igem synthetic biology

Synthetic Biology

Sergio Peisajovich

Lim Lab June 2007

Synthetic BiologyWhat is Synthetic Biology?

It is an emerging field of biology that aims at designing and building novel biological systems.

The final goal is to be able to design biological systems in the same way engineers design electronic or mechanical systems.

Synthetic BiologyWhy do we need it?

“What I cannot create, I do not understand.”

- Richard Feynman

Synthetic BiologyWhy do we need it?

Cells are the ultimate Chemical Factory.

Synthetic Biology

1- Biology is hierarchical

Is it achievable?

Synthetic Biology

2- Biology is Modular

Is it achievable?

Synthetic Biology

Hierarchy and Modular (recurrent) organization allows biology to be understandable and synthetic biology to be possible.

Is it achievable?

Synthetic BiologyA possible hierarchy for synthetic biology

Synthetic BiologyBiological Components: 1-Parts

Synthetic BiologyBiological Components: 2-Devices

Synthetic BiologyBiological Components: 3-Systems or Modules

Synthetic BiologyBiological Components: 3-Systems or Modules

Basu et al (2005) Nature, 434: 1130-4)

Synthetic BiologyBiological Components: 3-Systems or Modules

Synthetic BiologyBiological Components: 3-Systems or Modules

Synthetic Biology

For synthetic biology to become a form of engineering it will be necessary to achieve precision and reliability.

Factors preventing this:

1- Incomplete knowledge of biology.

2- Inherent functional overlap (parts with many -some unknown- functions, some of which are detrimental to the goal in mind.

3- Incompatibility between parts.

4- Parts functionality depends on context.

Synthetic Biology as Engineering

2- CI represses expression of unrelated host genes

3- LuxR interacts with CI and blocks its function

4- GFP is non-fluorescent in host

Synthetic BiologySynthetic Biology as Engineering Standard Parts

Parts should not have multiple functions

(One subunit of T7 phage DNA polymerase is actually E. coli thioredoxin)

Parts should not encode multiple functions

Synthetic BiologySynthetic Biology as Engineering Standard Parts

Different parts should be compatible

Parts should work in different contexts

Synthetic BiologySynthetic Biology as Engineering Standard Parts

Standardized parts could be easily exchanged between different devices (as well as between different laboratories)

Synthetic BiologySynthetic Biology as Engineering Abstraction

DNA TGCATGCTGATATACGGCTCGAT

Parts

Devices

Systems

Synthetic Biology