clostridium sporogenes delivers interleukin-12 to hypoxic tumours, producing...
Post on 17-Mar-2017
214 Views
Preview:
TRANSCRIPT
ORIGINAL ARTICLE
Clostridium sporogenes delivers interleukin-12 to hypoxictumours, producing antitumour activity without significanttoxicityY.-L. Zhang1, R. L€u1, Z.-S. Chang1, W.-Q. Zhang1, Q.-B. Wang1, S.-Y. Ding1 and W. Zhao2
1 Laboratory of Pathogenic Biology, Medical College, Qingdao University, Qingdao, 266071, China
2 Department of Microbiology, Medical College, Qingdao University, Qingdao, 266071, China
Significance and Impact of the Study: Interleukin-12 (IL-12) is a potent antitumour cytokine, but it istoxic when administrated systemically. This study demonstrates that murine IL-12 can be systemicallydelivered to hypoxic sites in solid tumours by Clostridium sporogenes, producing a clear delay in tumourgrowth and a 14�3% cure rate in a mouse tumour model. Importantly, there is no obvious toxicity asso-ciated with IL-12 during the treatment process. This result may be accounted for by the excellenttumour-targeting capacity of Cl. sporogenes, targeting IL-12 directly to the tumour site instead of tothe entire body.
Keywords
antitumour efficacy, Clostridium sporogenes,
deliver, EMT6, IL-12, mammary carcinoma,
toxicity.
Correspondence
Yan-Li Zhang, 301 The Boya Building, 308
Ningxia Road, Qingdao 266071, Shandong,
China.
E-mail: qdzhangyanli1974@163.com
2014/0634: received 25 March 2014, revised
31 July 2014 and accepted 23 August 2014
doi:10.1111/lam.12322
Abstract
Clostridium sporogenes ATCC 3584 is an obligate anaerobe that has been
reported to possess excellent tumour-targeting capacity. Here, we use
Cl. sporogenes as a vector to deliver IL-12, a potent antitumour cytokine that
bears numerous antitumour properties but that has limited clinical
applications due to its strong toxicity when delivered systemically. In this
study, Cl. sporogenes was genetically engineered to secrete murine IL-12, and its
antitumour efficacy and toxicity were investigated in a murine EMT6
mammary carcinoma model. After intravenous injection, Cl. sporogenes was
able to selectively settle and reproduce in the tumours without encroaching on
normal tissues, resulting in a clear delay of tumour growth and a 14�3% cure
rate. Importantly, the mice showed no obvious toxicity-associated side effects,
such as diarrhoea and weight loss, during the treatment process. The
significant antitumour efficacy and low toxicity of this treatment may be
explained by the selective tumour-targeting properties of Cl. sporogenes and by
the sustained release of IL-12 accompanying bacterial proliferation. This
moderate local IL-12 concentration would not induce the severe response in
the entire body, that is inevitable when IL-12 is administered directly.
Introduction
A key obstacle to targeted tumour therapy is drug deliv-
ery to a specific tumour. Recent advances in our under-
standing of the unique pathology of solid tumours have
opened new options for targeted tumour therapy.
Hypoxia is now a well-characterized feature, that is
believed to exist in almost every solid tumour; it increases
patient treatment resistance and favours tumour progres-
sion (Wei et al. 2007; Umer et al. 2012; Mayer and
Vaupel 2013). However, this disadvantage can actually be
advantageous, as hypoxic sites can provide an ideal envi-
ronment for an obligate anaerobe. The anaerobe can be
used as an anticancer gene vector that targets the hypoxic
area of a solid tumour irrespective of tumour type or
tumour-specific surface markers.
All Clostridia are obligate anaerobes. They comprise a
large and heterogeneous group of gram-positive, anaero-
bic, rod-shaped, spore-forming bacteria. Researchers have
long studied different species of Clostridia to exploit
Letters in Applied Microbiology © 2014 The Society for Applied Microbiology 1
Letters in Applied Microbiology ISSN 0266-8254
their anaerobic characteristics (Theys et al. 2006; Gardlik
and Fruehauf 2010; Umer et al. 2012; Zu and Wang
2014). Amongst researched Clostridium species, Cl. spor-
ogenes ATCC 3584, a strain isolated from soil, has been
reported to be avirulent, and it shows excellent coloniza-
tion and dispersion in tumours (Liu et al. 2008). It was
used as a vector to deliver IL-12 to solid tumours in this
study.
IL-12, a multifunctional cytokine, has been shown to
possess potent antitumour activity in a variety of murine
tumour models (Imagawa et al. 2004; Li et al. 2008; Pav-
lin et al. 2009). However, systemic application of IL-12 in
the clinic is hindered by its severe toxicity (Cohen 1995;
Leonard et al. 1997; Car et al. 1999). Studies using direct
injection of IL-12 into lesions or attempting the genetic
manipulation of various tumour cells, T cells or DC cells
to produce IL-12 in situ have not been fruitful (Simpson-
Abelson et al. 2009; Seo et al. 2011; Dietrich et al. 2012;
Kerkar et al. 2013; Tan et al. 2013). Clearly, the require-
ments of an effective clinical treatment cannot be satisfied
using local strategies, as many clinical tumours are inac-
cessible or invisible. Therefore, systemic IL-12 administra-
tion remains the best treatment option. This study
endeavoured to investigate the antitumour efficacy and
the toxicity of murine IL-12 after systemic delivery by
Cl. sporogenes ATCC3584 in BALB/c mice.
Results and discussion
IL-12 is effectively produced and secreted by Clostridium
sporogenes
The recombinant murine IL-12 (rmIL-12) concentration
in the culture supernatants of ATCC 3584-rmIL-12 was
approx. 18 pg ml�1, but rmIL-12 could not be detected
in cell lysates. These results showed that IL-12 can be
expressed in a secretory form (Fig. 1a). The promoter
and signal peptide of the secretory protein endo-b1,4-glu-canase (eglAp) from Cl. acetobutylicum P262 that was
fused to the 50end of the IL-12 gene must play a role in
regulating secretion. The eglAp sequence has been suc-
cessfully used to regulate the secretion of interleukin-2
(Barb�e et al. 2005) and murine tumour necrosis factor-a(Theys et al. 1999) from Cl. acetobutylicum and the secre-
tion of fungal secretory glycoside hydrolase from Cl. bei-
jerinckii (L�opez-Contreras et al. 2001). Immunoblot
analysis with a mouse IL-12 antibody revealed a clear IL-
12 band in the culture supernatants (Fig. 1b). Immuno-
blot analysis and ELISA were also performed with wild-
type (WT) Cl. sporogenes, and no IL-12 production was
detected (the data for this ELISA are not shown). All
results confirmed that rmIL-12 is efficiently secreted by
Cl. sporogenes and is folded into a native conformation.
Biological activity of IL-12 produced by recombinant
Clostridium sporogenes
IL-12 is a heterodimer consisting of two subunits (p35
and p40) encoded by different genes located in different
chromosomes. The IL-12 molecule has biological activity
only when the two subunits are expressed simulta-
neously and combined in a 1 : 1 ratio. A single peptide
chain comprising both subunits can ensure balanced
expression and assembly. We used a flexible linker that
works well with recombinant human IL-12 (Zhang et al.
2006) to link the two subunits into a single-chain fusion
gene.
As a control, 50 pg of commercially manufactured
rmIL-12 induced the production of approx. 80 pg ml�1
of IFN-c in splenocytes. The rmIL-12 produced by ATCC
3584-rmIL-12 induced approx. 70 pg ml�1 of IFN-c.However, splenocytes treated with WT Cl. sporogenes
supernatant did not produce significant amounts of IFN-
c, as expected (Fig. 2). These results suggested that the
secreted rmIL-12 was biologically active and was able to
stimulate IFN-c production in mouse splenocytes.
In vivo administration of Clostridium sporogenes
expressing IL-12 induces IFN-c production
The main biological effect of IL-12 is to promote IFN-cproduction (Sorensen et al. 2010). IFN-c expression was
significantly enhanced in mice treated with ATCC 3584-
25
20
15
10
5
0
a b c d
Cell lysates
IL-1
2 (p
g m
l–1 )
BDL
Supernatants
(a)
(b)
Figure 1 Expression of rmIL-12 in Clostridium sporogenes. (a) Quanti-
fication of rmIL-12 in the cell lysates and culture supernatants of
recombinant Cl. sporogenes by ELISA; BDL, below detectable levels.
(b) Immunoblot analysis of Cl. sporogenes culture supernatants; lanes
a and b are WT Cl. sporogenes, and lanes c and d are recombinant
Cl. sporogenes ATCC 3584-rmIL-12.
Letters in Applied Microbiology © 2014 The Society for Applied Microbiology2
Clostridia deliver IL-12 to treat tumors Y.-L. Zhang et al.
rmIL-12 as compared to mice treated with the WT ATCC
3584 strain or with PBS (P < 0�05, Fig. 3a). IFN-c levels
in mice that received ATCC 3584 alone were also slightly
elevated (P < 0�05, Fig. 3a), likely due to the physiologi-
cal reaction to the bacteria. In our research, the ATCC
3584-treated mice showed no obvious signs of toxicity
despite their elevated IFN-c level, even though the major-
ity of the acute toxic effects of IL-12 are IFN-c dependent
(Leonard et al. 1997; Car et al. 1999). We inferred that
the IFN-c level might have been too low to induce obvi-
ous toxicity. This result was consistent with the research
of Leonard and co-workers (Leonard et al. 1997). In their
study of the antitumour efficacy of IL-12, the serum IFN-
c levels in all live mice were no more than 400 ng ml�1,
a much higher level than that in our experiments (Fig. 3a,
less than 150 pg ml�1).
In vivo antitumour activity following systemic
administration of recombinant Clostridium sporogenes
Tumour colonization following Cl. sporogenes administra-
tion was quantified by performing a dilution series of
randomly selected tumours from bacteria-treated animals.
All investigated tumours showed colonization levels of
104–105 CFU g�1 tumour tissue. Viable Clostridia could
not be detected in normal tissues.
IL-12 is known as a pivotal regulator of cell-mediated
immunity that acts by enhancing the cytotoxic activity of
NK cells and cytotoxic T lymphocytes, It can also activate
humoral immunity to both T-dependent and T-indepen-
dent antigens (Zaharoff et al. 2010). Thus, IL-12 can exert
effective, immune response-dependent antitumour activ-
ity. We used immunocompetent BALB/c mice that can
react to IL-12 stimulation. This tumour model mimics
human tumours, as nearly all solid tumour patients are
immunocompetent.
To determine whether the IL-12 delivered by the
recombinant Cl. Sporogenes was sufficient to result in
measurable antitumour efficacy. We injected mice bearing
the EMT6 mammary carcinoma with the bacteria. The
tumour growth delay was calculated as the number of
days required for the relative tumour volume value
reaches 2. The data showed that ATCC 3584 alone
100IF
N -
γ (
pg m
l–1 ) 80
60
40
20
0
rmIL
-12
WT C
l.spo
roge
nes
ATCC 358
4-rm
IL-1
2
Figure 2 In vitro induction of IFN-c in mouse splenocytes by recombi-
nant Clostridium sporogenes. The IFN-c levels produced by mouse
splenocytes stimulated with ATCC 3584-rmIL-12 culture supernatant
showed statistically significant differences compared with the WT
Cl. sporogenes group (P < 0�05).
100
150
IFN
- γ
(pg
ml–
1 )
50
0
18 *
**
*
**
*
14
10
6
2
2
0
50
100
Sur
viva
l (%
)
150
0 20 40 60 80
4
Days after bacteia injection
Days after bacteia injection
Rel
ativ
e tu
mor
vol
ume
6 8 10 12 14 16 18 20 22 24–2
PBS
WT C
l.spo
roge
nes
ATCC 358
4-rm
IL-1
2
(a)
(b)
(c)
Figure 3 Antitumour activity of recombinant Clostridium sporogenes
ATCC 3584-rmIL-12. (a) IFN-c levels in mouse plasma on the 12th day
after injection. (b) Relative tumour volumes in the recombinant
Cl. sporogenes group (○), the ATCC 3584 group (□) and the PBS
control group (D). (c) The survival rates of the recombinant Cl. spor-
ogenes group (▬), the ATCC 3584 group (�) and the PBS control
group (∙∙∙).
Letters in Applied Microbiology © 2014 The Society for Applied Microbiology 3
Y.-L. Zhang et al. Clostridia deliver IL-12 to treat tumors
resulted in no delay in tumour growth. However, when
ATCC 3584-rmIL-12 was administered, we observed an
obvious and statistically significant antitumour efficacy
(tumour growth delay approx. 6 days; *P < 0�05 from
day 12 to 24) (Fig. 3b). An encouraging finding was that
one mouse (14�3%) was cured (Fig. 3c), the tumour
began to shrink on the day bacteria were injected, and
the tumour disappeared 26 days after treatment (Figure
S1). It should be noted that the MHC type of EMT6
tumour cells is H2d, which is identical to that of BALB/c
mice. Once inoculated, EMT6 cells grow continuously
unless interference occurs. These results thus indicated an
obvious antitumour effect and potential future applica-
tions for solid tumour eradication using recombinant
Cl. sporogenes.
After 24 days, the mouse tumours successively rup-
tured. We observed that nearly all mice in different
groups underwent a similar process: the tumours grew
bigger, the adjacent skin became dark and necrotic, and
the dark skin of the tumours ruptured. This result
accorded with the ischaemia and necrosis characteristics
of solid tumours. The tumours in the ATCC 3584-rmIL-
12 group ruptured first. A possible reason is that the
secreted IL-12 reduced tumour angiogenesis, killing the
tumour cells by enhancing the activity of NK cells, mac-
rophages and T lymphocytes and thereby promoting ear-
lier and more serious tumour necrosis and liquefaction,
finally resulting in tumour rupture from the necrotic area
of the skin. Once the tumours rupture, the anaerobic
environment is destroyed, the recombinant Cl. sporogenes
cells no longer play a role. Because the open wounds led
to bodily weakness, the mice eventually died from the
synergistic effects of tumour growth and the wound.
Thus, mouse death after tumour rupture was not ger-
mane to the treatment results, so it was not subject to
statistical analysis (Fig. 3c).
If the treatment method used in our study has a future
clinical application once antitumour efficacy is improved,
it will likely be used as an adjunct to surgery to treat
small tumours that are scattered and inaccessible inside
the body. Rupture is unlikely in a small and sequestered
tumour, and thus, IL-12 would remain functional, per-
haps making the treatment more efficacious.
The body weight of the mice in the ATCC 3584-rmIL-
12 and ATCC 3584 groups was transiently lowered after
injection, but it quickly recovered, and there were no sig-
nificant differences amongst the three groups (P > 0�05,Fig. 4). None of the mice in the ATCC 3584-rmIL-12
group displayed obvious signs of toxicity such as diar-
rhoea or weight loss.
In conclusion, we have demonstrated a novel strategy
that takes full advantage of the antitumour efficacy of IL-
12 while simultaneously minimizing toxicity. We
genetically engineered Cl. sporogenes to secrete biologically
active rmIL-12, and we showed that systemic administra-
tion of the bacteria produced significant antitumour effi-
cacy without obvious toxicity in immunocompetent mice.
This result may be accounted for by the excellent
tumour-targeting capability of Cl. sporogenes and the sus-
tained release of IL-12 accompanying bacterial growth at
the tumour site. Future investigations of strategies that
elevate the activity of the secreted IL-12 or exploit its
immune adjuvant functionality by combining it with
tumour-specific antigens are required to further improve
its antitumour efficacy.
Materials and methods
Strains and plasmids
Clostridium sporogenes ATCC 3584 was obtained from the
American Type Culture Collection (Santa Bioscientific
Co. Ltd. Shanghai, China). The strain was grown in
cooked meat medium (CMM) (Na2HPO4 5 g l�1, pep-
tone 30 g l�1, L- cysteine 0�5 g l�1, maltose 10 g l�1 and
cooked beef particles 50 g l�1) erythromycin when
needed (to select for recombinant at 37°C in a SHEL LAB
Bac III-2E anaerobic/environmental chamber (Sheldon
Manufacturing Inc., Cornelius, OR) under a 90% N2, 5%
H2 and 5% CO2 atmosphere. Cultures were supplemented
with 10 g l�1 erythromycin to select for recombinant
Cl. sporogenes. E. coli EPI400 was used for general clon-
ing. Strains were grown in Luria–Bertani media at 37°C.All strains were maintained as frozen stocks at �80°C in
appropriate media containing 20% glycerol. A DNA
sequence encoding linearized single-chain recombinant
murine IL-12 was artificially synthesized by GENEWIZ,
Inc. according to the reported sequence of murine IL-12
28
26
24
22
20
180 4 8 12 16
Days after bacteia injection
Wei
ght o
f mic
e (g
)
20 24
Figure 4 Mouse body weight in the PBS control (D), WT Clostridium
sporogenes (□) and ATCC 3584-rmIL-12 (○) groups.
Letters in Applied Microbiology © 2014 The Society for Applied Microbiology4
Clostridia deliver IL-12 to treat tumors Y.-L. Zhang et al.
(GenBank accession no.: NM_008352.2 and
NM_008351.2) and was inserted into plasmid PUC57.
The codons were optimized according to the known
codon usage preference of Cl. sporogenes. The E. coli-
Clostridia shuttle plasmid pIMP1 (Mermelstein et al.
1992) contains ampicillin and erythromycin resistance.
Plasmid pMD18T/eglAp, which contains the eglAp gene
from Cl. acetobutylicum strain P262 (GenBank accession
no. M31311.1), was constructed and is maintained in our
laboratory (Liu et al. 2011).
DNA manipulation and transformation procedures
The eglAp and rmIL-12 DNA sequences were amplified
with the primer pairs (Table 1) eglApF1/eglApR and IL-
12F/IL-12R, respectively, from their original plasmids.
They were fused to yield eglAp-rmIL-12 by amplification
with primers eglApF2 and IL-12R (Table 1). The product
was cloned into pIMP1 digested with SalI and AvaI to
generate pIMP1-e-rmIL-12. The recombinant plasmid
pIMP1-e-rmIL-12 was first constructed in E. coli EPI400
and then electroporated into Cl. sporogenes. The resulting
strain was designated as ATCC 3584-rmIL-12. The elec-
troporation technique used was based on published meth-
ods (Tyurin et al. 2004).
ELISA for detection of IL-12
A mouse IL-12 p70 ELISA kit (eBiosicence, San Diego,
CA) was used to determine the levels of rmIL-12 in cell
lysates and culture supernatants. The samples were pre-
pared as follows: 0�5 ml ATCC 3584-rmIL-12 or WT
Cl. sporogenes was diluted into 5 ml CMM and cultured
overnight until the OD600 reached 1�8. Recombinant
Cl. sporogenes was supplemented with 40 lg ml�1 eryth-
romycin during growth. The cultures (2�5 ml) were
chilled in an ice bath and centrifuged, and the superna-
tants were retained for ELISA assays. The cell pellets
underwent ultrasonic cracking to produce cell lysates.
Both the supernatants and the lysates were used for
ELISA according to the kit instructions.
Immunoblot analysis of IL-12
Clostridium sporogenes was cultured overnight in 15 ml
CMM. The supernatants were concentrated 20-fold with a
Millipore Amicon Centrifugal Filter Unit (3 kDa
NMWL). Samples were mixed with loading buffer lacking
2-mercaptoethanol and subjected to 10% SDS-PAGE.
Custom murine IL-12 polyclonal goat serum (1 lg ml�1,
R&D systems) and HRP-conjugated rabbit anti-goat IgG
(Zhongshan, Beijing) were used to detect the protein
according to manufacturer instructions. HRP-conjugated
rabbit anti-goat IgG was detected with an enhanced
chemiluminescent substrate (Super Signal West Pico
Trial Kit, Thermo Scientific, Rockford, IL) and an
image acquisition system (Fusion SL, Vilber Lourmat,
Marne-la-Vallee, France).
In vitro IFN-c detection
Supernatants from overnight cultures of Cl. sporogenes
were concentrated 20-fold as described above into a
final volume of 1000 ll PBS and were sterilized with a
Millipore 0�22-lm filter. Splenocytes from four mice
were plated on a 24-well plate (5 9 106 cells in 2 ml
RPMI-1640 medium per well) at 37°C under 5% CO2.
Splenocytes were incubated with 100 ll of concentrated
supernatant from ATCC 3584-rmIL-12 (rmIL-12 was
adjusted to approx. 50 pg ml�1 according to the ELISA
result) or from WT Cl. sporogenes. As a positive control,
mouse splenocytes were incubated with 50 pg of rmIL-
12 (R&D Systems, Minneapolis, MN) produced from
the insect cell line sf21; the accession numbers of the
two subunits in this preparation are P43432 (p40) and
NP_032377 (p35), with sequences identical to those
secreted by the bacteria (except for the linker sequence).
After 48 h of incubation, supernatants from the treated
splenocytes were harvested and tested for the presence
of IFN-c by ELISA (eBiosience Systems, San Diego, CA)
according to the manufacturer’s directions. All samples
were prepared in triplicate.
Mice and cells
Specific pathogen free, immunocompetent, female
BALB/c mice, weighing from 18 to 20 g, were supplied
by Vital River Laboratory Animal Technology Co. Ltd
(Beijing, China) and housed in sterile cages with auto-
claved bedding and free access to food and water. This
study and the animal protocols used in this study were
approved by the Chancellor’s Animal Research Commit-
tee at the Medical College of Qingdao University, in
accordance with National Institutes of Health guidelines.
BALB/c EMT6 mammary carcinoma cells were pur-
chased from the Chinese Academy of Medical Sciences
Table 1 Primers used in this study
Primers Oligonucleotide Sequence (50—30)
eglApF1 (SalI) ACGCGTCGACTTTTATATATATTTGTATTAA
eglApF2 (SalI) CTCGCGCCCGGTCGACTTTTATATATATT
eglApR GCTCCCACATAGCTTCAGCTTTATAAGTATTTGTTCCT
IL-12F TAAAGCTGAAGCTATGTGGGAGCTTGAGAAAGACG
IL-12R (AvaI) TTATAGCCCGGGTTAAGCACTGCTAAGATAGCCCAT
The underlined are restriction sites. The italic are complementary
regions.
Letters in Applied Microbiology © 2014 The Society for Applied Microbiology 5
Y.-L. Zhang et al. Clostridia deliver IL-12 to treat tumors
(Beijing, China). Cells were cultured in RPMI-1640
(GIBCO, Grand Island, NY) supplemented with 10%
foetal bovine serum (Excel Biology. Inc., Australia) at
37°C under 5% CO2.
Systemic delivery of Clostridium sporogenes to tumour-
bearing mice
A total of 1 9 106 EMT6 cells in 0�1 ml PBS were inocu-
lated subcutaneously into the right thorax of BALB/c mice.
Tumour volume (v) was calculated from digital vernier cal-
liper measurements (a, b and c) of three orthogonal axes
using the formula v = (abc) p/6. Experiments were initi-
ated when the tumour volume was approx. 200 mm3. To
test a potentially useful procedure for the treatment of scat-
tered or inaccessible tumours, injections were given system-
ically rather than locally. Animals were divided into three
groups (10 mice per group) that received, via the tail vein,
(i) WT Cl. sporogenes, (ii) ATCC 3584-rmIL-12 at a con-
centration of 108 spores 100 ll�1 PBS or (iii) the same vol-
ume of PBS alone. The drinking water for the ATCC 3584-
rmIL-12 group was supplemented with 10 lg ml�1 eryth-
romycin. Relative tumour volume was calculated in days
from the beginning of treatment using the formula (V-Vo)/
Vo, where Vo is the original tumour volume.The growth
delay was calculated by determining the number of days
required for relative tumour volume value reaches 2. On
the 12th day after Cl. sporogenes treatment, 3 mice in each
group were sacrificed for blood from the orbital sinus. The
serum was separated, and IFN-c levels were detected with
an ELISA kit (eBioscience). During the treatment, mice
were also observed for gross signs of toxicity, such as body
weight loss and diarrhoea, and were monitored daily for
survival.
Statistical analysis
Student’s t-test between two groups, or a one-way ANOVA
with Tukey’s post-test on three groups, was performed
with GRAPHPAD PRISM ver. 5.0 (GraphPad Software, Inc. La
Jolla, CA). P-values < 0�05 were considered statistically
significant.
Acknowledgements
This work was supported by grants from the Natural Sci-
ence Foundation of Shandong Province, China
(ZR2012HQ005, ZR2010CM011) and from the Science
and Technology Development Plan of Medicine and
Health of Shandong, China (2009HD005). We thank pro-
fessor Zhi-yong Yan, Guo-ying Wang and Jing Wang for
their helpful assistance in many discussions or for supply-
ing instruments in this study.
Conflict of interest
All co-authors declare no conflicts of interest.
References
Barb�e, S., Van Mellaert, L., Theys, J., Geukens, N., Lammertyn,
E., Lambin, P. and Ann�e, J. (2005) Secretory production
of biologically active rat interleukin-2 by Clostridium
acetobutylicum DSM792 as a tool for antitumor treatment.
FEMS Microbiol Lett 246, 67–73.
Car, B.D., Eng, V.M., Lipman, J.M. and Anderson, T.D. (1999)
The toxicology of interleukin-12: a review. Toxicol Pathol
27, 58–63.
Cohen, J. (1995) IL-12 deaths: explanation and a puzzle.
Science 270, 908.
Dietrich, A., Stockmar, C., Endesfelder, S., Guetz, A. and Aust,
G. (2012) The impact of intraoperative vaccination with
IL-12 modified autologous tumor cells in the Lewis lung
carcinoma mouse model. J Cancer Res Clin Oncol 138,
901–906.
Gardlik, R. and Fruehauf, J.H. (2010) Bacterial vectors and
delivery systems in cancer therapy. IDrugs 13, 701–706.
Imagawa, Y., Satake, K., Kato, Y., Tahara, H. and Tsukuda, M.
(2004) Antitumor and antiangiogenic effects of interleukin
12 gene therapy in murine head and neck carcinoma
model. Auris Nasus Larynx 31, 239–245.
Kerkar, S.P., Leonardi, A.J., van Panhuys, N., Zhang, L., Yu,
Z., Crompton, J.G., Pan, J.H., Palmer, D.C. et al. (2013)
Collapse of the tumor stroma is triggered by IL-12
induction of Fas. Mol Ther 21, 1369–1377.
Leonard, J.P., Sherman, M.L., Fisher, G.L., Buchanan, L.J.,
Larsen, G., Atkins, M.B., Sosman, J.A., Dutcher, J.P. et al.
(1997) Effects of single-dose interleukin-12 exposure on
interleukin-12-associated toxicity and interferon-gamma
production. Blood 90, 2541–2548.
Li, D., Yu, H., Xu, T.F., Li, J.H., Sun, Y.F. and Zhang, W.Q.
(2008) Interleukin-12 gene modification exerts antitumor
effects on murine mammary sarcoma cell line in vivo. Cell
Mol Immunol 5, 225–230.
Liu, S.C., Ahn, G.O., Kioi, M., Dorie, M.J., Patterson, A.V. and
Brown, J.M. (2008) Optimized Clostridium-directed
enzyme prodrug therapy improves the antitumor activity
of the novel DNA cross-linking agent PR-104. Cancer Res
68, 7995–8003.
Liu, Y., Zhang, W.Q., Yu, H., Lv, R., Zhang, Y.L., Xu, T.F. and
Li, D. (2011) Construction of a shuttle plasmid encoding a
chimeric gene of eglA p-Her2/neu ECD-IL-12. Xi Bao Yu
Fen Zi Mian Yi Xue Za Zhi 27, 370–373.
L�opez-Contreras, A.M., Smidt, H., van der Oost, J., Claassen,
P.A., Mooibroek, H. and de Vos, W.M. (2001) Clostridium
beijerinckii cells expressing Neocallimastix patriciarum
glycoside hydrolases show enhanced lichenan utilization
and solvent production. Appl Environ Microbiol 67,
5127–5133.
Letters in Applied Microbiology © 2014 The Society for Applied Microbiology6
Clostridia deliver IL-12 to treat tumors Y.-L. Zhang et al.
Mayer, A. and Vaupel, P. (2013) Hypoxia, lactate
accumulation, and acidosis: siblings or accomplices driving
tumor progression and resistance to therapy. Adv Exp Med
Biol 789, 203–209.
Mermelstein, L.D., Welker, N.E., Bennett, G.N. and
Papoutsakis, E.T. (1992) Expression of cloned homologous
fermentative genes in Clostridium acetobutylicum ATCC
824. Biotechnology (N Y) 10, 190–195.
Pavlin, D., Cemazar, M., Kamensek, U., Tozon, N., Pogacnik,
A. and Sersa, G. (2009) Local and systemic antitumor
efficacy of intratumoral and peritumoral IL-12 electrogene
therapy on murine sarcoma. Cancer Biol Ther 8,
2114–2122.
Seo, S.H., Kim, K.S., Park, S.H., Suh, Y.S., Kim, S.J., Jeun, S.S.
and Sung, Y.C. (2011) The effects of mesenchymal stem
cells injected via different routes on modified IL-12-
mediated antitumor activity. Gene Ther 18, 488–495.
Simpson-Abelson, M.R., Purohit, V.S., Pang, W.M., Iyer, V.,
Odunsi, K., Demmy, T.L., Yokota, S.J., Loyall, J.L. Jr et al.
(2009) IL-12 delivered intratumorally by multilamellar
liposomes reactivates memory T cells in human tumor
microenvironments. Clin Immunol 132, 71–82.
Sorensen, E.W., Gerber, S.A., Frelinger, J.G. and Lord, E.M.
(2010) IL-12 suppresses vascular endothelial growth factor
receptor 3 expression on tumor vessels by two distinct
IFN-gamma-dependent mechanisms. J Immunol 184,
1858–1866.
Tan, C., Dannull, J., Nair, S.K., Ding, E., Tyler, D.S., Pruitt,
S.K. and Lee, W.T. (2013) Local secretion of IL-12
augments the therapeutic impact of dendritic cell-tumor
cell fusion vaccination. J Surg Res 185, 904–911.
Theys, J., Nuyts, S., Landuyt, W., Van Mellaert, L., Dillen, C.,
B€ohringer, M., D€urre, P., Lambin, P. et al. (1999) Stable
Escherichia coli-Clostridium acetobutylicum shuttle vector
for secretion of murine tumor necrosis factor alpha. Appl
Environ Microbiol 65, 4295–4300.
Theys, J., Pennington, O., Dubois, L., Anlezark, G., Vaughan,
T., Mengesha, A., Landuyt, W., Ann�e, J. et al. (2006)
Repeated cycles of Clostridium-directed enzyme prodrug
therapy result in sustained antitumour effects in vivo. Br J
Cancer 95, 1212–1219.
Tyurin, M.V., Desai, S.G. and Lynd, L.R. (2004)
Electrotransformation of Clostridium thermocellum. Appl
Environ Microbiol 70, 883–890.
Umer, B., Good, D., Ann�e, J., Duan, W. and Wei, M.Q. (2012)
Clostridial spores for cancer therapy: targeting solid
tumour microenvironment. J Toxicol 2012, 862764.
Wei, M.Q., Ellem, K.A., Dunn, P., West, M.J., Bai, C.X. and
Vogelstein, B. (2007) Facultative or obligate anaerobic
bacteria have the potential for multimodality therapy of
solid tumours. Eur J Cancer 43, 490–496.
Zaharoff, D.A., Hance, K.W., Rogers, C.J., Schlom, J. and
Greiner, J.W. (2010) Intratumoral immunotherapy of
established solid tumors with chitosan/IL-12. J Immunother
33, 697–705.
Zhang, W.Q., Wang, L.N., Liu, Z.J., Mariameb, D., Yu, H.,
Yang, Z.S. and Yu, X.P. (2006) Functional evaluation of
recombinant human IL-12 ex vivo with cytokine follow
cytometry (CFC). Chin J Microbiol Immunol 26, 383–384.
Zu, C. and Wang, J. (2014) Tumor-colonizing bacteria: a
potential tumor targeting therapy. Crit Rev Microbiol 40,
225–235.
Supporting Information
Additional Supporting Information may be found in the
online version of this article:
Figure S1 The growth curve for each tumour in ATCC
3584-rmIL-12 (a), WT Clostridium sporogenes (b) and
PBS control (c) groups.
Letters in Applied Microbiology © 2014 The Society for Applied Microbiology 7
Y.-L. Zhang et al. Clostridia deliver IL-12 to treat tumors
top related