobacterium mediated transformation was the preferred method of potato
transformation dependant on optimum combination of bacterial density,
inoculation time and co-cultivation period for internodal and leaf explants.
• Stable transformation of potato with gus, rolA and rolC gene was carried out
successfully by employing Agrobacterium mediated transformation.
171
• rolA and rolC gene expression in transformed plants altered the plant
morphology and tuber yield.
• Crude extracts of rolA and rolC gene transgenic plants revealed higher
antifungal activities against Fusarium solani and Alternaria solani indicating
enhanced resistance of the transgenic plants against these pathogens.
Similarly, these extracts also showed an increase in antibacterial activities
against plant pathogenic bacteria including Agrobacterium tumefaciens strain
AT 10, Xanthomonas compestris and Pseudomonas syringae.
• rol genes enhanced the antioxidant activity of transformed potato plants.
Increased antioxidant activity of rol gene transformants may improve the plant
defense response by lowering the ROS produced after pathogen attack.
• Increased antimicrobial and antioxidant activities could be related with the
enhanced production of secondary metabolites like phenolics and flavonoids
in rolA and rolC transformed plants.
• Further research may be carried out to study the gene expression in T1 and T2
generations by RT-PCR and Northern blot analysis.
• In vivo antimicrobial assays may be carried out for T1 and T2 generations.
• Antioxidant activities of tubers from next generations could be analyzed.
• Carotenoid contents of the tubers of rol transgenic lines could be determined.
• T1 and T2 generations could be evaluated for abiotic stresses like salt and
drought stress.
172
References
Abbasi KU (2001). Potato plant regenerated from meristem tip culture and microtuber
formation from regenerated plants. M.Sc. thesis. Sindh Agric.Univ. Pak., pp:
85.
Agrawal GK, Rakwal R, Tamogami S, Yonekura M, Kubo A, Saji H (2002).
Chitosan activates defense/stress response(s) in the leaves of Oryza sativa
seedlings. Plant Physiol. Biochem. 40: 1061–1069.
Ahloowalia BS (1982). Plant regeneration from callus culture in potato. Euphytica 31:
755-759.
Ahmed S, Bhatti M, Hidayatullah K, Qurashi A (1993). An improved method for in
vitro multiplication of potato. Adv. in Plant Tiss. Cult. Pak. 61–65.
Ahrenholtz I, Harms K, de Vries J, Wackernagel W (2000). Increased killing of
Bacillus subtilis on the hair roots of transgenic T4 lysozyme-producing
potatoes. Appl. Environ. Microbiol. 66: 1862–1865.
Akhtar N, Munawwar MH, Hussain M, Mahmood M (2006). Sterile shoot production
and direct regeneration from the nodal explants of Potato cultivars. Asian J.
Plant Sci. 5 (5): 885-889.
Akhter S, Nasiruddin KM, Khaldun ABM (2007). Organogenesis of Dendrobium
orchid using traditional media and organic extracts. J. Agric. Rural Dev. 5
(1&2): 30-35.
Alphonse M, Badawi MA, Eldeen TMN, Elfar MM (1998). Factors affecting
regeneration ability of potato plants in vitro. Egypt J. Hort. 25: 129-144.
Alsheikh MK, Suso HP, Robson M, Battey NH, Wetten A (2002). Appropriate choice
of antibiotic and Agrobacterium strain improves transformation of antibiotic-
sensitive Fragaria vesca and F.v. semperflorens. Plant Cell Rep. 20: 1173–
1180.
173
Altamura MM (2004). Agrobacterium rhizogenes rolB and rolD genes: regulation and
involvement in plant development. Plant Cell Tiss. Org. Cult. 77: 89–101.
An G, Watson BD, Chiang CC (1986). Transformation of Tobacco, Tomato, Potato
and Arabidopsis thaliana using a Binary Ti Vector System. Plant Physiol. 81:
301-305.
Anjum MA, Ali H (2004a). Effect of culture medium on direct organogenesis from
different explants of various Potato genotypes. Biotech. 3: 187-193.
Anjum MA, Ali H (2004b). Effect of culture medium on shoot initiation from calluses
of different origin in potato (Solanum tuberosum L.). Biotech. 3: 194-199.
Appel HM (1992). Phenolics in ecological interactions-the importance of oxidation.
J. Chem. Ecol. 19: 1521–1552.
Arce P, Moreno M, Gutierrez M, Gebauer M, Dell'Orto P, Torres H, Acuna I, Oliger
P, Venegas A, Jordana X, Kalazich J, Holuigue L (1999). Enhanced resistance
to bacterial infection by Erwinia carotovora subsp. atroseptica in transgenic
potato plants expressing the attacin or the cecropin SB-37 genes. Am. J. Pot.
Res. 76: 169-177.
Austin S, Cassells AC (1983). Variation between plants regenerated from individual
calli produced from separated potato stem callus cells. Plant Sci.
Badoni A, Chauhan JS (2009). Microtuber: A source of germplasm conservation,
Report and Opinion 1 (3): 69-71.
Badr E, Mabrouk Y, Rakha F, Ghazy A (2008). Agrobacterium tumefaciens-mediated
transformation of Potato and analysis of genomic instability by RAPD. Res. J.
Agric. Biol. Sci. 4 (1): 16-25.
Bajaj YPS (1981). Regeneration of plants from potato meristems freeze preserved for
24 months. Euphytica 30 (1): 141-145.
Baker CJ, Orlandi EW (1995). Active oxygen in plant pathogenesis. Annu. Rev.
Phytopathol. 33: 299-321.
174
Banerjee AK, Prat S, Hannapel DJ (2006). Efficient production of transgenic potato
(S. tuberosum L. ssp. andigena) plants via Agrobacterium tumefaciens
mediated transformation. Plant Sci. 170: 732-738.
Barik DP, Mahapatra U, Chand PK (2005). Transgenic grasspea (Lathyrus sativus L.):
factors influencing Agrobacterium-mediated transformation and regeneration.
Plant Cell Rep. 24 (9): 523-31.
Bayles CJ, Ghemawat MS, Aist JR (1990). Inhibition by 2-deoxyglyglucose of callose
formation, papillae deposition and resistance to powdery mildew in mlo barley
mutant. Physiol. Molec. Plant Pathol. 36: 63-72.
Beaujean A, Sangwan RS, Lecardonnel A, Sangwan-Norrel BS (1998).
Agrobacterium-mediated transformation of three economically important
potato cultivars using sliced internodal explants: an efficient protocol. J. Exp.
Bot. (326): 1589-1595.
Beckman CH (2000). Phenolic-storing cells: keys to programmed cell death and
periderm formation in wilt disease resistance and in general defence responses
in plants? Physiol. Mol. Plant Pathol. 57: 101-110.
Beffa RS, Hofer RM, Thomas M, Meins F (1996). Decreased susceptibility to viral
disease of beta-1,3-glucanase-deficient plants generated by antisense
transformation. Plant Cell 8: 1001–1011.
Bendahmane A, Kanyuka K, Baulcombe DC (1999). The Rx gene from potato
controls separate virus resistance and cell death responses. Plant Cell 11: 781-
791.
Berrios EF, Gentzbittel L, Serieys H, Alibert G, Sarrafi A (1999). Influence of
genotype and gelling agents on in vitro regeneration by organogenesis in
sunflower. Plant Cell Tiss. Org. Cult. 59: 65-69.
Bhat V, Dalton SJ, Kumar S, Bhat BV, Gupta MG, Morris P (2001). Particle-inflow
gun-mediated genetic transformation of buffel grass (Cenchrus ciliaris L.):
optimizing biological and physical parameters. J. Appl. Genet. 42: 405-412.
175
Bhatnagar S, Kapur A, Khurana P (2002). Evaluation of parameters for high
efficiency gene transfer via particle bombardment in Indian mulberry. Ind. J.
Exp. Biol. 40: 1387-1393.
Bhatnagar S, Khurana P (2003). Agrobacterium tumefaciens mediated transformation
of Indian mulberry-Morus indica cv. K2: a time-phased screening strategy.
Plant Cell Rep. 21: 669-675.
Birch RG (1997). Plant transformation: problems and strategies for practical
application. Annu. Rev. Plant Physiol. Plant Mol. Biol. 48: 297-326.
Boase MR, Winefield CS, Lill TA, Bendall MJ (2004). Transgenic Regal
pelargonium that express the rolC gene from Agrobacterium rhizogenes
exhibit a dwarf floral and vegetative phenotype, In vitro Cell. Dev.-Plant 40:
46-50.
Bohlmann H (1994). The role of thionins in plant protection. Crit. Rev. Plant Sci. 13:
1-16.
Bolwell GP, Butt VS, Davies DR, Zimmerlin A (1995). The origin of the oxidative
burst in plants. Free Rad. Res. 23 (51): 7-532.
Bolwell GP, Wojtaszek P (1997). Mechanisms for the generation of reactive oxygen
species in plant defense: a broad perspective. Physiol. Mol. Plant Pathol. 51:
347-366.
Bond JE, Roose ML (1988). Agrobacterium-mediated transformation of the
commercially important citrus cultivar Washington navel orange. Plant Cell
Rep. 18: 229-234.
Bowles DJ (1990). Defense-related proteins in higher plants. Annu. Rev. Biochem.
59: 873-907.
Brisson LF, Tenhaken R, Lamb C J (1994). Functions of oxidative cross-linking of
cell wall structural proteins in plant disease resistance. Plant Cell 6: 1703-
1712.
176
Bulgakov VP, Khodakovskaya MV, Labetskaya NV, Chernoded GK, Zhuravlev YN
(1998). The impact of plant rolC oncogene on ginsenoside production by
ginseng hairy root cultures. Phytochem. 49: 1929-1934.
Bulgakov VP, Kusaykin M, Tchernoded GK, Zvyagintseva TN, Zhuravlev YN
(2002a). Carbohydrase activities of the rolC-gene transformed and non
transformed ginseng cultures. Fitoterapia 73: 638-643.
Bulgakov VP, Tchernoded GK, Mischenko NP, Khodakovskaya MV, Glazunov VP,
Zvereva EV (2002b). Effects of salicylic acid, methyl jasmonate, etephone and
cantharidin on anthraquinone production by Rubia cordifolia callus cultures
transformed with rolB and rolC genes. J. Biotechnol. 97: 213-221.
Bulgakov VP, Tchernoded GK, Mischenko NP, Shkryl YN, Fedoreyev SA, Zhuravlev
YN (2004). The rolB and rolC genes activate synthesis of anthraquinones in
Rubia cordifolia cells by mechanism independent of octadecanoid signaling
pathway. Plant Sci. 166: 1069-1075.
Bulgakov VP (2008). Functions of rol genes in plant secondary metabolism. Biotech.
Adv. 26: 318-324.
Bulgakov VP, Aminin DL, Shkryl YN, Gorpenchenko TY, Veremeichik GN,
Dmitrenok PS, Zhuravlev YN (2008). Suppression of reactive oxygen species
and enhanced stress tolerance in Rubia cordifolia cells expressing the rolC
oncogene. MPMI 21 (12): 1561-1570.
Burbulis N, Blinstrubiene A, Sliesaravicius A, Kupriene R (2007). Some factors
affecting callus induction in ovary culture of flax (Linum usitatissimum L.).
Biologia 53: 21-23.
Burrus M, Chanabe C, Alibert G, Bidney D (1991). Regeneration of fertile plants
from protoplasts of sunflower (Helianthus annuus L.). Plant Cell Rep. 10:
161-166.
Caldwell MM, Robberecht R, Flint SD (1983). Internal filters: Prospects for UV
acclimation in higher plants. Physiol. Plant. 58: 445-450.
177
Campbell MA, Fitzgerald HA, Ronald PC (2002). Engineering pathogen resistance in
crop plants. Transgen. Res. 11: 599-613.
Cardarelli M, Spanò L, De Paolis A, Mauro ML, Nitali G, Constantino P (1985).
Identification of the genetic locus responsible for non-polar root induction by
Agrobacterium rhizogenes 1855. Plant Mol. Biol. 5: 385-391.
Cardarelli M, Mariotti D, Pomponi M, Spanò L, Capone I, Costantino P (1987a).
Agrobacterium rhizogenes T-DNA genes capable of inducing hairy root
phenotype. Mol. Gen. Genet. 209: 475-480.
Cardarelli M, Spanò L, Mariotti D, Mauro ML, Van Sluys MA, Costantino P (1987b).
The role of auxin in hairy root induction. Mol. Gen. Genet. 208: 457-463.
Carneiro M, Vilaine F (1993). Differential expression of the rolA plant oncogene and
its effect on tobacco development. Plant J. 3:785-792.
Casanova E, Zuker A, Trillas MI, Moysset L, Vainstein A (2003). The rolC gene in
carnation exhibits cytokinin- and auxin-like activities. Sci. Hort. 97: 321-331.
Casanova E, Valde´s AE, Zuker A, Fernandez B, Vainstein A, Trillas MI (2004).
rolC-transgenic carnation plants: adventitious organogenesis and levels of
endogenous auxin and cytokinins. Plant Sci. 167: 551-560.
Casanova E, Trillas MI, Moysset L, Vainstein A (2005). Influence of rol genes in
floriculture. Biotechnol. Adv. 23: 3-39.
Chakravarty B, Wang-Pruski G, Flinn B, Gustafson V, Regan S (2007). Genetic
transformation in potato: approaches and strategies. Am. J. Pot. Res. 84 (4):
301-311.
Chang CC, Yang MH, Wen HM, Chern JC (2002). Estimation of total flavonoid
content in propolis by two complementary colorimetric methods. J. Food and
Drug Ana. 10: 178-182.
Changhe YU, Huang S, Chen C, Deng Z, Ling P, Fred G, Gmitter JR (2002). Factors
affecting Agrobacterium-mediated transformation and regeneration of orange
and citragen. Plant Cell, Tiss. Org. Cult. 71: 47-55.
178
Christey MC (2001). Use of Ri-mediated transformation for production of transgenic
plants. In vitro Cell Dev. Biol. 37: 687-700.
Conrath U, Chen Z, Ricigliano JR, Klessig DF (1995). Two inducers of plant defense
responses, 2,6-dichloroisonicotinic acid and salicylic acid, inhibit catalase
activities in tobacco. Proc. Nat. Acad. Sci. USA 92: 7143-7147.
Cooper RM, Resende MLV, Flood J, Rowen MG, Beale MH, Potter U (1996).
Detection and cellular location of elemental sulfur in disease resistant
genotypes of Theobroma cacao. Nature 379: 159-162.
Coruzzi G, Puigdomenech P (1994). Plant Molecular Biology: Molecular Genetic
Analysis of Plant Development and Metabolism. Berlin: Springer-Verlag.
Cowan MM (1999). Plant products as antimicrobial agents. Clin. Microbiol. Rev. 12
(4): 564-582.
Craig W, Gargano D, Scotti N, Nguyen TT, Lao NT, Kavanagh TA, Dix PJ, Cardi T
(2005). Direct gene transfer in potato: a comparison of particle bombardment
of leaf explants and PEG-mediated transformation of protoplasts. Plant Cell
Rep. 24: 603-611.
Dale PJ, Hampson KK (1995). An assessment of morphogenic and transformation
efficiency in a range of varieties of potato (Solanum tuberosum L.). Euphytica
85: 101-108.
Dangl JL, Dietrich RA, Richberg MH (1996). Death don't have no mercy: cell death
programs in plant-microbe interactions. Plant Cell 8: 1793-1807.
Dao L, Friedman M (1994). Chlorophyll, chlorogenic acid, glycoalkaloid, and
protease inhibitor content of fresh and green potatoes. J. Agric. Food Chem.
42: 633-639.
De Block M (1988). Genotype–independent leaf disc transformation of potato
(Solanum tuberosum) using Agrobacterium tumafaciens. Theor. Appl. Genet.
76: 767-774.
179
De Bondet A, Eggermont K, Penninckx I, Goderis I, Broekaert WF (1996).
Agrobacterium- mediated transformation of apple (Malus x domestica Borkh.)
An assessment of factors affecting regeneration of transgenic plants. Plant Cell
Rep. 15: 549-554.
Dehio C, Schell J (1993). Stable expression of a singlecopy rolA gene in transgenic
Arabidopsis thaliana plants allows an exhaustive mutagenic analysis of the
transgene associated phenotype. Mol. Gen. Genet. 241: 359-366.
Dehio C, Grossmann K, Schell J, Schmülling T (1993). Phenotype and hormonal
status of transgenic tobacco plants overexpressing the rolA gene of
Agrobacterium rhizogenes T-DNA. Plant Mol. Biol. 23:1199-2110.
Dempsey DA, Silva H, Klessig DF (1998). Engineering disease and pest resistance in
plants. Trends Microbiol. 6 (2): 54-61.
Dixon RA (2001). Natural products and plant disease resistance. Nature 411: 843-847.
Dixon RA, Paiva NL (1995). Stress-induced phenylpropanoid metabolism. Plant Cell
7: 1085-1097.
Doreste V, Ramos PL, Enr´ýquez GA, Rodr´ýguez R, Peral R, Pujol M (2002).
Transgenic potato plants expressing the potato virus X (PVX) coat protein
gene developed resistance to the viral infection. Phytoparasitica, 30 (2): 177-
185.
Ducreux LJM, Morris WL, Taylor MA, Millam S (2005). Agrobacterium-mediated
transformation of Solanum phureja. Plant Cell Rep. 24:10-14.
Durner J, Klessig DF (1996). Salicylic acid is a modulator of tobacco and mammalian
catalases. J. Biol. Chem. 271(45): 28492-28501.
Edwards K, Johnstone C, Thompson CA (1991). A simple and rapid method for the
preparation of plant genomic DNA for PCR analysis. Nucl. Acids Res. 19:
1349.
180
Ehrenfeld N, Romano E, Serrano C, Arce-Johnson P (2004). Replicase mediated
resistance against potato leafroll virus in potato Desirée plants. Biol. Res. 37:
71-82.
Elaleem KG, Modawi RS, Khalafalla MM (2009). Effect of plant growth regulators
on callus induction and plant regeneration in tuber segment culture of potato
(Solanum tuberosum L.) cultivar Diamant. Afr. J. Biotech. 8 (11): 2529-2534.
Ercolano MR, Ballvora A, Paal J, Steinbliss H-H, Salamini F, Gebhardt C (2004).
Functional complementation analysis in potato via biolistic transformation
with BAC large DNA fragments. Mol. Breed. 13: 15–22.
Escandón AS, Hahne G (1991). Genotype and composition of culture medium are
factors important in the selection for transformed sunflower (Helianthus
annuus) callus. Physiol. Plant 81: 367-676.
Estruch JJ, Chriqui D, Grossmann K, Schell J, Spena A (1991a). The plant oncogene
rolC is responsible for the release of cytokinins from glucoside conjugates.
EMBO J. 10: 2889-2895.
Estruch JJ, Parets-Soler A, Schmülling T, Spena A (1991b). Cytosolic localization in
transgenic plants of the rolC peptide from Agrobacterium rhizogenes. Plant
Mo1. Biol. 17: 547-550.
Eyles A, Davies NW, Yuan ZQ, Mohammed C (2003). Host response to natural
infection by Cytonaema sp. in the aerial bark of Eucalyptus globulus. For.
Pathol. 33: 317-331.
Ezhova TA (2003). Genetic control of totipotency of plant cells in an in vitro culture.
Russ. J. Dev. Biol. 34 (4): 197-204.
Faisal M, Ahmad N, Anis M (2005). Shoot multiplication in Rauvolfia tetraphylla L.
using thidiazuron. Plant Cell Tiss. Org. Cult. 80: 187-190.
Faiss M, Strnad M, Redig P, Dolezal K, Hanus J, Van Onckelen H, Schmulling T
(1996). Chemically induced expression of the rolC-encoded β-glucosidase in
181
transgenic tobacco plants and analysis of cytokinin metabolism: rolC does not
hydrolyze endogenous cytokinin glucosides in planta. Plant J. 10: 33-46.
FAO Stat (2009). http://faostat.fao.org/site/567/DesktopDefault.aspx? PageID=567#
Farhatullah M, Abbas Z, Abbas SJ (2007). In vitro effects of gibberellic acid on
morphogenesis of Potato explant. Int. J. Agric. Biol. 1: 181-182.
Farmer EE (1994). Fatty acid signalling in plants and their associated
microorganisms. Plant Mol. Biol. 26: 1423-1437.
Finer JJ (1987). Direct somatic embryogenesis and plant regeneration from immature
embryos of hybrid sunflower (Helianthus annuus L.) on a high sucrose-
containing medium. Plant Cell Rep. 6: 372–374.
Fladung M (1990). Transformation of diploid and tetraploid potato clones with the
rolC gene of Agrobacterium rhizogenes and characterization of transgenic
plants. Plant Breed. 104: 295-304.
Fladung M, Ballvora A (1992). Further characterization of rolC transgenic tetraploid
potato clones, and influence of daylength and level of rolC expression on yield
parameters. Plant Breed. 109: 18-27.
Fladung M, Grossmann K, Ahuja MR (1997a). Alterations in hormonal and
developmental characteristics in transgenic Populus conditioned by the rolC
gene from Agrobacterium rhizogenes. J. Plant Physiol. 150: 420-427.
Fladung M, Kumar S, Ahuja MR (1997b). Genetic transformation of Populus
genotypes with different chimoeric gene constructs constructs: Transformation
efficiency and molecular analysis. Transgen. Res. 6: 111-121.
Flores HE, Vivanco JM, Loyola-Vargas V (1999). Radicle biochemistry: the biology
of root-specific metabolism. Trends Plant Sci. 4: 220-226.
Foyer CH, Descourvieres P, Kunert KJ (1994). Protection against oxygen radicals: an
important defense mechanism studied in transgenic plant. Plant, Cell Environ.
17: 507-523.
182
Fracro F, Echeverrigaray S (2001). Micropropagation of Cunila galoides, a popular
medicinal plant of South Brazil. Plant Cell Tiss. Organ Cult. 64: 1-4.
Fry SC (1987). Intracellular feruloylation of pectic polysaccharides. Planta 171: 205–
211.
Gao A, Hakimi SM, Mittanck CA, Wu Y, Woerner BM, Stark DM, Shah DM, Liang
J, Rommens CMT (2000). Fungal pathogen protection in potato by expression
of a plant defensin peptide. Nature Biotechnol. 18: 1307-1310.
Gargantini PR, Gonzalez-Rizzo S, Chinchilla D, Raices M, Giammaria V, Ulloa RM,
Frugier F, Crespi MD (2006). A CDPK isoform participates in the regulation
of nodule number in Medicago truncatula. Plant J. 48: 843-856.
Ghaffoor A, Shah GB, Waseem K (2003). In vitro response of Potato (Solanum
tuberosum L.) to various growth regulators. Biotechnol. 2 (3): 191-197.
Gould J, Zhou Y, Padmanabhan V, Magallanes-Cedeno ME, Newton RJ (2002).
Transformation and regeneration of loblolly pine: shoot apex inoculation with
Agrobacterium. Mol. Breed. 10: 131-141.
Grayer RJ, Harborne JB (1994). A survey of antifungal compounds from higher
plants, 1982–1993. Phytochem. 37: 19-42.
Grunwald NJ, Flier WG, Sturbanum AK, Garay-Serrano M, van der Bosch BM,
Smart CD, Matuszak JM, Lozoya-Saldana H, Turkensteen LJ, Fry EW (2001).
Population structure of Phytophthora infestans in the Toluca valley region of
central Mexico. Phytopath. 91: 882-890.
Gudmestad NC, Secor GA (1993). Management of soft rot and ring rot. In: Rowe
R.C. (Ed.) Potato Health Management. APS Press, Saint Paul, MN, USA.
Gukasyan IA, Aksenova NP, Konstantinova TN, Golyanovskaya SA, Grishunina EV,
Romanov GA (2001). Agribacterial rol genes change the size of starch grains
in microtubers of transformed Potato (Solanum tuberosum L.) plants. Doklady
Biological Sciences 380: 486-488. Translated from Doklady Akademii Nauk,
Vol. 380 (5) 708–710.
183
Gustafson DI, Brants IO, Horak MJ, Remund KM, Rosenbaum EW, Soteres JK
(2006). Empirical modelling of genetically modified maize grain production
practices to achieve European Union labeling thresholds. Crop Sci. 46: 2133-
2140.
Gutiérrez-E MA, Luth D, Moore GA (1997). Factors affecting the Agrobacterium-
mediated transformation in Citrus and production of sour orange (Citrus
aurantium L.) plants expressing the coat protein gene of citrus tristeza virus.
Plant Cell Rep. 16: 745-753.
Hadi MZ, McMullen MD, Finer JJ (1996). Transformation of 12 different plasmids
into soybean via particle bombardment. Plant Cell Rep. 15: 500-505.
Hahlbrock K, Scheel D, Logemann E, Nürnberger T, Parniske M, Reinold S, Sacks
WR, Schmelzer E (1995). Oligopeptide elicitor mediated defense gene
activation in cultured parsley cells. Proc. Natl. Acad. Sci. USA 92: 4150-4157.
Hain R, Reif HJ, Krause E, Langebartels R, Kndle H (1993). Disease resistance
results from foreign phytoalexin expression in a novel plant. Nature 361: 153-
156.
Hamdi MM, Ceballos E, Ritter E, Galarreta JIR (1998). Evaluation of regeneration
ability in Solanum tuberosum L. Investigación Agraria, Producción y
Protección Vegetales 13: 159-16.
Hammerschmidt R (2005a). Phenols and plant–pathogen interactions: the saga
continues. Physiol. Mol. Plant Pathol. 66: 77-78.
Hammerschmidt R (2005b) Antioxidants and the regulation of defense. Physiol. Mol.
Plant Pathol. 66: 211-212.
Hammond-Kosacke E, Jones JDG (1996). Resistance gene dependent plant defense
responses. Plant Cell 8: 1773-1791.
Hangarter RP, Peterson MD, Good NE (1980). Biological activities of
indoleacetylamino acids and their use as auxins in tissue culture. Plant
Physiol. 65: 761-767.
184
Hansen G, Das A, Chilton MD (1994). Constitutive expression of the virulence genes
improves the efficiency of plant transformation by Agrobacterium. Proc. Natl.
Acad. Sci. USA 91: 7603–7607.
Harper JF, Harmon A (2005). Plants, symbiosis and parasites: a calcium signalling
connection. Nat. Rev. Mol. Cell. Biol. 6: 555-566.
Heath MC (1980). Reaction of nonsuscepts to fungal pathogens. Annu. Rev.
Phytopathol. 18: 211-236.
Heath MC (1998). Apoptosis, programmed cell death and the hypersensitive response.
Eur. J. Plant Pathol. 104: 117-124.
Heeres P, Schippers-Rozenboom M, Jacobsen E, Visser RGF (2002). Transformation
of a large number of potato varieties: genotype-dependent variation in
efficiency and somaclonal variability. Euphytica 124: 13–22.
Hefferon KL, Doyle S, Abouhaidar MG (1997). Immunological detection of the 8K
protein of potato virus X (PVX) in cell walls of PVX-infected tobacco and
transgenic potato. Arch. Virol. 142: 425-433.
Henn HJ, Wingender R, Schnabl H (1998). Regeneration of fertile interspecific
hybrids from cell fusion between Helianthus annuus L. and wild Helianthus
species. Plant Cell Rep. 18: 220-224.
Hewezi T, Perrault A, Alibert G, Kallerhoff J (2002). Dehydrating immature embryo
split apices and rehydrating with Agrobacterium tumefaciens: A new method
for genetically transforming recalcitrant sunflower. Plant Mol. Biol. Rep. 20
(4) 335-345.
Hoekema A, Huisman MJ, Molendijk L, van den Elzen PJM, Cornelissen BJC (1989).
The genetic engineering of two commercial potato cultivars for resistance to
potato virus X. Biotechnol. 7: 273-278.
Holford P, Newbury H (1992). The effects of antibiotics and their breakdown
products on the in vitro growth of Antirrhinum Majas. Plant Cell Rep. 11: 93-
96.
185
Hood EE, Gelvin SB, Melchers LS, Hoekema A (1993). New Agrobacterium helper
plasmids for gene transfer to plants. Transgen. Res. 2: 208-218.
Hooker WJ (1981). Compendium of potato diseases. American Phytopathological
Society, St. Paul, Minnesota, USA.
Horsch RB, Fraley RT, Rogers SG, Sanders PR, Lloyd A, Hoffman N (1984).
Inheritance of functional foreign genes in plants. Science 223: 496-498.
Humara JM, Lopez M, Ordas RJ (1999). Agrobacterium tumefaciens mediated
transformation of Pinus pinea L. cotyledon: an assessment of factors
influencing the efficiency of uidA gene transfer. Plant Cell Rep. 19 (1): 51-58.
Hussain I, Muhammad A, Chaudhry Z, Asghar R, Naqvi SMS, Rashid H (2005).
Morphogenic potential of three Potato (Solanum tuberosum) cultivars from
diverse explants, a prerequisite in genetic manipulation. Pak. J. Bot. 37 (4):
889-898.
Hussey G, Stacey NJ (1981). In vitro propagation of potato (Solanum tuberosum L.).
Ann. Bot. 48: 787-796.
Iapichino G, Chen THH, Fuchigami LH (1991). Adventious shoot production from a
vireya hybrid of rhododendron. Hort Sci. 26: 594-596.
Ikram UH (2005). Callus proliferation and somatic embryogenesis in cotton
(Gossypium hirsutum L.) Afri. J. Biotechnol. 4 (2): 206-209.
Imaseki (1986). Ethylene. In: Takahashi, N. (Ed.), Chemistry of Plant Hormones.
CRC Press, Boca Raton, FL, pp. 249-264.
Iovene M, Barone A, Fruscinate N, Monti L, Carputo D (2004). Selection for
aneuploid potato hybrids combining a low wild genome content and resistance
traits from Solanum commersonii. Theor. Appl. Genet. 109: 1139-1146.
Ishida BK, Suyder GW, Belkuap WR (1989). The use of in vitro-grown microtuber
discs in Agrobacterium-mediated transformation of Russet Burbank and
Lemhi Russet potatoes. Plant Cell Rep. 8: 325-328.
186
Ishii Y, Takamura T, Goi M, Tanaka M (2004). Callus induction and somatic
embryogenesis of Phalaenopsis. Plant Cell Rep. 17 (6): 446-450.
Islam R, Riazuddin S (1993). Effect of genotype and age of seedling on compatible
reaction between chickpea and Agrobacterium rhizogenes. Bangladesh J.
Microbiol. 10 (1): 29-32.
Islam MT, Dembele DP, Keller ER (2005). Influence of explant, temperature and
different culture vessels on in vitro culture for germplasm maintenance of four
mint accessions. Plant Cell Tiss. Org. Cult. 81: 123–130.
Ismail G, Schnabl H, Zoglauer K, Boehm R (2004). Agrobacterium-mediated
transformation of Larix decidua: an assessment of factors influencing the
efficiency of gus gene transfer. J Appl. Bot. Food Qual. Angew. Bot. 78: 83-
90.
Jabs T, Dietrich RA, Dangl JL (1996). Extracellular superoxide initiates runaway cell
death in an Arabidopsis mutant. Science 273: 1853-1856.
Jacks TJ, Davidonis GH (1996). Superoxide, hydrogen peroxide, and the respiratory
burst of fungally infected plant cells. Mol. Cell. Biochem. 158: 77-79.
Janna OA, Maziah M, Parveez GKA, Saleh K (2006). Factors affecting delivery and
transient expression of β-glucuronidase gene in Dendrobium sonia
protocormlike- body. Afr. J. Biotechnol. 5 (2): 88-94.
Jarret RL, Hasegawa PM, Erickson HT (1980). Effects of medium components on
shoot formation from cultured tuber discs of potato. J. Am. Soc. Horticult. Sci.
105: 238-242.
Jayasree T, Pavan U, Ramesh M, Rao AV, Reddy KJM, Sadanandam A (2001).
Somatic embryogenesis from leaf culture of potato. Plant Cell Tiss. Org. Cult.
64: 13-17.
Jefferson RA, Kavanagh TA, Bevan MW (1987). GUS fusion: β-glucuronidase as a
sensitive and versatile gene fusion marker in higher plants. EMBO J. 6: 3901-
3907.
187
Jusaitis M (1997). Micropropagation of adult Swaisona formosa Leguminosae:
Papilionoideae: Galegeae. In Vitro Cell. Dev. Biol. Plant 33: 213-220.
Kamo K, Blowers A (1999). Tissue specificity and expression level of gusA under
rolD, mannopine synthase and translation elongation factor 1 subunit ββ
promoters in transgenic Gladiolus plants. Plant Cell Rep.18: 809-815.
Kaneyoshi J, Kobayashi S (1999). Charactersitics of transgenic trifoliate orange
(Ponicirus trifoliate Raf.) possessing the rolC gene of Agrobacterium
rhizogenes Ri plasmid. J. Japan Soc. Hort. Sci. 68: 734-738.
Kangatharalingam N, Pierce ML, Bayles MB, Essenberg M (2002). Epidermal
anthocyanin production as an indicator of bacterial blight resistance in cotton.
Physiol. Mol. Plant Pathol. 61: 189-195.
Kanwal A, Ali A, Shoaib K (2006). In vitro microtuberization of Potato (Solanum
tuberosum L.) cultivar Kuroda- A new variety in Pakistan. Int. J. Agric. Biol.
8 (3): 337-340.
Kawchuk LM, Martin RR, McPherson J (1990). Resistance in transgenic potato
expressing the potato leafroll virus coat protein gene. MPMI 3 (5): 301-307.
Kayim M, Koc NK (1992). Obtaining of virus free potato (Solanum tuberosum L.)
planting stock material through meri stem culture. Doga, Turk Tarum ve
Ormancilik Dergis. 16 (2): 380-391.
Khatun N, Bari MA, Islam R, Huda S, Siddque NA, Rahman MA, Mullah MU
(2003). Callus induction and regeneration from nodal segment of potato
cultivar Diamant. J. Biol. Sci. 3: 1101-1106.
Kikuta Y, Okazawa Y (1982).Shoot-bud formation and plantlet regeneration in potato
tuber tissue cultured in vitro. J. Fac. Agr. Hokkaido Univ. 61 (1): 166-179.
Kiselev KV, Kusaykin MI, Dubrovina AS, Bezverbny DA, Zvyagintseva TN,
Bulgakov VP (2006). The rolC gene induces expression of a pathogenesis-
related β-1,3-glucanase in transformed ginseng cells. Phytochem. 67: 2225-
2231.
188
Kiselev KV, Gorpenchenko TY, Tchernoded GK, Dubrovina AS, Grishchenko OV,
Bulgakov VP (2008). Calcium-dependent mechanism of somatic
embryogenesis in Panax ginseng cell cultures expressing the rolC oncogene.
Mol. Biol. 42: 243-252.
Klee H, Horsch R, Rogers S (1987). Agrobacterium-mediated plant transformation
and its further applications to plant biology. Ann. Rev. Plant Physiol. 38: 467-
486.
Klessig DF, Malamy J (1994). The salicylic acid signal in plants. Plant Mol. Biol. 26:
1439-1458.
Kohli A, Griffiths S, Palacios N, Twyman RM, Vain P, Laurie DA, Christou P
(1999). Molecular characterization of transforming plasmid rearrangements in
transgenic rice reveals a recombination hotspot in the CaMV 35S promoter
and confirms the predominance of microhomology mediated recombination.
Plant J. 17: 591-601.
Kojima M, Kondo T (1985). An enzyme in sweet potato root which catalyzes the
conversion of chlorogenic acid, 3-caffeoylquinic acid, to isochlorogenic acid,
3,5-dicaffeoylquinic acid. Agric. Biol. Chem. 49: 2467-2469.
Koshita Y, Nakamura Y, Kobayashi S, Morinaga K (2002). Introduction of the rolC
gene into the genome of the Japanese persimmon causes dwarfism. J. Japan
Soc. Hortic. Sci. 71: 529-531.
Kubo J, Lee JR, Kubo I (1999). Anti-helicobacter pylori agents from the cashew
apple. J. Agric. and Food Chem. 47: 533-537.
Kumar A, Miller M, Whitty P, Lyon J, Davie P (1995). Agrobacterium mediated
transformation of five wild Solanum species using in vitro microtubers. Plant
Cell Rep. 14: 324-328.
Kurioka Y, Suzuki Y, Kamada H, Harada H (1992). Promotion of flowering and
morphological alterations in Atropa belladonna transformed with a CaMV
35S-rolC chimeric gene of the Ri plasmid. Plant Cell Rep. 12, 1-6.
189
Lam SL (1975). Shoot formation from potato tuber discs in vitro. Am. Pot. J. 54: 465-
467.
Lam SL (1977). Regeneration of plantlets from single cells in potatoes. Am. Pot. J.
54: 575.
Lane BG (1994). Oxalate, germin, and the extracellular matrix of higher plants.
FASEB J. 8: 294-301.
Laparra H, Burrus M, Hunold R, Damm B, Bravo-Angel A, Bronner R, Hahne G
(1995). Expression of foreign genes in sunflower (Helianthus annuus L.) -
evaluation of three gene transfer methods. Euphytica 85: 63-74.
Lattanzio V, Di Venere D, Linsalata V, Bertolini P, Ippolito A, Salerno M (2001).
Low temperature metabolism of apple phenolics and quiescence of Phlyctaena
vagabunda. J.Agric.Food Chem. 49: 5817–5821.
Lee CW, Wang LJ, Ke SQ, Qin MB, Cheng ZM (1996). Expression of the rolC gene
in transgenic plants of Salpiglossis sinuata L. Hort. Sci. 31: 571.
Lee SY, Kim HS, Kwon TO (2004). Variation in anther culture response and fertility
of backcrossed hybrids between indica and japonica rice (Oryza sativa). Plant
Cell Tiss. Org. Cult. 79: 25-30.
Lee SY, Kim MS, Kim JY, Mok IG (2007). Optimal conditions for gene transfer
through particle bombardment and Agrobacterium-mediated transformation in
Oncidium. Flower Res. J. 15 (3): 145-150.
Léon J, Lawton MA, Raskin I (1995). Hydrogen peroxide stimulates salicylic acid
biosynthesis in tobacco. Plant Physiol. 108: 1673-1678.
Levine A, Tenhaken R, Dixon R, Lamb C (1994). H2OP from the oxidative burst
orchestrates the plant hypersensitive disease resistance response. Cell 79, 583-
593.
Liapkova NS, Loskotova NA, Maisurian AN, Mazin VV, Korableva NP, Platonova
TA, Ladyzhenskaia EP, Evsiunina AS (2001). Isolation of genetically
190
modified potato plant containing the gene of defensive peptide from
Amaranthus. Prikl. Biokhim. Mikrobiol. 37: 349–354.
Lim-Ho EL, Lee GC, Phua LK (1985). Clonal propagation of orchids from flower
buds. Proc. 50th
Asian Orchid Congress, Singapore. 90-110.
Lin JJ, Assadgarcia N, Kuo J (1995). Plant hormone effect of antibiotics on the
transformation efficiency of plant tissues by Agrobacterium tumefaciens cells.
Plant Sci. 109: 171-177.
Lindeque JM, van der Mescht A, Slabbert MM, Henn G (1991). Variation in
phenotype and proteins in plants regenerated from cell suspensions of potato
cv. BP1. Euphytica, 54: 41-44.
Liu D, Raghothama KG, Hasegawa PM, Bressan RA (1994), Osmotin overexpression
in potato delays development of disease symptoms. Proc. Natl. Acad. Sci.
USA 91: 1888-1892.
Lorito M, Woo SL, Fernandez-Garcia I, Colucci G, Harman GE, Pintor-Toro JA,
Filippone E, Muccifora S, Lawrence CB, Zoina A, Tuzun S, Scala F (1998).
Genes from mycoparasitic fungi as a source for improving plant resistance to
fungal pathogens. Proc. Natl. Acad. Sci. USA 95: 7860-7865.
Lucas O, Kallerhoff J, Alibert G (2000). Production of stable transgenic sunflowers
(Helianthus annuus L.) from wounded immature embryos by particle
bombardment and co-cultivation with Agrobacterium tumefaciens. Mol.
Breed. 6: 479-487.
Maniatis T, Fritsch EF, Sambrook J (1982). Molecular Cloning, a Laboratory Manual.
Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Mante S, Morgens PH, Scorza R, Cordts JM, Callahan AM (1991). Agrobacterium-
mediated transformation of plum (Prunus domestica L.) hypocotyl slices and
regeneration of transgenic plants. Biotechnol. 9: 853-857.
191
Marani F, Pisi A (1977). Meristem-tip culture and vegetative propagation in potato.
ISHS Horticulturae 78: Symposium on tissue culture for horticultural
purposes, 56.
Maroti M, Rudolf J, Bognor J, Pozsar BI (1982). In vitro plantlets from potato shoot
segments. Acta Botanica Academiae Scientiarum Hungaricae 28: 127-132.
Martel A, Carcia E (1992). In vitro formation of adventitious shoots on discs of potato
(Solanum tuberosum L. cv. Sebago) tubers. Phyton Buenos Aires 53: 57-64.
Martin-Tanguy J, Corbineau F, Burtin D, Ben-Hayyim G, Tepfer D (1993). Genetic
transformation with a derivative of rolC from Agrobacterium rhizogenes and
treatment with alpha-amino isobutyric acid produce similar phenotypes and
reduce ethylene production and the accumulation of water insoluble
polyaminehydroxycinnamic acid conjugates in tobacco flowers. Plant Sci. 93:
63-76.
Martin-Tanguy J, Sun L-Y, Burtin D, Vernoy R, Rossin N, Tepfer D (1996).
Attenuation of the phenotype caused by the root-inducing, left-hand,
transferred DNA and its rolA gene. Plant Physiol. 111: 259-267.
Mauch-Mani B, Slusarenko AJ (1996). Production of salicylic acid precursors is a
major function of phenylalanine ammonia-lyase in the resistance of
Arabidopsis to Peronospora parasitica. Plant Cell 8: 203-212.
Maurel C, Barbier-Brygoo H, Spena A, Tempé J, Guern J (1991). Single rol genes
from the Agrobacterium rhizogenes TL-DNA alter some cellular responses to
auxin in Nicotiana tabacum. Plant Physiol. 97: 212-216.
McCabe D, Christou P (1993). Direct DNA transfer using electric discharge particle
acceleration (ACCELL™ technology). Plant Cell Tiss. Org. Cult. 33: 227-236.
McDonald S, Prenzler PD, Autolovich M, Robards K (2001). Phenolic content and
antioxidant activity of olive extracts. Food Chem. 73: 73-84.
McElroy D, Brettell RIS (1994). Foreign gene expression in transgenic cereals.
Trends Biotechnol. 12: 62-68.
192
Mehdy MC (1994). Active oxygen species in plant defense against pathogens. Plant
Physiol. 105: 467-472.
Melchers LS, Apotheker-de Groot M, Van der Knaap JA, Ponstein AS, Sela Buurlage
MB, Bol JF, Cornelissen BJC, Van den Elzen PJM, Linthorst, HJM (1994). A
new class of tobacco chitinases homologous to bacterial exo-chitinases
displays antifungal activity. Plant J. 5: 469-480.
Merja D, Stasa A (1997). In vitro regeneration and propagation of potato and its
genetic homogeneity determination by means of protein polymorphosim of
tubers. ISHS Acta Horticultarae, 462: I Balken Symposium on vegetables and
potatoes, 153.
Meyer A, Tempe´ J, Constantino P (2000). Hairy root: a molecular overview.
Functional analysis of Agrobacterium rhizogenes T-DNA genes. In: Stacey G,
Keen NT, ed. Plant–microbe interactions, Vol.5. Saint Paul, MN: APS Press,
93-139.
Michael T, Spena A (1995). The plant oncogenes rolA, B and C from Agrobacterium
rhizogenes: effects on morphology, development and hormone metabolism. In
Agrobacterium Protocols, Methods in Molecular Biology. Clifton, NJ:
Humana Press.
Miki BL, Fobert PF, Charest PJ, Iyer VN (1993). Procedures for introducing foreign
DNA into plants. Method Plant Mol. Biol. Biotechnol. 67-88.
Miller PR, Amirouche L, Stuchbury T, Mathews S (1985). The use of plant growth
regulators in micropropagation of slow-growing potato cultivars. Potato Res.
28: 479-486.
Minocha SC (1987). Plant growth regulators and morphogenesis in cell and tissue
culture of forest trees. In: Bonga, J. M., Durzan, D. J. (eds): Cell and Tissue
Culture in Forestry, Vol. 1. pp. 50-66. Martinus Nijhoff Publ., Dordrecht.
Mitiouchkina TY, Dolgov SV (2000). Modification of chrysanthemum flower and
plant architecture by rolC gene from Agrobacterium rhizogenes introduction.
Acta Hortic. 508. 163-172.
193
Moran JF, Klucas RV, Grayer R, Abian J, Becana M (1997). Complexes of iron with
phenolic compounds from soybean nodules and other legume tissues:
prooxidant and antioxidant properties. Free Radical Biol Medicine 22: 861-
870.
Müller A, Iser M, Hess D (2001). Stable transformation of sunflower (Helianthus
annuus L.) using a non-meristematic regeneration protocol and green
fluorescent protein as a vital marker. Transgen. Res. 10: 435-444.
Mullineaux CW, Tobin MJ, Jones GR (1997). Mobility of photosynthetic complexes
in thylakoid membranes. Nature 390: 421-424.
Murashige T, Skoog F (1962). A revised medium for rapid growth and bioassays with
tobacco tissue cultures. Plant Physiol. 15: 473-497.
Murray F, Brettell R, Matthews P, Bishop D, Jacobsen J (2004). Comparison of
Agrobacterium-mediated transformation of four barley cultivars using the GFP
and GUS reporter genes. Plant Cell Rep. 22: 397-402.
Nagib A, Hossain SA, Alam MF, Hossain MM, Islam R, Sultana RS (2003). Virus
free potato tuber seed production through meristem culture in Tropical Asia.
Asian J. of Plant Sci. 2 (8): 616-622.
Nasrin S (2003). Induction and evaluation of somaclonal variation in potato. J. Biol.
Sci. 3: 183-190.
Newell A, Rozman R, Hinchee A, Lawson C, Haley L, Sanders P, Kaniewski W,
Tumer N, Horsch B, Fraley T (1991). Agrobacterium-mediated transformation
of Solanum tuberosum L. cv. Russet Burbank. Plant Cell Rep. 10: 30-34.
Nilsson O, Crozier A, Schmülling T, Sandberg G, Olsson O (1993a). Indole-3-acetic
acid homeostasis in transgenic tobacco plants expressing the Agrobacterium
rhizogenes rolB gene. Plant J. 3: 681-689.
Nilsson O, Moritz T, Imbault N, Sandberg G, Olsson O (1993b). Hormonal
characterization of tobacco plants expressing the rolC gene of Agrobacterium
rhizogenes T-DNA. Plant Physiol. 102: 363-371.
194
Nilsson O, Moritz T, Sundberg B, Sandberg G, Olsson O (1996a). Expression of the
Agrobacterium rhizogenes rolC gene in a deciduous forest tree alters growth
and development and leads to stem fasciation. Plant Physiol. 112: 493-502.
Nilsson O, Little CHA, Sandberg G, Olsson O (1996b). Expression of two
heterologous promoters, Agrobacterium rhizogenes rolC and cauliflower
mosaic virus 35S, in the stem of transgenic hybrid aspen plants during the
annual cycle of growth and dormancy. Plant Mol. Biol. 31: 887-895.
Novak FJ, Zadina V, Horackova E, Maskova I (1980). The effect of growth regulators
on meristem tip development and in vitro multiplication of (Solanum
tuberosum L.) plants. Potato Res. 23: 155-166.
Oard JH, Paige DF, Simmonds JA, Gradziel TM (1990). Transient gene expression in
maize, rice and wheat cells using an airgun apparatus. Plant Physiol. 92: 334-
339.
Obeid HK, Allen MS, Bedgood DR, Prenzler PD, Robards K (2005). Investigation of
Australian olive mill waste for recovery of biophenols. J. Agric. Food Chem.
53: 9911-9920.
Ooms G, Karp A, Roberts J (1983). From tumor to tuber; tumor cell characteristics
and chromosome numbers of crown ball – derived tetraploid potato plants
(Solanum tuberosum cv. ‘Maris Bard’). Theor. Appl. Genet. 66: 169-172.
Ooms G, Bains A, Burrell M, Karp V, Twell D, Wilcox E (1985). Genetic
manipulation in cultivars of oilseed rape (Brassica napus) using
Agrobacterium. Theor. Appl. Genet. 71: 325-329.
Ooms G, Twell D, Bossen ME, Hoge JHC, Burrell MM (1986). Developmental
regulation of Ri T-DNA gene expression in roots, shoots and tubers of
transformed potato (Solatium tuberosum cv. Desirée). Plant Mol. Biol. 6: 321-
330.
Ooms G, Burrell MM, Karp AA, Bevan M, Hille J (1987). Genetic transformation in
two potato cultivars with T-DNA from disarmed Agrobacterium. Theor Appl
Genet. 73: 744-750.
195
Oono Y, Kanaya K, Uchimiya H (1990). Early flowering in transgenic tobacco plants
possessing the rolC gene of Agrobacterium rhizogenes Ri plasmid. Jpn. J.
Genet. 65: 7-16.
Orlikowska TK, Cranston HJ, Dyer WE (1995). Factors influencing Agrobacterium
tumefaciens-mediated transformation and regeneration of the safflower
cultivar “centennial”. Plant Cell Tiss. Org. Cult. 40: 85-91.
Osbourn AE (1996). Saponins and plant defense-A soap story. Trends Plant Sci. 1: 4-
9.
Osifa EO, Webb JK, Henshaw GG (1989). Variation amongst callus derived potato
plants, Solanum brevidens. J. Plant Physiol. 134: 1-4.
Osusky M, Zhou G, Osuska L, Hancock REW, Kay WW, Misra S (2000). Transgenic
plants expressing cationic peptide chimeras exhibit broad spectrum resistance
to phytopathogens. Nat. Biotechnol. 18: 1162-1166.
Osusky M, Osuska L, Hancock REW, Kay WW, Misra S (2004). Transgenic potatoes
expressing a novel cationic peptide are resistant to late blight and pink rot.
Transgen. Res. 13: 181-190.
Padmavati M, Sakthivel N, Thara KV, Reddy AR (1997). Differential sensitivity of
rice pathogens to growth inhibition by flavonoids. Phytochem. 46: 499-502.
Palazón J, Cusidó RM, Roig C, Piñol MT (1997). Effect of rol genes from
Agrobacterium rhizogenes TL-DNA on nicotine production in tobacco root
cultures. Plant Physiol. Biochem. 35: 155-162.
Palazón J, Cusidó RM, Roig C, Piñol MT (1998a). Expression of the rolC gene and
nicotine production in transgenic roots and their regenerated plants. Plant Cell
Rep. 17: 384-390.
Palazón J, Cusidó RM, Gonzalo J, Bonfill M, Morales S, Piñol MT (1998b). Relation
between the amount the rolC gene product and indole alkaloid accumulation
in Catharantus roseus transformed root cultures. J. Plant Physiol. 153: 712-
718.
196
Pandey SK, Ramesh B, Gupta PK (1994). Study on effect of genotype and culture
medium on callus formation and plant regeneration in rice (Oryza sativa L.).
Indian J. Genet. Plant Breed. 54: 293-299.
Parr AJ, Bolwell GP (2000). Phenols in the plant and in man. The potential for
possible nutritional enhancement of the diet by modifying the phenols content
or profile. J. Sci. Food Agric. 80: 985-1012.
Parveez GKA, Chowdhury MKU, Saleh NM (1997). Physical parameters affecting
transient GUS gene expression in oil palm (Elaeis guineesis Jacq.) using the
biolistic device. Ind. Crops Products 6: 41-50.
Parveez GKA, Chowdhury MKU, Saleh NM (1998). Biological parameters affecting
transient GUS gene expression in oil palm (Elaeis guineensis Jacq)
embryogenic calli via microprojectile bombardment. Ind. Crops Products 8:
17-27.
Parvez MM, Tomita-Yokotani K, Fujii Y, Konishi T, Iwashina T (2004). Effects of
quercetin and its seven derivatives on the growth of Arabidopsis thaliana and
Neurospora crassa. Biochem. Syst. Ecol. 32: 631-635.
Patrascu A (1981). Regeneration of potato plants by in vitro cultures of stem
segments. Revue Roumain de Biologie, Série de biologie végétale 26: 151-
155.
Peng M, Kuc J (1992). Peroxidase-generated hydrogen peroxide as a source of
antifungal activity in vitro and on tobacco leaf discs. Phytopath. 82: 696-699.
Perez C, Paul M, Bezique P (1990). An antibiotic assay by the agar well diffusion
method. Alta Biomed. Group Experiences. 15: 113.
Perl A, Kless H, Blumenthal A, Galili G, Galun E (1992). Improvement of plant
regeneration and GUS expression in scutellar wheat calli by optimization of
culture conditions and DNA-microprojectile delivery procedures. Mol. Gen.
Genet. 235: 279-284.
197
Preisig CL, Matthews DE, VanEtten HD (1989). Purification and characterization of
S-adenosyl-L-methionine: 6a-hydroxymaackiain 3-O-methyltransferase from
Pisum sativum. Plant Physiol. 91: 559-566.
Prinsen E, Chriqui D, Vilaine F, Tepfer M, Van Onckelen H (1994). Endogenous
phytohormone levels in tobacco plants transformed with Agrobacterium
rhizogenes pRi T-DNA genes. J. Plant Physiol. 144: 80-85.
Rabbani A, Askari B, Abbasi NA, Bhatti M, Quraishi A (2001). Effect of growth
regulators on in vitro multiplication of potato. J. Agric. Biol. 3: 181-182.
Rao RS, Ravishankar GA (2002). Plant cell cultures: Chemical factories of secondary
metabolites. Biotechnol. Adv. 20: 101-153.
Rasco-Gaunt S, Riley A, Barcelo P, Lazzeri P (1999). Analysis of particle
bombardment parameters to optimise DNA delivery into wheat tissues. Plant
Cell Rep. 19: 118-127.
Rauscher GM, Smart CD, Simko I, Bonierbale H, Mayton A, Greenland A, Fry WE
(2006). Characterization and mapping of Rpi-ber, a novel potato late blight
resistance gene from Solanum berthaultii. Theor. Appl. Genet. 112: 674-687.
Reddy MSS, Dinkins RD, Collins GB (2003). Gene silencing in transgenic soybean
plants transformed via particle bombardment. Plant Cell Rep. 21: 676-683.
Rice-Evans CA, Miller NJ, Paganga G (1997). Antioxidant properties of phenolic
compounds. Trends in Plant Sci. 2: 152-159.
Rice-Evans CA, Miller NJ (1998). Structure-antioxidant activity relationships of
flavonoids and isoflavonoides. In: Flavonoids in health and disease
(RiceEvans CA, Packer L eds.), Marcel Dekker Inc., New York pp.
199-220.
Rigden D, Carneiro M (1999). A structural model for the rolA protein and its
interaction with DNA. Proteins 37: 697-708.
Romano A, Raemakers K, Visser R, Mooibroek H (2001). Transformation of potato
Solanum tuberosum using particle bombardment. Plant Cell Rep. 20: 198-204.
198
Romano A, Raemakers K, Bernardi J, Visser R, Mooibroek H (2003). Transgene
organisation in potato after particle bombardment-mediated (co-)
transformation using plasmids and gene cassettes. Transgen. Res. 12: 461-473.
Romanov GA, Konstantinova TN, Sergeeva LI, Golyanovskaya SA, Kossmann J,
Willmitzer L, Schmülling T, Aksenova NP (1998). Morphology and tuber
formation of in-vitro-grown potato plants harboring the yeast invertase gene
and/or the rol gene. Plant Cell Rep. 18: 315-324.
Rosahl S (1996). Lipoxygenases in plants – their role in development and stress
response. Zeitschrift für Naturforschung 51C: 123-138.
Ryals JA, Neuenschwander UH, Willits MG, Molina A, Steiner HY, Hunt MD
(1996). Systemic acquired resistance. Plant Cell 8: 1809-1819.
Sanford JC, Smith FD, Russel JA (1993). Optimizing the biolistic process for
different biological applications. Meth. Enzymol. 217: 483-509.
Sarker RH, Mustafa BM (2002). Regeneration and Agrobacterium-mediated genetic
transformation of two indigenous potato varieties of Bangladesh. Plant Tiss.
Cult. 12(1): 69-77.
Sarker RH, Mustafa BM, Biswas A, Mahbub S, Nahar M, Hashem R, Hoque MI
(2003). In vitro regeneration in lentil (Lens culinaris Medik.) Plant Tiss. Cult.
13: 155-163.
Scandalios JG (1993). Oxygen stress and superoxide dismutases. Plant Physiol. 101:
7-12.
Schmitt F, Oakeley EJ, Jost JP (1997). Antibiotics induce genome-wide
hypermethylation in cultured Nicotiana tabacum plants J. Biol. Chem. 272:
1534-1540.
Schmülling T, Schell J, Spena A (1988). Single genes from Agrobacterium rhizogenes
influence plant development. EMBO J. 7: 2621–2629.
199
Schmülling T, Schell J, Spena A (1989). Promoters of the rolA, B and C genes of
Agrobacterium rhizogenes are differentially regulated in transgenic plants.
Plant Cell 1: 665-670.
Schmülling T, Fladung M, Grossmann K, Schell J (1993). Hormonal content and
sensitivity of transgenic tobacco and potato plants expressing single rol genes
of Agrobacterium rhizogenes T-DNA. Plant J. 3: 371–382.
Schopke C, Taylor NJ, Carcamo R, Beachy RN, Fauquet C (1997). Optimization of
parameters for particle bombardment of embryogenic suspension cultures of
cassava (Manihot esculenta Crantz) using computer image analysis. Plant Cell
Rep. 16: 526-530.
Scorza R, Zimmerman TW, Cordts JM, Footen KJ, Ravelonandro M (1994).
Horticultural characteristics of transgenic tobacco expressing the rolC gene
from Agrobacterium rhizogenes. J. Amer. Soc. Hort. Sci. 119: 1091-1098.
Selitrennikoff CP (2001). Antifungal proteins. Appl. Environ. Microbiol. 67: 2883-
2894.
Serrano C, Arce-Johnson P, Torres H, Gebauer M, Gutierrez M, Moreno M, Jordana
X, Venegas A, Kalazich J, Holouige L (2000). Expression of the chicken
lysozyme gene in potato enhances resistance to infection by Erwinia
carotovora, subsp. Atroseptica. Am. J. Pot. Res. 77: 191-199.
Sevón N, Oksman-Caldentey KM (2002). Agrobacterium rhizogenes-mediated
transformation: root cultures as a source of alkaloids. Planta Med. 68: 859-
868.
Shah GB (2002). In vitro response of Potato to various growth regulators. M.Sc.
Thesis. Department of Horticulture, Faculty of Agriculture, Gomal University,
Dera Ismail Khan, Pakistan.
Shahin EA, Simpson RB (1986). Gene transfer system for potato. Hort. Sci. 21: 1199-
1201.
200
Shakya P, Ranjit M, Manandhar A, Joshi SD (1992). Elimination of three viruses
from potato cv. Cardinal by meristem culture. J. Insti. Agric. Anim. Sci. 13:
89-93.
Sheerman S, Bevan MW (1988). Genetic transformation of potato Solanum
tuberosum using binary Agrobacterium tumefaciens vectors. Plant Cell Rep. 7:
13-16.
Sheng J, Citovsky V (1996). Agrobacterium-plant cell DNA transport: have virulence
proteins, will travel. Plant Cell 8: 1699-1710.
Sherf AF, MacNab AA (1986). Vegetable diseases and their control, Wiley, New
York.
Shibli RA, Abu B, Ein AM, Ajlouni MM (2002). In vitro and in vivo multiplication of
virus-free Spunta potato clone. Pak. J. Agric. Res. 17: 71-75.
Shirin F, Hossain M, Kabir MF, Roy M, Sarker RH (2007). Callus induction and plant
regeneration from internodal and leaf explants of four potato (Solanum
tuberosum L.) cultivars. World J. Agricult. Sci. 3 (1): 01-06.
Shkryl YN, Veremeichik GN, Bulgakov VP, Tchernoded GK, Mischenko NP,
Fedoreyev SA (2007). Individual and combined effects of the rolA, B and C
genes on anthraquinone production in Rubia cordifolia transformed calli,
Biotechnol. Bioeng. 100 (1) 118-125.
Simko I (1990). Effect of growth regulators on potato growth in vitro.
Polnohospodarstvo 36: 616-627.
Sinkar PS, Pythoud F, White FF, Nester EW, Gordon MP (1988). rolA locus of the Ri
plasmid directs developmental abnormalities in transgenic tobacco plants.
Genes Dev. 2, 688-697.
Skadhauge B, Thomsen K, von Wettstein D (1997). The role of barley testa layer and
its flavonoid content in resistance to Fusarium infections. Hereditas 126: 147-
160.
201
Slightom JL, Durand-Tardif M, Jouanin L, Tepfer D (1986). Nucleotide sequence
analysis of TL-DNA of Agrobacterium rhizogenes agropine type plasmid. J.
Biol. Chem. 261: 108-121.
Smith CJ (1996). Accumulation of phytoalexins: Defense mechanism and stimulus
response system. New Phytol. 132: 1-45.
Snyder GW, Belknap WR (1993). A modified method for routine Agrobacterium-
mediated transformation of in vitro grown potato microtubers. Plant Cell Rep.
12: 324-327.
Snyder BA, Nicholson RL (1990). Synthesis of phytoalexins in sorghum as a site
specific response to fungal ingress. Science 248: 1637-1639.
Solomon-Blackburn RM, Barker H (2001). Breeding virus-resistant potatoes
(Solanum tuberosum): a review of traditional and molecular approaches.
Heredity 86: 17-35.
Song J, Bradeen JM, Naess SK, Raasch JA, Wielgus SM, Haberlach GT, Liu J,
Kuang H, Austin-Phillips S, Buell CR, Helgeson JP, Jiang J (2003). Gene RB
cloned from Solanum bulbocastanum confers broad spectrum resistance to
potato late blight. Proc. Natl. Acad. Sci. USA 100: 9128-9133.
Souq F, Coutos-Thevenot P, Yean H, Delbard G, Maziere Y, Barber JP (1996).
Genetic transformation of roses, 2 examples: one on morphogenesis, the other
on anthocyanin biosynthetic pathway. Second Intl. Symp. Roses, Acta Hortic.
424: 381-388.
Spanò L, Mariotti D, Cardarelli M, Branca C, Costantino C (1988). Morphogenesis
and auxin sensitivity of transgenic tobacco with different complements of the
Ri T-DNA. Plant Physiol. 87: 479-483.
Spena A, Schmülling T, Koncz C (1987). Independent and synergistic activity of rol
A, B and C loci in stimulating abnormal growth in plant. EMBO J. 6: 3891-
3899.
202
Stevenson WR (1993). Management of early blight and late blight. In: Potato Health
Management. Rowe RC ed. American Phytopathology Society, St. Paul, MN.
pp 141-147.
Stiekema WJ, Heidekamp F, Dirkse WG, Beckum JV, Haan PD, Bosch CT (1988).
Molecular cloning and analysis of four potato tuber mRNAs. Plant Mol. Biol.
11: 255-269.
Sun L-Y, Touraud G, Charbonnier C, Tepfer D (1991a). Modification of phenotype in
Belgian endive (Cichorium intybus) through genetic transformation by
Agrobacterium rhizogenes: conversion from biennial to annual flowering.
Transgen. Res. 1: 14-22.
Sun L-Y, Monneuse M-O, Martin-Tanguy J, Tepfer D (1991b). Changes in flowering
and accumulation of polyamines and hydroxycinnamic acid polyamine
conjugates in tobacco plants transformed by the rolA locus from the Ri TL-
DNA of Agrobacterium rhizogenes. Plant Sci. 80: 145-146.
Tadesse Y, Sági L, Swennen R, Jacobs M (2003). Optimisation of transformation
conditions and production of transgenic sorghum (Sorghum bicolor) via
microparticle bombardment. Plant Cell, Tiss. Org. Cult. 75: 1-18.
Takahama U, Oniki T (1997). A peroxidase/phenolics/ascorbate system can scavenge
hydrogen peroxide in plant cells. Physiol. Plant 101: 845-852.
Talukder SK, Nasiruddin KM, Yesmin S, Begum R, Sarker S (2002). In vitro root
formation on orchid plantlets with IBA and NAA. Progressive Agriculture 13
(1-2), 25-28.
Tamura M, Togami J, Ishiguro K, Nakamura N, Katsumoto Y, Suzuki K, Kusumi T,
Tanaka Y (2003). Regeneration of transformed verbena (verbena x hybrida)
by Mediated tumefaciens. Plant Cell Rep. 21: 459-466.
Tavazza R, Tavazza M, Ordas RJ, Ancora G, Benvenuto E (1988). Genetic
transformation of potato (Solanum tuberosum): an efficient method to obtain
transgenic plants. Plant Sci. 49: 175-181.
203
Tepfer D (1983). The potential uses of Agrobacterium rhizogenes in the genetic
engineering of higher plants: nature got there first, p. 153−164. In: Genetic
Engineering in Eukaryotes, P. Lurquin, A. Kleinhofs (Eds.). Plenum Press,
New York.
Tepfer D (1984). Transformation of several species of higher plants by
Agrobacterium rhizogenes: sexual transmission of the transformed genotype
and phenotype. Cell 47: 959-967.
Trujillo C, Arengo ER, Jaramillo S, Hoyos R, Orduz S, Arango R (2001). One step
transformation of two Andean potato cultivars (Solanum tuberosum L. subsp.
Andigena). Plant Cell Rep. 20: 639-641.
Turhan H (2004). Callus induction and growth in transgenic potato genotypes. Afr. J.
Biotech. 3(8): 375-378.
Twell D, Ooms G (1987). The flanking DNA of a patatin gene directs tuber specific
expression of a chimeric gene in potato. Plant Mol. Biol. 9: 365-375.
Urs NVR, Dunleavy JM (1975). Enhancement of bactericidal activity of a peroxidase
system by phenolic compounds. Phytopath. 65: 686-690.
Vain P, McMullen M D, Finer JJ (1993). Osmotic treatment enhances particle
bombardment-mediated transient and stable transformation of maize. Plant
Cell Rep. 12: 84-88.
van Altvorst AC, Bino RJ, van Dijk AJ, Lamers AMJ, Lindhout WH, van der Mark F,
Dons JJM (1992). Effects of the introduction of Agrobacterium rhizogenes rol
genes on tomato plant and flower development. Plant Sci. 83: 77-85.
van de Geijn SC, Helder J, Van l tooren, HG, Hanisch ten Cate ChH (1988). Growth,
root respiration and phosphorus utilization of normal and Agrobacterium
rhizogenes transformed potato plants. Plant Soil 111: 283-288.
van der Salm TPM, Hanisch ten Cate ChH, Dons HJM (1996). Prospects for
applications of rol genes for crop improvement. Plant Mol. Biol. Rep. 14: 207-
228.
204
VanEtten HD, Mansfield JW, Bailey JA, Farmer EE (1994). Two classes of plant
antibiotics: phytoalexins versus “phytoanticipins”, Plant Cell 6: 1191-1192.
Vansuyt G, Vilaine F, Tepfer M, Rossignol M (1992). rolA modulates the sensitivity
to auxin of the proton translocation catalyzed by the plasma membrane H+-
ATPase in transformed tobacco. FEBS Lett. 298: 89-92.
Veena V, Taylor CG (2007). Agrobacterium rhizogenes: Recent developments and
promising applications. In Vitro Cell Dev. Biol. 43: 383-403.
Vermerris W, Nicholson R (2006). Phenolic Compounds Biochemistry. Springer,
Netherland, ISBN 101-4020-5163-8.
Vilaine F, Charbonnier C, Casse-Delbart F (1987). Further insight concerning the TL
region of the Ri plasmid of Agrobacterium rhizogenes strain A4: Transfer of a
1.9-Kb fragment is sufficient to induce transformation roots on tobacco leaf
fragments. Mol. Gen. Genet. 210: 111-115.
Visser RG (1991). Regeneration and transformation of potato by Agrobacterium
tumefaciens. In: Lindsey K (ed) Plant tissue culture manual supplement 2.
Kluwer, Dordrecht, pp B5:1-9.
Visser RG, Hergersberger M, van der Leij FR, Jacobsen E, Witholt B, Feenstra WJ
(1989). Molecular cloning and partial characterization of the gene for
granule-bound starch synthase from a wildtype and an amylose-free potato
(Solanum Tuberosum L.) Plant Sci. 64: 185-192
Walden R, Wingender R (1995). Gene-transfer and plant-regeneration (techniques).
Trends Biotechnol. 13: 324-331.
Wang PJ, Huang LC (1975). Callus cultures from potato tissue and the exclusion of
potato virus X from plants regenerated from stem tips. Canadian J. Bot. 53:
2565-2567.
Wang J, Sun Y, Hu J, Cui G (2004). Factors affecting the frequencies of callus
induction and plantlet regeneration in maize immature embryo culture. Acta
Agron. Sin. 30: 398-402.
205
Webb KJ, Morris P (1992). Methodologies of plant transformation. In Plant Genetic
Manipulation for Crop Protection, 7-45 (eds. Gatehouse AMR, Hilder VA,
Boulter D). Wallingford, UK: CAB International.
Webb KJ, Osifo EO, Henshaw GG (1983). Shoot regeneration from leaflet discs of
six cultivars of potato (Solanum tuberosum L.). Plant Sci. Lett. 30: 1-8.
Wenzler H, Mignery G, May G, Park W (1989). A rapid and efficient transformation
method for the production of large numbers of transgenic potato plants. Plant
Sci. 63: 79-85.
White FF, Taylor BH, Huffman GA, Gordon MP, Nester EW (1985). Molecular and
genetic analysis of the transferred DNA regions of the root-inducing plasmid
of Agrobacterium rhizogenes. J. Bacteriol. 164: 33-44.
Winefield C, Lewis D, Arathoon S, Deroles D (1999). Alteration of petunia plant
form through the introduction of the rolC gene from Agrobacterium
rhizogenes. Mol. Breed. 5: 543-551.
Wingender R, Henn HJ, Barth S, Voeste D, Machlab H, Schnabl H (1996). A
regeneration protocol for sunflower (Helianthus annuus L) protoplasts. Plant
Cell Rep. 15: 742-745.
Wroblewski T, Tomczak A, Michelmore R (2005). Optimization of Agrobacterium-
mediated transient assays of gene expression in lettuce, tomato and
Arabidopsis. Plant Biotechnol. J 3: 259-273.
Xiao L, Ha SB (1997). Efficient selection and regeneration of creeping bentgrass
transformations following particle bombardment. Plant Cell Rep. 16: 874-878.
Xing YJ, Yang Q, Ji Q, Luo YM, Zhang YF, Gu K, Wang DZ (2007). Optimization
of Agrobacterium-mediated transformation parameters for sweet potato
embryogenic callus using β-glucuronidase (GUS) as a reporter. Afr. J.
Biotechnol. 6 (22): 2578-2584.
Yadav NR, Sticklen MB (1995). Direct and efficient regeneration from leaf explants
of Solanum tuberosum L. cv. Bintje. Plant Cell Rep. 14: 645-647.
206
Yang J, Lee H, Shin DH, Oh SK, Seon JH, Paek KY, Han K (1999). Genetic
transformation of Cymbidium orchid by particle bombardment. Plant Cell Rep.
18: 978-984.
Yasmin S, Nasiruddin KM, Begum R, Talukder SK (2003). Regeneration and
establishment of potato plantlets through callus formation with BAP and
NAA. Asian J. Plant Sci. 2(12): 936-940.
Ye X, Brown SK, Scorza R, Cordts J, Sanford JC (1994). Genetic transformation of
peach tissues by particle bombardment. J. Am. Soc. Hort. Sci. 119: 367-373.
Yee S, Stevens B, Coleman S, Seabrook JEA, Li X-Q (2001). High efficiency
regeneration in vitro from potato petioles from intact leaflets Am. J. Potato
Res. 78: 151-157.
Yilmaz Y, Toledo RT (2004). Health aspects of functional grape seed constituents.
Trends Food Sci. Technol. 15: 422-433.
Yordanov Y, Yordanova E, Atanassov A (2002). Plant regeneration from interspecific
hybrid and backcross progeny of Helianthus eggertii x Helianthus annuus.
Plant Cell Tiss. Org. Cult. 71: 7-14.
Yousef AAR, Suwwan MA, Musa AM, Abu-Qaoud HA (1997). In vitro culture and
microtuberization of spunta potato (Solanum tuberosum). Dirasat Agri. Sci.
24: 173-181.
Yu D, Xie Z, Chen C, Fan B, Chen Z (1999). Expression of tobacco class II catalase
gene activates the endogenous homologous gene and is associated with disease
resistance in transgenic potato plants. Plant Mol. Bio1. 39: 477-488.
Zaman SM, Quraishi A, Hassan G, Raziuddin S, Khabir A, Gul N (2001). Meristem
culture of Potato (Solanum tuberosum L.) for production of virus free
plantlets. Online J. Biol. Sci. 1(10): 898-899.
Zhen W, Chen X, Liang H, Hu Y, Gao Y, Lin Z (2000). Enhanced late blight
resistance of transgenic potato expressing glucose oxidase under the control of
pathogen-inducible promoter. Chin. Sci. Bull. 45: 420-425.
207
Zhu QE, Maher S, Masoud R, Dixon R, Lamb CJ (1994). Enhanced protection against
fungal attack by constitutive coexpression of chitinase and glucanase genes in
transgenic tobacco. Biotechnol. 12: 807-812.
Zouine J, El hadrami I (2004). Somatic Embryogenesis in Phoenix dactylifera L.:
Effect of exogenous supply of sucrose on proteins, sugar, phenolics and
peroxydases activities during the embryogenic cell suspension culture.
Biotechnol. 3: 114-118.
Zouzou M, Kouakou T, Koné M, Peeters M, Swennen R (1997). Callogenèse chez le
cotonnier cultivé en Côte d'Ivoire: effets position explant hypocotyle, variétés,
source de carbone et régime hormonal. In: African Crop Science Society (eds)
Proceedings of 3rd African Crop Science Conference, Kampala, Uganda, pp.
1489-1494
Zuker A, Tzfira T, Scovel G, Ovadis M, Shklarman E, Itzhaki H (2001). RolC-
transgenic carnation with improved horticultural traits: Quantitative and
qualitative analyses of greenhouse-grown plants. J. Am. Soc. Hort. Sci. 126:
13-18.
Zupan JR, Zambryski P (1995). Transfer of T-DNA from Agrobacterium to the plant
cell. Plant Physiol. 107 (4): 1041-1047.
208
APPENDIX-I
Luria Broth Base (LB) Medium
Components
g/l
Tryptone 1.0
Yeast extract 0.5
Sodium chloride 1.0
Agar is added at a concentration of 1.5 g/100ml to solid medium. The liquid medium is without agar.
209
APPENDIX-II
GUS Assay
Stock Solution Volume of stock/ml of gus buffer
50 mM phosphate buffer pH 7.0 500 µl
X-Gluc 25 mg / 500 µl DMSO 20 µl
0.5% Triton X-100 5 µl
20% methanol 200 µl
Distilled H2O 275 µl
DMF: Dimethyl Formamide
Dark: -20°C
50 mM phosphate buffer
Na2 HPO4 7H2O [NW=268]
2.68 g/100 ml
1N HCl = 2 ml (to adjust pH)
210
APPENDIX-III
Nucleotide Sequence of rolA Gene and its Reverse Complement 5’ to 3’
1
51
101
151
201
251
GAATTAGCCG GACTAAACGT CGCCGGCATG GCCCAGACCT TCGGAGTATT
ATCGCTCGTC TGTTCTAAGC TTGTTAGGCG TGCAAAGGCC AAGAGGAAGG
CCAAACGGGT ATCCCCGGGC GAACGCGACC ATCTTGCTGA GCCAGCCAAT
CTGAGCACCA CTCCTTTGGC CATGACTTCC CAAGCCCGAC CGGGACGTTC
AACGACCCGC GAGTTGCTGC GAAGGGACCC TTTGTCGCCG GACGTGAAAA
TTCAGACCTA CGGGATTAAT ACGCATTTCG AAACAAACCT ACGGGAT
3’ to 5’
1
51
101
151
201
251
ATCCCGTAGG TTTGTTTCGA AATGCGTATT AATCCCGTAG GTCTGAATTT
TCACGTCCGG CGACAAAGGG TCCCTTCGCA GCAACTCGCG GGTCGTTGAA
CGTCCCGGTC GGGCTTGGGA AGTCATGGCC AAAGGAGTGG TGCTCAGATT
GGCTGGCTCA GCAAGATGGT CGCGTTCGCC CGGGGATACC CGTTTGGCCT
TCCTCTTGGC CTTTGCACGC CTAACAAGCT TAGAACAGAC GAGCGATAAT
ACTCCGAAGG TCTGGGCCAT GCCGGCGACG TTTAGTCCGG CTAATTC
211
APPENDIX-IV
Nucleotide Sequence of rolC Gene and its Reverse Complement
5’ to 3’
1
51
101
151
201
251
301
351
401
451
501
GCTGAAGACG ACCTGTGTTC TCTCTTTTTC AAGCTCAAAG TGGAGGATGT
GACAAGCAGC GATGAGCTAG CTAGACACAT GAAGAACGCC TCAAATGAGC
GTAAACCCTT GATCGAGCCG GGTGAGAATC AATCGATGGA TATTGACGAA
GAAGGAGGGT CGGTGGGCCA CGGGCTGCTG TACCTCTACG TCGACTGCCC
GACGATGATG CTCTGCTTCT ATGGAGGGTC CTTGCCTTAC AATTGGATGC
AAGGCGCACT CCTCACCAAC CTTCCCCCGT ACCAGCATGA TGTGACTCTC
GATGAGGTCA ATAGAGGGCT CAGGCAAGCA TCAGGTTTTT TCGGTTACGC
GGATCCTATG CGGAGCGCCT ACTTCGCTGC ATTTTCTTTC CCTGGGCGTG
TCATCAAGCT GAATGAGCAG ATGGAGCTAA CTTCGACAAA GGGAAAGTGT
CTGACATTCG ACCTCTATGC CAGCACCCAG CTTAGGTTCG AACCTGGTGA
GTTGGTGAGG CATGGCGAGT GCAAGTTTGC AATCGGC
3’ to 5’
1
51
101
151
201
251
301
351
401
451
501
GCCGATTGCA AACTTGCACT CGCCATGCCT CACCAACTCA CCAGGTTCGA
ACCTAAGCTG GGTGCTGGCA TAGAGGTCGA ATGTCAGACA CTTTCCCTTT
GTCGAAGTTA GCTCCATCTG CTCATTCAGC TTGATGACAC GCCCAGGGAA
AGAAAATGCA GCGAAGTAGG CGCTCCGCAT AGGATCCGCG TAACCGAAAA
AACCTGATGC TTGCCTGAGC CCTCTATTGA CCTCATCGAG AGTCACATCA
TGCTGGTACG GGGGAAGGTT GGTGAGGAGT GCGCCTTGCA TCCAATTGTA
AGGCAAGGAC CCTCCATAGA AGCAGAGCAT CATCGTCGGG CAGTCGACGT
AGAGGTACAG CAGCCCGTGG CCCACCGACC CTCCTTCTTC GTCAATATCC
ATCGATTGAT TCTCACCCGG CTCGATCAAG GGTTTACGCT CATTTGAGGC
GTTCTTCATG TGTCTAGCTA GCTCATCGCT GCTTGTCACA TCCTCCACTT
TGAGCTTGAA AAAGAGAGAA CACAGGTCGT CTTCAGC
212
APPENDIX-V
Southern Blot Solutions
Denaturing Solution (1 liter)
0.5 N NaOH 20.0 g NaOH
1.5 M NaCl 87.7 g NaCl
ddH2O to final volume
Neutralizing Solution (1 liter)
1 M Tris 121.1 g Tris Base
3 M NaCl 175.4 g NaCl
• fill to approximately 80% volume with ddH2O
• pH to 7.0 with concentrated HCl (≈60 ml/liter)
• bring to volume with ddH2O
Prehyb & Hybridization Solution (500 ml)
50% Formamide 250 ml Formamide
3X SSC 75 ml 20X SSC
1X Denhardt’s Solution 5 ml 100X Denhardt’s
20 µg/ml salmon sperm DNA 1 ml 10 mg/ml
5% Dextran Sulfate 25 g Dextran Sulfate
2% SDS 100 ml 10% SDS
Distilled water 69 ml
213
APPENDIX-VI
y = 0.1397x - 0.0416R2 = 0.9915
-1
0
1
2
3
4
0 5 10 15 20 25
Concentration (mcg/ml)
Abs
orba
nce
(725
nm
)
A: Calibration curve of gallic acid for calculation of total phenolics
y = 0.1551x + 0.049
R2 = 0.9997
0
0.5
1
1.5
2
2.5
0 2 4 6 8 10 12 14 16
Concentration (mcg/ml)
Abs
orba
nce
(415
nm)
B: Calibration curve of quercetin for calculation of total flavonoids
top related