clostridium sporogenes delivers interleukin-12 to hypoxic tumours, producing...

ORIGINAL ARTICLE

Clostridium sporogenes delivers interleukin-12 to hypoxictumours, producing antitumour activity without significanttoxicityY.-L. Zhang1, R. L€u1, Z.-S. Chang1, W.-Q. Zhang1, Q.-B. Wang1, S.-Y. Ding1 and W. Zhao2

1 Laboratory of Pathogenic Biology, Medical College, Qingdao University, Qingdao, 266071, China

2 Department of Microbiology, Medical College, Qingdao University, Qingdao, 266071, China

Significance and Impact of the Study: Interleukin-12 (IL-12) is a potent antitumour cytokine, but it istoxic when administrated systemically. This study demonstrates that murine IL-12 can be systemicallydelivered to hypoxic sites in solid tumours by Clostridium sporogenes, producing a clear delay in tumourgrowth and a 14�3% cure rate in a mouse tumour model. Importantly, there is no obvious toxicity asso-ciated with IL-12 during the treatment process. This result may be accounted for by the excellenttumour-targeting capacity of Cl. sporogenes, targeting IL-12 directly to the tumour site instead of tothe entire body.

Keywords

antitumour efficacy, Clostridium sporogenes,

deliver, EMT6, IL-12, mammary carcinoma,

toxicity.

Correspondence

Yan-Li Zhang, 301 The Boya Building, 308

Ningxia Road, Qingdao 266071, Shandong,

China.

E-mail: [email protected]

2014/0634: received 25 March 2014, revised

31 July 2014 and accepted 23 August 2014

doi:10.1111/lam.12322

Abstract

Clostridium sporogenes ATCC 3584 is an obligate anaerobe that has been

reported to possess excellent tumour-targeting capacity. Here, we use

Cl. sporogenes as a vector to deliver IL-12, a potent antitumour cytokine that

bears numerous antitumour properties but that has limited clinical

applications due to its strong toxicity when delivered systemically. In this

study, Cl. sporogenes was genetically engineered to secrete murine IL-12, and its

antitumour efficacy and toxicity were investigated in a murine EMT6

mammary carcinoma model. After intravenous injection, Cl. sporogenes was

able to selectively settle and reproduce in the tumours without encroaching on

normal tissues, resulting in a clear delay of tumour growth and a 14�3% cure

rate. Importantly, the mice showed no obvious toxicity-associated side effects,

such as diarrhoea and weight loss, during the treatment process. The

significant antitumour efficacy and low toxicity of this treatment may be

explained by the selective tumour-targeting properties of Cl. sporogenes and by

the sustained release of IL-12 accompanying bacterial proliferation. This

moderate local IL-12 concentration would not induce the severe response in

the entire body, that is inevitable when IL-12 is administered directly.

Introduction

A key obstacle to targeted tumour therapy is drug deliv-

ery to a specific tumour. Recent advances in our under-

standing of the unique pathology of solid tumours have

opened new options for targeted tumour therapy.

Hypoxia is now a well-characterized feature, that is

believed to exist in almost every solid tumour; it increases

patient treatment resistance and favours tumour progres-

sion (Wei et al. 2007; Umer et al. 2012; Mayer and

Vaupel 2013). However, this disadvantage can actually be

advantageous, as hypoxic sites can provide an ideal envi-

ronment for an obligate anaerobe. The anaerobe can be

used as an anticancer gene vector that targets the hypoxic

area of a solid tumour irrespective of tumour type or

tumour-specific surface markers.

All Clostridia are obligate anaerobes. They comprise a

large and heterogeneous group of gram-positive, anaero-

bic, rod-shaped, spore-forming bacteria. Researchers have

long studied different species of Clostridia to exploit

Letters in Applied Microbiology © 2014 The Society for Applied Microbiology 1

Letters in Applied Microbiology ISSN 0266-8254

their anaerobic characteristics (Theys et al. 2006; Gardlik

and Fruehauf 2010; Umer et al. 2012; Zu and Wang

2014). Amongst researched Clostridium species, Cl. spor-

ogenes ATCC 3584, a strain isolated from soil, has been

reported to be avirulent, and it shows excellent coloniza-

tion and dispersion in tumours (Liu et al. 2008). It was

used as a vector to deliver IL-12 to solid tumours in this

study.

IL-12, a multifunctional cytokine, has been shown to

possess potent antitumour activity in a variety of murine

tumour models (Imagawa et al. 2004; Li et al. 2008; Pav-

lin et al. 2009). However, systemic application of IL-12 in

the clinic is hindered by its severe toxicity (Cohen 1995;

Leonard et al. 1997; Car et al. 1999). Studies using direct

injection of IL-12 into lesions or attempting the genetic

manipulation of various tumour cells, T cells or DC cells

to produce IL-12 in situ have not been fruitful (Simpson-

Abelson et al. 2009; Seo et al. 2011; Dietrich et al. 2012;

Kerkar et al. 2013; Tan et al. 2013). Clearly, the require-

ments of an effective clinical treatment cannot be satisfied

using local strategies, as many clinical tumours are inac-

cessible or invisible. Therefore, systemic IL-12 administra-

tion remains the best treatment option. This study

endeavoured to investigate the antitumour efficacy and

the toxicity of murine IL-12 after systemic delivery by

Cl. sporogenes ATCC3584 in BALB/c mice.

Results and discussion

IL-12 is effectively produced and secreted by Clostridium

sporogenes

The recombinant murine IL-12 (rmIL-12) concentration

in the culture supernatants of ATCC 3584-rmIL-12 was

approx. 18 pg ml�1, but rmIL-12 could not be detected

in cell lysates. These results showed that IL-12 can be

expressed in a secretory form (Fig. 1a). The promoter

and signal peptide of the secretory protein endo-b1,4-glu-canase (eglAp) from Cl. acetobutylicum P262 that was

fused to the 50end of the IL-12 gene must play a role in

regulating secretion. The eglAp sequence has been suc-

cessfully used to regulate the secretion of interleukin-2

(Barb�e et al. 2005) and murine tumour necrosis factor-a(Theys et al. 1999) from Cl. acetobutylicum and the secre-

tion of fungal secretory glycoside hydrolase from Cl. bei-

jerinckii (L�opez-Contreras et al. 2001). Immunoblot

analysis with a mouse IL-12 antibody revealed a clear IL-

12 band in the culture supernatants (Fig. 1b). Immuno-

blot analysis and ELISA were also performed with wild-

type (WT) Cl. sporogenes, and no IL-12 production was

detected (the data for this ELISA are not shown). All

results confirmed that rmIL-12 is efficiently secreted by

Cl. sporogenes and is folded into a native conformation.

Biological activity of IL-12 produced by recombinant

Clostridium sporogenes

IL-12 is a heterodimer consisting of two subunits (p35

and p40) encoded by different genes located in different

chromosomes. The IL-12 molecule has biological activity

only when the two subunits are expressed simulta-

neously and combined in a 1 : 1 ratio. A single peptide

chain comprising both subunits can ensure balanced

expression and assembly. We used a flexible linker that

works well with recombinant human IL-12 (Zhang et al.

2006) to link the two subunits into a single-chain fusion

gene.

As a control, 50 pg of commercially manufactured

rmIL-12 induced the production of approx. 80 pg ml�1

of IFN-c in splenocytes. The rmIL-12 produced by ATCC

3584-rmIL-12 induced approx. 70 pg ml�1 of IFN-c.However, splenocytes treated with WT Cl. sporogenes

supernatant did not produce significant amounts of IFN-

c, as expected (Fig. 2). These results suggested that the

secreted rmIL-12 was biologically active and was able to

stimulate IFN-c production in mouse splenocytes.

In vivo administration of Clostridium sporogenes

expressing IL-12 induces IFN-c production

The main biological effect of IL-12 is to promote IFN-cproduction (Sorensen et al. 2010). IFN-c expression was

significantly enhanced in mice treated with ATCC 3584-

25

20

15

10

5

0

a b c d

Cell lysates

IL-1

2 (p

g m

l–1 )

BDL

Supernatants

(a)

(b)

Figure 1 Expression of rmIL-12 in Clostridium sporogenes. (a) Quanti-

fication of rmIL-12 in the cell lysates and culture supernatants of

recombinant Cl. sporogenes by ELISA; BDL, below detectable levels.

(b) Immunoblot analysis of Cl. sporogenes culture supernatants; lanes

a and b are WT Cl. sporogenes, and lanes c and d are recombinant

Cl. sporogenes ATCC 3584-rmIL-12.

Letters in Applied Microbiology © 2014 The Society for Applied Microbiology2

Clostridia deliver IL-12 to treat tumors Y.-L. Zhang et al.

rmIL-12 as compared to mice treated with the WT ATCC

3584 strain or with PBS (P < 0�05, Fig. 3a). IFN-c levels

in mice that received ATCC 3584 alone were also slightly

elevated (P < 0�05, Fig. 3a), likely due to the physiologi-

cal reaction to the bacteria. In our research, the ATCC

3584-treated mice showed no obvious signs of toxicity

despite their elevated IFN-c level, even though the major-

ity of the acute toxic effects of IL-12 are IFN-c dependent

(Leonard et al. 1997; Car et al. 1999). We inferred that

the IFN-c level might have been too low to induce obvi-

ous toxicity. This result was consistent with the research

of Leonard and co-workers (Leonard et al. 1997). In their

study of the antitumour efficacy of IL-12, the serum IFN-

c levels in all live mice were no more than 400 ng ml�1,

a much higher level than that in our experiments (Fig. 3a,

less than 150 pg ml�1).

In vivo antitumour activity following systemic

administration of recombinant Clostridium sporogenes

Tumour colonization following Cl. sporogenes administra-

tion was quantified by performing a dilution series of

randomly selected tumours from bacteria-treated animals.

All investigated tumours showed colonization levels of

104–105 CFU g�1 tumour tissue. Viable Clostridia could

not be detected in normal tissues.

IL-12 is known as a pivotal regulator of cell-mediated

immunity that acts by enhancing the cytotoxic activity of

NK cells and cytotoxic T lymphocytes, It can also activate

humoral immunity to both T-dependent and T-indepen-

dent antigens (Zaharoff et al. 2010). Thus, IL-12 can exert

effective, immune response-dependent antitumour activ-

ity. We used immunocompetent BALB/c mice that can

react to IL-12 stimulation. This tumour model mimics

human tumours, as nearly all solid tumour patients are

immunocompetent.

To determine whether the IL-12 delivered by the

recombinant Cl. Sporogenes was sufficient to result in

measurable antitumour efficacy. We injected mice bearing

the EMT6 mammary carcinoma with the bacteria. The

tumour growth delay was calculated as the number of

days required for the relative tumour volume value

reaches 2. The data showed that ATCC 3584 alone

100IF

N -

γ (

pg m

l–1 ) 80

60

40

20

0

rmIL

-12

WT C

l.spo

roge

nes

ATCC 358

4-rm

IL-1

2

Figure 2 In vitro induction of IFN-c in mouse splenocytes by recombi-

nant Clostridium sporogenes. The IFN-c levels produced by mouse

splenocytes stimulated with ATCC 3584-rmIL-12 culture supernatant

showed statistically significant differences compared with the WT

Cl. sporogenes group (P < 0�05).

100

150

IFN

- γ

(pg

ml–

1 )

50

0

18 *

**

*

**

*

14

10

6

2

2

0

50

100

Sur

viva

l (%

)

150

0 20 40 60 80

4

Days after bacteia injection


Rel

ativ

e tu

mor

vol

ume

6 8 10 12 14 16 18 20 22 24–2

PBS

WT C

l.spo

roge

nes

ATCC 358

4-rm

IL-1

2

(a)

(b)

(c)

Figure 3 Antitumour activity of recombinant Clostridium sporogenes

ATCC 3584-rmIL-12. (a) IFN-c levels in mouse plasma on the 12th day

after injection. (b) Relative tumour volumes in the recombinant

Cl. sporogenes group (○), the ATCC 3584 group (□) and the PBS

control group (D). (c) The survival rates of the recombinant Cl. spor-

ogenes group (▬), the ATCC 3584 group (�) and the PBS control

group (∙∙∙).


Y.-L. Zhang et al. Clostridia deliver IL-12 to treat tumors

resulted in no delay in tumour growth. However, when

ATCC 3584-rmIL-12 was administered, we observed an

obvious and statistically significant antitumour efficacy

(tumour growth delay approx. 6 days; *P < 0�05 from

day 12 to 24) (Fig. 3b). An encouraging finding was that

one mouse (14�3%) was cured (Fig. 3c), the tumour

began to shrink on the day bacteria were injected, and

the tumour disappeared 26 days after treatment (Figure

S1). It should be noted that the MHC type of EMT6

tumour cells is H2d, which is identical to that of BALB/c

mice. Once inoculated, EMT6 cells grow continuously

unless interference occurs. These results thus indicated an

obvious antitumour effect and potential future applica-

tions for solid tumour eradication using recombinant

Cl. sporogenes.

After 24 days, the mouse tumours successively rup-

tured. We observed that nearly all mice in different

groups underwent a similar process: the tumours grew

bigger, the adjacent skin became dark and necrotic, and

the dark skin of the tumours ruptured. This result

accorded with the ischaemia and necrosis characteristics

of solid tumours. The tumours in the ATCC 3584-rmIL-

12 group ruptured first. A possible reason is that the

secreted IL-12 reduced tumour angiogenesis, killing the

tumour cells by enhancing the activity of NK cells, mac-

rophages and T lymphocytes and thereby promoting ear-

lier and more serious tumour necrosis and liquefaction,

finally resulting in tumour rupture from the necrotic area

of the skin. Once the tumours rupture, the anaerobic

environment is destroyed, the recombinant Cl. sporogenes

cells no longer play a role. Because the open wounds led

to bodily weakness, the mice eventually died from the

synergistic effects of tumour growth and the wound.

Thus, mouse death after tumour rupture was not ger-

mane to the treatment results, so it was not subject to

statistical analysis (Fig. 3c).

If the treatment method used in our study has a future

clinical application once antitumour efficacy is improved,

it will likely be used as an adjunct to surgery to treat

small tumours that are scattered and inaccessible inside

the body. Rupture is unlikely in a small and sequestered

tumour, and thus, IL-12 would remain functional, per-

haps making the treatment more efficacious.

The body weight of the mice in the ATCC 3584-rmIL-

12 and ATCC 3584 groups was transiently lowered after

injection, but it quickly recovered, and there were no sig-

nificant differences amongst the three groups (P > 0�05,Fig. 4). None of the mice in the ATCC 3584-rmIL-12

group displayed obvious signs of toxicity such as diar-

rhoea or weight loss.

In conclusion, we have demonstrated a novel strategy

that takes full advantage of the antitumour efficacy of IL-

12 while simultaneously minimizing toxicity. We

genetically engineered Cl. sporogenes to secrete biologically

active rmIL-12, and we showed that systemic administra-

tion of the bacteria produced significant antitumour effi-

cacy without obvious toxicity in immunocompetent mice.

This result may be accounted for by the excellent

tumour-targeting capability of Cl. sporogenes and the sus-

tained release of IL-12 accompanying bacterial growth at

the tumour site. Future investigations of strategies that

elevate the activity of the secreted IL-12 or exploit its

immune adjuvant functionality by combining it with

tumour-specific antigens are required to further improve

its antitumour efficacy.

Materials and methods

Strains and plasmids

Clostridium sporogenes ATCC 3584 was obtained from the

American Type Culture Collection (Santa Bioscientific

Co. Ltd. Shanghai, China). The strain was grown in

cooked meat medium (CMM) (Na2HPO4 5 g l�1, pep-

tone 30 g l�1, L- cysteine 0�5 g l�1, maltose 10 g l�1 and

cooked beef particles 50 g l�1) erythromycin when

needed (to select for recombinant at 37°C in a SHEL LAB

Bac III-2E anaerobic/environmental chamber (Sheldon

Manufacturing Inc., Cornelius, OR) under a 90% N2, 5%

H2 and 5% CO2 atmosphere. Cultures were supplemented

with 10 g l�1 erythromycin to select for recombinant

Cl. sporogenes. E. coli EPI400 was used for general clon-

ing. Strains were grown in Luria–Bertani media at 37°C.All strains were maintained as frozen stocks at �80°C in

appropriate media containing 20% glycerol. A DNA

sequence encoding linearized single-chain recombinant

murine IL-12 was artificially synthesized by GENEWIZ,

Inc. according to the reported sequence of murine IL-12

28

26

24

22

20

180 4 8 12 16


Wei

ght o

f mic

e (g

)

20 24

Figure 4 Mouse body weight in the PBS control (D), WT Clostridium

sporogenes (□) and ATCC 3584-rmIL-12 (○) groups.



(GenBank accession no.: NM_008352.2 and

NM_008351.2) and was inserted into plasmid PUC57.

The codons were optimized according to the known

codon usage preference of Cl. sporogenes. The E. coli-

Clostridia shuttle plasmid pIMP1 (Mermelstein et al.

1992) contains ampicillin and erythromycin resistance.

Plasmid pMD18T/eglAp, which contains the eglAp gene

from Cl. acetobutylicum strain P262 (GenBank accession

no. M31311.1), was constructed and is maintained in our

laboratory (Liu et al. 2011).

DNA manipulation and transformation procedures

The eglAp and rmIL-12 DNA sequences were amplified

with the primer pairs (Table 1) eglApF1/eglApR and IL-

12F/IL-12R, respectively, from their original plasmids.

They were fused to yield eglAp-rmIL-12 by amplification

with primers eglApF2 and IL-12R (Table 1). The product

was cloned into pIMP1 digested with SalI and AvaI to

generate pIMP1-e-rmIL-12. The recombinant plasmid

pIMP1-e-rmIL-12 was first constructed in E. coli EPI400

and then electroporated into Cl. sporogenes. The resulting

strain was designated as ATCC 3584-rmIL-12. The elec-

troporation technique used was based on published meth-

ods (Tyurin et al. 2004).

ELISA for detection of IL-12

A mouse IL-12 p70 ELISA kit (eBiosicence, San Diego,

CA) was used to determine the levels of rmIL-12 in cell

lysates and culture supernatants. The samples were pre-

pared as follows: 0�5 ml ATCC 3584-rmIL-12 or WT

Cl. sporogenes was diluted into 5 ml CMM and cultured

overnight until the OD600 reached 1�8. Recombinant

Cl. sporogenes was supplemented with 40 lg ml�1 eryth-

romycin during growth. The cultures (2�5 ml) were

chilled in an ice bath and centrifuged, and the superna-

tants were retained for ELISA assays. The cell pellets

underwent ultrasonic cracking to produce cell lysates.

Both the supernatants and the lysates were used for

ELISA according to the kit instructions.

Immunoblot analysis of IL-12

Clostridium sporogenes was cultured overnight in 15 ml

CMM. The supernatants were concentrated 20-fold with a

Millipore Amicon Centrifugal Filter Unit (3 kDa

NMWL). Samples were mixed with loading buffer lacking

2-mercaptoethanol and subjected to 10% SDS-PAGE.

Custom murine IL-12 polyclonal goat serum (1 lg ml�1,

R&D systems) and HRP-conjugated rabbit anti-goat IgG

(Zhongshan, Beijing) were used to detect the protein

according to manufacturer instructions. HRP-conjugated

rabbit anti-goat IgG was detected with an enhanced

chemiluminescent substrate (Super Signal West Pico

Trial Kit, Thermo Scientific, Rockford, IL) and an

image acquisition system (Fusion SL, Vilber Lourmat,

Marne-la-Vallee, France).

In vitro IFN-c detection

Supernatants from overnight cultures of Cl. sporogenes

were concentrated 20-fold as described above into a

final volume of 1000 ll PBS and were sterilized with a

Millipore 0�22-lm filter. Splenocytes from four mice

were plated on a 24-well plate (5 9 106 cells in 2 ml

RPMI-1640 medium per well) at 37°C under 5% CO2.

Splenocytes were incubated with 100 ll of concentrated

supernatant from ATCC 3584-rmIL-12 (rmIL-12 was

adjusted to approx. 50 pg ml�1 according to the ELISA

result) or from WT Cl. sporogenes. As a positive control,

mouse splenocytes were incubated with 50 pg of rmIL-

12 (R&D Systems, Minneapolis, MN) produced from

the insect cell line sf21; the accession numbers of the

two subunits in this preparation are P43432 (p40) and

NP_032377 (p35), with sequences identical to those

secreted by the bacteria (except for the linker sequence).

After 48 h of incubation, supernatants from the treated

splenocytes were harvested and tested for the presence

of IFN-c by ELISA (eBiosience Systems, San Diego, CA)

according to the manufacturer’s directions. All samples

were prepared in triplicate.

Mice and cells

Specific pathogen free, immunocompetent, female

BALB/c mice, weighing from 18 to 20 g, were supplied

by Vital River Laboratory Animal Technology Co. Ltd

(Beijing, China) and housed in sterile cages with auto-

claved bedding and free access to food and water. This

study and the animal protocols used in this study were

approved by the Chancellor’s Animal Research Commit-

tee at the Medical College of Qingdao University, in

accordance with National Institutes of Health guidelines.

BALB/c EMT6 mammary carcinoma cells were pur-

chased from the Chinese Academy of Medical Sciences

Table 1 Primers used in this study

Primers Oligonucleotide Sequence (50—30)

eglApF1 (SalI) ACGCGTCGACTTTTATATATATTTGTATTAA

eglApF2 (SalI) CTCGCGCCCGGTCGACTTTTATATATATT

eglApR GCTCCCACATAGCTTCAGCTTTATAAGTATTTGTTCCT

IL-12F TAAAGCTGAAGCTATGTGGGAGCTTGAGAAAGACG

IL-12R (AvaI) TTATAGCCCGGGTTAAGCACTGCTAAGATAGCCCAT

The underlined are restriction sites. The italic are complementary

regions.



http://www.ncbi.nlm.nih.gov/nuccore/NM_008352.2

http://www.ncbi.nlm.nih.gov/nuccore/NM_008351.2

http://www.ncbi.nlm.nih.gov/nuccore/M31311.1

http://www.ncbi.nlm.nih.gov/nuccore/NP_032377

(Beijing, China). Cells were cultured in RPMI-1640

(GIBCO, Grand Island, NY) supplemented with 10%

foetal bovine serum (Excel Biology. Inc., Australia) at

37°C under 5% CO2.

Systemic delivery of Clostridium sporogenes to tumour-

bearing mice

A total of 1 9 106 EMT6 cells in 0�1 ml PBS were inocu-

lated subcutaneously into the right thorax of BALB/c mice.

Tumour volume (v) was calculated from digital vernier cal-

liper measurements (a, b and c) of three orthogonal axes

using the formula v = (abc) p/6. Experiments were initi-

ated when the tumour volume was approx. 200 mm3. To

test a potentially useful procedure for the treatment of scat-

tered or inaccessible tumours, injections were given system-

ically rather than locally. Animals were divided into three

groups (10 mice per group) that received, via the tail vein,

(i) WT Cl. sporogenes, (ii) ATCC 3584-rmIL-12 at a con-

centration of 108 spores 100 ll�1 PBS or (iii) the same vol-

ume of PBS alone. The drinking water for the ATCC 3584-

rmIL-12 group was supplemented with 10 lg ml�1 eryth-

romycin. Relative tumour volume was calculated in days

from the beginning of treatment using the formula (V-Vo)/

Vo, where Vo is the original tumour volume.The growth

delay was calculated by determining the number of days

required for relative tumour volume value reaches 2. On

the 12th day after Cl. sporogenes treatment, 3 mice in each

group were sacrificed for blood from the orbital sinus. The

serum was separated, and IFN-c levels were detected with

an ELISA kit (eBioscience). During the treatment, mice

were also observed for gross signs of toxicity, such as body

weight loss and diarrhoea, and were monitored daily for

survival.

Statistical analysis

Student’s t-test between two groups, or a one-way ANOVA

with Tukey’s post-test on three groups, was performed

with GRAPHPAD PRISM ver. 5.0 (GraphPad Software, Inc. La

Jolla, CA). P-values < 0�05 were considered statistically

significant.

Acknowledgements

This work was supported by grants from the Natural Sci-

ence Foundation of Shandong Province, China

(ZR2012HQ005, ZR2010CM011) and from the Science

and Technology Development Plan of Medicine and

Health of Shandong, China (2009HD005). We thank pro-

fessor Zhi-yong Yan, Guo-ying Wang and Jing Wang for

their helpful assistance in many discussions or for supply-

ing instruments in this study.

Conflict of interest

All co-authors declare no conflicts of interest.

References

Barb�e, S., Van Mellaert, L., Theys, J., Geukens, N., Lammertyn,

E., Lambin, P. and Ann�e, J. (2005) Secretory production

of biologically active rat interleukin-2 by Clostridium

acetobutylicum DSM792 as a tool for antitumor treatment.

FEMS Microbiol Lett 246, 67–73.

Car, B.D., Eng, V.M., Lipman, J.M. and Anderson, T.D. (1999)

The toxicology of interleukin-12: a review. Toxicol Pathol

27, 58–63.

Cohen, J. (1995) IL-12 deaths: explanation and a puzzle.

Science 270, 908.

Dietrich, A., Stockmar, C., Endesfelder, S., Guetz, A. and Aust,

G. (2012) The impact of intraoperative vaccination with

IL-12 modified autologous tumor cells in the Lewis lung

carcinoma mouse model. J Cancer Res Clin Oncol 138,

901–906.

Gardlik, R. and Fruehauf, J.H. (2010) Bacterial vectors and

delivery systems in cancer therapy. IDrugs 13, 701–706.

Imagawa, Y., Satake, K., Kato, Y., Tahara, H. and Tsukuda, M.

(2004) Antitumor and antiangiogenic effects of interleukin

12 gene therapy in murine head and neck carcinoma

model. Auris Nasus Larynx 31, 239–245.

Kerkar, S.P., Leonardi, A.J., van Panhuys, N., Zhang, L., Yu,

Z., Crompton, J.G., Pan, J.H., Palmer, D.C. et al. (2013)

Collapse of the tumor stroma is triggered by IL-12

induction of Fas. Mol Ther 21, 1369–1377.

Leonard, J.P., Sherman, M.L., Fisher, G.L., Buchanan, L.J.,

Larsen, G., Atkins, M.B., Sosman, J.A., Dutcher, J.P. et al.

(1997) Effects of single-dose interleukin-12 exposure on

interleukin-12-associated toxicity and interferon-gamma

production. Blood 90, 2541–2548.

Li, D., Yu, H., Xu, T.F., Li, J.H., Sun, Y.F. and Zhang, W.Q.

(2008) Interleukin-12 gene modification exerts antitumor

effects on murine mammary sarcoma cell line in vivo. Cell

Mol Immunol 5, 225–230.

Liu, S.C., Ahn, G.O., Kioi, M., Dorie, M.J., Patterson, A.V. and

Brown, J.M. (2008) Optimized Clostridium-directed

enzyme prodrug therapy improves the antitumor activity

of the novel DNA cross-linking agent PR-104. Cancer Res

68, 7995–8003.

Liu, Y., Zhang, W.Q., Yu, H., Lv, R., Zhang, Y.L., Xu, T.F. and

Li, D. (2011) Construction of a shuttle plasmid encoding a

chimeric gene of eglA p-Her2/neu ECD-IL-12. Xi Bao Yu

Fen Zi Mian Yi Xue Za Zhi 27, 370–373.

L�opez-Contreras, A.M., Smidt, H., van der Oost, J., Claassen,

P.A., Mooibroek, H. and de Vos, W.M. (2001) Clostridium

beijerinckii cells expressing Neocallimastix patriciarum

glycoside hydrolases show enhanced lichenan utilization

and solvent production. Appl Environ Microbiol 67,

5127–5133.



Mayer, A. and Vaupel, P. (2013) Hypoxia, lactate

accumulation, and acidosis: siblings or accomplices driving

tumor progression and resistance to therapy. Adv Exp Med

Biol 789, 203–209.

Mermelstein, L.D., Welker, N.E., Bennett, G.N. and

Papoutsakis, E.T. (1992) Expression of cloned homologous

fermentative genes in Clostridium acetobutylicum ATCC

824. Biotechnology (N Y) 10, 190–195.

Pavlin, D., Cemazar, M., Kamensek, U., Tozon, N., Pogacnik,

A. and Sersa, G. (2009) Local and systemic antitumor

efficacy of intratumoral and peritumoral IL-12 electrogene

therapy on murine sarcoma. Cancer Biol Ther 8,

2114–2122.

Seo, S.H., Kim, K.S., Park, S.H., Suh, Y.S., Kim, S.J., Jeun, S.S.

and Sung, Y.C. (2011) The effects of mesenchymal stem

cells injected via different routes on modified IL-12-

mediated antitumor activity. Gene Ther 18, 488–495.

Simpson-Abelson, M.R., Purohit, V.S., Pang, W.M., Iyer, V.,

Odunsi, K., Demmy, T.L., Yokota, S.J., Loyall, J.L. Jr et al.

(2009) IL-12 delivered intratumorally by multilamellar

liposomes reactivates memory T cells in human tumor

microenvironments. Clin Immunol 132, 71–82.

Sorensen, E.W., Gerber, S.A., Frelinger, J.G. and Lord, E.M.

(2010) IL-12 suppresses vascular endothelial growth factor

receptor 3 expression on tumor vessels by two distinct

IFN-gamma-dependent mechanisms. J Immunol 184,

1858–1866.

Tan, C., Dannull, J., Nair, S.K., Ding, E., Tyler, D.S., Pruitt,

S.K. and Lee, W.T. (2013) Local secretion of IL-12

augments the therapeutic impact of dendritic cell-tumor

cell fusion vaccination. J Surg Res 185, 904–911.

Theys, J., Nuyts, S., Landuyt, W., Van Mellaert, L., Dillen, C.,

B€ohringer, M., D€urre, P., Lambin, P. et al. (1999) Stable

Escherichia coli-Clostridium acetobutylicum shuttle vector

for secretion of murine tumor necrosis factor alpha. Appl

Environ Microbiol 65, 4295–4300.

Theys, J., Pennington, O., Dubois, L., Anlezark, G., Vaughan,

T., Mengesha, A., Landuyt, W., Ann�e, J. et al. (2006)

Repeated cycles of Clostridium-directed enzyme prodrug

therapy result in sustained antitumour effects in vivo. Br J

Cancer 95, 1212–1219.

Tyurin, M.V., Desai, S.G. and Lynd, L.R. (2004)

Electrotransformation of Clostridium thermocellum. Appl

Environ Microbiol 70, 883–890.

Umer, B., Good, D., Ann�e, J., Duan, W. and Wei, M.Q. (2012)

Clostridial spores for cancer therapy: targeting solid

tumour microenvironment. J Toxicol 2012, 862764.

Wei, M.Q., Ellem, K.A., Dunn, P., West, M.J., Bai, C.X. and

Vogelstein, B. (2007) Facultative or obligate anaerobic

bacteria have the potential for multimodality therapy of

solid tumours. Eur J Cancer 43, 490–496.

Zaharoff, D.A., Hance, K.W., Rogers, C.J., Schlom, J. and

Greiner, J.W. (2010) Intratumoral immunotherapy of

established solid tumors with chitosan/IL-12. J Immunother

33, 697–705.

Zhang, W.Q., Wang, L.N., Liu, Z.J., Mariameb, D., Yu, H.,

Yang, Z.S. and Yu, X.P. (2006) Functional evaluation of

recombinant human IL-12 ex vivo with cytokine follow

cytometry (CFC). Chin J Microbiol Immunol 26, 383–384.

Zu, C. and Wang, J. (2014) Tumor-colonizing bacteria: a

potential tumor targeting therapy. Crit Rev Microbiol 40,

225–235.

Supporting Information

Additional Supporting Information may be found in the

online version of this article:

Figure S1 The growth curve for each tumour in ATCC

3584-rmIL-12 (a), WT Clostridium sporogenes (b) and

PBS control (c) groups.



clostridium sporogenes delivers interleukin-12 to hypoxic tumours, producing...

Documents