introduction to biostatistics (zju 2008) wenjiang fu, ph.d associate professor division of...
Post on 21-Dec-2015
220 Views
Preview:
TRANSCRIPT
Introduction to Introduction to Biostatistics (ZJU Biostatistics (ZJU
2008)2008)Wenjiang Fu, Ph.DWenjiang Fu, Ph.DAssociate ProfessorAssociate Professor
Division of Biostatistics, Department of Division of Biostatistics, Department of Epidemiology Epidemiology
Michigan State UniversityMichigan State UniversityEast Lansing, Michigan 48824, USAEast Lansing, Michigan 48824, USA
Email: Email: fuw@msu.edufuw@msu.eduwww: www: http://www.msu.edu/~fuwhttp://www.msu.edu/~fuw
IntroductionIntroduction Biostatistics ? Why do we need to study Biostatistics? Biostatistics ? Why do we need to study Biostatistics? A test A test
for myself !for myself !
Statistics – Data science to help to decipher data collected in Statistics – Data science to help to decipher data collected in many aspects of events using probability theory and many aspects of events using probability theory and statistical principles with the help of computer. statistical principles with the help of computer.
Statistics Statistics TheoreticalTheoreticalAppliedApplied BiostatsBiostats
EconomicsEconomicsFinanceFinanceEngineeringEngineering
SportsSports… …… …
Data:Data: Events: Events: party, disease, accident, award, party, disease, accident, award, game …game …
Subjects: human, animal … Subjects: human, animal … Characteristics: Characteristics: sex, race, age, weight, sex, race, age, weight,
height …height …
Inferentialstatistics
Estimation
Hypothesistesting
Prediction
StatisticsStatistics
samplingpopulation sample
descriptivestatistics
parameterstatistic
Most commonly, statistics refers to numerical data or other data. Statistics may also refer to the process of collecting, organizing, presenting, analyzing and interpreting data for the purpose of making inference, decision, policy and assisting scientific discoveries.
frequency
probability
Grand challenges we are Grand challenges we are
facingfacing … …
“Data”
Knowledge&
InformationDecision
Statistics
21st century will be the golden age of statistics !
Grand challenges we are Grand challenges we are
facingfacing … …1.1. Data collection technology has advanced Data collection technology has advanced
dramatically, but dramatically, but withoutwithout sufficient sufficient statistical sampling design and experimental statistical sampling design and experimental design.design.
2.2. Advancement of technology for discovering Advancement of technology for discovering and retrieving useful information has been and retrieving useful information has been lagginglagging and has become the bottleneck. and has become the bottleneck.
3.3. More sophisticated approaches are More sophisticated approaches are neededneeded for decision making and risk management.for decision making and risk management.
Statistical Challenges Statistical Challenges - Massive Amount of - Massive Amount of
DataData
Statistical Challenges – Statistical Challenges – Image DataImage Data
Statistics in ScienceStatistics in Science
Cosmic microwave background radiationHigh Energy Physics
Tick-by-tick stock data Genomic/protomic data
Statistics in ScienceStatistics in Science
Finger Prints Microarray
What do we do?What do we do? New ways of thinking and attacking New ways of thinking and attacking
problemsproblems Finding sub-optimal but Finding sub-optimal but
computationally feasible solutions.computationally feasible solutions. New paradigm for new types of dataNew paradigm for new types of data Be satisfied with ‘very rough’ Be satisfied with ‘very rough’
approximationsapproximations Turn research results into easy and Turn research results into easy and
publicly available software and publicly available software and programs programs
Join force with computer Join force with computer scientists. scientists.
Some ‘Some ‘hothot’ research ’ research directionsdirections
Dimension reductionDimension reduction VisualizationVisualization Dynamic systemsDynamic systems Simulation and real time Simulation and real time
computationcomputation Uncertainty and risk Uncertainty and risk
managementmanagement Interdisciplinary researchInterdisciplinary research
Reasons to Study Reasons to Study Biostatistics IBiostatistics I
Biostatistics is everywhere around Biostatistics is everywhere around us:us: Our life: entertainment, sports game, Our life: entertainment, sports game,
shopping, party, communication (cell shopping, party, communication (cell phone), travel …phone), travel …
Our work: career, business, school …Our work: career, business, school … Our health: food, weather, disease … Our health: food, weather, disease … Our environment: safety, security, chemical, Our environment: safety, security, chemical,
animal, animal, Our well-being: physical examination, Our well-being: physical examination,
hospital, being happy, longevity. hospital, being happy, longevity.
Reasons to Study Reasons to Study Biostatistics IBiostatistics I
Entertainment - party: music / dance /foodEntertainment - party: music / dance /food Alcohol, cigarette, drug, etc. Alcohol, cigarette, drug, etc.
Sports game Sports game Car racing, skiing (time to event – survival Car racing, skiing (time to event – survival
analysis).analysis). Shopping: diff taste /preference : Shopping: diff taste /preference :
Allergy to certain food /smell : peanut, flowers … Allergy to certain food /smell : peanut, flowers … Communication - cell phone use Communication - cell phone use
Potential hazard – leads to health problem (CA …) Potential hazard – leads to health problem (CA …) Travel – infectious diseases, safety, accident Travel – infectious diseases, safety, accident
……
Reasons to Study Reasons to Study Biostatistics IIBiostatistics II
We care our society, our family, our We care our society, our family, our environment, our school, scientific research …environment, our school, scientific research …
Major impact on society and communities.Major impact on society and communities. Disease transmissionDisease transmission Healthcare benefit, health economicsHealthcare benefit, health economics Quality of life (research, health improvement)Quality of life (research, health improvement) Safety issue (outbreaks of diseases, etc.)Safety issue (outbreaks of diseases, etc.)
Job market is very promising. Job market is very promising. Applications in a wide-range of areas.Applications in a wide-range of areas.
Healthcare, quality of life, Healthcare, quality of life, Career – job market: scientific, public or private, Career – job market: scientific, public or private,
industrial …industrial …
Reasons to Study Reasons to Study Biostatistics IIIBiostatistics III
Biostatistics research and applicationsBiostatistics research and applications Major employers in the USMajor employers in the US
Research universities, Hospitals, Institutes Research universities, Hospitals, Institutes (NIH), CDC, DoD, NASA, pharmaceutical (NIH), CDC, DoD, NASA, pharmaceutical industry, biotech industry, banks and other industry, biotech industry, banks and other data warehouse … data warehouse …
Major universities having biostatistics Major universities having biostatistics department in the USdepartment in the US Harvard U, U. Michigan, U. Washington Harvard U, U. Michigan, U. Washington
(Seattle), UC (Berkeley, LA, SF), JHU, Yale U, (Seattle), UC (Berkeley, LA, SF), JHU, Yale U, Stanford U … Stanford U …
Reasons to Study Reasons to Study Biostatistics IVBiostatistics IV
New Biostatistics research areas (still growing)New Biostatistics research areas (still growing) Medical research. Medical research. Recent trend in employment Recent trend in employment
Private industry: Google, Microsoft …Private industry: Google, Microsoft … Affymetrix, Illumina, Agilent, Golden Helix, Affymetrix, Illumina, Agilent, Golden Helix,
23andMe …23andMe … Investment – stock market, Capital One, Bank of Investment – stock market, Capital One, Bank of
America, Goldman Sack, etc.America, Goldman Sack, etc.
Nano tech, green energy (alternative energy) Nano tech, green energy (alternative energy) ……
Example 1. Medical study Example 1. Medical study data: Ob/Gyndata: Ob/Gyn
Modeling of PlGF: Placental Growth Factor
Example 2. Genomics study Example 2. Genomics study Single Nucleotide Single Nucleotide
Polymorphism (SNP) Polymorphism (SNP) Homologous pairs of chromosomesHomologous pairs of chromosomes
Paternal allelePaternal allele
Maternal alleleMaternal allele
Paternal allele
Maternal allele
ACGAACAGCTTGCTTGTCGA
ACGAGCAGCTTGCTCGTCGA
SNP A/G
Computational Genomics: SNP Computational Genomics: SNP GenotypeGenotype
Error rate : around 5% : Genome-wide association studies – millions of SNPs
ApplicationsApplications
Genetic counseling: Genetic counseling: gene expression + family medical history gene expression + family medical history
diseasedisease Breast cancer (BRCA) …Breast cancer (BRCA) …
Achieve accurate estimation and prediction Achieve accurate estimation and prediction Early detection / early treatment (cancer, …)Early detection / early treatment (cancer, …) Accurate diagnosis (HIV +)Accurate diagnosis (HIV +)
Help development of new drugs for treatment.Help development of new drugs for treatment. Help to protect environment, live longer and Help to protect environment, live longer and
happier, improve quality of life. happier, improve quality of life.
Did I pass my test?Did I pass my test?
I hope I have convinced you to study I hope I have convinced you to study biostatistics.biostatistics.
Chapter 2. Descriptive Chapter 2. Descriptive StatisticsStatistics
First important thing to do is to First important thing to do is to visualize data.visualize data.
Plot of dataPlot of data Scatter plot – pair-wise (var 1 vs. var 2)Scatter plot – pair-wise (var 1 vs. var 2)
Scatter plotScatter plot
Descriptive StatisticsDescriptive Statistics
Summarize data using statisticsSummarize data using statistics Central location (mean, median)Central location (mean, median) Range (min, max)Range (min, max) Variability (variance, standard deviation)Variability (variance, standard deviation) ModeMode Quantiles (percentiles)Quantiles (percentiles)
Rank data, but avoid long listing (use Rank data, but avoid long listing (use grouping, instead)grouping, instead)
Measure of LocationMeasure of Location
1
1 N
ii
xN
MeanMean
The mean is the sum of all the observations divided by the number of observations.
Population mean :Population mean :
Sample mean :Sample mean :
N The number of observations in the population.
n The number of observations in the sample.
n
iixn
x1
1
The mean is the most widely used measure of location and has the following properties :The mean is the most widely used measure of location and has the following properties :
The mean is oversensitive to extreme values in the sample.The mean is oversensitive to extreme values in the sample.
,baxy ii ni ,,1 bxay
N
i
n
iii xxx
1 1
0)()(
Properties of the meanProperties of the mean
Translation of dataTranslation of data
Measure of LocationMeasure of Location
Median and ModeMedian and Mode
The median is the value of the “middle” point of samples, when samples are arranged in ascending order.The median is the value of the “middle” point of samples, when samples are arranged in ascending order.
Median = The [(n+1)/2]th largest observation if n is odd.
= The average of the (n/2)th and (n/2+1)th largest observation if n is even.
The mode is the most frequently occurring value among all the observations in a sample. It is the most probable value that would be obtained if one data point is selected at random from a population.
The mode is the most frequently occurring value among all the observations in a sample. It is the most probable value that would be obtained if one data point is selected at random from a population.
Calculate the median and mode of the following data:
12, 24, 36, 25, 17, 19, 24, 11
Sorted data : 11, 12, 17, 19, 24, 24, 25, 36
Example: Median and ModeExample: Median and Mode
19 2421.5,
2
Median = Mode = 24
≤ ≤ = =
Mean Median Mode
≤ ≤
The mean is influenced by outliers while the median is not.The mean is influenced by outliers while the median is not.
The mode is very unstable. Minor fluctuations in the data can change it substantially; for this reason it is seldom calculated.
mode mode
bimodal
When the shape of a distribution to the left and the right is mirror image of each other, the distribution is symmetrical. Examples of symmetrical distribution are shown below :
When the shape of a distribution to the left and the right is mirror image of each other, the distribution is symmetrical. Examples of symmetrical distribution are shown below :
A skewed distribution is a distribution that is not symmetrical . Examples of skewed distributions are shown below :A skewed distribution is a distribution that is not symmetrical . Examples of skewed distributions are shown below :
Positively skewed Negatively skewed
Symmetry and Skewness in Distribution
Range and Mean Absolute Deviation (MAD)Range and Mean Absolute Deviation (MAD)
The Range is the simplest measure of dispersion. It is simply the difference between the largest and smallest observations in a sample.
The mean absolute deviation is the average of the absolute values of the deviations of individual observations from the mean.
minmax xxRange
n
xxMAD
n
ii
1
||
Measure of DispersionMeasure of Dispersion
Quantile (percentile) is the general term for a value at or below which a stated proportion (p/100) of the data in a distribution lies.
Quantile (percentile) is the general term for a value at or below which a stated proportion (p/100) of the data in a distribution lies.
Quartiles: p = .25, .50, .75 Quantile / Percentile : p is any probability value
Quantiles or PercentilesQuantiles or Percentiles
Measure of DispersionMeasure of Dispersion
Let [k] denote the largest integer k. For example, [3]=3, [4.7]=4.
The p-th percentile is defined as follows:
• Find k = np/100.
• If k is an integer, the p-th percentile is the mean of the k-th and (k+1)-th observations (in the ascending sorted order).
• If k is NOT an integer, the p-th percentile is the [k]+1-th observation.
Calculating Quantiles or PercentilesCalculating Quantiles or Percentiles
Sorted data : 2, 4, 7, 8, 12, 14, 16, 17, 19, 20
(n = 10)10th percentile: k = np/100 = 10×10/100 = 1
Average of 1st and 2nd observations = (2+4)/2 = 3
75th percentile: k = np/100 = 10×75/100 = 7.5[7.5]+1 = 7+1 = 8th observation = 17
ExampleCalculate the 10th percentile and the 75th percentile of the following data:
7, 12, 16, 2, 8, 4, 20, 14, 19, 17
The variance is a measure of how spread out a distribution is. It is computed as the average squared deviation of each number from its mean. The standard deviation is the square root of the variance. It is the most commonly used measure of spread.
The variance is a measure of how spread out a distribution is. It is computed as the average squared deviation of each number from its mean. The standard deviation is the square root of the variance. It is the most commonly used measure of spread.
sample variance
Variance and Standard DeviationVariance and Standard Deviation
Measure of DispersionMeasure of Dispersion
1
)(1
2
2
n
xxs
n
ii
x
sample standard deviation2xx ss
,baxy ii ni ,,1 ,222xy sas | | ,y xs a s
Five people have their body mass index (BMI) calculated as
[body weight (kg)] / [height] 2
18, 20, 22, 25, 24
ExampleExample
1
2 2
1
1 10921.8
5
1 32.8( ) 8.2
1 5 1
8.2 2.86
n
ii
n
x ii
x
X xn
s x Xn
s
A direct comparison of two or more measures of dispersion may be difficult because of difference in their means.
A relative dispersion is the amount of variability in a distribution relative to a reference point or benchmark.
A common measure of relative dispersion is the coefficient of variation (CV).
A direct comparison of two or more measures of dispersion may be difficult because of difference in their means.
A relative dispersion is the amount of variability in a distribution relative to a reference point or benchmark.
A common measure of relative dispersion is the coefficient of variation (CV).
This measure remains the same regardless of the units used when only scaling applies. Very useful !
Good Example: Weight, Kg versus Lb.
Bad Example: Temperature: C vs F.
This measure remains the same regardless of the units used when only scaling applies. Very useful !
Good Example: Weight, Kg versus Lb.
Bad Example: Temperature: C vs F.
x
sCV x100
Relative Dispersion – Coefficient of VariationRelative Dispersion – Coefficient of Variation
Frequency DistributionFrequency Distribution
Long list of data collection can be confusing, and need to be grouped in moderate intervals, rather than listed as raw data point.
Hospital Length of Stay (LOS)__________________________________________________________________________________________81 44 29 23 16 13 12 11 11 64 43 28 22 16 13 12 11 11 12 1263 43 28 21 16 13 12 11 11 58 42 28 21 15 13 12 11 10 11 1098 58 42 28 20 15 13 12 11 10 93 56 36 28 20 15 12 12 11 1086 55 36 27 19 15 12 12 11 10 83 50 32 27 18 14 12 12 11 1083 50 32 26 27 14 12 12 11 10 81 48 30 23 17 14
Hospital Length of Stay (LOS)__________________________________________________________________________________________81 44 29 23 16 13 12 11 11 64 43 28 22 16 13 12 11 11 12 1263 43 28 21 16 13 12 11 11 58 42 28 21 15 13 12 11 10 11 1098 58 42 28 20 15 13 12 11 10 93 56 36 28 20 15 12 12 11 1086 55 36 27 19 15 12 12 11 10 83 50 32 27 18 14 12 12 11 1083 50 32 26 27 14 12 12 11 10 81 48 30 23 17 14
Interval Frequency Relative Frequency
LOS
LOS
LOS
LOS
LOS
LOS
LOS
LOS
LOS
LOS
A summary table works better
than raw data.
A summary table works better
than raw data.
A bar graph is simply a bar chart of data that has been classified into a frequency distribution. The attractive feature of a bar graph is that it allows us to quickly see where the most of the observations are concentrated.
Graphic MethodsGraphic Methods
Interval Frequency
LOS
LOS
LOS
LOS
LOS
LOS
LOS
LOS
LOS
LOS
Bar Graph
Histogram provides a distribution plot, where the bars are not necessarily of the same length. The area of each bar is proportional to the density of the data or percentage of data points within the bar.
Graphic MethodsGraphic Methods
Histogram
3 1
1 31.5 , 1.5
IQR Q Q
MIN Q IQR MAX Q IQR
MIN MAX
The box Plot is summary plot based on the median and interquartile range (IQR) which contains 50% of the values. Whiskers extend from the box to the highest and lowest values, excluding outliers. A line across the box indicates the median.
The box Plot is summary plot based on the median and interquartile range (IQR) which contains 50% of the values. Whiskers extend from the box to the highest and lowest values, excluding outliers. A line across the box indicates the median.
Graphic MethodsGraphic MethodsBox Plot
top related