proceedings zafar-corrected
Post on 14-Jan-2017
365 Views
Preview:
TRANSCRIPT
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
1
THE GLOBAL CHICKEN: RECENT REMARKABLE EVENTS AND
FUTURE THREATS AND OPPORTUNITIES
Corrie Brown, DVM, PhD, DACVP
Josiah Meigs Distinguished Professor
University of Georgia, Athens, GA 30602, USA
corbrown@uga.edu
ABSTRACT
Chickens have the distinction of being the oldest domesticated food animal and also the most
populous. The red junglefowl was domesticated in Asia, as early as 7000BC, becoming the common
barnyard animal we know. Today there are at least 19 billion chickens in the world, one for every
three humans. Chicken crosses many cultural boundaries with ease, it is the one meat that can be
found universally in the cuisines of every nation.
Intensive production has allowed chickens to expand beyond the traditional backyard bird to
assume a huge role in agribusiness. Globally, there are roughly 87M metric tons of broiler meat
produced annually, with 12% of that designated for export. The World Organization for Animal
Health (OIE) lists 13 diseases of poultry requiring international notification and potential suspension
of export capacity. Of these, two deserve special attention for their negative impacts – highly
pathogenic avian influenza (HPAI) and Newcastle disease (ND). HPAI has emerged in recent years as
a very serious threat to poultry production globally because of the propensity of certain strains to
infect and occasionally kill humans. The ND virus continues to circulate and decimate chicken
populations it infects. Sustainable solutions to these two diseases represent huge opportunities for
our profession.
Although much smaller in numbers overall than their commercial cousins, village chickens are the
main staple of smallholders throughout the world and provide a very important part of animal source
food, so essential in supplying the micronutrients needed for growth and overall health. Village
chickens also form a key part of the microeconomy, as the extra income from selling eggs or meat,
usually done by women, is invested back into the family. As such, village chickens represent a
marvelous opportunity to enhance the livelihoods and health of the rural poor. However, these
roaming chickens continue to pose a serious threat to the commercial sector in every country, as has
been evidenced many times with both HPAI and ND. Resolving the conflict, these chickens present to
their commercial cousins will be essential.
Key Words: Trade; economy; highly pathogenic avian influenza, Newcastle disease
ORIGINS OF CHICKEN
Chickens have the distinction of being the oldest domesticated food animal, with the red
junglefowl becoming part of the human backyard as early as 7000BC in Asia. It was probably first
domesticated for cockfighting, the world’s oldest continual sport. The red junglefowl was likely
crossed with what is today known as the grey junglefowl of South Asia, which gave it the yellow skin
we know, and the familiar barnyard animal of today.
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
2
Chickens also win the contest for the most populous food animal. The number of chickens in the
world have tripled over the last 30 years, so that today there are almost 22 billion chickens in the
world, one for every three humans.
Poultry is the second most commonly consumed meat in the world (33% of total), following
closely after pork, which comprises 34%. And certainly poultry is found in more places than pork. In
fact, chicken is the one meat that can be found universally in the cuisines of every nation. It crosses all
cultural boundaries with ease. Virtually every country has some dish they proclaim as their own, and
that contains chicken – Southern Fried Chicken, Coq Au Vin, Chicken Parmigiana, Kung Pao Chicken,
Tandoori Chicken, Chicken Kiev, etc.
HOW CHICKEN INTENSIFICATION CAME ABOUT
How did we get chicken from the small backyard flocks, overseen predominantly by smallholders,
and constituting a minority of the global livestock species populations, to 22 billion today? In the
1950’s, farmers began to realize that they could raise a bird for meat only, rather than the dual
purpose bird that scavenges about the yard. They built houses, supplied the birds with some grain,
and then began selective breeding so that they would reach market weight at the earliest possible
moment. As a result, profits were excellent, and affordability superb, allowing both consumers and
producers to great advantage. This deliberate breeding has allowed the time to market for broilers to
drop considerably over the last 20 years, from a couple of months down to only 5 weeks.
Intensification of the poultry industry reached its maximum growth in the 1990’s and early
2000’s, as can be seen from the massive expansion in numbers, according to FAOSTAT (Fig. 1).
Much of this expansion in intensive poultry production took place in the developing world. Brazil
provides a stellar example, where a country that is considered to be an emerging market, was able to
modernize and intensify its poultry production to the point where, since 2014, Brazil is now the
leading exporter of chicken globally. This translates into considerable foreign cash flowing into the
country, helping to diversify other industries and creating overall a more robust national economy.
Most of the growth of the industry in the developing world has been done through investments
by foreign-owned companies. Historically, foreign direct investment (FDI) has often been oriented
toward food. And of all the agricultural commodities, poultry production lends itself the best to FDI.
International investors look for opportunities to invest that will provide good value for dollar given,
and poultry production in the developing world fits perfectly. There is availability of inexpensive
labor, the setup costs are attainable, and the turnover of product into the marketplace is rapid. As a
result, huge monetary flows went from the developed to the developing world, helping to expand
intensive poultry production.
Global FDI took a slight downturn with the worldwide recession in 2008, but now is picking up
again. As FDI continues to grow, it is predominantly South-South flows of funds, mostly due to
emerging markets in Asia investing in developing nations.
GLOBAL TRADE
Chickens might just serve as the “mascot” of globalization. The advent of complex
interdependence represented by increasing trade among countries has chicken at the forefront of
cross-border traffic and international efforts at development.
Intensive production has allowed chickens to expand beyond the traditional backyard bird to
assume a huge role in agribusiness. Globally, there are roughly 87M metric tons of broiler meat
produced annually, with 12% of that designated for export, totaling more than 20B USD (Fig. 2). This
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
3
represents huge value for exporting countries but also has large risks. Disease incursions can halt
trade precipitously, greatly endangering the economic enterprise.
ECONOMIC OPPORTUNITIES AND FOOD SECURITY PROVIDED BY CHICKENS
Poultry is widely considered as the livestock of the poor. Chickens kept by smallholders are
referred to as “village” chickens, and are perfectly suited to the environment and the local economic
situation. Input resources are minimal, mostly just kitchen leftovers, but those who also raise grain
may supply the birds with small amounts of grain as well.
Fig. 1: Estimates of numbers of chickens in the
world, demonstrating and almost tripling of
populations over 30 years.
Fig. 2: Dollar value of chicken meat that is
exported from one country to another,
globally, demonstrating a ten-fold increase
over 25 years.
Globally, most rural households have some poultry. Although much smaller in numbers overall
than their commercial cousins, village chickens are the main staple of smallholders throughout the
world and provide a very important part of animal source food, so essential in supplying the
micronutrients needed for cognitive growth and overall health.
There are probably a billion people in the world who qualify as “smallholders.” Many consider
the term “smallholder” to mean those farmers that are not yet intensified, or those farmers that have
yet to move out of poverty. However, smallholders have persisted for centuries, and are likely to
persist long into the future. Within the smallholder system, the household is the main unit, and
poultry offer huge value-added for minimal input.
Village chickens form a key part of the microeconomy, as the extra income from selling eggs or
meat, usually done by women, is invested back into the family, with much of the income going to
children’s schooling or medical costs. It is estimated that 2-5% of annual household income across
subSaharan Africa is from poultry and poultry products. Also the high quality protein that chickens
and their eggs provide is invaluable for supplying the animal source food so essential in helping to
ensure adequate micronutrients for optimal health and cognitive development. As such, village
chickens represent a marvelous opportunity to enhance the livelihoods and health of the rural poor.
Most development programs aimed at decreasing rural poverty have at least a partial focus on
smallholder poultry.
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
4
Across the world, the numbers of village chickens are only a small fraction of total chicken
populations, as they are far outnumbered, on a global scale, by their commercially-reared cousins.
However, depending on the specific country, village chickens may actually be the overwhelming
majority. This is generally true for most of the low-income food-deficit countries. In Nigeria, for
instance, village chickens are thought to constitute 77% of the national flock. And in Ethiopia, Uganda,
and Malawi, more than 80% of the chickens raised in these countries are “village” rather than
“commercial.”
Unfortunately, there are often considerable losses in the village birds. Predators claim many and
illnesses constantly threaten. Diseases are particularly hard to control, as biosecurity is really not
feasible for these roaming scavengers. As a result, village chickens continue to pose a serious threat
to the commercial sector in every country, as has been evidenced many times with both highly
pathogenic avian influenza (HPAI) and Newcastle disease (ND). Resolving the conflict these chickens
present to their commercial cousins will be essential.
DISEASES THREATENING THE INDUSTRIES
Robust and continuing trade in animals and animal products is dependent on freedom from
disease. The World Organization for Animal Health (OIE) lists 13 diseases of poultry requiring
international notification and potential suspension of export capacity. Of these, two deserve special
attention for their negative impacts – HPAI and ND. HPAI has emerged in recent years as a very
serious threat to poultry production globally because of the propensity of certain strains to infect and
occasionally kill humans. The ND virus continues to circulate and decimate chicken populations it
infects. Sustainable solutions to these two diseases represent huge opportunities for our profession.
These two diseases are covered in more detail below.
In addition, there are emerging diseases which cause consternation and can temporarily interrupt
commerce.
Avian leucosis (subgroup J) virus (ALV-J) arose in the late 1990’s, creating myeloid neoplasms.
Unfortunately some breeding companies had their genetic stock contaminated with ALV-J, resulting in
the disease being exported to more than 50 countries. There were major losses of broiler breeders
worldwide.
Fowl adenovirus serotype 4, the cause of hydropericardium syndrome, was first described in
Pakistan in the 1990’s and has now spread to many parts of the world. There can be heavy losses,
with a sudden onset of mortality up to 80%. In addition to causing illness and death, the virus is
known to be immunosuppressive because of its damaging effects on lymphoid tissues.
The highly pathogenic avian influenza global pandemic (H5N1) that began in 2003 gave great
insight into economic problems engendered as a result of a trade-limiting and/or public health-threat
disease. Direct losses were especially high in Southeast Asian countries. It is estimated that the
outbreaks in 2003-2004 resulted in losses of 17% of the total bird populations in Vietnam,
representing 44M birds, and 14.5% in Thailand, or 29M birds. Thailand lost its position as the 5th
largest global exporter of poultry, as, during the first quarter of 2004, poultry exports fell 75%.
Similar decreases were seen in Hong Kong and China. There were also great losses in other parts of
the economy as well, for instance, tourism dropped, as travelers became wary of journeying to
locales where there might be affected birds. Although research has shown that infection of humans
requires very close contact with affected birds, often multiple birds, nevertheless, the 40% mortality
rate in humans associated with infection has made many public health officials very cautious. This
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
5
virus continues to circulate, greatly hampering trade and creating economic hardships as well as
straining public health resources in affected countries.
Costs and threats regarding the smallholders as a result of H5N1 were less rigorously quantified.
As mandatory slaughter was instituted in many areas, it had a marked negative impact on the
smallholder. It wiped out the contribution of poultry to the family income as well as to food security.
Sale value was markedly reduced. For instance, in Vietnam, a country hit hard by H5N1,
confinement/eradication method resulted in a 10-25% decrease in the poorest families’ annual
incomes.
The H5N1 experience also showed the world how the character and shape of the outbreak
curves can differ according to the relative proportions of village vs. commercial chickens. In East and
Southeast Asia, the Middle East, and Africa, there were high casualty rates in the poultry industry,
extensive spread, and prolonged outbreaks, largely due to the presence of outdoor birds that kept
the outbreaks percolating. Western European countries such as Germany and France also have some
outdoor birds, but not typical smallholder operations, more like niche markets, and they were able to
ban outdoor poultry production, which greatly abbreviated their outbreak experiences. So, it was
apparent that controlling the outbreaks required monitoring among the outdoor birds, a very
challenging endeavor in resource-poor countries.
Another strain of HPAI, H5N2, entered the US in December 2014, with migratory birds infecting
backyard poultry kept in the Pacific Northwest. The virus subsequently spread to the Midwest and
decimated poultry production in some states. As a result, during the first half of 2015, US exports
dropped by 14%, as various trading partners placed sanctions on American-origin poultry and poultry
products. The value of the US poultry industry fell by $390M. A total of 49M birds succumbed to the
disease or were euthanized in the face of spread. This caused increased prices in chicken and very
notably eggs, which doubled in price during the first few months of the outbreak. Thanksgiving
turkeys, a large November-based market in the US, are predicted to be offered at extremely high
prices, as a result of the major turkey producers losing much of their stock during the H5N2
outbreaks over the summer.
Newcastle disease, an avian paramyxovirus, has a global distribution. There are only very few
areas of the world that can claim freedom from the disease, and even these areas have periodic
incursions. This disease may be responsible for more morbidity and mortality, and failure of
industries, and also enhanced food insecurity, than any other disease of chickens.
When Newcastle disease enters a house of chickens, the morbidity rate is close to 100% and the
mortality can be as much as 90%.
Recent outbreaks in countries with advanced animal health infrastructure demonstrate how an
incursion can be extremely costly. An outbreak in the US in 2002-2003 took the lives of three
million birds with estimated industry losses of $5B. Regionalization of the country, according to OIE
guidelines, saved the national chicken industry from total implosion, as the disease remained confined
to the most western part of the US, allowing the chicken production on East and Midwest to
continue relatively unimpaired.
Finding hard data about the impact of ND on village chickens is more challenging. It is estimated
to be the main cause of loss of chickens throughout Africa. Where data exist, for instance, in Chad,
annual losses to smallholder farmers from ND are estimated at 65-100% annually. Unfortunately the
current vaccines for ND may protect against severe disease but overwhelming challenge exposure
will still result in birds becoming ill and dying. Also, vaccinated birds, when infected, still shed the
field virus in their feces when infected, and so the virus can continue to spread. A question often
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
6
asked is about the prevalence of ND. It is known that, in contrast to HPAI, ND is more likely to be
in the region constantly, not just in an outbreak form. A serologic study of unvaccinated birds
demonstrates that the virus is probably constantly or intermittently present throughout the year in
areas.
CONCLUSIONS
In summary, poultry has become the most global of all livestock commodities, with tremendously
burgeoning numbers of commercial birds which undergo a significant amount of international
movement. At the same time, poultry remains the stronghold of the smallholder, supplying much
needed boosts to food security, nutrition, and household economies. Disease agents don’t care
which sector – smallholder or commercial – they infect and the resulting damage to both can be
severe. Ensuring that both sectors are maintained in a sustainable and profitable way is essential.
REFERENCES
Adler J and A Lawler, 2012. How the chicken conquered the world. Smithsonian, 43: 40-47.
Antipas BB, K Bidjeh and ML Youssouf, 2012. Epidemiology of Newcastle disease and its economic
impact in Chad. Euro J Experim Biol, 2: 2286-2292.
Asthana M, R Chandra and R Kumar, 2013. Hydropericardium syndrome: current state and future
developments. Archive Virology 158: 921-931. doi: 10.1007/s00705-012-1570x
Bagust TJ, 2013. Emerging pathogens of poultry diseases. Poult Develop Rev, FAO, 101-102.
Birol E, D Asare-Marfo, G Ayele, A Mensah-Bonsu, L Ndirangu et al., 2010. The impact of avian flu on
livelihood outcomes in Africa: evidence from Ethiopia, Ghana, Kenya and Nigeria. Afr J Agric Res
Econ, 8: 275-288.
Otte J, D Roland-Holst and D Pfeiffer, 2006. HPAI control measures and household incomes in
Vietnam. Pro-Poor Livestock Policy Initiative, www.fao/ag/pplpi.html
Rushton J, R Viscarra, E Guerne Bleich and A McLeod, 2005. Impact of avian influenza outbreaks in
the poultry sectors of five South East Asian countries (Cambodia, Indonesia, Lao PDR, Thailand,
Viet Nam) outbreak costs, responses and potential long term control. World’s Poult Sci J, 61:
491-514. doi: 10.1079/WPS200570.
Serrão E, J Meers, R Pym, R Copland, D Eagle et al., 2012. Prevalence and incidence of Newcastle
disease and prevalence of avian influenza infection of scavenging village chickens in Timor-Lesté.
Prev Vet Med, 104: 301-308.
Sonaiya EB, 2007. Family poultry, food security and the impact of HPAI. World’s Poult Sci J, 63:132-
138. doi: 10.1079/WPS2006135
Taha FA, 2007. How Highly Pathogenic Avian Influenza (H5N1) Has Affected World Poultry-Meat
Trade. A Report from the Economic Research Service, LDP-M-159-02.
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
7
VECTOR VACCINES FOR POULTRY: THEIR ADVANTAGES AND LIMITATIONS
COMPARED TO CLASSICAL VACCINES
Michel Bublot
Merial S.A.S., 254 rue Marcel Mérieux 69007 Lyon, France
ABSTRACT
Vector vaccines have been developed and licensed for poultry since the mid-1990s. Avian vector
vaccines are bivalent vaccines since the vector is itself a vaccine strain. The current avian licensed
vector vaccines are based on 3 types of vectors: fowlpox, Newcastle disease (ND) virus and
herpesvirus of turkey (HVT), the latter type being the most widely used. The most successful is an
HVT-IBD that confers protection against both Marek’s disease and infectious bursal disease (IBD). It
combines major advantages over conventional IBD vaccines including safety, efficacy and a single
hatchery administration. In contrast to vector vaccines against other diseases, the efficacy of HVT-
IBD outperformed that of classical IBD vaccines, including the immune complex IBD vaccines. HVT-
ND vaccines are safe and induce a long duration of protection but a slow onset and a poor local
immunity. The use of live ND vaccine is still required in complementation of HVT-ND vaccines.
HVT-ILT vaccines are bringing safety to ILT vaccines, but their efficacy is clearly lower than the
classical live CEO vaccines. HVT-AI induces a broad level of protection but a slow onset of immunity.
These HVT-based vectors are currently not fully compatible and poultry veterinarians need to know
how each type of vaccine is working, their performances and limitations in order to set up a
vaccination program including both vector and classical vaccines in line with the field situation.
Key Words: Vector vaccine, modified-live vaccine, immune-complex vaccine, IBD, ND, ILT
Introduction
The quality and performances of vaccines has improved a lot since the pioneered work of
Edward Jenner and Louis Pasteur in the 18th and 19th century, respectively. Industrial production of
classical vaccines based on modified-live or inactivated pathogen agents initiated in the second half of
the 20th century. In 1973, the cloning a foreign DNA fragment into a bacteria plasmid using restriction
enzyme was the start of the rapidly evolving genetic engineering area which led to the modern
biotechnology. Thirteen year later (1986), the first “biotech vaccine” was licensed against human
hepatitis B; it was a subunit vaccine produced in yeast and it replaced the first generation vaccine
made from plasma of infected patients. In the veterinary field, a vaccinia-vectored vaccine was first
licensed in 1994 as baits to vaccinate wildlife against rabies (Brochier et al., 1991). Since then, many
new biotech vaccines have been developed, especially for veterinary applications (Meeusen et al.,
2007). In poultry, viral vector vaccine technology is the most successful technology applied for
development of new vaccines. This minireview will focus on the description of currently licensed
vector vaccines for poultry. Their advantages and limitations compared to classical vaccines will be
discussed.
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
8
1. The mechanisms of action of vector vaccines
A vector vaccine is a vaccine that utilizes one organism (the vector) as a carrier to generate
protection against a second organism. Since the pioneer work on the vaccinia vector, numerous
studies have shown the potential of vector vaccines in veterinary medicine (Brun et al., 2008). Avian
vector vaccines are often bivalent vaccines since the vector is usually itself a vaccine strain. There are
2 major components in vector vaccines: the vector and the foreign sequence inserted into its
genome. This inserted sequence will allow expression of a “protective gene” of the targeted pathogen
agent during in vivo replication of the vector. The resulting “protective protein” will then induce an
immune response against this agent that will protect the vaccinated host from subsequent challenge
(Fig. 1). The immune response includes humoral, cellular as well as mucosal immunity if the vector
replicates in mucosal tissues. The inserted sequence also contains sequences that will drive optimal
expression of the protective gene such as promoter and poly-adenylation signal. The protective
gene(s) of most viruses are known but those from bacteria or parasites remain to be identified. This
is one of the reasons why vector vaccines usually target viral and not bacterial or parasitic diseases.
Fig. 1: Schematic representation of the mechanisms of action of the HVT-IBD vector vaccine as an
example of bivalent vector vaccine protecting against both infectious bursal disease (IBD) and Marek’s
disease (MD). The vector vaccine infects the target cells of the vaccinated host soon after vaccination.
It then starts its replication cycle during which it expresses the foreign protective protein (in this
example of HVT-IBD, the IBDV VP2 protein). This foreign protein as well as the vector proteins will
induce an immune response that will protect the vaccinated chicken against both IBD and MD. Vector
virus-infected cells will also release new vector virus progeny that will infect new target cells. These
successive replication cycles will further increase foreign protective protein and vector production,
and consequently, the immune response against both IBD and MD.
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
9
The choice of the vector is critical since it will have an impact on many vaccine properties
including the route and the timing of vaccine administration, the persistence of the vaccine and
protective gene expression, the efficacy of the vaccine in presence of maternally-derived antibodies
(MDA), the dose of the vaccine, the type of immunity induced by the vaccine, the possibility to
associate the vector vaccine with other vaccines, and the manufacturing and stability of vaccine. Large
DNA viruses such as poxvirus and herpesvirus are vectors of choice since their genome can be easily
manipulated and they can afford insertion of relatively large foreign sequences that are stably
integrated into their genome. In mammals, non-replicative vectors such as the canarypox have been
developed (Poulet et al., 2007), but in avian, all licensed vector vaccines are currently based on
replicative vectors. Replicative vectors allow using a lower dose and only one administration.
Fowlpox (FP) and herpesvirus of turkey (HVT) are the most common vectors used in poultry but
Newcastle disease virus (NDV) has also been recently developed. The viral vector vaccines may
contain a certain amount of the protective protein either in or outside its viral structure, but it is
usually considered that it is the de novo expression of the protective gene during in vivo vector
replication that will induce most of the protective immune response and not the protective protein
physically present in the vaccine.
2. Fowlpox-based vector vaccines
Licensed fowlpox (FP)-based vector vaccines have been developed against Newcastle disease
(ND), avian influenza (AI), infectious laryngotracheitis (ILT) and Mycoplasma gallisepticum (Mg). They
are bivalent vaccines since they also protect against fowlpox disease. The FP-NDV was the first
vector vaccine to be licensed in poultry in 1994 (Taylor et al., 1990) in the USA followed by the FP-AI
(H5 subtype) (Swayne et al., 1997). The latter (TROVAC®-AIV H5*) expresses the hemagglutinin
(HA) gene from a 1983 highly pathogenic (HP) Irish H5N8 isolate and it has been used mainly in
Mexico infection since 1998 to protect chickens against low pathogenic (LP) H5N2. This vaccine can
be administered by the sub-cutaneous route to one-day-old chicks at the hatchery at the same time
as Marek’s disease vaccine. It was shown to induce a broad immunity against multiple HP and LP AI of
H5 subtypes, including H5N1 isolates that emerged in the early 2000s (Bublot et al., 2006, Bublot et
al., 2010). The immune response is directed against the HA only, and detection of infection in
vaccinated birds can then easily be performed using serologic tests detecting the antibody response
against other AI proteins such as the nucleoprotein; it is therefore compatible with a DIVA
(differentiating infected from vaccinated animals) strategy. Since their emergences, these H5N1 (and
H5-based reassortants with other neuraminidase (NA) subtypes) isolates evolved antigenically and
this fowlpox-based vaccine progressively lost its ability to protect well against these new isolates.
Interestingly, the FP-AI vaccine induces a strong priming response, which can be boosted by the
administration of an inactivated AI vaccine. This heterologous prime-boost vaccination scheme was
found to induce a broad protection even against HPAI H5N1 antigenic-drift variants such as those
which emerged in Indonesia in 2007 and in Egypt in 2008, against which both the FP-AI and
heterologous inactivated vaccines alone were poorly protective (Swayne et al., 2015). The recent
study of anti-vector and anti-insert MDA interferences on AI immunogenicity and efficacy of the FP-
AI and inactivated vaccines indicated that the anti-vector (anti-FP) MDA had limited effects on FP-AI
immunogenicity; the anti-insert (anti-AI) MDA had the highest negative impact on the inactivated
vaccine but it also interfered with FP-AI. However, the FP-AI priming in birds with AI MDA could
clearly overcome the strong MDA interference on inactivated vaccine (Richard-Mazet et al., 2014).
This prime-boost regimen has been applied in the field in Mexico and in Egypt. It was also shown to
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
10
be immunogenic in ducks, a species in which the fowlpox is not thought to replicate (Steensels et al.,
2009, Bublot et al., 2010). A FP-AI was also developed in China in 2005 to control HPAI H5N1
infections (Chen and Bu, 2009).
The efficacy levels induced by the FP-ILT and FP-Mg against ILT (Johnson et al., 2010, Vagnozzi et
al., 2012) and Mg challenge (Ferguson-Noel et al., 2012), respectively, were found to be relatively low
compared to classical vaccines. This poor performance may be due to the lack of induction of
mucosal immunity induced by the fowlpox vector, and, for Mg, to the poor protective ability of the
Mg gene inserted into the fowlpox vector.
3. Herpes of turkey-based vector vaccine
The HVT vector has advantages over FP: It is suitable and safe for both in ovo and subcutaneous
hatchery administration and to provide a life-long immunity. The long duration of immunity is likely
the result of persistence of the HVT vector in the vaccinated chickens: it is thought that the
protective gene inserted into the HVT vector is expressed either continuously during latency or
frequently during regular episodes of reactivation. This vector can also hasten the maturation of the
chicken embryo immune response when administered in ovo (Gimeno et al., 2015). The generation of
the first HVT vector vaccine was reported in 1992 in a NDV model (Morgan et al., 1992), but the first
licensed HVT-based vector was an infectious bursal disease vaccine (HVT-IBD designated
VAXXITEK® HVT+IBD*) that was launched in Brazil in 2006 and that became the most used vector
vaccine; more than 65 billion birds were vaccinated so far in at least 75 countries worldwide (Darteil
et al., 1995, Bublot et al., 2007, Le Gros et al., 2009). This live vector vaccine expresses the IBDV gene
coding for VP2, the external capsid protein of IBDV. It combines major advantages over modified-live
(MLV) or immune complex (ICx) conventional IBD vaccines including safety, efficacy and a single
hatchery administration. It is the only live IBD vaccine that does not induce bursal lesions and
therefore, has no immunosuppressive effect. The IBD MLV contain either attenuated intermediate (I)
or less attenuated intermediate plus (I+) IBDV strain. They are administered in the drinking water
either once or twice when mean MDA levels reached the level low enough so that they can replicate.
This level is lower for I-based MLV but for both types of MLV, it is below the level at which very
virulent or variant IBD strains replicate (Fig. 2A). The immune complex (ICx) vaccine is administered
at the hatchery but the I+ IBDV strain present in this vaccine will not replicate until MDA reach a
certain level (Jeurissen et al., 1998), which is also below the level that inhibits wild type IBDV
replication (Fig. 2B). There is therefore a period of time at which the birds are sensitive to wild type
IBDV infection and are not yet protected by these MLV or ICx vaccines; this period is called the
“immunity gap” (Fig. 2). In contrast to these conventional vaccines, the HVT-vectored IBD vaccine
starts to replicate soon after hatchery administration, even in birds with high levels of passive anti-
IBDV MDAs. The early HVT vector replication and IBDV VP2 gene expression allow the early
induction of active IBDV antibody titers that will progressively compensate the decrease of passive
MDA, the overall antibody levels remaining above the protective threshold (Fig. 2C) (Prandini et al.,
2008). The vector vaccine technology is therefore the only one that can solve the issues of safety
and immunity gap observed with MLV and ICx IBD vaccines. The HVT-IBD vector vaccine as well as
the ICx allowed to move the IBD vaccination from the farm to the hatchery where vaccination could
be performed in better conditions. The convenience and success of hatchery vaccination has
increased the demand for hatchery vaccines with long duration of immunity against other diseases.
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
11
Fig. 2A
Fig. 2B
Fig. 2: Comparison of immune response induced by three types of IBDV vaccines: (A) intermediate
(I) or intermediate plus (I+) MLV vaccine administered by drinking water, (B) immune complex (ICx)
vaccine containing an I+ MLV administered at the hatchery, and (C) HVT-IBD vector vaccine
administered at the hatchery. Immunity gap will be observed with the I, I+ and ICx vaccines but not
with the HVT-IBD vector vaccine. Other abbreviations used in this figure: Ab antibody, MDA
maternally-derived antibodies, wt wild type, vvIBDV very virulent infectious bursal disease virus.
HVT-vectored ND vaccines were licensed soon after HVT-ND. The NDV gene inserted into the
vector is the gene coding for the fusion (F) protein, which plays an important role in NDV entry.
Surprisingly, this vaccine was shown to induce HI antibody titers which usually target the
hemagglutinin-neuraminidase (HN) NDV protein. The anti-F antibodies likely prevent the contact
between NDV HN hemagglutination sites and red blood cells by steric hindrance (Palya et al., 2012).
These HVT-ND vaccines do not induce respiratory reactions. The onset of immunity induced by
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
12
HVT-ND vaccine was delayed compared to NDV MLV and the efficacy level in birds with MDAs was
lower than in SPF chickens (Morgan et al., 1993). However, the duration of immunity induced by
HVT-ND vaccine was live long (up to 72 week-of-age in layers) (Palya et al., 2014). The HVT-ND has
a systemic replication which does not induce a good mucosal immunity and the protection against
tracheal replication induced after intra-ocular NDV challenge was found to be low (Morgan et al.,
1992). Live ND vaccines need therefore to be used in addition of HVT-ND to compensate their slow
onset of immunity and their poor local immunity induction. The ND killed vaccine applied before the
laying period was also found to boost the antibody titers and to better reduce the NDV shedding
after challenge (Palya et al., 2014).
The licensed HVT-ILT vaccines contain either the glycoprotein D and glycoprotein I (Johnson et
al., 2010) or a truncated form of glycoprotein B (Esaki et al., 2013). These HVT-ILT vaccines were
shown to be safer than the conventional chicken embryo (CEO) or tissue culture (TCO) MLV
vaccines. However, their efficacy level was lower than that induced by the conventional vaccines
(Johnson et al., 2010, Vagnozzi et al., 2012). As for HVT-ND, their onset of immunity and local
protection against ILT replication in the trachea were relatively weaker than MLV vaccine in
conventional chickens (Johnson et al., 2010, Vagnozzi et al., 2012, Esaki et al., 2013).
An HVT-avian influenza (AI) vaccine has also recently been licensed. It contains the hemagglutinin
gene from a highly pathogenic AI (HPAI) H5N1 strain isolated in Hungary in 2006 (Rauw et al., 2011).
As for FP-AI, this HVT-AI vaccine is compatible with the DIVA strategy. It was shown to induce a
good level of clinical protection (from 60 to 100%) against a wide panel of H5 strains including
antigenic variants in SPF and/or in chickens with MDA (Rauw et al., 2011, Soejoedono et al., 2012,
Kilany et al., 2014, Kapczynski et al., 2015, Kilany et al., 2015). Both HI antibody titers and cell-
mediated immunity contributed to protection (Kapczynski et al., 2015). AI MDA may delay the onset
of immunity but do not seem to impact the duration of immunity (Rauw, 2015). The boost with an
AI inactivated vaccine could further increase the protection and antibody levels and decrease viral
load in oropharyngeal swabs after challenge (Rauw et al., 2012, Soejoedono et al., 2012, Kilany et al.,
2015).
HVT vector vaccines do not spread from vaccinated chickens to non-vaccinated ones. It is
therefore very important to keep the cold chain during transportation, to store and prepare the
vaccine using the standard operating procedures and to assure correct administration of the vaccine
to all chicks. Any missed birds at vaccination will not have a second chance to get this vaccine and
will not be protected. This is a key factor of success for the application of this type of vaccine.
Another important aspect to consider is the health status of the vaccinated chicks. Indeed, a
functional immune system is required to get optimal immunity from vector vaccines. Early infection
with immunosuppressive viruses such as chicken infectious anemia virus will likely impaired vaccine
potency and it is therefore very important to control the early infection and vertical transmission in
young chicks by vaccinating the breeders against these agents.
HVT vector vaccines are fully compatible with Marek’s disease serotype 1 (CVI988) or serotype
2 (SB-1) vaccines. In contrast, combination of an HVT vector vaccine with parental HVT or with
another HVT vector vaccine usually leads to the decrease of protection against at least one of the
target diseases. The mechanism of this interference is not known but it may be due, at least in part,
to the competitive replication and infection of target cells. Interference between some HVT vector
pairs may be more pronounced than others. In particular, the association of the HVT-AI with an
HVT-ND has been reported to have minor negative impact on AI and ND immunogenicity: it delayed
the onset of immune response against AI and ND (Rauw, 2015). At the present time, no HVT vector
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
13
has a claim of compatibility with another HVT vector. Additional research is needed to evaluate if
the interference observed between specific HVT vector pairs is sufficiently low to be acceptable in
some field epidemiological situations.
4. Newcastle disease virus-based vector vaccine
NDV vector vaccines (Ge et al., 2007) have been used against H5 HPAI in China since 2006
(Chen and Bu, 2009) and against H5N2 LPAI in Mexico since 2008 (Sarfati-Mizrahi et al., 2010). They
are bivalent, protecting against both ND and AI and are compatible with the DIVA strategy. The AI
HA expressed by the NDV vector was shown to be present at the surface of the NDV (Veits et al.,
2006). One of their major advantages is that they are administered by mucosal route either by eye
drop or by mass administration using spray or drinking water. The mucosal administration and
mucosal replication of this vector allows the induction of a local immunity, and therefore, such vector
may be ideal for respiratory diseases. Although most chickens are vaccinated with NDV MLV by
spray at the hatchery, all but one (Lardinois et al., 2012) NDV-AI vaccination publications reported
vaccination of 1 to 3 week-old chickens. Data comparing immunogenicity of NDV-AI when
administered at 1 day-of-age or at 1 week-of-age or later are still missing to evaluate if the chicken’s
adaptive immune system is mature enough at hatch to provide optimal AI immune response using this
type of vector. Anti-NDV and anti-AI MDA were shown to interfere on NDV-AI immunogenicity but
at variable levels (Sarfati-Mizrahi et al., 2010, Faulkner et al., 2013, Lambrecht et al., 2015).
Interestingly, anti-NDV MDA had positive impact on AI protection whereas anti-AI MDA decreased
AI protection (Lambrecht et al., 2015). NDV-AI was also found to be immunogenic in ducks and a
FP-AI priming at 1 or 2 day of age followed by a NDV-AI boost 15 days later fully protect SPF
Muscovy ducks 12 weeks later (Niqueux et al., 2013) indicating that the prime-boost vaccination
scheme performed with two different vector vaccines may be very efficient and still compatible with
the DIVA strategy. Encouraging data have also been recently published on the use of the NDV vector
as a vaccine for ILT (Kanabagatte Basavarajappa et al., 2014, Zhao et al., 2014) but these candidates
have not been licensed so far.
5. Future challenges on the development of new vector vaccines
The development of vector vaccines against avian diseases during last two decades has been a
success story, especially the HVT vector has significantly changed the industry. The integrated
poultry industry has clearly seen an advantage to use potent vaccines at the hatchery and to decrease
vaccine administrations at the farm. The challenge today is to develop polyvalent vector vaccines that
can be administered concomitantly at the hatchery without interference. One of the possible
solutions is to insert the protective gene(s) from different pathogen agents into one vector. Inserting
several genes into one vector may potentially lead to genetic instability and to decreased efficacy
compared to vector with single insert. The development of a double HVT-ND+ILT has recently been
reported (Morsey et al., 2015). Another strategy could be the use of other vectors that do not
interfere with the existing ones. One potential example could be the generation of the CVI988
(Rispens) MDV serotype 1 strain as a vector as previously described (Sakaguchi et al., 1998). In
addition, there would clearly be a benefit to create other vectors that are able to induce a strong
mucosal immune response and compatible with existing vaccines.
Another challenge is the induction of a broad protection against pathogenic agents that show a
great antigenic variability, such as avian influenza. One of the possible solutions is to modify the
inserted gene sequence so that it better matches that of circulating strains such as described in (Giles
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
14
and Ross, 2011); other solutions for antigen design leading to an increase of the broadness of
protection are also being evaluated (Schussek et al., 2014). MDA interference on vector vaccines is
also an issue; additional studies should be done to better understand the mechanisms of interference
and to design ways to minimize its impact. As described above, the prime-boost strategy using either
two different vector vaccines or one vector and one classical vaccine have shown promising results in
terms of broadening the immune response and of overcoming MDA interference (Niqueux et al.,
2013, Richard-Mazet et al., 2014, Schussek et al., 2014).
There are also many pathogen agents including viruses such as the infectious bronchitis virus,
bacteria and parasites for which the vector vaccine technology has been disappointing. This is likely
due to the unavailability or poor protective ability of the protective gene identified for these agents.
Vaccinomics technologies should facilitate the finding and the design of better protective genes in the
future (Schussek et al., 2014).
Conclusion
The vector vaccine technology, and in particular the HVT vector, has changed ways to control
some of the major poultry diseases. The HVT-IBD vaccine is the only vaccine that can combine
hatchery administration, absence of vaccine-induced bursal lesions and its consequent
immunosuppression, and excellent IBD protection levels in birds with MDA without any immunity
gap. This technology has pushed back vaccine administration from the field to the hatchery where
vaccination can be better controlled. HVT-ND, HVT-AI and HVT-ILT are providing excellent safety
and duration of protection after one hatchery administration, but they do not provide a rapid onset
of protection, nor a good mucosal immunity. Optimal protection may need concomitant or booster
vaccination with MLV and/or inactivated vaccines. Fowlpox and NDV vectored vaccines have also
shown interesting features, which when combined with other vaccines may clearly induce broader
immunity. Future research on vector vaccines will need to be focused on solving the current
problems observed with the use of theses vaccines and in particular, their compatibility and their
induction of a strong mucosal immune response, a rapid onset and a broad protection in chicks with
high levels of MDA. The solution may come from the development of newly designed vector vaccines
but it may also include the combination of biotech and conventional vaccines. The challenge for the
poultry veterinarian will be to know how each vaccine works in order to design the optimal
vaccination program that will give protection linked to the epidemiologic area.
Acknowledgement
I thank Marcus Remmers for the critical reading of the manuscript. *TROVAC and *VAXXITEK
are registered trademarks of Merial in the USA and elsewhere.
References
Brochier, B, MP Kieny, F Costy, P Coppens, B Bauduin, et al., 1991. Large-scale eradication of rabies
using recombinant vaccinia-rabies vaccine. Nature, 354: 520-522.
Brun, A, E Albina, T Barret, DA Chapman, M Czub, et al., 2008. Antigen delivery systems for
veterinary vaccine development. Viral-vector based delivery systems. Vaccine, 26: 6508-6528.
Bublot, M, RJ Manvell, W Shell and IH Brown, 2010. High level of protection induced by two fowlpox
vector vaccines against a highly pathogenic avian influenza H5N1 challenge in specific-pathogen-
free chickens. Avian Dis, 54: 257-261.
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
15
Bublot, M, N Pritchard, FX Le Gros and S Goutebroze, 2007. Use of a vectored vaccine against
infectious bursal disease of chickens in the face of high-titred maternally derived antibody. J
Comp Pathol, 137 Suppl 1: S81-84.
Bublot, M, N Pritchard, DE Swayne, P Selleck, K Karaca, et al., 2006. Development and use of fowlpox
vectored vaccines for avian influenza. Ann N Y Acad Sci, 1081: 193-201.
Bublot, M, A Richard-Mazet, S Chanavat-Bizzini, FX Le Gros, M Duboeuf, et al., 2010. Immunogenicity
of poxvirus vector avian influenza vaccines in Muscovy and Pekin ducks. Avian Dis, 54: 232-238.
Chen, H and Z Bu, 2009. Development and application of avian influenza vaccines in China. Curr Top
Microbiol Immunol, 333: 153-162.
Darteil, R, M Bublot, E Laplace, JF Bouquet, JC Audonnet, et al., 1995. Herpesvirus of turkey
recombinant viruses expressing infectious bursal disease virus (IBDV) VP2 immunogen induce
protection against an IBDV virulent challenge in chickens. Virology, 211: 481-490.
Esaki, M, L Noland, T Eddins, A Godoy, S Saeki, et al., 2013. Safety and efficacy of a turkey herpesvirus
vector laryngotracheitis vaccine for chickens. Avian Dis, 57: 192-198.
Faulkner, OB, C Estevez, Q Yu and DL Suarez, 2013. Passive antibody transfer in chickens to model
maternal antibody after avian influenza vaccination. Vet Immunol Immunopathol, 152: 341-347.
Ferguson-Noel, N, K Cookson, VA Laibinis and SH Kleven, 2012. The efficacy of three commercial
Mycoplasma gallisepticum vaccines in laying hens. Avian Dis, 56: 272-275.
Ge, J, G Deng, Z Wen, G Tian, Y Wang, et al., 2007. Newcastle disease virus-based live attenuated
vaccine completely protects chickens and mice from lethal challenge of homologous and
heterologous H5N1 avian influenza viruses. J Virol, 81: 150-158.
Giles, BM and TM Ross, 2011. A computationally optimized broadly reactive antigen (COBRA) based
H5N1 VLP vaccine elicits broadly reactive antibodies in mice and ferrets. Vaccine, 29: 3043-3054.
Gimeno, IM, NM Faiz, AL Cortes, T Barbosa, T Villalobos, et al., 2015. In Ovo Vaccination with
Turkey Herpesvirus Hastens Maturation of Chicken Embryo Immune Responses in Specific-
Pathogen-Free Chickens. Avian Dis, 59: 375-383.
Jeurissen, SH, EM Janse, PR Lehrbach, EE Haddad, A Avakian, et al., 1998. The working mechanism of
an immune complex vaccine that protects chickens against infectious bursal disease. Immunology,
95: 494-500.
Johnson, DI, A Vagnozzi, F Dorea, SM Riblet, A Mundt, et al., 2010. Protection against infectious
laryngotracheitis by in ovo vaccination with commercially available viral vector recombinant
vaccines. Avian Dis, 54: 1251-1259.
Kanabagatte Basavarajappa, M, S Kumar, SK Khattar, GT Gebreluul, A Paldurai, et al., 2014. A
recombinant Newcastle disease virus (NDV) expressing infectious laryngotracheitis virus (ILTV)
surface glycoprotein D protects against highly virulent ILTV and NDV challenges in chickens.
Vaccine, 32: 3555-3563.
Kapczynski, DR, M Esaki, KM Dorsey, H Jiang, M Jackwood, et al., 2015. Vaccine protection of
chickens against antigenically diverse H5 highly pathogenic avian influenza isolates with a live HVT
vector vaccine expressing the influenza hemagglutinin gene derived from a clade 2.2 avian
influenza virus. Vaccine, 33: 1197-1205.
Kilany, W, G Dauphin, A Selim, A Tripodi, M Samy, et al., 2014. Protection conferred by recombinant
turkey herpesvirus avian influenza (rHVT-H5) vaccine in the rearing period in two commercial
layer chicken breeds in Egypt. Avian Pathol, 43: 514-523.
Kilany, WH, MK Hassan, M Safwat, S Mohammed, A Selim, et al., 2015. Comparison of the
effectiveness of rHVT-H5, inactivated H5 and rHVT-H5 with inactivated H5 prime/boost
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
16
vaccination regimes in commercial broiler chickens carrying MDAs against HPAI H5N1 clade
2.2.1 virus. Avian Pathol, 44: 333-341.
Lambrecht, B, A Lardinois, O vandersleyen, M Steensels, N Desloges, et al., 2015. Stronger
interference of Avian Influenza than Newcastle Disease Virus specific maternal derived antibodies
with a recombinant NDV-H5 vaccine. Avian Dis, In press.
Lardinois, A, M Steensels, B Lambrecht, N Desloges, M Rahaus, et al., 2012. Potency of a recombinant
NDV-H5 vaccine against various HPAI H5N1 virus challenges in SPF chickens. Avian Dis, 56: 928-
936.
Le Gros, FX, A Dancer, C Giacomini, L Pizzoni, M Bublot, et al., 2009. Field efficacy trial of a novel
HVT-IBD vector vaccine for 1-day-old broilers. Vaccine, 27: 592-596.
Meeusen, NT, J Walker, A Peters, PP Pastoret and G Jungersen, 2007. Current status of veterinary
vaccines. Clinical Microbiology Reviews, 20: 489-510.
Morgan, RW, J Gelb, Jr., CR Pope and PJ Sondermeijer, 1993. Efficacy in chickens of a herpesvirus of
turkeys recombinant vaccine containing the fusion gene of Newcastle disease virus: onset of
protection and effect of maternal antibodies. Avian Dis, 37: 1032-1040.
Morgan, RW, J Gelb, Jr., CS Schreurs, D Lutticken, JK Rosenberger, et al., 1992. Protection of
chickens from Newcastle and Marek's diseases with a recombinant herpesvirus of turkeys vaccine
expressing the Newcastle disease virus fusion protein. Avian Dis, 36: 858-870.
Morsey, M, L Gergen, S Cook, B Ledesma, W Cress, et al., 2015. Double recombinant HVT-based
vaccines for simultaneous protection against Newcastle disease, Marek’s disease and Infectious
Laryngeotracheitis. XIXth World Veterinary Poultry Association Congress, Capetown, South
Africa.
Niqueux, E, O Guionie, M Amelot and V Jestin, 2013. Prime-boost vaccination with recombinant H5-
fowlpox and Newcastle disease virus vectors affords lasting protection in SPF Muscovy ducks
against highly pathogenic H5N1 influenza virus. Vaccine, 31: 4121-4128.
Palya, V, I Kiss, T Tatar-Kis, T Mato, B Felfoldi, et al., 2012. Advancement in vaccination against
Newcastle disease: recombinant HVT NDV provides high clinical protection and reduces
challenge virus shedding with the absence of vaccine reactions. Avian Dis, 56: 282-287.
Palya, V, T Tatar-Kis, T Mato, B Felfoldi, E Kovacs, et al., 2014. Onset and long-term duration of
immunity provided by a single vaccination with a turkey herpesvirus vector ND vaccine in
commercial layers. Vet Immunol Immunopathol, 158: 105-115.
Poulet, H, J Minke, MC Pardo, V Juillard, B Nordgren, et al., 2007. Development and registration of
recombinant veterinary vaccines. The example of the canarypox vector platform. Vaccine, 25:
5606-5612.
Prandini, F, M Bublot, FX Le Gros, A Dancer, L Pizzoni, et al., 2008. Assessment of the immune
response in broilers and pullets using two ELISA kits after in ovo or day-old vaccination with a
vectored HVT + IBD vaccine (VAXXITEK® HVT+IBD). Zootecnica International, Sept2008: 40-
50.
Rauw, F, 2015. Evaluation of the compatibility between rHVT-F and rHVT-H5 ND and AI vaccines
regarding immunogenicity and efficacy when administrated simultaneously to day-old chickens.
Interference with MDA. 19th World Veterinary Pourlty Association Congress Capetown, South
Africa.
Rauw, F, V Palya, Y Gardin, T Tatar-Kis, KM Dorsey, et al., 2012. Efficacy of rHVT-AI vector vaccine
in broilers with passive immunity against challenge with two antigenically divergent Egyptian clade
2.2.1 HPAI H5N1 strains. Avian Dis, 56: 913-922.
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
17
Rauw, F, V Palya, S Van Borm, S Welby, T Tatar-Kis, et al., 2011. Further evidence of antigenic drift
and protective efficacy afforded by a recombinant HVT-H5 vaccine against challenge with two
antigenically divergent Egyptian clade 2.2.1 HPAI H5N1 strains. Vaccine, 29: 2590-2600.
Richard-Mazet, A, S Goutebroze, FX Le Gros, DE Swayne and M Bublot, 2014. Immunogenicity and
efficacy of fowlpox-vectored and inactivated avian influenza vaccines alone or in a prime-boost
schedule in chickens with maternal antibodies. Vet Res, 45: 107.
Sakaguchi, M, H Nakamura, K Sonoda, H Okamura, K Yokogawa, et al., 1998. Protection of chickens
with or without maternal antibodies against both Marek's and Newcastle diseases by one-time
vaccination with recombinant vaccine of Marek's disease virus type 1. Vaccine, 16: 472-479.
Sarfati-Mizrahi, D, B Lozano-Dubernard, E Soto-Priante, F Castro-Peralta, R Flores-Castro, et al.,
2010. Protective dose of a recombinant Newcastle disease LaSota-avian influenza virus H5
vaccine against H5N2 highly pathogenic avian influenza virus and velogenic viscerotropic
Newcastle disease virus in broilers with high maternal antibody levels. Avian Dis, 54: 239-241.
Schussek, S, A Trieu and DL Doolan, 2014. Genome- and proteome-wide screening strategies for
antigen discovery and immunogen design. Biotechnol Adv, 32: 403-414.
Soejoedono, RD, S Murtini, V Palya, B Felfoldi, T Mato, et al., 2012. Efficacy of a recombinant HVT-H5
vaccine against challenge with two genetically divergent Indonesian HPAI H5N1 strains. Avian
Dis, 56: 923-927.
Steensels, M, M Bublot, S Van Borm, J De Vriese, B Lambrecht, et al., 2009. Prime-boost vaccination
with a fowlpox vector and an inactivated avian influenza vaccine is highly immunogenic in Pekin
ducks challenged with Asian H5N1 HPAI. Vaccine, 27: 646-654.
Swayne, DE, JR Beck and TR Mickle, 1997. Efficacy of recombinant fowl poxvirus vaccine in protecting
chickens against a highly pathogenic Mexican-origin H5N2 avian influenza virus. Avian Dis, 41:
910-922.
Swayne, DE, DL Suarez, E Spackman, S Jadhao, G Dauphin, et al., 2015. Antibody titer has positive
predictive value for vaccine protection against challenge with natural antigenic-drift variants of
H5N1 high-pathogenicity avian influenza viruses from Indonesia. J Virol, 89: 3746-3762.
Taylor, J, C Edbauer, A Rey-Senelonge, JF Bouquet, E Norton, et al., 1990. Newcastle disease virus
fusion protein expressed in a fowlpox virus recombinant confers protection in chickens. J Virol,
64: 1441-1450.
Vagnozzi, A, G Zavala, SM Riblet, A Mundt and M Garcia, 2012. Protection induced by commercially
available live-attenuated and recombinant viral vector vaccines against infectious laryngotracheitis
virus in broiler chickens. Avian Pathol, 41: 21-31.
Veits, J, D Wiesner, W Fuchs, B Hoffmann, H Granzow, et al., 2006. Newcastle disease virus
expressing H5 hemagglutinin gene protects chickens against Newcastle disease and avian
influenza. Proc Natl Acad Sci U S A, 103: 8197-8202.
Zhao, W, S Spatz, Z Zhang, G Wen, M Garcia, et al., 2014. Newcastle disease virus (NDV)
recombinants expressing infectious laryngotracheitis virus (ILTV) glycoproteins gB and gD
protect chickens against ILTV and NDV challenges. J Virol, 88: 8397-8406.
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
18
KEY ASPECTS TO BE CONSIDERED ON THE MONITORING AND TESTING OF
FLOCKS VACCINATED WITH RHVT-ND
Roberto Soares, DVM, MAM, ACPV
Ceva Animal Health, Malaysia
ABSTRACT
Newcastle disease virus (NDV) causes illness in many avian species and typically manifests in
respiratory and gastrointestinal or nervous system (or both) symptoms. The most severe form of
Newcastle disease (ND) can result in mortality rates exceeding 90% in susceptible chicken flocks.
Different strategies have been used to control ND, but vaccination is by far the most popular
approach. Numerous conventional live and inactivated ND vaccines have been used for many decades
in routine vaccination protocols in the poultry industry. Nevertheless, this condition still causes many
problems around the world, especially due to interference of maternally derived antibody (MDA) and
problems with vaccine application in the field. ND vaccines can also cause post-vaccination reaction
and interference with Infectious Bronchitis vaccines. Such drawbacks with conventional vaccines led
to the development of live viral vector vaccines, also known as recombinant vaccines. A particular
success story has been the development of a recombinant vaccine using as a vector the Turkey
Herpesvirus (HVT) to express the Newcastle disease virus fusion protein. The HVT possess a large
DNA where foreign gens, such as F gen from NDV, can be safely inserted into nonessential region of
the HVT genome along with an appropriate promoter, without disturbing the its infectivity. The
recombinant HVT ND (rHVT ND) has been demonstrating strong protective efficacy to different
NDV genotypes in many chicken producers around the world. This vaccine provide protection after
replication of HVT virus, which stimulation immune response neutralizing antibodies to virus F
protein, one of the major functional glycoprotein on the NDV surface and by stimulating the cellular
immune response. The assessment rHVT ND vaccine replication and take is done through molecular
technique (RT-PCR) and immune response (HI and ELISA). After the introduction of a rHVT ND
vaccine into the market, we have been monitoring the onset and duration of immunity to NDV in
many flocks under different vaccination protocol in field and laboratory conditions. Data will be
presented and discussed showing key aspects to be considered on monitoring and testing Broilers
and Layers flocks vaccinated with rHVT ND.
Key Words: Newcastle Disease virus, recombinant HVT vaccines, monitoring
Introduction
Newcastle disease virus (NDV; avian paramyxovirus serotype I) causes severe clinical disease in
many avian species, which typically is manifested in respiratory and/or gastrointestinal and/or
neurological clinical signs and lesions. The most severe forms of Newcastle disease (ND) can result in
mortality rates exceeding 90% in susceptible poultry flocks.
Different strategies have been used to control ND, but sanitary policy, biosecurity and
vaccination are by far the most popular approaches. Numerous conventional live and inactivated
(killed) ND vaccines have been used for many decades in routine vaccination protocols for broilers
and long living birds. Nevertheless, the disease still causes huge losses around the world. These
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
19
conventional vaccines very often fail especially due to the interference of maternally derived
antibodies (MDA) and improper vaccine application in the field. ND vaccines can also cause post-
vaccination reaction and interference with Infectious Bronchitis vaccines. Such drawbacks with
conventional vaccines led to the development of safer live viral vector vaccines, also known as
recombinant vaccines. A particular success story has been the development of a recombinant vaccine
using the Turkey Herpesvirus (HVT) as a vector in which the F protein gene (fusion protein) of NDV
has been inserted. The rHVT-F has demonstrated to be highly efficacious in protecting against strong
challenges with different NDV genotypes. Additionally, this type of vaccine proved to be safe (Morgan
et al., 1992), less sensitive to MDA (Morgan et al., 1993) and induces life-long immunity (Reddy et al.,
1996, Palya et al., 2014). Due to that, rHVT-F vaccine has been rapidly introduced into the Broiler,
Breeder, and Layer vaccination programs worldwide. Although serology has been widely used to
assess the “take’ of classical ND vaccines (Live attenuated and inactivated), with the introduction of
new generation of ND vaccine using recombinant technology, sometimes questions arise regarding
how to monitor the “take” of this type of vaccine. The aim of this article is to share key aspects that
should be considered for monitoring of broiler and layer flocks vaccinated with rHVT-F.
Monitoring rHVT ND vaccine
Following its injection, either by in-ovo or subcutaneously on the first day of age, rHVT-F vaccine
replicates in the host cells, inducing progressive but strong humoral and cellular immune responses
against the F protein expressed on cell surface. The monitoring of the rHVT-F vaccine can be
accomplished by detection of rHVT-F vaccine virus using PCR and/or by seroconversion using HI.
Detection of rHVT-F vaccine virus
After inoculation, MD vaccine viruses, including HVT, can be recovered by PCR from different
tissues. The Spleen and feather pulp (FP) samples have been wide used to detect MD virus replication
pattern and vaccine take (Fabricant et al., 1982; Baigent and Davison, 1999; Baigent et al., 2005). Since
rHVT-F vaccine is a HVT based recombinant vaccine, its replication follows the same pattern as
ordinary HVT (Reddy et al., 1996). Therefore, spleen and FP can be used to confirm vaccination in
flocks that received rHVT-F vaccine.
We recently evaluated the take of rHVT-F in spleen and feather samples from 4 weeks old
Broiler flocks (unpublished data). In this trial we were able to recover rHVT-F from 100% of spleen
sample, however only 69.4% of FP samples were positive. Due to the low recovering of rHVT-F
vaccine from FP, spleen has been selected as preferential sample for monitoring rHVT-F vaccine
“take”.
The assessment of vaccine “take” in spleen samples from commercial Layers after rHVT-F
vaccination was done by using HVT specific real-time PCR (Palya et al., 2014). The rHVT-F was
detected in 70% to 100% of spleen samples between 2 and 4 weeks post-vaccination. Moreover, the
rate of positivity increased as the birds get older reaching 100% between 4 and 6 weeks post-
vaccination. After week 4, the expression of the F gene was evidenced in most of the birds until 74
weeks, which was the end of test period. These results confirmed the life-long persistence of the
virus in vaccinated birds and thereby ensuring strong and long lasting immunity to ND through the
continuous antigenic stimulation.
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
20
Monitoring Antibody Immune Response to rHVT-F
As it was abovementioned, the F glycoprotein expressed by rHVT-F vaccine has been successfully
protecting chickens against virulent NDV challenge. The F protein elicits neutralizing antibodies,
which are capable to prevent NDV cell penetration and cell-to-cell spreading. This immune response
can be measured by hemagglutination inhibition (HI) and by ELISA.
Palya et al. (2012), evaluated the onset of immunity in Broilers vaccinated with rHVT-F vaccine by
in ovo and subcutaneous inoculation at hatch. The antibody immune response was assessed by HI and
by ELISA (BioCheck). The HI test results clearly detected specific antibody response at 4-6 weeks of
age, reaching a HI titer close to 5 log2 at 6 weeks. ELISA test was able to show some antibody
response when compared to unvaccinated group but, in most of the cases, the measured ELISA
values remained negative (below the positive threshold given for the kit by the manufacturer).
In other trial, this time with commercial Layers vaccinated with rHVT-F alone or in combination
with live attenuated ND vaccine, (Palya et al., 2014), detection of onset and duration of antibody
response was assessed using HI test and ELISA. The results showed onset of antibody response
clearly detectable by HI test at 4 and 6 weeks in the pullets vaccinated with the combination but not
in the pullets vaccinated by the rHVT-F alone. ELISA clearly detected antibody response in the pullets
vaccinated with the combination at 6 weeks, but not at 4 weeks. The antibody response induce by a
single vaccination at hatch, whatever the program, could be detected for 74 weeks with both assays.
Conclusion
The recombinant rHVT-F vaccine expressing the F protein applied in the hatchery induces
homogenous and solid immunity against MD and ND by stimulating cellular and humoral immune
responses. However, many external factors may interfere with the efficacy of this vaccine such as
inappropriate storage, poor preparation and/or administration of the vaccine. Therefore, it is very
important to monitor vaccine take and seroconversion following vaccine application in the hatchery.
The real-time PCR has demonstrated to be a sensitive mean to assess the replication of rHVT-F in
the spleen of Broilers and Layers at around 4 weeks of age. Antibody response could be measured
by HI and ELISA test, however, HI test showed to be more sensitive than ELISA to detect early
seroconversion.
References
Baigent S, V Nair and R Currie, 2006. Real-time quantitative PCR for Marek’s disease vaccine virus in
feather samples: applications and opportunities. Dev Biol (Basel), 126: 271-281.
Baigent SJ, LJ Petherbridge, K Howes, LP Smith, RJ Currie et al., 2005. Absolute quantitation of
Marek’s disease virus genome copy number in chicken feather and lymphocyte samples using
real-time PCR. J Virol Methods, 123: 53-64.
Baigent SJ, LP Smith, RJ Currie and VK Nair, 2005. Replication kinetics of Marek’s disease vaccine
virus in feathers and lymphoid tissues using PCR and virus isolation. J Gen Virol, 86: 2989-2998. Fabricant J, BW Calnek and KA Schat, 1982. The early pathogenesis of turkey herpesvirus infection in
chickens and turkeys. Avian Dis, 26: 257-264.
Morgan RW, J Gelb Jr, CR Pope and PJ Sondermeijer, 1993. Efficacy in chickens of a herpesvirus of
turkeys recombinant vaccine containing the fusion gene of Newcastle disease virus: onset of
protection and effect of maternal antibodies. Avian Dis, 37: 1032-1040.
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
21
Morgan RW, J Gelb Jr, CS Schreurs, D Lutticken, JK Rosenberger et al., 1982. Protection of chickens
from Newcastle and Marek’s diseases with a recombinant herpesvirus of turkeys vaccine
expressing the Newcastle disease virus fusion protein. Avian Dis, 36: 858-870.
Palya V, I Kiss, T Tata´r-Kis, T Mato, B. Felföldi et al., 2012. Advancement in vaccination against
Newcastle disease: recombinant HVT NDV provides high clinical protection and reduces
challenge virus shedding with the absence of vaccine reactions. Avian Dis, 56: 282-287.
Palya V, T Tata´r-Kis, T Mato, B Felföldi and Y Gardin, 2014. Onset and long-term duration of
immunity provided by a single vaccination with a turkey herpesvirus vector ND vaccine in
commercial layers. Vet Immunol Immunop, 158: 105-115.
Rauw F, Y Gardin, V Palya, S Anbari, S Lemaire et al., 2010. Improved vaccination against Newcastle
disease by an in ovo recombinant HVT-ND combined with an adjuvanted live vaccine at day-old.
Vaccine, 28: 823-833.
Reddy SK, JM Sharma, J Ahmad, DN Reddy, JK McMillen et al., 1996. Protective efficacy of a
recombinant herpesvirus of turkeys as an in ovo vaccine against Newcastle and Marek’s diseases
in specific-pathogen-free chickens. Vaccine, 14: 469-477.
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
22
NEW CASTLE DISEASE: ITS IMPACT AND CONTROL IN PAKISTAN
Hanif Nazir Chaudhary
Bio-POUL International,
Defence Housing Authority, Lahore Cantt, Pakistan
ABSTRACT
Newcastle Disease is one of the major disease threat to all types and ages of the commercial
poultry as well as back yard game and wild birds in Pakistan. In the past we did not have many choices
to protect the birds from but now the focus is on proper diagnosis. The protection do not start from
vaccination. It starts with good bio-security vaccination and then most importantly regular titre
monitoring. Since couple of years problem is seen commonly in long living birds like breeders and
layers where the titer monitoring is there but a better interpretation need more attention. If the
mean titer looks fine and there are birds falling below protection threshold those birds get problem
and not only suffer mortality but also production losses. In majority of cases the mortality continues
because of egg peritonitis and at the same time the chick quality suffers as well. It’s important to
regularly monitor titers day 1,25 and slaughter age in broilers to achieve Log 2 titers above 5 in
broilers at day 25 while as in long live birds all birds every 4 week monitoring should be above 7 log 2
HI titers and if that's not the case an immediate decision of re vaccination becomes important. Not
doing so flock gets hit by ND and variable losses can occur.
INTRODUCTION
Not a new disease but from last year’s last years the disease has shown its new phase never seen
before. It caused unprecedented mortalities in broilers and production losses occurred both in layers
and breeders.
In the beginning like always there was debate on the confirmation but soon everyone agreed that its
nothing else but ND. In this regard PPA disease control committee got involved with field scientists
as well as public sector research organizations along with leading private sector diagnostic labs. There
30 weeks
old
breeder
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
23
were series of meetings particularly in Lahore and Islamabad the most affected areas. The research
scientists presented their experimental work and lab trials confirming that existing vaccines do
protect this challenge of ND which is not the same in field conditions. Getting information from
international scientists through their experience from similar situation from other countries was part
of the National Disease Control Committee particularly that of regional countries of Asia Pacific it
was realized that we need to focus on.
Monitoring antibody titers
It was concluded that if the problem have to be protected well then the titers at any stage should
not go lower than 5 which is a high asking rate for broilers but became possible by incorporating
killed vaccines along with just only using live vaccines in broilers.
This gave a boost in titers and not only protected the vaccinated flocks but also started
education in infection load by not allowing disease virus to get passages to get more pathogenicity.
Today when you are reading these lines the disease has come at large under control except may be
some rare sporadic cases.
Courtesy Dr Kamal
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
24
Keeping the titers high
Since the disease has reduced but we must not forget that ND is an endemic problem which may
erupt once it finds favorable conditions. One of the favorable conditions may be that we forget our
objective of keeping titers high and start compromising on low titers by reducing vaccines to cut the
cost. Cutting cost can be more attractive when market of the broiler is down and broiler flocks are
sold at breakeven or even lower than production cost.
Profit and loss is part of the business and very important to look at but nothing is more costly
when disease comes and losses go out of control. We must keep vaccination programs aiming high
titers by both live and killed vaccines.
In long live birds layers and breeders its important to monitor antibody titers at every 4 weeks
frequency and make sure lowest titers of any sample should not be below Log 2 at 8. Companies
have multiple flocks so can keep a track of past flocks and a baseline can be developed against existing
vaccination program.
Immunosuppression
This used to be less attentive problem in the past but now became more important because
birds cannot built good titers if Gumboro subclinical or clinical affect the flock and damage immune
organs. Science is progressing and thanks to the new inventions. We were handicapped in the past to
choose from live vaccines which were mild, intermediate, Intermediate plus and even hot vaccines.
We were having support of killed vaccines but it remained always a debate to choose from safety
RANGE AVG RANGE AVG RANGE AVG RANGE AVG RANGE AVG
1 1st day 4 to 7 5.9
2 4th 5 to 12 10.06 7 to 11 9.5 6 to 11 7.92 543-2266 1199 5 to 9 7.83
3 8th 5 to 12 10.07 10 to11 10.93 7 to 11 10.4 8 to 10 8.79 8 to 9 8.75
4 13th 7 t0 11 10.47 11 to 11 11 9 to 11 10.77 8 to 10 9 9 to 10 9.5
5 17th 9 t0 11 10.67 8 to 11 10.5 8 to 11 10.7 7 to 9 8.16
6 21st 8 to 11 10.2 8 to 11 10.37 7 to 11 10.5 8 to 10 9.09
7 26th 8 to 11 10.07 9 to 11 10.08 7 to 10 9.07 4to7 (9-11)5.9 (10.25)
8 30th 7 t0 11 9.47 8 to 11 9.92 10 to 11 10.83 7 to 9 8.58
9 34th 8 to 11 9.73 7 to 11 9.17 10 to 11 10.8 8 to 9 8.66
10 39th 6 to 10 7.53 6 to 10 8.1 10 to 11 10.9
11 43rd 6 to 10 7.67 9 to 11 10.67 10 to 11 10.8
12 47th 10 t0 11 10.8 9 to 11 10.57 10 to 11 10.8
13 52nd 9 t0 11 10.6 9 to 11 10.67 10 to 11 10.67
14 56th 9 to 11 10.7 9 to 11 10.17 10 to 11 10.73
15 60th 10 t0 11 10.87 9 to 11 10.67 10 to 11 10.8
16 65th 10 t0 11 11 9 to 11 10.7 10 to 11 10.8
17 69th 8 to 11 10.6 10 to 11 10.67 10 to 11 10.9
18 73rd 10 to 11 10.9 10 to 11 10.63
19 77+
Flock 3 Flock 4
Culled Culled
ND Titers monitoring profileFlock 5S.NO,
AGE
WEEKS Flock 1 Flock 2
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
25
efficacy dilemma. If that was settled then cost issue was popping up strongly along with vaccines
handling issue.
With the vector vaccines now available in Pakistan most of the practical issues have been
addressed and this timely availability of this vaccine helped controlling this havoc of ND by proper
attention towards immunosuppression.
Points to note
We often get confused with the interpretation of titers which is not an easy subject to
understand. Protection is not only linked with the level of antibodies you measure with tests like HI
tests. The nature has given birds and animals multiple layers of protection just like the army that the
formation of troops is deployed in several layers of defense. The titers in SPF chicks coming from SPF
parents respond different to vaccines while as the commercial chicks coming from vaccinated parents
behave altogether different. Titers of different ages have different meanings.
The birds receiving live and killed vaccines at day old show higher titers after 30 days Challenge
of ND at 1,5,10,15.20,30,40,50 days of age. Live and killed vaccination combination at day old gave full
protection at day 20. Protection against ND challenge remained high like SPF chicks trial in the group
which got live and killed ND vaccine at day old.
Conclusion
Bio-security is fundamental prerequisite to control all diseases where present time ND is no
exception. I am not going into lengthy debates and just focus on vaccination. A minimum of 2-3 live
vaccines and 1-2 killed vaccines are important to protect this ND we have been suffering from recent
past along with Vector Gumboro vaccine to protect immunosuppression due to Gumboro.
Its worth mentioning that all companies do not produce same quality of vaccines. Definitely its
our duty to find out who is the best and not just who is cheap. During the outbreak time while
analyzing the facts we often found use of poor source vaccines. The unfortunate part of this disease
season was everything was sold by everyone on the name of ND as one of the reason was top
companies ran out of stock and farmer found shelter under a source could not save him. Being a
present day farmers it’s our duty to arrange vaccine 1st and then go for chicks.
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
26
RESPIRATORY DISEASES OF POULTRY WITH SPECIAL ATTENTION
TO AVIAN INFLUENZA
Hafez M. Hafez1* and El-Sayed M. Abdelwhab2
1Institute of Poultry Diseases, Free University Berlin, Germany; 2Institute of Molecular Virology and
Cell Biology, Federal Research Institute for Animal Health, Friedrich-Loeffler-Institut, Germany
*Corresponding Author: hafez@vetmed.fu-berlin.de
ABSTRACT
Respiratory diseases of poultry are associated with severe economic losses, due to high
mortality, high medication cost, drop in egg production in layer and breeder flocks and in many
cases low fertility and hatchability. Several pathogens are incriminated as possible cause either
alone or in synergy with different other micro-organisms or accompanied with non-infectious
factors such as climatic conditions and management related problems.
Worldwide the emerging and re-emerging respiratory diseases and/or infections of poultry are:
Infectious Bronchitis, Infectious Laryngotracheitis, Avian Metapneumovirus, Ornithobacterium
rhinotracheale and Fowl cholera infections. In addition, Avian Influenza, Newcastle disease and
Mycoplasma infections appear to cause problem in some countries.
Influenza A viruses are members of the Orthomyxoviridae family. At present 18 H subtypes
and 9 N subtypes are known. Currently, only the viruses of H5 and H7 subtype have been shown
to be highly pathogenic for poultry, but not all H5 and H7 viruses are highly pathogenic. However,
it has been proven that highly pathogenic avian influenza viruses emerge in domest ic poultry from
low pathogenic progenitors. Since December 2003, epidemic influenza has devastated the poultry
industry. From 2014 till now about 35 countries reported Influenza outbreaks tens of millions of
birds were culled or died from the disease. In addition, infection with subtype H9N2 accompanied
with high economic losses affected the poultry in several countries.
The final diagnosis of respiratory infections can only be reached by isolation and identification
of the causative agent and /or by detection of DNA or RNA using PCR. In addition, serological
examinations for detection of antibodies can be also carried out.
Disease prevention and control focuses primarily on: prevent the introduction and spread of
infectious diseases. This includes biosecurity as well as Eradication policy such as in case of HPAI
and sometimes by industry in case of vertically transmitted infections. Vaccination is regarded as
one of the most beneficial control measure. However, vaccinal breaks can be observed in some
vaccinated flocks due to incomplete immunization coverage, or vaccine failure, but were also
associated with immune escape mutants from the current vaccine strains. Antimicrobials are
important and essential tools to control bacterial infectious diseases. Generally, therapy or
vaccination alone is of little value, unless they are accompanied with improvements in all aspects of
management and biosecurity.
Key Words: Influenza, Hygiene, Vaccination, Therapies
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
27
Introduction
Respiratory diseases of poultry remain of major economic and public health importance. Many
pathogenic microorganisms are present to a limited degree under most management conditions. If
conditions favourable for multiplication of the specific pathogen exist, an active disease outbreak
may occur in apparently healthy flocks. The severity and course of any respiratory disease is
influenced by virulence of the agent, immune status of the birds and management.
Respiratory diseases of poultry are associated with severe economic losses, due to high
mortality, high medication cost, drop in egg production in layer and breeder flocks and in many
cases low fertility and hatchability. In breeder flocks attention must be paid to prevent infections
with vertically transmitted agents. Early recognition and monitoring programmes are essential in
managing the infections and minimizing the economic impacts. Many of these diseases once
introduced into a geographic area, can explode into an epidemic and may have a significant negative
effect on the national and international trade.
Several pathogens are incriminated as a possible cause either alone (mono-causal) or in
synergy with different other micro-organisms (multi-causal) or accompanied by non-infectious
factors such as climatic conditions and management related problems (Table 1).
Table 1: Some possible cause of respiratory disease in poultry
Non infectious Infectious
Management Viral agents
Litter quality IB, ILT, ND, Influenza A, aMPV,
Stocking density PMV3, Pox
Ventilation rate Bacterial agents
Temperature ORT, P. multocida, Mycoplasma, E. coli
High ammonia level Chlamydia, Haemophilus, Bordetella
High dust concentration Streptococci, Staphylococci
Feed Mycotic agents
High dust content Aspergillus fumigatus
Vitamin A deficiency Parasites
Syngamus, Cryptosporidium
These infectious agents can be introduced and spread in poultry farms by different routes. It
occurs either by the vertical and/or horizontal route. At early days of age, the main disease problems
are related to vertically transmitted infections such as Mycoplasma, salmonella, E. coli or improper
hatchery management. Those and other infectious agents can also be transmitted horizontally
(laterally) by direct contact between infected and non-infected susceptible birds, and through indirect
contact with contaminated feed, water, equipment, environment and dust through ingestion or
inhalation. The severity of clinical signs, duration of the disease and mortality are extremely variable
and are influenced by type, virulence and the pathogenicity of the infectious agent, immune status and
age of the birds as well as by many environmental factors such as poor management, inadequate
ventilation, high stocking density, poor litter conditions, poor hygiene, high ammonia level, concurrent
diseases and the type of secondary infections.
The diagnosis of the disease complexes usually is not a straightforward business. Basically the
diagnosis consists of case history as well as management and environmental investigation on spot. In
addition, clinical investigations and post-mortem examination are an important step toward disease
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
28
diagnosis. However, clinical signs and necropsies are mostly not the final step of the diagnosis. The
final diagnosis can be reached by laboratory diagnosis. Presumptive diagnosis of infections therefore
must be confirmed by isolation and identification of the causative agent. Further possibilities are the
detection of DNA or RNA using PCR. Serological examinations for detection of antibodies can be
carried out. In general, however, many factors such as governmental regulation, goal of examinations,
cost benefit analysis, equipment facilities, availability of reagents and experiences of the staff are
influenced and to some instance limit the choice of the laboratory methods (Hafez and Hess, 1999).
The emerging and re-emerging respiratory diseases and or infections of poultry mostly include
Infectious Bronchitis (IB), Infectious Laryngotracheitis (ILT), Avian Metapneumovirus (aMPV),
Ornithobacterium rhinotracheale (ORT) and Fowl cholera (FC) infections. In addition, Avian Influenza
(AI), Newcastle disease (ND) and Mycoplasma infections appear to cause poultry health problems in
some countries.
Prevention and control of respiratory diseases focused primarily on dedicated planning and sound
management practices, which prevent the introduction and spread of infectious diseases. This
includes managing the environment by supplying adequate ventilation and heat to maintain bird
comfort, to keep the litter in good condition, insure supplying fresh feed and water of diseases with
good quality, and limiting exposure to infectious agents through biosecurity, cleaning and disinfection.
Eradication policy and killing of infected flocks and/or contact flocks by legislations in cases of
suspicion or confirmed outbreaks with a considerable public health and/or economic impacts such as
in case of highly pathogenic avian influenza (HPAI) and ND in the EU as well as in case Salmonella
Enteritidis or Salmonella Typhimurium in breeder flocks (Hafez, 2005). In addition, sometimes by
industry in case of vertically transmitted infections such as mycoplasma in breeder flocks. In all case
knowledge about micro-organism, sensitivity to physical and chemical agents, mode of transmission
and method of isolation and /or detection are essential.
Vaccination is regarded as one of the most beneficial biopharmaceutical interventions, due to
its ability to induce protection against infectious diseases through activation of the immune system.
However several considerations should be taken in account before using vaccines such as:
governmental regulations, epidemiological situation in the area and /or on the farm, goal of
vaccination, availability of the vaccine and cost benefit analysis. Progressive vaccine production
technologies such as recombinant, subunit, reverse genetic and nucleic acid vaccines can significantly
reduce the cost of vaccines, ensure better efficacy and allow easy and rapid intervention to face the
steady mutation of the microorganisms. Furthermore, the development of efficient vaccines against
bacterial infections will lead to a reduction of the use of antibiotics and subsequently of the
development of resistant bacteria.
Antimicrobials are important and essential tools to control bacterial infectious diseases, if the
above mentioned measures did not prevent the infection in aim to insure health of the flock and to
enhance the welfare and to reduce the economic losses. In such cases, therapy should be considered
as the last effective weapon, but treatment without accurate diagnosis, critical selection of the
product, accurate dosage, adequate duration and monitoring treatment is unacceptable. In addition, if
necessary as in case of treatment failure, corrective action should be taken.
In the space available, it is not possible to review extensively the entire field of respiratory
diseases. Instead, this paper is limited to Avian influenza.
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
29
Avian Influenza
Avian influenza (AI) is a highly contagious disease of many kinds of poultry, wild and cage birds. It
is characterised by marked variations in morbidity, mortality, signs and lesions. In addition, the
infection causes periodically epidemics in humans, horses, pigs, seals, whales, and variety of birds. AI
viruses are members of the Orthomyxoviridae family. Within the family there are four types of
influenza: A, B, C and D. Types B and C affect only humans and type D in cattle. Type A virus, the
only known to infect birds. The RNA virus is enveloped, heat labile, sensitive to ether, chloroform
and different chemical disinfectants (Swayne et al., 2013).
The AI viruses are RNA negative-sense, single-stranded, enveloped viruses contain genomes
composed of eight separate segments encode for at least 11 viral proteins. Avian influenza A viruses
are divided into subtypes on the base of the antigenic relationships of the surface glycoproteins
haemagglutinin (HA) and neuraminidase (NA). The haemagglutinin and neuraminidase are repectivelly
important in the attachment and release of the virus from the host cells (Palese and Shaw, 2007). To
date, 18 H and 11 N subtypes of avian influenza viruses (AIV) have been detected. All AIV subtypes
except H17N10 (Tong et al., 2012) and H18N11 (Tong et al., 2013), which recently detected in bats,
are known to infect birds.
Based on their pathogenicity for poultry, AI viruses are divided into low pathogenic (LPAIV)
resulting in mild or asymptomatic infections and highly pathogenic (HPAIV) causing up to 100%
morbidity and mortality. Accorrding ot the European Union Council directive (EC, 2005), Highly
pathogenic avian influenza (HPAI): means an infection of poultry or other captive birds caused by: (a)
avian influenza viruses of the subtypes H5 or H7 with genome sequences codifying for multiple basic
amino acids at the cleavage site of the haemagglutinin molecule similar to that observed for other
HPAI viruses, indicating that the haemagglutinin molecule can be cleaved by a host ubiquitous
protease; or (b) avian influenza viruses with an intravenous pathogenicity index in six-week old
chickens greater than 1.2. low pathogenic avian influenza (LPAI): means an infection of poultry or
other captive birds caused by avian influenza viruses of any subtype including H5 or H7 that do not
come within the above mentioned definition of HPAI.
Generally only few strains of H5 or H7 subtypes fulfilled the defined criteria of high pathogenicity
which potentially evolve from low virulent precursors (Lupiani and Reddy, 2009). However, HPAIVs
are responsible for magnificent economic losses in poultry industry and pose a serious threat to
public health (Webster et al., 1992; Peiris et al., 2007).
Constant genetic and antigenic variation of AIV is an important feature for continuous evolution
of the virus (Brown, 2000). Gradual antigenic changes due to acquisition of point mutations known as
“antigenic drift” are commonly regarded to be the driving mechanism for influenza virus epidemics
from one year to the next. However, possible “antigenic shift or reassortment” of influenza virus
occurs by exchange genes from different subtypes is relatively infrequent, however it results in severe
pandemics (Ferguson et al., 2003).
There is little or no evidence of vertical transmission (egg-borne infection). However, eggshell
surfaces can be contaminated with the virus. The disease transmitted horizontally by direct contact
with infected birds or indirectly through contaminated equipments. In addition, the infection can
easily be spread by people (contaminated shoes, clothes), crates egg flats, and egg cases vehicles. Wild
and domesticated waterfowl are the major natural reservoir of influenza viruses. Representatives of
all of the different subtypes of influenza A viruses have been isolated from birds, particularly from
aquatic species such as ducks, geese, and gulls (Alexander, 2000). They may be infected with more
than one type without clinical signs, excrete the virus for long periods and mostly do not develop
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
30
detectable antibodies. A marked similarity between the subtypes prevalent in the waterfowl
population and those infecting poultry were reported several times. The continuing spread of H5N1
appears to be related to two factors: spread through movement of poultry (legal as well as illegal) and
spread through wild migratory birds (Liu et al., 2005). Free-ranging backyard chickens, illegal
transportation of domestic birds, and cockfighting also have been shown to contribute to spread of
the virus (Tiensin et al., 2005). Kilpatrick et al. (2006) investigated the pathways by which the virus has
and will spread between countries. They integrated data on phylogenetic relationships of virus
isolates, migratory bird movements, and trade in poultry and wild birds to determine the pathway for
52 individual introduction events into countries and predict future spread. The results show that 9 of
21 of H5N1 introductions to countries in Asia were most likely through poultry, and 3 of 21 were
most likely through migrating birds. In contrast, spread to most (20/23) countries in Europe was most
likely through migratory birds. Spread in Africa was likely partly by poultry (2/8 introductions) and
partly by migrating birds (3/8). The obtained results predict that H5N1 is more likely to be
introduced into the Western Hemisphere through infected poultry and into the mainland United
States by subsequent movement of migrating birds from neighbouring countries, rather than from
eastern Siberia. These results highlight the potential synergism between trade and wild animal
movement in the emergence and pandemic spread of pathogens and demonstrate the value of
predictive models for disease control.
The severity of clinical signs, course of the disease, and mortality in poultry after infection with
AIV are extremely variable from highly acute to a very mild or even inapparent form with few or no
clinical signs. Clinical signs may include high mortality, ruffled feathers, depression, diarrhoea, sudden
drop in egg production, cyanosis of comb and wattles, oedema and swelling of head, blood-tinged
discharge from nostrils, respiratory distress, incoordination and pin-point haemorrhages mostly seen
on the feet and shanks.
Lesions at post mortem may include swelling of the face. Removing skin from the carcass will
show a clear straw-coloured fluid in the subcutaneous tissues. Blood vessels are usually engorged.
Haemorrhage may be seen in the trachea, proventriculus, and throughout the intestines. Pancreatic
necrosis and nephritis are also not uncommon. Young broilers may show signs of severe dehydration
with other lesions less pronounced or entirely absent.
The final diagnosis should be based on laboratory examination and consideration of the exsisting
legislations. Usually based on isolation and identification of the virus and /or detection of the RNA
using PCR. In addition, serological examinations for detection of antibodies can be also carried out.
Disease prevention and control
The control based mostly on enforcement of biosecurity measures, surveillance, culling of
infected flocks, and preventive vaccination, were used in some countries to reduce the economic
losses. The community measures for the control of HPAI are based first on the depopulation of the
infected flocks, in accordance with community legislation on animal welfare. Once the presence of
HPAIV has been officially confirmed all poultry and other captive birds on the holding shall be killed
without delay under official supervision. The killing shall be carried out in such a way as to avoid the
risk of spread of avian influenza, in particular during transport. If an outbreak occurs, it is necessary to
prevent any further spread of infection by carefully monitoring and restricting movements of poultry
and by tightening biosecurity measures at all levels of poultry production, by cleaning and disinfecting
the infected holding, by establishing protection based on a minimum radius of 3 kilometres around
the infected holding itself contained in a surveillance zone based on a minimum radius of 10
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
31
kilometres and, if necessary, by vaccination (EC, 2005). In some countries and places, culling of flocks
infected with LPAI H5 or H7 were applied too.
In accordance with Directive 2005/94/EC (EC, 2005), vaccination against avian influenza is
generally prohibited in the EU. However, under certain circumstances a member state can introduce
emergency vaccination as a short term measure or may also introduce preventative vaccination in
poultry or other captive birds as a long term measure. The Commission shall immediately examine
and approve the vaccination plan.
The vaccination strategy should allow differentiation between infected and vaccinated animals.
Products of vaccinated poultry, such as meat and table eggs, can then be placed on the market in
accordance with the relevant Community legislation.
The major advantages of the vaccine to control AIV in poultry are to reduce shedding of the
virus, morbidity, mortality, bird-to-bird transmission and to limit decrease in egg production. In most
of countries inactivated adjuvanted homologous /or heterologous vaccines are used. For both
homologous and heterologous vaccines, the degree of clinical protection and the reduction in viral
shedding are improved by a higher antigen mass in the vaccine. For heterologous vaccines the degree
of protection is not strictly correlated to the degree of homology between the haemagglutinin genes
of the vaccine and challenge strains. It was expected to continue for the next 10 years (Swayne, 2012;
Spackman and Swayne, 2013).
During the outbreak of HPAI H5N2 in 1994-1995 Mexico applied large-scale vaccination
campaign using inactivated homologous H5N2 vaccines (Garcia et al., 1998; Lee et al., 2004). Recently,
inactivated H7N3 vaccines were used in Mexico to control the ongoing outbreaks of HPAI H7N3
since 2012 (Kapczynski et al., 2013). Also, Pakistan used inactivated H7N1 vaccines to control HPAI
H7N1 outbreaks in 1995 (Naeem and Hussain, 1995) and in 2003-2004 (Naeem & Siddique, 2006).
Also, the inactivated H7N3 and H7N1 vaccines as a part of the intervention plan were used in Italy
against H7N1 and H7N3 in 2000-2002, respectively (Capua and Marangon, 2007). In USA against
LPAIV H7N2 in 2003 (Capua and Alexander, 2004) and in North Korea against H7N7 in 2005
(Swayne, 2012).
After the re-emergence of the Asian H5N1 in 2003, vaccines were used in many countries to
reduce the economic losses of the disease. Occasionally, vaccines for HPAI H5N1 have been used for
short periods in Cote d’Ivoire, France, Kazakhstan, Mongolia, Netherlands, Pakistan, Russia and
Sudan. Currently, four countries use different H5N1 vaccines in poultry: China since 2004, Indonesia
since 2004, Viet Nam since 2005 and Egypt since 2006 (Abd-Abdelwhab and Hafez, 2015).
Furthermore, 10 countries used inactivated H9N2 vaccines in poultry.
Canada and USA used vaccines to control H1 and H3 swine influenza viruses in turkeys.
Germany, South Africa and USA used vaccines to control H6 outbreaks and also USA used H2 and
H4 vaccines (Swayne, 2012). The use of bivalent H5-H7 and H7-H9 inactivated vaccines were used in
Italy (Capua and Alexander, 2004) and Pakistan (Capua and Marangon, 2007), respectively.
Several novel vaccines have been developed with high efficiency such as recombinant fowl pox
viruses expressing the H5 or H7 antigen or other vectors; infectious laryngotracheitis virus.
Additional Examples include, DNA vaccines, Subunit vaccines, vaccines based on reverse genetics,
Adenovirus-, baculovirus-, Newcastle disease-vectored vaccine and Newcastle disease virus–based
bivalent live attenuated vaccine were described and summarized by (Abdelwhab et al., 2014,
Abdelwahab and Hafez, 2015). So far, only H5- expressing viral vectored vaccines have been used in
the field (i.e.: in China, Egypt and Mexico) to control HPAI H5N1 and H5N2 outbreaks in poultry
(Bublot et al., 2007; Swayne, 2012).
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
32
Vaccinal breaks were observed in vaccinated flocks in some countries. Vaccinal break, defined as
sub-optimal vaccinal protection of a flock and can have several causes. The efficacy of vaccine is very
much dependent on the quality of the product as well as the quality of the manufacturing process and
quality control procedures. In addition, the antigen concentration is very important. According to
Gardin (2007) the reduction of the antigen content leads to a reduction of the capacity of the vaccine
to reduce the shedding, although antibody response to vaccination remains almost identical and
although the monitoring of antibody response in the fields is useful to check the quality of the
vaccination, but is not a very accurate and sensitive way to evaluate the level of protection.
Inappropriate storage, handling and improper administration are further factors. The quality of
the vaccines application is crucial since all non injected chickens are not protected, and improperly
injected chicks will be poorly protected. Using post-vaccination necropsy (residue of oil at the site of
injection) or serological testing demonstrated, that it is not uncommon to see as much as 20% or
30% or even more of chickens that were not injected (Gardin, 2007).
Several challenges facing the efficiency of the vaccine to control the HPAIV outbreaks have been
reported and summarized by (Abdelwahab and Hafez, 2015) as follow:
1) Vaccine is HA subtype specific and in some regions where multiple subtypes are co-circulating
(i.e., H5, H7 and H9), vaccination against multiple HA subtypes is required (Suarez and Schultz-
Cherry, 2000).
2) Vaccine-induced antibodies hinder routine serological surveillance and differentiation of infected
birds from vaccinated ones requires more advanced diagnostic strategies (Suarez, 2005).
3) Vaccination may prevent the clinical disease but can’t prevent the infection, this lead to “silent”
circulation of the virus in vaccinated flocks poses a potential risk of virus spread among poultry
flocks and spillover to humans (Capua and Alexander, 2006; Hafez et al., 2010).
4) Immune pressure induced by vaccination on the circulating virus in an area increases the
evolution rate of the virus and accelerates the viral antigenic drift to evade the host-immune
response (Lee and Song, 2013).
5) After emergence of antigenic variants, the vaccine becomes useless and/or inefficient to protect
the birds and periodical update of the vaccine is required (Abdelwhab et al., 2011; Grund et al.,
2011; Kilany et al., 2011).
6) Vaccine-induced immunity usually peaks three to four weeks after vaccination and duration of
protection following immunization remains to be elucidated (Swayne and Kapczynski, 2008).
7) Maternally acquired immunity induced by vaccination of breeder flocks could interfere with
vaccination of young birds (Maas et al., 2011; Abdelwhab et al., 2012).
8) Other domestic poultry (i.e., ducks, geese, turkeys), zoo and/or exotic birds even within the
same species (i.e., Muscovy vs. Pekin ducks) respond differently to vaccination which have not yet
been fully investigated compared to chickens (Cagle et al., 2011).
9) Co-infections or prior infection with immunosuppressive pathogens or ingestion of mycotoxins
can inhibit the immune response of AIV-vaccinated birds (Sun et al., 2009; Hegazy et al., 2011).
10) For the recombinant vaccines, keeping cold-chain is pivotal, it can cause or aggravate respiratory
tract infections and reassortment with wild type viruses can not be totally excluded (Abdelwahb
and Hafez, 2015).
11) Factors related to vaccine manufacturing, quality, identity of vaccine strain, improper handling
and/or administration can be decisive for efficiency of any AIV vaccine (Swayne and Kapczynski,
2008).
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
33
Therefore, presence of new alternative and complementary strategies target different AIV
serotypes/subtypes/drift-variants should be encouraged. Several possible alternative approaches for
control of AIV in poultry particularly against the HPAI (H5N1) subtypes were described and
summarized (Abdelwhab and Hafez, 2012).
Conclusions
In conclusion avian influenza infections in poultry are associated with severe economic losses,
early recognition and monitoring programmes are essential in managing the infections and a universal
solution for prevention and control of avian influenza does not exist. Generally, one of the above
mentioned measures alone is of little value, unless they are accompanied by improvements in all
aspects of management and bio-security. In countries in which the infection is endemic and when
other control measures such as stamping out, movement restriction of poultry and bio-security
cannot stop the spread of the infection poultry flocks should be vaccinated using a vaccine of high
quality.
Finally, since the success of any control program depends on the hygiene practices of the
personnel, it is essential to incorporate education programs about micro-organisms and their modes
of transmission, as well as awareness of the reasons behind such control programs for all people
involved throughout the poultry production chain.
References
Abdelwhab EM and HM Hafez, 2012. Insight into Alternative Approaches for Control of Avian
Influenza in Poultry, with Emphasis on Highly Pathogenic H5N1. Viruses, 4, 3179-3208;
doi:10.3390/v4113179.
Abdelwhab EM and HM Hafez, 2015. Control of Avian Influenza in Poultry with Antivirals and
Molecular Manipulation. Epidemiology II Theory, Research and Practice Publisher: Concept Press
Ltd. ISBN: 978-1-922227-75-1.
Abdelwhab EM, C Grund, MM Aly, M Beer, TC Harder et al., 2011. Multiple dose vaccination with
heterologous H5N2 vaccine: immune response and protection against variant clade 2.2.1 highly
pathogenic avian influenza H5N1 in broiler breeder chickens. Vaccine, 29: 6219-6225.
Abdelwhab EM, C Grund, MM Aly, M Beer, TC Harder et al., 2012. Influence of maternal immunity on
vaccine efficacy and susceptibility of one day old chicks against Egyptian highly pathogenic avian
influenza H5N1. Vet Microbiol, 155: 13-20.
Abdelwhab EM, J Veits and TC Mettenleiter, 2014. Prevalence and control of H7 avian influenza
viruses in birds and humans. Epidemiology and Infection, 1-25.
Alexander DJ, 2000. A review of avian influenza in different bird species. Proceedings of the ESVV
Symposium on Animal Influenza Viruses, Gent 1999. Vet. Microbiol, 74: 3-13.
Brown EG, 2000. Influenza virus genetics. Biomed Pharmacoth, 54: 196-209.
Bublot M, N Pritchard, JS Cruz, TR Mickle, P Selleck et al., 2007. Efficacy of a fowlpox-vectored avian
influenza H5 vaccine against Asian H5N1 highly pathogenic avian influenza virus challenge. Avian
Dis, 51(1 Suppl): 498-500.
Cagle C, TL To, T Nguyen, J Wasilenko, SC Adams et al., 2011. Pekin and Muscovy ducks respond
differently to vaccination with a H5N1 highly pathogenic avian influenza (HPAI) commercial
inactivated vaccine. Vaccine, 29: 6549-6557.
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
34
Capua I and S Marangon, 2007. The use of vaccination to combat multiple introductions of Notifiable
Avian Influenza viruses of the H5 and H7 subtypes between 2000 and 2006 in Italy. Vaccine, 25:
4987-4995.
Capua I and DJ Alexander, 2004. Avian influenza: recent developments. Avian Pathol, 33: 393-404.
Capua I and DJ Alexander, 2006. The challenge of avian influenza to the veterinary community. Avian
Pathol, 35: 189-205.
DH Lee and CS Song, 2013. H9N2 avian influenza virus in Korea: evolution and vaccination. Clin Exp
Vaccine Res, 2: 26-33.
EC, 2005. COUNCIL DIRECTIVE 2005/94/EC of 20 December 2005 on Community measures for
the control of avian influenza and repealing Directive 92/40/EEC. Off J Eur Union, L: 10-17.
Ferguson NM, AP Galvani, RM Bush, 2003. Ecological and immunological determinants of influenza
evolution. Nature, 422: 428-433.
Garcia A, H Johnson, DK Srivastava, DA Jayawardene, DR Wehr et al., 1998. Efficacy of inactivated
H5N2 influenza vaccines against lethal A/Chicken/Queretaro/19/95 infection. Avian Dis, 42: 248-
256.
Gardin Y, 2007. Vaccination against H5N1 highly pathogenic avian influenza: some questions to be
addressed. Proceedings of the 56th Western Poultry Disease Conference, March 26-29, 2007.
Las Vegas, Nevada, USA, pp: 80-83.
Grund C, EM Abdelwhab, AS Arafa, M Ziller, MK Hassan et al., 2011. Highly pathogenic avian
influenza virus H5N1 from Egypt escapes vaccine-induced immunity but confers clinical
protection against a heterologous clade 2.2.1 Egyptian isolate. Vaccine, 29: 5567-5573.
Hafez HM and M Hess, 1999. Modern techniques in diagnosis of poultry diseases. Archiv für
Gefluegelkunde, 63: 237-245.
Hafez HM, 2005. Governmental regulations and concept behind eradication and control of some
important poultry diseases. World’s Poult Sci J, 61: 569-581.
Hafez HM, A Arafa, EM Abdelwhab, A Selim, SG Khoulosy et al., 2010. Avian influenza H5N1 virus
infections in vaccinated commercial and backyard poultry in Egypt. Poult Sci, 89: 1609-1613.
Hegazy AM, FM Abdallah, LK Abd-El Samie and AA Nazim, 2011. The relation between some
immunosuppressive agents and widespread nature of highly pathogenic avian influenza (HPAI)
post vaccination. J Amer Sci, 7: 66-72.
Kapczynski DR, M Pantin-Jackwood, SG Guzman, Y Ricardez, E Spackman et al., 2013.
Characterization of the 2012 highly pathogenic avian influenza H7N3 virus isolated from poultry
in an outbreak in Mexico: pathobiology and vaccine protection. J Virol, 87: 9086-9096.
Kilany WH, EM Abdelwhab, AS Arafa, A Selim, M Safwat et al., 2011. Protective efficacy of H5
inactivated vaccines in meat turkey poults after challenge with Egyptian variant highly pathogenic
avian influenza H5N1 virus. Vet Microbiol, 150: 28-34.
Kilpatrick AM, AA Chmura, DW Gibbons, RC Fleischer, PP Marra et al., 2006. Predicting the global
spread of H5N1 avian influenza. Proceedings National Academy of Sciences of the USA, 103:
19215-19216.
Lee CW, DA Senne and DL Suarez, 2004. Effect of vaccine use in the evolution of Mexican lineage
H5N2 avian influenza virus. J Virol, 78: 8372-8381.
Liu J, H Xiao, F Lei, Q Zhu, K Qin et al. 2005. Highly pathogenic H5N1 influenza virus infection in
migratory birds. (Brevia) Science 309(5738), 1206. Highly Pathogenic H5N1 Influenza Virus
Infection in Migratory Birds.
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
35
Lupiani B and SM. Reddy, 2009. The history of avian influenza. Comp Immunol Microbiol Infect Dis,
32: 311-323.
Maas R, S Rosema, D van Zoelen and S Venema, 2011. Maternal immunity against avian influenza
H5N1 in chickens: limited protection and interference with vaccine efficacy. Avian Pathol, 40: 87-
92.
Naeem K and N Siddique, 2006. Use of strategic vaccination for the control of avian influenza in
Pakistan. Dev Biol (Basel), 124: 145-150.
Naeem K and M Hussain, 1995. An outbreak of avian influenza in poultry in Pakistan. Vet Rec, 137:
439.
Palese P and ML Shaw, 2007. Orthomyxoviridae: The viruses and their replication. In Fields Virology,
5th ed; Knipe DM, PM Howley, Eds; Lippincott Williams & Wilkins: Philadelphia, PA, USA pp:
1647-1689.
Peiris JS, DM de Jong and Y Guan, 2007. Avian influenza virus (H5N1): a threat to human health. Clin
Microbiol Rev, 20: 243-267.
Spackman E and DE Swayne, 2013. Vaccination of gallinaceous poultry for H5N1 highly pathogenic
avian influenza: current questions and new technology. Virus Res, 178: 121-132.
Suarez DL, 2005. Overview of avian influenza DIVA test strategies. Biologicals, 33: 221-226.
Suarez DL and S Schultz-Cherry, 2000. Immunology of avian influenza virus: a review. Dev Comp
Immunol, 24: 269-283.
Sun S, Z Cui, J Wang and Z Wang, 2009. Protective efficacy of vaccination against highly pathogenic
avian influenza is dramatically suppressed by early infection of chickens with reticuloendotheliosis
virus. Avian Pathol, 38: 31-34.
Swayne DE and D Kapczynski, 2008. Strategies and challenges for eliciting immunity against avian
influenza virus in birds. Immunolog Rev, 225: 314-331.
Swayne DE, 2009. Avian influenza vaccines and therapies for poultry. Compar Immunol, Microbiol
Infec Dis, 32: 351-363.
Swayne DE, 2012. Impact of vaccines and vaccination on global control of avian influenza. Avian Dis,
56(4 Suppl): 818-828.
Swayne DE, DL Suarez and LD Sims, 2013. Influenza. In: Swayne DE, JR Glisson, LR McDougald, LK
Nolan, DL Suarez and V Nair (Ed). Diseases of Poultry. 13th Edition. John Wiley & Sons, Inc, USA
ISBN: 978-0-470-95899-5. pp: 181-281.
Tiensin T, P Chaitaweesup, T Songserm, A Chaising, W Hoonsuwan et al., 2005. Highly pathogenic
avian influenza H5N1, Thailand 2004. Emer Infec Dis, 11: 1664-1672.
Tong S, X Zhu, Y Li, M Shi, J Zhang et al., 2013. New world bats harbor diverse influenza a viruses.
PLoS Pathogens, 9: e1003657.
Tong S, Y Li, P Rivailler, C Conrardy, DA Castillo et al., 2012. A distinct lineage of influenza A virus
from bats. Proc Natl Acad Sci USA, 109: 4269–4274.
Webster RG, WJ Bean, OT Gorman, TM Chambers and Y Kawaoka 1992. Evolution and ecology of
influenza A viruses. Microbiolog Rev, 56: 152-179.
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
36
PATHOGENESIS OF AVIAN AIRSACCULITIS: CON-INFECTION OF CHLAMYDIA
PSITTACI WITH H9N2, ORT AND ASPERGILLUS FUMIGATUS CONTRIBUTES TO
SEVERE PNEUMONIA AND HIGHLY MORTALITY IN SPF CHICKENS
Jun Chu1, Qiang Zhang1, Zonghui Zuo1, Peng Zhao1, Tianyuan Zhang1,
Zhiqiang Shen2, Guanggang Qu2 and Cheng He1*
1Key Lab of Animal Epidemiology and Zoonosis of Ministry of Agriculture, China; College of
Veterinary Medicine, China Agricultural University, Beijing 100193, China; 2Shandong Binzhou
Academy of Animal Science & Veterinary Medicine, Shandong 256600, China
*Corresponding Author: chenghe@cau.edu.cn
ABSTRACT
Since 2007, outbreak of airsacculitis is characterized as the uncontrollable respiratory distress in
broilers, pigeons and hens and causes a huge loss to Chinese poultry industry. However, the
pathogenesis is unclear. In current study, the sera were collected to detect antibodies against
Ornithobacterium rhinotracheale (ORT), Chlamydia psittaci (C. psittaci) and Avian metapeumovirus (aMPV)
from the recovery birds. SPF chickens inoculated with the clinical isolates from the diseased birds
were explored to identify pathogenesis between airsacculitis and multi-infection.
A total of 1693 serum samples were collected and detected using commercial ELISA kits. In the
survey, 550 samples were detected to be positive for ORT (80.3%), 241 sera were identified as
positive for aMPV (65.5%) while 364 samples were found to be positive for C. psittaci
(68.4%).Interestingly, chickens aged 1-day-old was found to be 90.1-100.0% positive for C. psittaci,
66.7-83.3% positive for aMPV and 29.5-73.5% positive for ORT, respectively. Higher seroprevalence
of C. psittaci and aMPV were found in the breeding species as compared to those of commercial
chickens.
In the artificial experiment, eighty SPF chickens aged 21-day-old were randomly divided into 8
groups. Post inoculated with C. psittaci, ORT and H9N2 by throat/ intranasal drop, chickens were
given Aspergillus fumigatus (A. fumigatus). Mortality, body weight gain, lesion scores and cytokines were
evaluated. Consequently, 37.5% mortality was observed in the birds with C. psittaci, ORT, H9N2 and
Aspergillus fumigatus at same time while 25% mortality was found in the combination with C. psittaci,
ORT and A. fumigatus infection. Also, airsacculitis was replicated in two groups, while other groups
had respiratory diseases without mortality.
Our seroprevalences survey indicates that ORT, C. psittaci and aMPV are prevalent in poultry.
Combination of C. psittaci, ORT, H9N2 and A. fumigatus contribute to the replication of poultry air
sacculitis. The early infection of C. psittaci plays a leading role and induces secondary infections to
H9N2 and ORT, triggering the injury of air sacs and lungs.
Key Words: Air sacculitis, seroprevalence, co-infection, SPF chickens
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
37
LARYNGOTRACHEITIS IN CHICKENS IN PAKISTAN
Ahmed Din Anjum
Department of Pathobiology, Riphah College of Veterinary Sciences, Lahore, Pakistan
ABSTRACT
Respiratory diseases are one of the most common problems in today's commercial poultry and
fancy birds. Amongst these, Infectious laryngotracheitis (ILT) is a highly contagious disease of
chickens. Field outbreaks of ILT in layer flocks, pheasants and peafowl are reported here. Outbreaks
in White Leghorn layers were seen between 12 and 18 weeks of age. Majority of the affected birds
had conjunctivitis, sticky nose, tracheal rales and gasping. The flocks also exhibited decrease in feed
consumption. Morbidity reached almost 100% in some flocks and mortality ranged between 10 and
70 per cent. At necropsy, nasal cavity contained copious amounts of clear thick mucus to yellowish
exudate. Lesions were most consistently found in the larynx and upper trachea. Histologically, severe
necrotizing tracheobronchitis and occasionally basophilic intranuclear inclusion bodies were seen in
the tracheal epithelium. Vaccination, eye drop, in the face of these outbreaks mostly induced
adequate protection around 4th day post vaccination. In conclusion, the outbreaks of ILT in layer
flocks and in fancy birds should be taken as an emerging threat. There may be more ILT cases which
are incorrectly diagnosed due to the nondescript clinical signs of this disease. Along with biosecurity
measures, ILT vaccine may be considered in the regular vaccination schedules. Vaccination early in an
outbreak of ILT can be an effective tool to decrease mortality.
Key Words: Infectious laryngotracheitis, Clinical signs, Lesions, Vaccination
Introduction
Respiratory diseases are one of the most common, world-wide, problems in today's commercial
poultry and fancy birds. Amongst these, Infectious laryngotracheitis (ILT) is a highly contagious viral
respiratory disease of chickens. Clinically, ILT may present as a mild, acute or peracute disease and is
characterised by severe dyspnoea, neck extension, conjunctivitis and severe production losses (Bagust
et al., 2000). It is a disease of economic significance for the poultry industry because it induces high
mortality and drops in egg production and egg size in layers and delayed growth, poor feed
conversion and increased condemnations in broilers (Humberd et al., 2002; Kirkpatrick et al., 2006;
Anonymous, 2008).
Until 1980-1990’s, it was occasionally seen in breeder flocks in Northern areas in Pakistan
(Anjum, 1991). This presentation describes the field outbreaks of ILT in commercial layers, pheasants
and peafowl in Punjab province including Sargodha, Faisalabad and Lahore. Outbreaks in White
Leghorn layers were seen between 12 and 18 weeks of age.
Materials and Methods
The study is based on investigation of field outbreaks of respiratory disease in commercial
poultry and wildlife. Flock history (acute), disease trend (rapidly spreading among pen-mates),
symptoms (conjunctivitis, neck extension during an inspiratory effort with open beak to inhale more
air) and characteristic lesions (conjunctivitis, tracheitis) in birds were taken as suggestive of ILT.
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
38
Blood samples were collected from few flocks at the start of the respiratory signs and three
weeks later. Sera were separated and antibody titres were determined using commercial ELISA kits
(Biocheck, Holland).
Clinical Description
The ILT outbreaks were seen in layer flocks in Sargodha, Faisalabad and Lahore, during the
months of March through May 2015. The clinical presentation of field cases of ILT was variable from
mild to severe.
The affected pullets, initially exhibited signs of ocular edema, conjunctivitis and ocular discharge
followed by nasal discharge, moist rales and open-mouth breathing. Severely affected birds frequently
emitted a cawing sound - high pitched squawk. In pullets, the morbidity was upto 90 per cent and the
mortality was variable from 5-15 per cent.
In laying flocks, initially there was reduced feed intake. Many of the affected birds were sitting
with their eyes closed and head between feathers. There was frothy discharge from eyes or sticky
eyes. Later, some of the affected birds developed swelling of the infra-orbital sinuses. Mortality was
less than 10 per cent. Clinical signs were accompanied by 10-15 per cent egg drop. Egg production
returned to its previous rate in around four weeks. Egg quality was not affected.
At postmortem examination, nasal cavity contained copious amounts of clear thick mucus. There
was mild congestion to numerous petechial haemorrhages on the mucosal surface of the larynx and
trachea. Very few birds had caseous exudate or diptheritic casts occluding the lumen of upper
trachea. There was general body congestion (dark muscles) but viscera appeared normal.
In case of more than one houses at any farm, spread from house to house took around a seven
to 10 days. Vaccination, eye drop, in the face of these outbreaks mostly induced adequate protection
around 4th day post-vaccination. Clinical signs and mortality tended to disappear in around three to
four weeks through entire flock. Clinical recovery in some flocks prolonged to 7-8 weeks and
immunosuppression was suspected for this prolonged recovery.
At certain wildlife facilities, pheasants were most affected whereas peafowl and turkeys did not
show clinical disease. Clinical signs and lesions in pheasants were similar to those seen in the layer
birds. There was manifold increase in antibody titre against ILT without any vaccination with ILT virus
(Table 1).
Table 1: Antibody titre against ILT in affected flocks.
Flock
First
Sample
Second sample (21 days later)
Mean titre Range CV (%)
1 259 3341 662-6900 55.04
2 216 3070 870-5300 45.36
3 58 3513 1083-6200 44.05
4 197 3686 1461-6700 48.26
Discussion
Until the year 2000, breeder flocks were mainly kept in Northern areas to take advantage of
weather. With the start of environmentally controlled houses, breeder flocks are now also raised in
plain areas in Punjab. In Pakistan, to date, preventive vaccination for ILT is mainly practiced only for
breeding stocks. Three vaccine types are available viz., chick embryo origin (CEO), tissue culture
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
39
origin (TCO), and a pox-vectored recombinant vaccine. The CEO vaccines are usually more invasive
and have the capability of reverting to virulence and causing full-blown ILT signs. The TCO does not
spread significantly or revert to virulence. In case of the pox-vectored recombinant vaccine, if a bird
has had previous exposure to pox prior to being given this vaccine, immunity to ILT will be minimal
Vaccinated birds or birds recovered from natural infection are immune for around a year. Parental
immunity is passed on to the progeny but maternal antibodies do not protect offspring against ILTV
infection or interfere with vaccination (Davison, et al., 2006; Vagnozzi, et al., 2012; Coppo, et al.,
2013).
During 1990’s outbreaks of ILT were limited to Northern areas in Pakistan (Anjum, 1991). This
study describes field outbreaks of ILT in Punjab. A rising antibody titre in paired sera against ILT
(Table-1) confirms the disease. These outbreaks may be an evidence of increasing occurrence of the
disease in Pakistan in recent years. A priori, this spread may be related to emergence of pathogenic
strains from vaccines used in breeder flocks. Noteworthy, once a bird is infected with ILT virus, it
becomes a life-long carrier and can shed the ILT virus during times of stress, infecting other birds
(Hughes, 1991). Even the vaccine strains can shed virus for 10-11 days after inoculation.
Guy et al. (1991) reported an increased virulence of modified-live ILT vaccine virus following
bird-to-bird passage. Recently, Lee et al. (2012) showed that current ILT vaccines are mildly
pathogenic and increase in virulence by bird-to-bird passage, from vaccinates to non-vaccinates, in the
field. Through uncontrollable “back passage” the vaccine viruses may regain enough virulence to
cause an outbreak of ILT (vaccinal laryngotracheitis, also known as VLT) (WSDA, 2011).
Furthermore, the recombinant vaccines do not induce mortality and do not cause an increase in feed
conversion or in mortality, but they do allow field viruses to replicate in the trachea and conjunctiva,
and in consequence, vaccinated-challenged chickens do get infected with field viruses (Vagnozzi, et al.,
2012).
Clinical signs and lesions are very similar to those reported in other studies (Kirkpatrick et al.,
2006). Other than morbidity, mortality and reduced performance, ILT is also suspected to synergize
the impact of pathogens that have normally little impact such as Mycoplasma synoviae. Outbreaks can
occur in broilers resulting in a marked reduction in feed intake and growth rate (VanderKop, 1993;
Linares et al., 1994). However, ILT in broilers was not under study during this period. Vaccination in
the face of an outbreak in egg-type layers can be an effective tool to reduce the severity, mortality
and longevity of the disease. However, never use the vaccine unless the diagnosis is definitely
confirmed.
References
Anjum AD, 1991. Emerging Diseases of Poultry in Pakistan. Proceedings of the 3rd International
Congess organized by Pakistan Veterinary Medical Association on 28-29 November 1990 in
Islamabad. pp: 205-213.
Aonymous, 2008. Avian infectious laryngotracheitis - Chapter 2.3.3. OIE Terrestrial Manual, pp. 456-
463.
Bagust TJ, RC Jones and JS Guy, 2000. Avian ILT. Rev Sci Tech, 19: 483-492.
Coppo MJ, AH Noormohammadi, GF Browning and JM Devlin, 2013. Challenges and recent
advancements in Infectious Laryngotracheitis Virus vaccines. Avian Pathol, 42: 195–205.
Davison S, EN Gingerich, S Casavant and RJ Eckroade, 2006. Evaluation of the efficacy of a live
fowpox-vectored infectious laryngotracheitis/avian encephalomyelitis vaccine against ILT viral
challenge. Avian Dis, 50: 50–54.
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
40
Guy JS, HJ Barnes and L Smith, 1991. Increased virulence of modified-live ILT vaccine virus following
bird-to-bird passage. Avian Dis, 35: 348-355.
Hughes CS, RA Williams, RM Gaskell, FT Jordan, JM Brandbury et al., 1991. Latency and reactivation
of infectious laryngotracheitis vaccine virus. Arch Virol, 121: 213-218.
Humberd J, M García, SM Ribler, RS Resurrección and TP Brown, 2002. Detection of Infectious
Laryngotracheitis Virus in formalin-fixed, paraffin-embedded tissues by Nested polymerase chain
reaction. Avian Dis, 46: 64-74.
Kirkpatrick NC, A Mahmoudian, CA Colson, JM Devlin and AH Noormohammadi, 2006. Relationship
between mortality, clinical signs and tracheal pathology in infectious laryngotracheitis. Avian
Pathol, 35: 449–453.
Lee SW, PF Markham, MJ Coppo, AR Legione, JF Markham et al., 2012. Attenuated vaccines can
recombine to form virulent field viruses. Science, 337: 188.
Linares JA, AA Bickford, GL Cooper, BR Charlton and PR Woolcock, 1994. An outbreak of infectious
laryngotracheitis in California broilers. Avian Dis, 38: 188-192.
Vagnozzi A, G Zavala, SM Riblet, A Mundt and M Garcia, 2012. Protection induced by commercially
available live-attenuated and recombinant viral vector vaccines against infectious laryngotracheitis
virus in broiler chickens. Avian Pathol, 41: 21–31.
VanderKop MA, 1993. Infectious laryngotracheitis in commercial broiler chickens. Can Vet J, 34: 185.
WSDA, 2011. Vaccine-like Infectious Laryngotracheitis (ILT). Washington State Department of
Agriculture, extension paper.
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
41
INFECTIOUS BRONCHITIS: CURRENT DISEASE SCENARIO IN PAKISTAN
Khalid Naeem*, Saba Rafique, Naila Siddique and Mohammad Athar Abbas
National Reference Lab for Poultry Diseases,
National Agricultural Research Centre,
Park Road, Islamabad, Pakistan
*Corresponding Author: naeem1955@gmail.com
ABSTRACT
Infectious Bronchitis Virus (IBV) is considered to be primarily involved in various in infections of
respiratory tract and urogenital tract in chickens of different age groups in this country. The sero-
prevalence data from non-IBV vaccinated back-yard poultry from different areas in the country have
revealed a wide distribution of IBV antibodies, which reflected that around 70% of the tested chicken
possessed positive IBV ELISA antibody titers, ranging from 453 to 16747. Whereas the normal base-
line post-vaccination mean antibody titers in IBV vaccinated laying flocks usually ranges from 4000 to
8000, some extremely high mean titers range of 12,000-18,000 has been recorded. This is reflection
of the fact that such birds were exposed to the field IBVs despite routine vaccination. Furthermore,
multiple field isolates of IBV earlier identified by RT-PCR also have been characterized using
restriction fragment length polymorphism (RFLP), where the results indicated the distribution of
these isolates into various distinct groups (genotypes), being different from the known IBV vaccine
strains being used in this country. Similarly, a variety of clinical picture observed in the field has
shown some links to the condition of co-infection between IBV and ORT or AIV H-9. Furthermore,
some of the available data regarding the sequence analysis of spike gene of local isolates indicate
continuous emergence of IBV variants in the field which obviously requires readdressing of the issues
of vaccine selection and adoption of more effective vaccination schedules.
Key Words: Infectious Bronchitis Virus, Sero-prevalence, ELISA, RT-PCR
Introduction
Avian infectious bronchitis virus (IBV) causes a highly contagious and economically significant
disease in chickens. The disease is characterized by respiratory signs but in young chickens severe
respiratory distress commonly occurs while in layers it causes decrease in egg production. Both the
chickens and pheasants are considered natural host of IBV where the virus cause disease. The virus is
transmitted by the air-borne route, direct chicken to chicken contact and indirectly through
mechanical spread. It can persist in the birds and faeces for several weeks or months.
The IB virus is a member of the genus Coronavirus, family Coronaviridae, Order Nidovirales. IBV and
other avian coronaviruses of turkeys and pheasants are classified as group 3 coronaviruses, with
mammalian coronaviruses comprising groups 1, 2 and 4. Group 4 is the more recently identified
severe acute respiratory syndrome (SARS) coronavirus (Cavanagh, 2003). IBV is an enveloped,
positive sense single stranded RNA virus containing an un-segmented genome approximately 27.6 kb
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
42
in size. The virion has four structural proteins: nucleocapsid protein (N), membrane glycoprotein (M)
small envelope protein (E), and glycosylation spike glycoprotein (SP) (Su et al., 2011).
Many IBV serotypes have been described probably due to the frequent point mutations that
occur in RNA viruses and also due to recombination events in nature. For this reason, the
characterization of virus isolates existing in the field is very important. The spike (SP) protein is one
of the major structure proteins of IBV proteins that is cleaved into two smaller proteins namely SP1
and SP2. SP1 gene contains three hypervariable regions that are responsible for the induction of
neutralizing and serotype specific antibodies (Haqshenas et al., 2005).
In some of the earlier reported studies from Pakistan, antibodies to several "American" and
"European" IB variants have been demonstrated (Ahmed et al., 2007). A recent study has revealed the
sero-prevalence of IBV in backyard poultry and duck, indicating these species may act as a reservoir
for IBV or related viruses (Rahim et al., 2015). As no IBV vaccination is used in these species, such an
alternative reservoir would have major implications for vaccination and control programs for IBV
prevention in commercial poultry in this country. On the basis of this information some additional
work is ongoing here at NRLPD-NARC regarding the isolation, serotyping and genotyping of the IBVs
from the field so that a suitable vaccination program using common field serotype as vaccines can be
adopted to protect against the locally prevalent distinct IBVs.
During 2013-15 a comprehensive serological evaluation of the flocks with or without the usage
of IBV vaccines has been conducted. The sero-prevalence data from non-IBV vaccinated back-yard
poultry from different areas in the country have revealed a wide distribution of IBV antibodies, which
reflected that around 70% of the tested chickens possessed positive IBV ELISA antibody titers, ranging
between 450 to 16747 (Rahim et al., 2015). Whereas for IBV the normal base-line post-vaccination
mean antibody titres at the time of laying usually ranges in this country from 3000 to 7000. However,
in such vaccinated flocks some extremely high antibody titre ranges of 12,000-21,000 have also been
recorded among the flocks showing production losses with or without some changes in egg quality. In
some cases, such conditions have also led to the detection of IBVs from the selected flocks. All this
reflected that such birds were exposed to the field IBVs despite routine vaccination. Furthermore,
multiple field isolates of IBV identified here by RT-PCR have also been characterized using restriction
fragment length polymorphism (RFLP), where the results indicated the distribution of these isolates
into few distinct groups (genotypes), being different from the known IBV vaccine strains in use in this
country (Rafique et al., 2015). Similarly, a variety of clinical pictures observed in the field has shown
the involvement of ORT or AIV-9, later confirmed by the detection of these organisms through
serological and/or PCR evaluation.
In Pakistan, traditionally IBV Mass type strains have been used for vaccination, however, at
different times variants of D-274, D-1466, 4/91 and GA 98 have also been used. Unfortunately, at
many places use of any or all of these vaccines did not protect the flocks from subsequent IBV
infections. The IBV recovered from such cases have been grouped into 4/91-like variants, QX-like
variants and a group of Pak Isolates of unique variation (Rafique et al., 2005). Additional work is being
carried out to further characterize these new IBV isolates.
Based on the routine NRLPD-NARC surveillance data regarding PCR-based detection of IBVs, it
has been found that 4/91 vaccine viruses are persisting in broiler breeder flocks even up to 8-9 weeks
post vaccination. In this regard, some earlier studies examining re-isolated IBV vaccine viruses have
shown that selection of vaccine subpopulations as well as mutations in the spike glycoprotein can be
detected after only one infectious cycle (McKinley et al., 2008). Additional studies specifically
examining the mechanism for the persistence of IBV 4/91 vaccine under local field conditions in this
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
43
country are required, as it is well known that the longer IBV persists in the field the more
opportunity it has to undergo genetic drift and shift resulting in new variant viruses, which may be the
cause of current vaccine failure. In order to achieve higher level of protection of commercial layers
and parent stock during the laying period, the use of inactivated IBV vaccines after a priming with live
IBV vaccines has been generally practiced to be effective against homologous Mass-strain challenges,
but for increasing the level of protection against heterologous challenges (variants), development of
killed vaccines from the most common circulating variant for use in the laying period could be an
appropriate solution for overcoming the prevailing IBV infections among the vaccinated flocks.
Conclusion
It is pointed out that the presence of IBV infection in commercial poultry among the flocks
vaccinated with multiple serotypes of IBV is indicator of independent evolution of IBV in Pakistan and
persistence of divergent stains currently circulating in the country. It is very critical to complete
genetic characterization of circulating IBV viruses to study the genetic relatedness among viruses and
vaccine strains. This will guide us for best vaccines selection and improve our effort to control the
disease.
References
Ahmed Z, K Naeem and A Hameed, 2007. Detection and sero-prevalence of infectious bronchitis
virus strains in commercial poultry in Pakistan. Poult Sci, 86: 1392-35.
Cavanagh D, 2003. Severe acute respiratory syndrome vaccine development experiences of
vaccination against avian infectious bronchitis coronavirus. Avian Pathol, 32: 567–582.
Haqshenas G, K Assasi and H Akrami, 2005. Isolation and molecular characterization of infectious
bronchitis virus isolate Shiraz IBV, by RT PCR and restriction enzyme analysis. Iranian J Vet Res,
6: 9-15.
McKinley T, AH Deborah and MW Jackwood, 2008. Avian coronavirus infectious bronchitis
attenuated live vaccines undergo selection of subpopulations and mutations following vaccination.
Vaccine, 26: 1274-1284.
Rafique S, K Naeem, N Siddique, MA Abbas, AA Shah et al., 2015. Sequence analysis of 793B-like
Infectious bronchitis virus isolated from Pakistan. Turkish J Biol ((Submitted).
Rahim A, K Naeem, N Siddique, A Hameed and S Rafique, 2015. Determination of Avian Infectious
Bronchitis Virus sero-prevalence among commercial and backyard poultry. Intl J Poul Sci
(Submitted).
Su JL, ZT Zhou, ZS Guo, QR Xu, YC Xiao et al., 2011. Identification of five bronchitis virus (IBV)
strains isolated in China and phylogenetic analysis of the S1gene. Afr J Microbiol Res, 6: 2194-
2201.
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
44
IMMUNE ENHANCER PROPOLIS AND POULTRY PROPOLIS VACCINE
Zhiqiang Shen* and Guanggang Qu,
Shandong Binzhou Animal Science and Veterinary Medicine Academy, No 169, Huanghe 2nd Road,
Binzhou, Shandong, China
*Corresponding Author: bzshenzq@163.com
ABSTRACT
The propolis is a type of natural material and wasp product formed by mixture of cells tissue
fluid and gelatinoid collected by bees from collagen plants axillary bud and lingual gland, wax
secretions of bees, and possesses broad spectrum biologic activities and immunologic enhancement.
The propolis is acknowledged as the greatest “natural antibiotics” all over the world, with the
properties of anti-inflammatory, anti-bacterial, oxidative stability, anti-aging, anti-virus, cytoactive,
reinforce energy, pull oneself together, relieve fever, detoxification and immunity enhancement. The
contents in propolis, including flavones, enzymes, alcohols, lipids and acids, have wide immunological
effects.
Professor Shen Zhiqiang, as the leader of a research group, has been researching vaccines for
livestock and poultry by using nanometer propolis over 20 years, is the first one to apply the natural
propolis with the function of a broad spectrum of biological activities instead of conventional chemical
propolis to develop vaccines. The group established an innovation technology platform with
independent innovation and intellectual property rights for the nano-propolis adjuvant vaccine
development and industrialization.
Series of the nano-propolis adjuvant vaccines developed by the team can fully trigger the body's
immune defense system, including the cellular immune system, humoral immune system, red blood
cells immune system and macrophage complement immune system to produce specific and non-
specific immunity. The vaccines are green, safe, fast, efficient and long-duration. Furthermore, the
vaccines can meet the requirement of food safety standards, are easy for storage, transportation and
application, and play an important role in animal disease prevention and control in China.
Key Words: Propolis; Adjuvant; Vaccine; Immune system
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
45
TREATMENT OF AVIAN TIBIAL DYSCHONDROPLASIA USING TRADITIONAL
CHINESE MEDICINES BY HSP90 INHIBITION
Muhammad Kashif Iqbal1§, Jingying Liu1§, Fazul Nabi1,2, Muhammad Shahzad3 and Jiakui Li1*
1College of Veterinary Medicine, Huazhong Agricultural University, Wuhan 430070, PR China; 2Faculty of Veterinary & Animal Sciences, Lasbela University of Agriculture, Water and Marine
Sciences, Uthal 90150, Balochistan, Pakistan; 3University College of Veterinary & Animal Sciences, The
Islamia University of Bahawalpur 63100, Pakistan
§These authors equally contributed in this study
*Corresponding Author: lijk210@sina.com
ABSTRACT
Tibial dyschondroplasia (TD) mainly occurring in fast growing avian species is an important
tibiotarsal bone disorder that contributes a great economic loss in poultry industry. TD is
characterized by a-vascular and non-mineralized growth plate and is attributed to abnormal
differentiation of chondrocytes and lameness. Heat-shock protein 90 (Hsp90) is a proangiogenic
factor in animal tissues; however; its expressions increase in case of chicken TD. The
Epigallocatechin-3-gallate (EGCG) and Apigenin are traditional Chinese medicine (TCM) which are
well known for their Hsp90 inhibitory activities. In this experiment, TD was induced by dietary thiram
and the TD-affected birds were treated with EGCG and Apigenin. The histological study of growth
plates was carried out with H&E staining, and the mRNA expression of Hsp90 was examined by
reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR). Results showed
that as compared to control group, TD had displayed the changes in chondrocytes differentiation
with lack of blood vessels; and an increased expression of Hsp90 was observed significantly (P<0.05)
resulting in the development of TD and lameness. However, on administering the EGCG and
Apigenin to TD-affected birds, the normal chondrocytes columnar organization was restored with
vascularization and decreased Hsp90 expression activity (P<0.05) which ultimately abrogated the
lameness. Our results suggest that Hsp90 is the key factor in the development of TD, and EGCG and
Apigenin have a novel effect on Hsp90 inhibition properties thus reducing the lameness and leg
deformity in chicken broiler. Ours findings are a first time approach towards the treatment of TD in
broiler chicken through TCM.
Key Words: Tibial dyschondroplasia; Hsp90; traditional Chinese medicine; EGCG, Apigenin
INTRODUCTION
Tibial dyschondroplasia (TD, a long bone disorder in fast growing birds demonstrates the
presence of a-vascularized and non-mineralized cartilage in the growth plate (Shahzad et al., 2015)
bringing changes in normal differentiation of chondrocytes normally associated with cartilage
vascularization and mineralization (Pines et al., 1998).
Heat shock protein 90 (Hsp90) among its clients plays a major role in angiogenesis. In cancer
therapy, several Hsp90 inhibitors have been developed to inhibit vascularization. The inhibition of
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
46
Hsp90 by synthetic Geldanamycin has been recently studied in TD where the down regulation of
Hsp90 brought the angiogenesis in the TD-affected area.
Many natural plants and extracts rich in polyphenols, flavonoids and carotens as antioxidants have
been recognized to treat many diseases. Being extensively utilized in animals, such plants have been
found better than synthetic drugs due to their lower cytotoxicity and side effects. Traditional Chinese
medicines (TCM) have been used for centuries in China to cure various diseases. Among those, many
medicines have been employed to promote angiogenesis to treat several bone related conditions
depicting a positive effect on the treatment (Yang et al 2014).
Epigallocatechin-3-gallate (EGCG), a main component of green tea is found to have the curative
effects in inflammatory and oxidative stressed conditions. EGCG is a novel Hsp90 inhibitor and
protective against various types of cancer (Yin et al 2009, Clement Yuri 2009, Song et al 2005) by
suppressing the expression of Hsp70 and HSP90 in vivo and in vitro cultures (Tran et al., 2010).
Apigenin, a member of flavone family is present in vegetables, fruits, spices and herbs; and have
the anti-inflammatory, antioxidant and anti-cancerous properties. This compound has been reported
to inhibit the Hsp90 expressions through hypoxia-inducible factor 1 alpha (HIF-1 alpha) (Shukla et al.
2010, Fang et al., 2005).
In this study, we evaluated the efficiency and safety of TCM (EGCG and Apigenin) in un-
vascularized avian growth plates in thiram-induced avian tibial dyschondroplasia; and investigated their
effect as Hsp90 inhibitors in TD-affected growth plate.
MATERIALS AND METHODS
Experimental birds: The experiment was conducted concerning all national legislations and
protection of animal welfare under the approval of committee of Huazhong Agricultural University
Wuhan, China. Three hundred one-day-old male broiler chicks average weighing 48±0.5 g were
purchased from commercial hatchery and maintained under standard hygienic conditions.
TD establishment and treatment with TCM: The chicks were weighed and divided equally into
two groups: a control group (n=150) which received a standard normal diet, and thiram group kept
on the same diet as to the control group (n=150) but with the addition of 40 mg/kg of tetra methyl
thiuram disulphide (Thiram) to induce TD til the end of experiment. TD was evaluated and scored
according to Pines et al (2005). After disease induction, when more than seventy five percent birds
started showing the lameness signs, half of the birds from the thiram group were separated into two
separate groups designated as the EGCG and Apigenin treatment groups. These groups were fed
with the thiram-containing diet and treated with TCM; the birds of EGCG group were treated with
EGCG @ 10 mg/kg/d intra-peritoneally (i.p) (Tianjin Shilan Technology Co.Ltd. China) and birds in
Apigenin group were given Apigenin @ 5mg/kg/d i.p (Wuhan Dinghui Chemical Co.LTD) intra-
peritoneally (i.p). Normal saline was administered to control group.
Broiler chicks from all groups were euthanized by cervical dislocation on day 7 & 14 and growth
plates were dissected out for further analysis. Tibiotarsal bones from each group were fixed in 4%
paraformaldehyde, frozen in liquid nitrogen and stored at -70oC.
Hematoxylin & eosin (H&E) staining: Growth plate samples were fixed overnight in 4%
paraformaldehyde in PBS at 4oC and the bone tissue was decalcified in 10% EDTA. After dehydration
in ethanol, clearing in xylene and embedding in paraffin wax, the growth plate histological slices were
cut into 5 um thickness to prepare the histological slides and stained by H & E staining method.
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
47
RNA extraction and reverse transcription quantitative real time PCR (RT-qPCR):
Growth plates were disrupted and homogenized in TRIzol reagent (Invitrogen, Carlsbad, California
USA) to extract the total RNA which was transcribed to cDNA with cDNA kit (TransGen Biotech
Co.Ltd Beijing, China). RT-qPCR was performed with specific Hsp90 primers from Gallus gallus
sequence as: Forward CCTCCTCCATACGTGATGTGTCA and Reverse
GCCTGGGCATTGATGAAGATG. Quantification of gene expression was performed by Step One
Real-Time PCR system (Applied Biosystems, CA, USA) with SYBR green kit (Takara Dalian, China).
All samples were run with following thermal parameters: 95oC for 30 sec, 40 amplification cycles at
95oC for 8 sec, 59oC for 30 sec and 72oC for 30 seconds. The delta CT method was used to quantify
the expressions and the differences between gene expression levels were analyzed by t test. The
differences were considered significant at P<0.05.
Statistical analysis: All data was analyzed by one way ANOVA following the Tukey’s test and
presented as means ± standard error of means (SEM). The differences were considered statistically
significant at P<0.05.
RESULTS
Effect of EGCG on thiram-induced TD-affected growth plates: Morphologically, the birds
started showing signs of lameness after two days of TD induction (Fig. 1). On slaughtering, an un-
vascularized mass on proximal side of tibiotarsal bones was observed in TD-affected birds (Fig. 1). In
EGCG treatment group, the growth plate width and lameness signs started to reduce which was
more obvious on day 14 as compared to thiram-fed group. In H&E staining, a significant difference
was observed between normal and TD-affected growth plate with rough column organization and less
blood vessels in chondrocytes in later group (Fig. 2). The EGCG administration resulted in a new
blood vessel formation with a normal and proper chondrocyte disclosure in the hypertrophic region
of growth plate (Fig. 2). In qRT-PCR, the levels of Hsp90 expressions was found up-regulated
significantly (P<0.05) in thiram-fed TD birds as compared to control group; however, a significant
reduction in Hsp90 expressions was observed in EGCG administered group bringing its level
returned to the normal values in the region (Fig. 3).
Effect of apegenin on thiram-induced TD-affected growth plate: To cure TD, the anti-Hsp90
treatment was studied by using Apigenin as an Hsp90 inhibitor. After the administration of Apegenin
to the thiram-induced TD chicks, the affected growth plate size and signs of lameness were abrogated
on day 14. At this stage, the chicks were able to stand and walk properly (Fig. 4). On H&E staining of
TD-affected cartilage cells (thiram-fed group), the hypertrophic zone of growth plate depicted a
decline in blood vessels and improper chondrocytes differentiation; however, the Apigenin
administration cured the chicks from TD and by bringing about the massive blood vessels in the
hypertrophic area (Fig. 5). In parallel to that, a significant increase in Hsp90 expressions was observed
(P<0.05) in TD-affected birds as compared to control group; however in contrary, the Apegenin
administration caused a reduction in Hsp90 expressions in growth plate (Fig. 6).
DISCUSSION
Chicken broiler long bone defects ultimately lead to gait abnormality and pose a serious animal
welfare issue resulting into great economic loss. The mechanism of endochondral ossification occurs
in growth plates. The chondrocytes are surrounded in extracellular matrix (ECM) which is a
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
48
reservoir of various growth factors and several enzymes involved in chicken endochondral
ossification (Shahzad et al., 2014).
Fig. 1: Effect of EGCG on growth plate size and lameness. Chicks and tibial growth plates were
photographed. Lameness and the avascular, distended growth plate with tibial dyschondroplasia and
the recovery from lameness and normal size growth plate size after EGCG treatment. GP=growth
plate; TD=Tibial dyschondroplasia.
Fig. 2: Growth plate sections stained with hematoxylin and eosin staining. After EGCG treatment,
appropriate chondrocyte disclosure and new blood vessels formations. HZ, Hypertrophic Zone.
Arrow indicates blood vessels in the hypertrophic zone.
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
49
Fig. 3: Real-time quantitative PCR analysis of Hsp90 in growth plate was evaluated before and after
administration of EGCG in TD affected birds. The results are expressed in arbitrary units as the
means ±SE. Control group set to one thus equivalent to the N-fold difference. abcletters indicate
significant difference (P <0.05).
Tibial Dyschondroplasia is described by the presence of a dull white non-mineralized cartilage mass
that extends into the metaphysis of the proximal tibiotarsus bone. (Leach and Nesheim 1965).
In this study, TD was induced by dietary 40 mg/kg of thiram in feed. Thiram an agricultural
fungicide has experimentally taken much attention due to its toxicity in poultry farming by causing
lameness in birds (Rath et al., 2005). After TD induction, the chicks were administered with TCM
medicines (EGCG and Apigenin); alongside thiram-feed was continued till the end of experiment.
Both medicines were found to start recovery after two days of their administration and a complete
healing was observed within a week. A complete whole recovery was seen by the end of experiment
with a decrease in growth plate lesion and lameness in TD-afflicted birds.
An alternative therapy is a worth approach because of less toxic side effects towards treatment.
Traditional Chinese medicines (TCM) have been used in clinical practice for thousands of years and
many herbs have been demonstrated for the treatment of bones and joint diseases. Recently, various
modern techniques have provided insight to meet such interests; and modern science has been
looking for their validation, especially in the control and treatment of chronic diseases. (Zhang et al.,
2012, Leung, 2001). The basic aim of present study was the treatment of TD by using TCM; EGCG
and Apigenin by employing their ability to inhibit Hsp90 activity in avian growth plates.
Hsp90 inhibitors are widely used to prevent the vascularization in cancer; however, the previous
reports have confirmed the role of Hsp90 in chicken growth plate where the Hsp90 inhibition has
brought the vascularization in TD-affected area with the abrogation of lameness. We have also
reconnoitered the therapeutic benefits of TCM by targeting the Hsp90 in TD. The results revealed
that the administration of TCM had brought massive blood vessels in TD-afflicted area by inhibiting
the Hsp90 expression and resulted into the re-establishment of normal growth plate morphology.
Herzog et al. (2011) and Genin et al. (2012) recently reported the Hsp-90 inhibition activity by a
synthetic drug which resulted in the abrogation of lameness in affected growth plate.
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
50
Fig. 4: Effect of Apigenin growth plate size and lameness. Lameness and the large size growth plate in
the chicks with TD. Apigenin treatment resulted in normal growth plate size and recovery from TD.
GP= growth plate; TDL= TD lesion.
Fig. 5: Hematoxylin and eosin staining of growth plate histological sections of normal , TD and
Apigenin treated groups. TD afflicted growth plate was with irregular columnar arrangement of the
chondrocytes. Apigenin administration causes the appropriate columnar arrangement with emergent
huge blood vessels in the hypertrophic zone. Arrow indicates blood vessels. Columnar arrangements
of chondrocytes can be seen in parenthesis. PZ=Proliferative zone, HZ=Hypertrophic zone.
Hsp90 is a chaperone protein that aids other proteins and stabilizes them against stress. In our
experiment, by administering TCM, the mRNA expressions of Hsp90 were restored to their normal
levels in thiram-induced birds and the lameness started subsiding with an increase in blood supply in
the affected area. TD is characterized through cell death, lack of blood supply, and damage of blood
capillaries in the chondrocyte of growth plate (Rath et al., 2005). In present study, the increased
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
51
expression of Hsp90 in TD lesions was in accordance with the previous reports (Herzog et al., 2011;
Genin et al., 2012; Shahzad et al., 2015).
In our experiment, the administration of EGCG and Apigenin increased blood supply in the
hypertrophic zone of growth plate and brought the normal differentiation. Thiram induction
promoted chicken growth plate abnormal endochondral calcification and chondrocyte proliferation
and disturbed the development of normal cartilage (Tian et al., 2009; Shahzad et al., 2014). In
conclusion, this is the first study describing the use of traditional Chinese medicine, EGCG and
Apigenin in chicken broiler to cure the lameness in broiler chicken by inhibiting the Hsp90 activity.
Fig. 6: Hsp90 mRNA expression was analyzed in chicken epiphyseal growth plates of proximal tibiae
isolated from normal, TD induced, Apegenin treated chicks. Data expressed in arbitrary units as the
mean±SE. Control group set to one thus equivalent to the N-fold difference. abLetters indicate
significant difference (P<0.05).
Acknowledgment: The study was supported by the Research Fund for the Doctoral Program of
Higher Education of China (No. 20120146110017) and The National Natural Science Foundation of
China (No.31460682).
REFERENCES
Clement Y, 2009. Can green tea do that? A literature review of the clinical evidence. Prev Med 49:
83-87.
Fang J, C Xia, Z Cao, JZ Zheng, E Reed et al., 2005. Apigenin inhibits VEGF and HIF-1 expression via
PI3K/AKT/p70S6K1 and HDM2/p53 pathways. Faseb J, 19: 342-353.
Genin O, A Hasdai, D Shinder and M Pines, 2012. The effect of inhibition of heat-shock proteins on
thiram-induced tibial dyschondroplasia. Poult Sci, 91: 1619-1626.
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
52
Herzog A, O Genin, A Hasdai, D Shinder and M Pines, 2011. Hsp90 and angiogenesis in bone
disorders-lessons from the avian growth plate. Am J Physiol Regul Integr Comp Physiol, 301:
R140-147.
Leach RM Jr and MC Nesheim, 1965. Nutritional, genetic and morphological studies of an abnormal
cartilage formation in young 405 chicks. J Nutr, 86: 236-244.
Leung PC, 2001. Evidence-based alternative medicine Hong Kong Med J, 7: 332-334.
Pine M, A Hasdai and M Monsonego-Ornan, 2005. Tibial dyschondroplasia – tools, new insights and
future prospects World’s Poult Sci J, 61: 285-297.
Pines M, V Knopov, O Genina, S Hurwitz, A Faerman et al., 1998. Development of avian tibial
dyschondroplasia: gene expression and protein synthesis. Calcif Tissue Int, 63: 521-527.
Rath NC, MP Richards, WE Huff, GR Huff and JM Balog, 2005. Changes in the tibial growth plates of
chickens with thiram-induced dyschondroplasia. J Comp Pathol, 133: 41-52.
Shahzad M, J Liu, J Gao, Z Wang, D Zhang et al., 2015. Differential expression of extracellular matrix
metalloproteinase inducer (EMMPRIN/CD147) in avian tibial dyschondroplasia. Avian Pathol, 44:
13-18.
Shahzad M, J Gao, P Qin, J Liu, Z Wang et al., 2014. Expression of Genes encoding matrilin-3 and
cyclin-I during the impairment and recovery of chicken growth plate in tibial dyschondroplasia.
Avian Dis, 58: 468-473.
Shukla S and S Gupta, 2010. Apigenin: a promising molecule for cancer prevention. Pharm Res 27:
962-978.
Song JM, KH Lee and BL Seong, 2005. Antiviral effect of catechins in green tea on influenza virus.
Antiviral Res, 68: 66-74.
Tran PL, SA Kim, HS Choi, JH Yoon and SG Ahn, 2010. Epigallocatechin-3-gallate suppresses the
expression of HSP70 and HSP90 and exhibits anti-tumor activity in vitro and in vivo. BMC
Cancer, 10: 276.
Tian WX, WP Zhang, JK Li, DR Bi, DZ Guo et al., 2009. Identification of differentially expressed
genes in the growth plate of broiler chickens with thiram-induced tibial dyschondroplasia. Avian
Pathol, 38: 161-166.
Velada I, F Capela-Silva, F Reis, E Pires, C Egas et al., 2011. Expression of genes encoding extracellular
matrix macromolecules and metalloproteinases in avian tibial dyschondroplasia. J Comp Pathol,
145: 174-186.
Yang Y, A Chin, L Zhang, J Lu and RW Wong, 2014. The role of traditional Chinese medicines in
osteogenesis and angiogenesis. Phytother Res, 28: 1-8.
Yin, Z, EC Henry and TA Gasiewicz, 2009. (-)-Epigallocatechin-3-gallate is a novel Hsp90 inhibitor.
Biochemistry, 48: 336-345.
Zhang D, J Zhang, C Fong, X Yao and M Yang, 2012. Herba epimedii flavonoids suppress osteoclastic
differentiation and bone resorption by inducing G2/M arrest and apoptosis. Biochimie, 94: 2514-
2522.
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
53
ENTERIC DISORDER IN POULTRY: NEVER-ENDING STORY
Hafez Mohamed Hafez, MVSc., Dr.med.vet; Dr. med vet habil.
Institute of Poultry Diseases, Free University Berlin, Germany
Koenigsweg 63, 14165 Berlin, Germany
hafez@vetmed.fu-berlin.de
ABSTRACT
The enteric health of growing poultry is imperative to success of the production. The basic role
of poultry production is turning feed stuffs into meat. Any changes in this turning process, due to
mechanical, chemical or biological disturbance of digestive system (enteric disorders) is mostly
accompanied with high economic losses due to poor performance, increased mortality rates and
increased medication costs.
Several pathogens (viruses, bacteria and parasites) are incriminated as possible cause of enteric
disorders either alone (mono-causal), in synergy with other micro-organisms (multi-causal), or with
non-infectious causes such as feed and /or management related factors. In addition, excessive levels of
mycotoxins and biogenic amines in feed lead to enteric disorders. The severity of clinical signs and
course of the disorders are influenced by several factors such as management, nutrition and the
involved agent(s). Under field conditions, however, it is difficult to determine whether the true cause
of enteric disorders, is of infectious or non-infectious origin.
The effect of antimicrobial growth promoters (AGP) on gut flora results in improvement of
digestion, better absorption of nutrients, and a more stable balance in the microbial population and
reduce the intestinal stress. However, AGP can also increase the prevalence of drug-resistant
bacteria. In recent years and since the ban of use of antimicrobial growth promoters in several
countries the incidence of intestinal disorders especially those caused by clostridial infection was
drastically increased. Field observations in several countries in Europe showed that poultry industry
faced several problems in after banned of AGP`s. Based on „Precautionary Principle” the EU has
decided to ban the use growth-promoting antibiotics in feed of food producing animals completely by
January 2006. The impact of the ban of the antibiotics used as growth promoters has been seen on
the performances (body weight and Feed conversion rate) as well as on the rearing husbandry (Wet
litter and ammonia level), Animal welfare problem (Foot pad dermatitis) and general health issues on
the birds (enteric disorders due to dysbacteriosis and Clostridial infections). The present review
described in general the several factors involved in enteric disorders in poultry.
Key Words: Enteric diseases, Necrotic enteritis, Poultry
Introduction
The basic role of poultry production is turning feed stuffs into meat. Broilers and meat turkeys
are very efficient at both growth and feed conversion rate. Any slight alteration from the optimal
condition is mostly accompanied by disruption of the growth process and all over performance. To
reach the maximal potential of development, considerable demands should be placed on good
intestinal health.
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
54
Enteric disorders are one of the most important groups of diseases they affect poultry and are
continuing to cause high economic losses in the many areas world- wide due to increased mortality
rates, decreased weight gain, increased medication costs, and increased feed conversion rates. Several
pathogens (viruses, bacteria and parasites) are incriminated as possible causes of enteric disorders
either alone (mono-causal), in synergy with different other microorganisms (multi-causal) or with
non-infectious causes such as feed and /or management related factors (Table 1). Under field
conditions, however, it is difficult to determine weather the true cause of enteric disorders in poultry
is of infectious or non-infectious origin (Hafez, 2011).
Table 1: Some possible causes of enteric disorders in poultry
Non - Infectious Infectious
Feed Viral agents
Structure Reo, Astro, Entero, Rota,
Palatability Coronavirus enteritis, HE
Energy content ND, Influenza A
Pellet quality Bacterial agents
Management Salmonellas, E. coli,
Available feed space Clostridia
Available water space Mycotic agents
Distribution of feeders Candida
Distribution of waterers Parasites
Air quality Coccidia, Histomonas,
Temperature Hexamitia, Ascaridia
Stocking density
Infections with Clostridium perfringens
Infections with Clostridium perfringens (C. perfringens) in poultrycan cause several clinical
manifestations and lesions include necrotic enteritis, necrotic dermatitis, cholangiohepatitis as well
as gizzard erosion. However, subclinical infection can take place too. In addition, C. perfringens
type A has been showed to cause food poisoning in humans (Løvland and Kaldhusdal, 2001;
McClane et al., 2006; Novoa-Garrido et al., 2006).
C. perfringens is a Gram-positive, non-motile, spore-forming anaerobic bacterium which
iswidespread in soils, feed, litter and the intestinal tract of diseased and healthy birds. C. perfringens
grows extremely rapidly, with a generation time of 8-10 min, and growth is accompanied by abundant
gas production (Bryant and Stevens, 1997). The bacterial spores are very resistant to heat,
desiccation, acids and many chemical disinfectants (Willis, 1977).
C. perfringens is divided into 5 biotypes A, B, C, D, and E based on the synthesis of four major
lethal toxins: alpha, beta, epsilon, and iota. Along with these four major toxins, enterotoxin (CPE) and
beta2 (CPB2) toxins are considered as important toxins for enteric diseases. However, it is not clear
whether CPE and CPB2 are involved in C. perfringens-associated avian enteric diseases (Crespo et al.,
2007). The infections in poultry are mostly caused by C.perfringens type A, and to a lesser extent by
type C (Engström et al., 2003). Because C. perfringens type A is highly prevalent in the intestines of
healthy animals, controversy exists about its real pathogenic role (McClane et al., 2006). Additionally,
it was shown that strains isolated from necrotic enteritis outbreaks did not produce more alpha toxin
compared to isolates from the gut of clinically healthy broilers (Gholamiandehkordi et al., 2006).
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
55
Timbermont et al. (2009) examined the ability of C. perfringens isolates from both healthy and diseased
poultry, and from calf hemorrhagic enteritis cases, producing different concentrations of alpha toxin
in vitro, to induce necrotic enteritis in broilers. The obtained results revealed that induction of
necrotic lesions in the broiler gut is not associated with the ability to produce alpha toxin in vitro.
Moreover, the results also suggest that the virulence of C. perfringens strains is to some extent host
specific since two C. perfringens strains isolated from calf hemorrhagic enteritis were not able to
produce necrotic lesions in chickens. Keyburn et al. (2008) were able to identify a novel toxin (netB)
in a C. perfringens type A strains isolated from chickens suffering from necrotic enteritis. According to
the authors this novel toxin is the first definitive virulence factor to be identified in avian C. perfringens
strains capable of causing necrotic enteritis. However, netB strain could be also found in healthy
chickens and turkeys (Gad et al., 2011a) as well as in other animal species such bovine (Martin, 2010).
On the hand, Martin (2010) reported that the majority (58%) of chickens with NE were caused by C.
perfringens isolates that were NetB positive. Under experimental condition they found that only
strains that possess NetB were capable of producing NE regardless of the source of the isolate. NetB
negative strains including those isolated from cases of NE were unable to produce NE in the disease
model. Martin and Smyth (2009) also found a strong correlation between the detection of the cpb2
gene and netb gene. However, when interpreting the results it has to be kept in mind that the
presence of the gene of a toxin does not necessarily mean that the toxin is produced, as it was shown
for netb toxin (Abildgaard et al., 2010) or cpb2 (Crespo et al.,2007).
Necrotic enteritis (NE)
NE is an acute disease caused by C. perfringens when proliferates to high numbers in the small
intestine and produces toxins responsible for damaging the intestinal lining. The disease has been
observed in several domestic and wild birds worldwide. Recently several reviews were published
(Van Immerseel et al., 2004; Opengart, 2008, Hafez, 2011). Beside clinically manifested disease,
subclinical infections may take place and are mostly accompanied with reduction of performance. The
most important source of infection in poultry appears to be contaminated feed, litter, water and the
environment. In addition, some reports about the possible vertical transmission have been published
(Köhler et al., 1974; Craven et al., 2003). Recently, Martin (2010) were able to demonstrate under
experimental condition, that factors such as co-infection with Eimeria species, genotype of chicken
and the strain of C. perfringens were the most critical factors involved in disease development, while
other factors such as age of chickens, contact with litter and protein content of the diet played a
lesser role.
After experimental infection, the first mild clinical signs are evident approximately 24 to 36
hours after administration of a pure C. perfringens culture to broiler chickens. The clinical signs
appear suddenly; apparently healthy birds may become acutely depressed and die within hours.
Mortality ranges between 2 and 10%. Affected birds show ruffled feathers, marked depression, in-
appetence, tendency to huddle, watery droppings and diarrhoea.
On autopsy dehydration is the most common finding. Breast muscles are dark red and gizzards
are full of litter. Severe inflammation in the duodenum and jejunum is the most predominant finding,
but in some instances the entire length of the intestinal tract is involved.
The intestine is distended thin walled and filled with gas and contains dark offensive fluid. The mucosa
is covered with green or brown diphteroid membrane, which can be easily separated from the lining.
As the condition progresses, areas of necrosis can be recognized from outside of the intestine.
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
56
The presence of C. perfringens in the intestinal tract or inoculation of the animals with high doses
of C. perfringens, however, does generally not lead to the development of necrotic enteritis. One or
several predisposing factors may be required to elicit the clinical signs and lesions. It appears that
some dysfunctions of the alimentary tract are necessary predisposing cause of infection. Intestinal
stasis, intestinal distension, coccidiosis, salmonellosis, crop mycosis and haemorrhagic enteritis (HE)
may predispose the birds to infection. Also consumption of diets high in energy, protein and fish meal
as well as the consumption of high fibre litter and wheat based diet (Kaldhusdal and Skjerve, 1996;
Kocher, 2003 Williams, 2005). In addition, Siegel et al. (1993) reported that genetic susceptibility
could be an additional factor, which can influence the course of infection.
Cholangiohepatitis
Cholangiohepatitis causes severe economic losses due to high liver condemnation rate on the
processing and downgraded of the slaughtered carcasses. Clostridium perfringens is usually isolated in
association with the disease. The hepatitis characterized by an enlarged firm liver sometimes with a
slightly knobby surface and a medium tan colour. Histopathological lesions consist of hyperplasia of
the bile duct, fibrinoid necrosis, cholangitis and occasionally focal granulomatous inflammation
(Onderka et al., 1990; Løvland and Kaldhusdal, 1999; Sasaki et al., 2000).
Gizzard erosions
Gizzard erosions has been observed in commercial broiler chickens and several non-infectious
factors such as mycotoxin-contaminated feed, vitamin B6 and E deficiency, inadequate levels of
sulphur-containing dietary amino acids, high levels of dietary copper, pelleted feed as well as inclusion
of certain fish meals in the diets and were discriminated as possible cause. Ono et al. (2003) reported
on Outbreaks of adenoviral gizzard erosion in slaughtered broiler chickens in Japan and Novoa-
Garrido et al. (2006) found a significant association between gizzard lesions and increased caecal C.
perfringens counts in broiler chickens.
Diagnosis
A presumptive diagnosis may be made from the case history, clinical signs, lesions and staining
fresh smears of upper part of the intestinal tract with Gram stain showing an abundant number of
clostridia organisms. This should be confirmed by the isolation of the causative agent. For isolation
several media are available such as sheep blood agar supplemented with neomycin or tryptose-sulfite-
cycloserine agar (TSC). The identification can be carried out using biochemical tests. In addition, PCR
was developed to detect of alpha toxin (Heikinheimo and Korkeala, 2005) as well as a real-time PCR
for quantitative detection of C. perfringens in gastrointestinal tract of poultry (Wise and Siragusa,
2005). Also ELISAs for direct detection of C. perfringens major toxins and enterotoxin are
commercially available.
Treatment
Treatment with antibiotics such as penicillin, amoxicillin, ampicillin, erythromycin,
dihydrostreptomycin and tetracyclin provided a satisfactory clinical response. Penicillin’s are
known to be particularly active against C. perfringens. Resistance to penicillin is very rare and β-
lactamase has not been demonstrated. Three days is the minimum duration of treatment, however
longer applications may be required. Recently, Gad et al. (2011b) were determined the minimum
inhibitory concentrations of 16 antibiotics for 100 Clostridium perfringens isolates collected between
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
57
2008 and 2009 from commercial turkey flocks using a commercially available broth micro- dilution
test kit. No isolates were resistant against β- lactam antibiotics (amoxicillin, oxacillin, and penicillin),
lincospectin, tylosin, doxycyclin, tetracycline, enrofloxacin, trimethoprim/sulfamethoxazole,
lincomycin, and tilmicosin. A low frequency of resistance was detected against erythromycin and
tiamulin with 5 and 20%, respectively. Spectinomycin, neomycin and colistin showed the highest
incidence of resistance with 74, 94 and 100%, respectively. Similar results were also obtained by
testing from strain collect from layery flocks. No isolates were resistant against β-lactam antibiotics
(amoxicillin, oxacillin, and penicillin), lincospectin, tylosin, doxycyclin, tetracycline, enrofloxacin,
trimethoprim/ sulfamethoxazole, lincomycin, and tilmicosin. A low frequency of resistance was
detected against erythromycin and tiamulin with 17.4% and 19.6% respectively. However, most of the
isolated (67.4%) were partially sensitive to erythromycin. Spectinomycin, neomycin, and colistin
showed the highest incidence of resistance with 87.0%, 93.5%, and 100% respectively (Gad et al.,
2012)
According to Brennan et al. (2000) administration of dietary Tylan® for seven consecutive days
following confirmation of an NE field outbreak reduced the NE mortality and lesion score and
improved overall growth as well as feed conversion in broilers. The optimum dose of Tylan to
control NE was 100 ppm. No resistance to the ionophorous anticoccidial drugs such as Narasin has
been found (Martel et al., 2004). Brennan et al. (2001) reported that Narasin, when administrated at
70 ppm in feed from Day 0 to 41 prevents morbidity, mortality and suppression of growth and feed
conversion associated with NE in broilers.
Vaccination
Active and passive immunity using vaccination against C. perfringens and its toxins appears to
offer protection. Heier et al. (2001) found out that broiler flocks with high titres of maternal
antibodies against C. perfringens alpha-toxin had lower mortality during the production period than
flocks with low tiers. Also Løvland et al. (2004) use toxoids vaccines based on C. perfringens type A
and C toxoids to vaccinate breeder flocks. The IgG responses in vaccinated parent hens were distinct
and the levels of antibodies to C. perfringens alpha - toxin in progeny of the vaccinated hens was high
enough to protect the progeny against subclinical C. perfringens associated necrotic enteritis. On the
other hand several recent investigations showed that immunity to NE after oral infection using
virulent strain and subsequent treatment is much better than using avirulent C. perfringens strains
and they identified immunogenic secreted proteins apparently uniquely produced by virulent C.
perfringens isolates and concluded that there are certain secreted proteins beside to alpha-toxin, that
are involved in immunity to NE in broiler chickens (Thompson et al., 2006; Kulkarni et al., 2007).
Further additional study showed the ability of oral immunisation against C. perfringens in broiler
chickens using an attenuated Salmonella vaccine vector (Kulkarni et al., 2008).
Alternatives to AGPs
There are several approaches to overcome the detrimental effects on poultry performance after
a withdrawal of antimicrobial grpwth promotors. Investigations indicate that competitive exclusion,
prebiotics, probiotics, enzymes and acids can impact the incidence and severity of NE in poultry. The
data suggest that these products may provide the poultry industry with an alternative management
tool that has the potential to promote better intestinal health and decrease monetary losses due to
C. perfringens (McReynolds et al., 2009). At this moment it is difficult to evaluate novel strategies
developed to antibiotic-free feeding concepts. Combination of different approaches is necessary to
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
58
enhance the performance and reduced health status of the birds. The practical relevance of these
approaches may vary between the different areas in the world. Currently, a wide range of novel feed
additives are commercially available. The suggested modes of action are summarized in Table 2 as
described by (Langhout et al., 2003).
Table 2: Different groups of non-antibiotic feed additive and their suggested mode of action
Additive Possible mode of action
Probiotics Introduction of desirable bacteria into the gastrointestinal tract
Prebiotics Promotion of the growth of desirable bacteria in the gastrointestinal
tract
Enzymes Elimination of the anti-microbial effects of carbohydrates
Immune stimulating
products
Reducing sub-clinical infections via an improved development of the
immune system
Acids Inhibition of the growth of bacteria
Essential oils Inhibition of the growth of bacteria, improving the development of
the immune system, improving the palatability of the diet
On the other hand (Thiery, 2005) tried many alternatives to growth promoters in turkey feed. Most
of results of the additives he tried were very disappointing. They sometimes show a slight effect at
one period, but no effect at the end of the rearing period, sometimes even showing a negative effect
(Table 3).
Table 3: Experience with different groups of non-antibiotic feed additive in meat Turkey
Prebiotics One result with MOS at 3rd weeks of age on the feed conversion rate, but
nothing after
Probiotic Sometimes a slight effect on FCR at one point.
Once an interesting result on the decreasing of the
E. coli population in the gut.
Essential oils and spices Slight or no effect for a competitive cost.
Nevertheless, the association of some plant extracts with other selected
additives may improve the droppings quality as well as FCR.
Acidifiers Nothing at all (single or blended, encapsulated or not…)
Clays Improve the quality of the pellets
Conclusions
Implementation of several approaches such as improvement of management, feed formulation
and use of alternative products to modulate the intestinal flora led to an improvement of the
situation. Limiting exposure to infectious agents through biosecurity, vaccination, supportive therapy,
cleaning and disinfection are essential. In addition, early recognition in managing the enteric disorders
is very important. Finally, use of an effective anticoccidial drug in the ration is helpful to minimise the
effect of enteritis. Since, recent investigations showed that the use of some alternative products might
be able to reduce the intestinal colonization with pathogenic bacterial agents. This could be an
additional tool to reduce enteric disorders in future.
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
59
References
Abildgaard L, TE Sondergaard, RM Engberg, A Schramm, O Højberg, 2010. In vitro production of
necrotic enteritis toxin B, NetB, by netB-positive and netB-negative Clostridium perfringens
originating from healthy and diseased broiler chickens. Vet Microbiol, 144: 231-235.
Brennan JJ, G Moore, S Poe, G Vessie, J Wilson et al., 2000. Efficacy of dietary tylosin phosphate
(Tylan) for control of necrotic enteritis in broiler chickens. 89th Meeting Poultry Science Assoc,
Montreal, Canada (Abs.).
Brennan JJ, R Bagg, DA Barnum, J Wislon and P Dick, 2001. Efficacy of Narasin in the prevention of
necrotic enteritis in broiler chicks. Avian Dis, 45: 210-214.
Bryant AE and LS Stevens, 1997. The Pathogenesis of Gas Gangrene. Academic Press, San Diego,
USA, pp: 186-187.
Craven SE, NA Cox, JS Bailey and DE Cosby, 2003. Incidence and tracking of Clostridium perfringens
through an integrated broiler chicken operation. Avian Dis, 47: 707-711.
Crespo R, DJ Fisher, HL Shivaprasad, ME Fernandez-Miyakawa and FA Uzal, 2007. Toxinotypes of
Clostridium perfringens isolated from sick and healthy avian species J Vet Diag Invest, 19: 329-
333.
Engström BE, C Fermer, A Lindberg, E Saarinen, V Båverud et al., 2003. Molecular typing of isolates of
Clostridium perfringens from healthy and diseased poultry. Vet Microbiol, 94: 225-235.
Gad W, R Hauck, M Krüger and HM Hafez, 2011a. Prevalence of Clostridium perfringens in
commercial turkey and layer flocks. Archiv für Geflügelkunde, 75: 74-79.
Gad W, R Hauck, M Krüger and HM Hafez, 2011b. Determination of antibiotic sensitivities of
Clostridium perfringens isolates from commercial turkeys in Germany in vitro. Archiv für
Geflügelkunde, 75: 80-83.
Gad W, R Hauck, M Krüger and HM Hafez 2012. In vitro determination of antibiotic sensitivities
of Clostridium perfringens isolates from layer flocks in Germany Arch. Geflügelk., 76: 234-238.
Gholamiandehkordi A, R Ducatelle, M Heyndrickx, F Haesebrouck and F Van Immerseel, 2006.
Molecular and phenotypical characterization of Clostridium perfringens isolates from poultry
flocks with different disease status. Vet Microbiol, 113:143-152.
Hafez HM, 2011. Enteric diseases of poultry with special attention to Clostridium perfringens. Pak
Vet J, 31: 175-184.
Heier BT, A Løvland, KB Soleim, M Kaldhusdal and J Jarp, 2001. A field study of naturally occurring
specific antibodies against Clostridium perfringens alpha toxin in Norwegian broiler flocks. Avian
Dis, 45: 724-732.
Heikinheimo A and H Korkeala, 2005. Multiplex PCR assay for toxinotyping Clostridium
perfringens isolates obtained from Finnish broiler chickens. Letters Appl Microb, 40: 407-411.
Kaldhusdal M and E Skjerve, 1996. Association between cereal contents in the diet and incidence of
necrotic enteritis in broiler chickens in Norway. Prev Vet Med, 28: 1-16.
Keyburn AL, JD Boyce, P Vaz, TL Bannam, ME Ford et al., 2008. NetB, a new toxin that is associated
with avian necrotic enteritis caused by Clostridium perfringens. PLoS Pathog 4: e26. doi: 10.1371
/journal. ppat.0040026.
Kocher A, 2003. Nutritional manipulation of necrotic enteritis outbreak in broilers. Recent Adv
Anim Nutr (Australia), 14: 111-116.
Köhler B, S Kölbach and J Meine,1974. Untersuchungen zur nekrotischen Enteritis der Hühner. 2.
Mitteilung: Mikrobiologische Aspekte. Monatsh für Veterinärmedizin, 29: 385-391.
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
60
Kulkarni RR, VR Parreira, S Sharif and JF Prescott, 2007. Immunization of Broiler Chickens against
Clostridium perfringens -Induced Necrotic Enteritis. Can Vet J, 14: 1070-1077.
Kulkarni RR, VR Parreira, S Sharif and JF Prescott, 2008.Oral immunization of broiler chickens against
necrotic enteritis with an attenuated Salmonella vaccine vector expressing Clostridium
perfringens antigens. Vaccine, 26: 4194-4203.
Langhout P and P Wijtten, 2003. The use of antimicrobial, enzymes, prebiotics, probiotics, essential
oils and organic acids in broilers; a review. In: Latin American Poultry Congress, 18., 2003, Santa
Cruz de La Sierra, 2003. Proceedings. Santa Cruz de La Sierra: XVIII Congresso Latino
Americano de Avicultura. CD-Rom. anghout P, 2007. Broilers nutrition optimisation. Afma
Matrix, 16: 33-37.
Løvland A and M Kaldhusdal, 1999. Liver lesions seen at slaughter as an indicator of necrotic enteritis
in broiler flocks. FEMS Microbiol Med Microbiol, 24: 345-351.
Løvland A, M Kaldhusdal, K Redhead, E Skjerve and A Lillehaug, 2004. Maternal vaccination against
subclinical necrotic enteritis in broilers. Avian Path, 33: 81-90.
Martel A, LA Devriese, K Cauwerts, K De Gussem, A Decostere et al., 2004. Susceptibility of
Clostridium perfringens strains from broiler chickens to antibiotics and anticoccidials. Avian Path,
33: 3-7.
Martin TG and JA Smyth, 2009: Prevalence of netB among some clinical isolates of Clostridium
perfringens from animals in the United States. Vet Microbiol, 136: 202-205.
Martin TG, 2010. The importance of the strain of Clostridium perfringens in the development of
necrotic enteritis of poultry. Dissertations Collection for University of Connecticut. Paper
AAI3402008. http://digitalcommons.uconn.edu/dissertations/AAI34 02008. Accessed on January
1, 2010.
McClane BA, FA Uzal, MEF Miyakawa, D Lyerly and T Wilkins, 2006. The Enterotoxic Clostridia. In:
The Prokaryotes: A handbook on the biology of bacteria. Dworkin M and Falkow S eds. Springer,
pp: 763- 778.
McReynolds J, C Waneck, J Byrd, K Genovese, S Duke et al., 2009. Efficacy of multistrain direct-fed
microbial and phytogenetic products in reducing necrotic enteritis in commercial broilers. Poult
Sci, 88: 2075-2080.
Novoa-Garrido M, S Larsen and M Kaldhusdal, 2006. Association between gizzard lesions and
increased caecal Clostridium perfringens counts in broiler chickens. Avian Path, 35: 367-372.
Onderka DK, CC Langevin and JA Hanson, 1990. Fibrosing cholehepatitis in broiler chickens
induced by bile duct ligations or inoculation of Clostridium perfringens. Can J Vet Res, 54: 285-
290.
Ono M, Y Okuda, S Yazawa, I Shibata, S Sato et al., 2003. Outbreaks of adenoviral gizzard erosion in
slaughtered broiler chickens in Japan. Vet Rec, 153: 775-779.
Opengart K, 2008. Necrotic enteritis. In: Diseases of Poultry.12th Ed, Saif YM, Fadly AM, Glisson JR,
McDougald LR, Nolan LK and Swayne DE, Eds. Iowa State University Press. Iowa, USA, pp:
872- 879.
Sasaki J, M Goryo and K Okada, 2000. Cholangiohepatitis in chickens induced by bile duct ligations
and inoculation of Clostridium perfringens. Avian Path, 29: 405-410.
Siegel PB, AS Larsen, CT Larsen and EA Dunnington, 1993. Resistance of chickens to an outbreak of
necrotic enteritis as influenced by major histocompatibility genotype and background genome.
Poult Sci, 72: 1189-1191.
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
61
Thompson DR, VR Parreira, RR Kulkarni and JF Prescott, 2006. Live attenuated vaccine-based
control of necrotic enteritis of broiler chickens. Vet Microbiol, 113: 25–34.
Thiery P, 2005. How to deal with the removal of the antibiotic growth promoters (AGP) in Turkeys,
consequences for the producer- The French experience. In: Turkey production: prospects on
future developments (Ed. Hafez, H.M). Mensch & Buch Verlag, Berlin-Germany. ISBN: 3-89820-
993-8. pp: 63-69.
Van Immerseel F, J De Buck, F Pasmans, G Huyghebaert, F Haesebrouck et al., 2004. Clostridium
perfringens in poultry: an emerging threat for animal and public health. Avian Path, 33: 537-549.
Williams RB, 2005. Intercurrent coccidiosis and necrotic enteritis of chickens: rational, integrated
disease management by maintenance of gut integrity. Avian Path, 34: 159-180.
Willis AT, 1977. Anaerobic-bacteriology: clinical and laboratory practice. (3 ED) pp: 360.
Butterworths, London,
Thompson DR, VR Parreira, RR Kulkarni and JF Prescott, 2006. Live attenuated vaccine-based
control of necrotic enteritis of broiler chickens. Vet Microbiol, 113: 25–34.
Timbermont l, A Lanckriet, AR Gholamiandehkordi, F Pasmans, A Martel et al., 2009. Origin of
Clostridium perfringens isolates determines the ability to induce necrotic enteritis in broilers.
Comp Immunol Microbiol Infect Dis, 32: 503–512
Wise MG and GR Siragusa, 2005. Quantitative Detection of Clostridium perfringens in the Broiler
Fowl Gastrointestinal Tract by Real-Time PCR. Appl Environ Microbiol, 71: 3911-3916.
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
62
HA AND NA GENE SEQUENCE ANALYSIS OF 13 H9N2 SUBTYPE AVIAN
INFLUENZA VIRUSES ISOLATED IN SHANDONG, CHINA
Guanggang Qu1,4, Zhiqiang Shen1*, Wu Ai2, Bing Huang2, Changjiang Wang3, Yuexing Wu3, Maofeng
Li3, Jishan Liu1, Jinlong Chen3 and Feng Wei1,4
1Binzhou Animal Science and Veterinary Medicine Academy of Shandong Province, Binzhou 256600,
PR China; 2Institute of poultry, Shandong Academy of Agricultural Sciences, Jinnan 250023, PR China; 3Shandong Lvdu Bio-Technology Co., Ltd, Binzhou 256600, PR China; 4Shandong Binzhou
Research,Development and Promotion Center for Livestock and Poultry Propolis VaccineS,
Binzhou 256600, PR China
*Corresponding Author: bzshenzq@163.com
ABSTRACT
In order to understand the genetic variation and epidemic regularity of avian influenza virus
subtype H9N2 in Shandong Province, this research collected 13 strains of H9N2 subtype isolated
from different chicken farms in Shandong. HA and NA gene sequence of H9N2 virus amplification
was operated by RT-PCR to determine sequence. Homology analysis and genetic evolution analysis
were applied to analyze the HA and NA gene complete sequences of avian influenza viruses. Results
showed that 12 of the isolates HA genes belonged to S2-like, which is a classical prevalent strain in
Shandong. The homology of nucleotide sequences (amino acid sequences) between the isolates and
CK /SD /S2/2005 is 92.0%-96.3% (93.9%-97.7%). However, the relationship of the isolates and the
BJ94 strain which is the primary strain isolated in China is far, implying the evolution of HA gene of
AIV. While the homology of NA gene of SD 02 isolate is far from that of other 12 isolates and the
reference strains.
Key Words: Avian influenza virus, H9N2 subtype, HA gene, NA gene, genetic evolution analysis
INTRODUCTION
Avian influenza is a highly viral contagious disease caused by type A orthomyxovirus, which has
multiple serum subtypes with frequent genetic variation. According to the surface glycoproteins:
hemagglutinin (HA) and neuraminidase (NA), these viruses are divided into subtypes (Guan et al.,
1996). At present, 17 HA (H1-H17) and 10 NA (N1-N10)subtypes have been recognized (Zhang
et al., 2013). All subtypes were identified initially from avian species, except for the H17N10 subtype,
which was isolated from bats (Tong et al., 2012). Based on the difference in pathogenicity and
virulence, avian influenza viruses can be divided into two distinct groups (Capua and Alexander,
2014), which are highly pathogenic avian influenza viruses (HPAIV) and low pathogenic avian influenza
viruses (LPAIV). The HPAIV with high fatality rate resulted in serious economic losses in the poultry
industry. However, the harmful effect caused by LPAIV cannot be overlooked. Among the LPAIV, the
H9N2 subtype has been most studied because of its pandemic potential and its successful
transmission to humans (Seifi et al., 2010). In 1966, the H9N2 subtype avian influenza virus was
isolated initially from turkey population in America and it was mainly found in aquatic birds and wild
ducks of North America then in China, H9N2 AIV was firstly isolated from chickens population in
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
63
1994 (Chen et al., 1994; Li et al., 2003; Liu et al., 2003a,2003d), and since then this subtype of avian
influenza virus has been widely spread in China's major poultry breeding areas. Infection of H9N2
often results in respiratory symptoms, decrease of egg laying rate, immunosuppression and leading to
infection by other pathogens, despite its low pathogenic characteristic, which caused tremendous
economic loss to Chinese poultry industry (Chen et al., 2012). Furthermore, it may lead to potential
crises of anthropozoonosis because of the fact that H9N2 virus contains internal genes needed for
the human transmission of the H5N1 subtype (Guo et al., 2000).
The complete genome of the H9N2 virus is composed of eight antisense single-stranded RNA
fragments encoding at least 11 kinds of protein, of which hemagglutinin (HA) and neuraminidase (NA)
are two important elements of the surface of the virus. HA gene and NA gene are two most frequent
mutations in the genome of avian influenza viruses, which are closely related to the virulence and
transmission of the virus. HA, the main surface antigen and protective antigen of influenza virus, plays
a key role in virus adsorption and membrane-spanning process, and it can stimulate the body to
produce antibodies. The amino acid sequence of HA cleavage site and potential glycosylation sites are
the key factors to determine the pathogenicity and virulence of avian influenza viruses. As one of the
major glycoproteins on the surface of the avian influenza virus, NA plays an important part in the
diffusing of the virus which can avoid accumulation of the virus when budding with the function of
cracking the connection between hemagglutinin and cell surface sialic acid, on the other hand, NA has
the effect on the cutting ability of HA gene, resulting in the different pathogenicity of different avian
influenza subtypes to some extent.
In this study, the HA and NA genes of 13 H9N2 AIV strains isolated from chickens from
Shandong provinces in 2015 were analyzed with other publicly available sequences of H9N2 virus , to
predict the trend of H9N2 virus evolution in Shandong provinces in China.
MATERIALS AND METHODS
Sample collection: The H9N2 viruses used in this study were isolated from the lung samples of
sick chickens from Chicken Farms in Shandong Province in 2005. All lung samples were stored at
−80ºC until used for molecular diagnosis and virus isolation.
Virus detection: The frozen lung samples were homogenized with cold phosphate-buffered saline
(PBS) (pH 7.2) and then centrifuged at 12000 rpm, 4ºC for 15 min to remove the solid debris. The
homogenates was collected for viral RNA extraction by using a QIAamp Viral RNA Mini Kit (Qiagen
Inc., Valencia, CA, USA) in accordance with the manufacturer’s instructions. Total RNA was eluted
from the column in a final volume of 60 μl and stored at −80ºC. RT-PCR detection was performed by
using PrimeScript™ One Step RT-PCR Kit (TAKARA, Dalian, China) with the specific primers (Table
1) directed to the matrix (M) gene.
Virus isolation: 100 μl the homogenates positive by RT-PCR containing 1000 U/ml of penicillin and
1000 μg/ml of streptomycin were inoculated into the allantoic cavity of 9-11days old specific-
pathogenic-free (SPF) chicken eggs and the eggs were incubated for 48–72 h at 37ºC and harvested
according to the standard protocols described in the WHO Manual on Animal Influenza Diagnosis
and Surveillance (Webster et al., 2005). The hemagglutination assay was performed following a
previously described method (Reed and Muench, 1938; Webster et al., 2005).
Primer design and sequence determination: According to the HA and NA gene sequences of
AIV were downloaded from GenBank, to find relatively conservative region, the upstream and
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
64
downstream primers were designed by Primer 5.0. And the primers were synthesized by Shanghai
Generay Biotech Co., Ltd. The upstream primer of HA gene: F: 5’-ACTCAAGATGG
AAGCACTATCAC-3’.The downstream primer of HA gene: R: 5’-GGTGTTTTT
GCCAATTATATACA-3’.The upstream primer of NA gene: F: 5’-AGCRAAAG
CAGGAGTAAAAATGAAT-3’.The downstream primer of NA gene: R: 5’-AGTAGA
AACAAGGAGTTTTTTCTAAAA-3’.
Sequence analysis: Virus RNA was extracted according to the QIAamp Viral RNA Mini Kit (Qiagen
Inc., Valencia, CA, USA) guidelines. Reverse transcription followed by PCR was conducted using the
specific primers for HA and NA following the M-MLV reverse transcription manual (New England
Biolabs, Inc, Ipswich, MA, USA). The PCR was performed in a volume of 25 μL, with the reaction
mixture containing buffer mixture 12.5 μL, primer mixture (10 μM) 2 μL, template cDNA 3 μL,
DiH2O.7.5 μL and conducted as follows: 94 ℃ for 5 min followed by 35 cycles at 94 C for 45 s, 50ºC
for 45 s, 72ºC for 2 min with a final extension of 72ºC for 10 min.The product was purified using a
PCR purification kit (Promega, Madison, WI, USA) and ligated into the PMD18-T vector (TAKARA).
The recombinant plasmid was extracted from the by the Wizard_ Plus SV Minipreps
(Promega, Madison, WI, USA) and sequenced by Shanghai Sangon Biotech Co.,Ltd. The sequencing
results were submitted to NCBI to BLAST with sequences in GenBank, and Phylogenetic analyses
were performed with other influenza virus sequence data available in GenBank using software
Lasergene 7.0 (DNAStar).
RESULTS
Identification and Isolation of H9N2: To identify the virus using RT-PCR, the results showed 13
samples were H9N2 subtype positive. In order to isolate the viruses, 9~11 days old SPF chicken
embryos were inoculated with the extraction of pathologic specimen and the allantoic fluid was
harvested at 72h. RT-PCR test results showed that these isolates were H9N2 subtypes. The HA test
was done for the 13 ofs strains virus (Table 1).
Table 1: H9N2 influenza viruses sequenced in the present study
Strains Genotype Amio acids of RBS in HA gene Cleavage site HA
titer 183 190 226 228
SD 01 S I G R PARSSR GL 10
SD 02 N I G R PSRSSR GL 9
SD 03 N I G R PSRSSR GL 8
SD 04 N I G R PSRSSR GL 10
SD 05 N I G R PSRSSR GL 9
SD 06 N I G R PSRSSR GL 9
SD 07 N I G R PSRSSR GL 6
SD 08 N I G R PSRSSR GL 8
SD 09 N I G R PSRSSR GL 11
SD 10 N I G R PSRSSR GL 8
SD 11 N I G R PSRSSR GL 11
SD 12 N I G R PSRSSR GL 9
SD 13 N I G R PSRSSR GL 11
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
65
Genetic evolution analysis: By RT-PCR assay, HA and NA genes with a length of 1.7 kb and 1.4
kb separately from 13 isolates, were amplified and the size of the specific segments were consistent
with the expected results (Fig.1). Homology comparison were operated for HA and NA genes of the
13 isolates and reference H9N2 subtypes downloaded from GenBank to draw phylogenetic trees,
respectively.
Fig. 1: RT-PCR amplification of HA and NA genes
The phylogenetic tree of HA gene segments showed that SD 01 isolate belonged to BJ94-like
strain; and the other 12 viruses belonged to the S2-like sub lineage, implying that this kind of
genotype may be the dominant H9N2 strain in Shandong Province. The phylogenetic tree of NA
genes showed that all of the NA genes of the isolates belonged to Y280-like subgroup except for the
one of SD 02 which keep aboriginal and was far from other isolates and reference strains in
relationship. Unanimously, the NA protein sequences of 12 H9N2 isolates had a deletion of 3 amino
acids in 62-65th site except that of SD 02.
HA genes sequence and nucleotide (amino acids) homology analysis: The HA genes of 13
H9N2 isolates were sequenced. Results showed that 12 of them had an open reading frame (ORF)
with length of 1683 bp, encoding 560 amino acids and the rest one had an ORF with length of 1680
bp, encoding 559 amino acids. The homologies comparison result of HA suggested that 12 of the
isolates except for SD 01 strain shared higher homology with reference strains isolated in 2011-2013
than these isolated in the early years, while SD01 strain was highly identical to the vaccine strain SD-6
isolated in 1996. The H9N2 viruses we isolated in 2015 shared nucleotide (amino acid) homologies
of 92.5-100% (94.1-100%), but only homologies of 89.3%-91.6% (90.2%-93.2%) with the vaccine strain
SD-6.
1.7k bp 1.4k bp
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
66
Fig. 2: The phylogenetic tree of HA genes
Amino acid sequence analysis of HA cleavage site and receptor binding site: To investigate
the molecular characteristics of H9N2 influenza viruses in Shandong province, the deduced amino
acid sequences of the HA protein of isolated strains were aligned. The analysis of key amino acid
residues of HA showed that the amino acid sequence near the cleavage site was PSRSSR/G and
contains an A to S substitution at 334th amino acid residues (Table 1), compared to the315- PARSSR/G-
321 motif of most early BJ/94-like viruses. It was proved that the leucine residue at position 226 in
HA is related to the specificity of human virus-like receptor, while our sequence showed the position
226 were G not L among the 13 isolates. Deficiency of basic amino acids in the cleavage site sequence
implied that these isolates were low pathogenic avian influenza viruses.
In HA sequence of avian influenza (Fig. 2), the X which is consistent with the sequence of NXT/S,
is considered to be a potential glycosylation site that can affect the binding ability of HA receptor and
virulence of the virus. The SD 02 strain shares 8 potential glycosylation sites which has a quantity
advantage than other isolates (Table 2).
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
67
Table 2: Potential glycosylation site of HA
Viruses Potential glycosylation site
29 141 145 218 298 305 313 492
NST NVS NGT NRT NTT NVS NCS NGT
SD 01 + + + - + + - +
SD 02 + + + + + + + +
SD 03 + + - + + + + +
SD 04 + + - - + + + +
SD 05 + + - + + + + +
SD 06 + + - + + + + +
SD 07 + + - - + + + +
SD 08 + + - - + + - +
SD 09 + + - + + + + +
SD 10 + + - - + + + +
SD 11 + + - + + + + +
SD 12 + + - - + + + +
SD 13 + + - + + + + +
Amino acid deficiency analysis of NA: Amino acid deficiency is very common in the H9N2
subtypes, and only part of the H9N2 strains encodes a complete NA amino acid sequence (Fig. 3). All
of the NA amino acid sequence of H9N2 isolates except SD 02 has a lack of 3 amino acids in 63-65th
site.
DISCUSSION
H9N2 subtype virus has been an important one that is influencing the poultry industry since it
was first identified in China in 1994 and it exist in chickens, ducks and a variety of other birds. In
addition, the fact that more and more of the H9N2 strains with receptor binding capacity can infect
people implies that we should pay close attention to the genetic evolutionary characteristics and
molecular epidemiology of this subtype of avian flu virus.
In the present study, we isolated and identified 13 H9N2 subtypes of avian influenza, and analyzed
the genetic evolution of the HA and NA genes of these viruses with the available sequence data
downloaded from NCBI. Based on the epidemic region of the H9N2 subtype AIV, it is divided into
Eurasian pedigree and the American pedigree. The Eurasian lineage is prevalent in Eurasia, especially
in East Asia and Southeast Asia, and the American pedigrees are mainly in the North America. Most
of China’s epidemic H9N2 strains belong to Eurasian lineages except for Y439 occurred in Hong
Kong and CK HL35 (DQ064366) are American pedigree. There’s no American pedigree H9N2
subtypes found in Shandong Province.
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
68
Fig. 3: The phylogenetic tree of NA genes
The result of phylogenetic analysis of HA and NA genes of H9N2 strains showed that the HA
cleavage site sequence of the 13 isolated strains was PSRSSR/GL despite of an A to S substitution.
According to the characteristics of HA cleavage site of the virus, all of the 13 H9N2 isolates belonged
to the low virulence strains with no consecutive basic amino acids sequences (Liu et al., 2003). It is
generally believed that the 191st amino acid of HA receptor binding site is the most conservative one
and the amino acid of 13 H9N2 isolates in this site was Amine (N) in our study. The amino acid of
234 site usually changes first when the H9N2 subtype to adjust to a new host (Matrosovich et al.,
2000). The amino acid of 12 strains of the isolates in our study was leucine (L) in that site, coinciding
with the H9N2 subtype of Hong Kong human resource, except for SD 01 strain with glutamine (Q) in
that site.
Guo et al. (2002) believe that the deficiency of 3 amino acids in the 63-65th site of NA amino acid
sequence is a useful genetic marker (Guo et al., 2002), and Liu think that it’s a mark of Chinese H9N2
subgroup. The 12 H9N2 strains have this deficiency in our study except SD 02 isolates. Whether this
deficiency of amino acids has an effect on the virulence of H9N2 still needs to be studied.
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
69
REFERENCES
Capua I and DJ Alexander, 2004. Avian influenza: recent developments. Avian Pathol, 33: 393-404.
Chen F, ZQ Yan, J Liu, et al., 2012. Phylogenetic analysis of hemagglutinin genes of 40 H9N2 subtype
avian influenza viruses isolated from poultry in China from 2010 to 2011. Virus genes, 45: 69-75.
Guan Y, KF Shortridge, S Krauss et al., 1999. Molecular characterization of H9N2 influenza viruses:
were they the donors of the “internal” genes of H5N1 viruses in Hong Kong?. Proceedings of the
National Academy of Sciences, 96: 9363-9367.
Guo XF, M Liao, CA Xin, 2002. Cloning and sequencing of HA and NA gene of A/ Chicken/ Guangxi/
99(H9N2). J Anim Husb Vet Med, 33: 486-491.
Guo YJ, S Krauss, DA Senne et al. 2000. Characterization of the pathogenicity of members of the
newly established H9N2 influenza virus lineages in Asia. Virology, 267: 279-288.
Liu H, X Liu, J Cheng et al. 2003. Phylogenetic analysis of the hemagglutinin genes of twenty-six avian
influenza viruses of subtype H9N2 isolated from chickens in China during 1996-2001. Avian Dis,
47: 116-127.
Matrosovich M, A Tuzikov, N Bovin et al., 2000. Early alterations of the receptor-binding properties
of H1, H2, and H3 avian influenza virus hemagglutinins after their introduction into mammals. J
Virol, 74: 8502-8512.
Seifi S, K Asasi, A Mohammadi, 2010. Natural co-infection caused by avian influenza H9 subtype and
infectious bronchitis viruses in broiler chicken farms. Vet Arhiv, 80: 269-281.
Tong S, Y Li, P Rivailler et al., 2012. A distinct lineage of influenza A virus from bats. Proceedings of
the National Academy of Sciences, 109: 4269-4274.
Zhang Q, J Shi, G Deng et al., 2013. H7N9 influenza viruses are transmissible in ferrets by respiratory
droplet. Science, 341: 410-414.
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
70
MYCOTOXICOSIS: A PERSISTENT THREAT TO POULTRY INDUSTRY
Muhammad Zargham Khan*, Sheraz Ahmed Bhatti, Aisha Khatoon,
Ahrar Khan and Muhammad Kashif Saleemi
Department of Pathology, University of Agriculture Faisalabad, Pakistan
*Corresponding author: mzargham2000@yahoo.com
ABSTRACT
Fungi are ubiquitously present in the agricultural products and by-products. Mycotoxins, the
secondary metabolites of toxigenic species of fungi are universally present in the agricultural
products. So far more than 400 mycotoxins have been identified. However, only few of these bear
significance from injurious effects in the animals and human consuming them. The most important
mycotoxins from the food animal and human diseases point of view include aflatoxins, ochratoxins,
DON, DAS, T-2, zerealenone etc. Animals fed on mycotoxin contaminated feeds not only may
suffer from injurious effects of these mycotoxins but also pass these metabolites into the animals food
products in a variety of dairy and agricultural products. Most of the mycotoxins grow in the field
conditions on the crops still standing in the fields. The concentration of these mycotoxins in cereals
and grains vary according to the climatic conditions. Still other mycotoxins are produced by the fungi
under storage conditions under optimal conditions of humidity and temperature. Such fungi are
known as storage fungi. Aflatoxins and ochratoxins are the most frequently know storage fungi. The
present presentation discusses the prevalence of different mycotoxins present in the feeds and foods
and their impact upon the animals and human health. Different strategies to alleviate the injurious
effects of mycotoxins will also be discussed.
Key Words: Mycotoxins, Agricultural products, Poultry Feed.
INTRODUCTION
The word “mycotoxin” originated from the combination of a Latin word “toxicum” and Greek
word “mykes” meaning poison and fungus (Turner et al., 2010). The term ‘mycotoxin’ is usually used
for the secondary metabolites of the fungi that easily colonize agricultural crops and also during the
post-harvest stages (Richard, 2007). Contributing factors to the contamination of food and feed stuffs
with mycotoxins include moisture content, environmental temperature and the activity of insect
(Coulombe, 1993). Up until now, more than 400 mycotoxins with toxic potential have been identified
(Kabak et al., 2006), however, only a few of them have distinct toxic effects. They are usually
genotypically specific. A variety of fungal species can produce the same mycotoxin, for example,
ochratoxin is produced by Penicillium verrucosum in the temperate regions of the world while in
tropical regions of the world Aspergillus ochraceus is the principal ochratoxin producing specie (Kabak,
2009; Thrane, 1989).
Mycotoxins pose a potential threat to the health of humans and the domestic animals. These are
extremely variable in their physical and biological properties and toxic effects. A high concentration
of mycotoxins in feed and food can impose a health risk to animals and humans leading to economic
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
71
losses (Dinis et al., 2007). However, assessment of the adverse health effects have been complicated
by many factors, including the intake levels, toxin species, age of target animals, duration of exposure,
mechanisms of action and metabolism. In addition, there is a lack of research on the availability of
reliable and efficient methods for detection and quantitation of i) mycotoxins, ii) difference in animal
species sensitivity, iii) errors in sample collection. Inefficient analytical methods used and the co-
existence of a variety of mycotoxins and their interactions need attention of researchers (Whitlow &
Hagler Jr., 2002).
The toxic syndromes resulting from mycotoxin intake are known as mycotoxicoses (Richard et
al., 2003). The principal target organs in case of mycotoxicosis are liver, kidney, lungs, the endocrine,
nervous and the immune system (Abdulkadar et al., 2004). Ingestion of mycotoxin contaminated feed
in farm animals resulted in their residual presence in products like milk, meat, cheese and eggs leading
to exposure of customers to mycotoxins (Ramos and Hernandez, 1996).
Aflatoxins
Aspergillus flauvs and A. parasiticus are the two main species of fungi known to produce aflatoxins
(AF) as their secondary metabolites and to the lesser extent A. nomius is also aflatoxigenic (Frisvad,
2005; Richard, 2009). A large variety of feed and foodstuffs such as dried fruits, cereals, nuts and
spices have been found contaminated with AF (Diener et al., 1987). Out of 18 different types of
isolated aflatoxins, AFB1, AFB2, AFG1 and AFG2 are of great importance and common natural
contaminant of food and feedstuff (Battilani et al., 2008). In milking animals AFB1 and AFB2 are
converted into their toxic metabolites called aflatoxin M1 (AFM1) and M2 (AFM2), respectively.
Poultry birds are susceptible to AFB1 toxicity. Significant adverse health effects, including death
have been observed by feeding of AFB1 contaminated feed. Significant morphologic alterations were
observed in liver, which became enlarged, friable and lighter in color (Quezada et al., 2000). The
toxicity of AFB1 in broiler birds occurs in dose and time related manner. Most of the research work
conducted so far, indicated that severity of the toxicity enhanced with prolongation of duration of
feeding contaminated diet and the level of contamination (Oliveira et al., 2002; Hussain et al., 2008;
Khan et al., 2014).Hussain et al. (2008) also reported decrease in body weight due to prolonged
duration of exposure to the AFB1 contaminated diet. The exposure of the broiler birds with 0.3
mg/kg of AFB1 resulted in decreased total serum protein levels (Raju and Devegowda, 2000).
Recently published epidemiological reports suggested a close relation between the AF
contaminated feed and incidence of Newcastle disease outbreak. In general, the lower doses of AFB1
may adversely affect the immune system of the bird whereas higher levels of contamination elicit a
negative effect on the performance parameters. The threshold dose of AFB1 to induce the negative
influence on cell mediated and humoral immune responses has been reported to be approximately
0.4 and 1.0 mg/ kg, respectively (Yunus et al., 2011). Therefore, chronic intake of contaminated feed
containing the lower concentration of aflatoxins might pose a severe risk to animal health, increasing
susceptibility to infections or reducing vaccination efficacy.
Ochratoxins
Ochratoxin (OT) was discovered in 1965 as a toxic secondary metabolite of Aspergillus ochraceus.
However, its toxic potential was realized after isolation from sorghum seed strain K-804 in South
Africa (Scott, 1965). It was first reported by Shotwell et al. (1969) as a natural contaminant of corn.
There are three members of this family known as OTA, OTB and OTC. Among these the most toxic
and commonly detected type in foodstuff is OTA (Atkins & Norman, 1998; Peraica et al., 1999). The
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
72
cereal commodities (wheat, maize, barley and oats) are the primary cause of ochratoxin
contamination of food and foodstuffs in addition to groundnuts, dried fruits and coffee beans, which
has been infected by the OT producing fungi like A. ochraceus, A. niger, A. carbonarius, P. verrucosum, P.
virridicatum etc. (Bennett & Klich, 2003).
The International Agency for Research on Cancer (IARC) categorized AF as a possible source of
human carcinogen and placed it into the category ‘group 2B’. The toxic effects resulting from the
exposure of OTA included nephrotoxicity, hepatotoxicity, immunosuppression and carcinogenic
effects on animals and humans (Anonymous, 1993). Different species exhibited different sensitivity
levels when exposed to acute OTA toxicity (O'Brien and Dietrich, 2005). Pigs are particularly
sensitive to OTA because of the long serum half-life and tissue accumulation. This was sustained by
high protein affinity and enterohepatic and renal recirculation. Poultry species eliminate OTA faster
than mammals, leading to a lower accumulation level. The OTA half-life in plasma of pigs was 20 to 30
times higher than that of poultry, thus resulted in higher incidence of ochratoxicosis in pigs (Duarte et
al., 2011).The toxicity of OTA in the poultry birds has been reported by several researchers. The
lethal dose of OTA (LD50) varies in different poultry species and depends on the age and route of
administration. LD50 value for broiler birds at first day of age was 2.14 mg/kg and at three weeks of
age, it was 3.6 mg/kg body weight (Peckham et al., 1971). Following chronic exposure to lower levels
of OTA, the kidneys were primarily affected, causing mycotoxic nephropathy in pigs and chickens
(Stoev et al., 2012). Several pathological changes could be observed, varying from desquamation and
focal degeneration of tubular epithelium cells to peritubular fibrosis and thickening of the basal
membrane (O'Brien and Dietrich, 2005). This lead to renal insufficiency, but not to tumor promotion
in poultry and mammals. In addition, OTA was hepatotoxic, teratogenic and immunotoxic (Duarte et
al., 2011).
STRATEGIES TO COMBAT MYCOTOXINS INDUCED INJURIOUS EFFECTS
A survey conducted by FAO in 2001, specified that almost 25% of world annual crops are
contaminated with mycotoxins (Anonymous, 2001). Keeping in view the contamination level and
deleterious effects of mycotoxins a number of strategies have been deployed to reduce the growth of
mycotoxigenic fungi, to detoxify contaminated feed and to lower the systemic availability once
mycotoxins are ingested by the animal.
Contamination of the crops with mycotoxins might occur in pre-harvest stage when the crops
are standing in the field or during storage and processing (postharvest stage). Approaches for
preventing mycotoxicosis in animals may therefore, be divided into pre-harvesting and post-harvesting
strategies. The mycotoxins control during pre-harvest stage is difficult and their contamination can
possibly be reduced by the development of the resistant crops by genetic modifications and breeding.
Specific mycotoxin contamination can be reduced significantly by the application of certain techniques,
although the complete elimination of mycotoxins is currently not achievable (Kabak et al., 2006). The
most important strategy to bear in mind for pre-harvesting is the application of good agricultural
practices. Appropriate good agricultural practices include controlling the insect’s infestation, crop
rotation, elimination of crop residues, irrigation, soil cultivation and proper use of chemicals.
Postharvest storage conditions are essential to prevent the growth of mold and consequently the
mycotoxins (Schrodter, 2004). The moisture contents during storage should be kept less than 15% to
avoid the development of hotspots with high moisture levels which favor the mold growth (Jard et al.,
2011). Before storage, visibly damaged or infected grains should be removed. This method is
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
73
however, not exhaustive or very specific (Jard et al., 2011) and multiple reduction strategies should be
combined.
Several chemical detoxification methods have also been described. Any method adopted for
detoxification must not affect the nutritive value of the commodity and also must not result in the
development of toxic products during the mycotoxin inactivation process. The wide varieties of
chemical decontamination processes include radiation, oxidation, reduction, ammonization,
alkalization, acidification and deamination (Kabak et al., 2006).
Many of the previously described methods for the detoxification of agricultural commodities have
restricted application due to the associated problems including incomplete detoxification and the
inapplicability in practice. An alternative approach was the inclusion of mycotoxin detoxifying agents
in the feed to decrease the bioavailability of toxins. This method presently has been the most
commonly used one (Jard et al., 2011; Kolosova and Stroka, 2011). These detoxifiers can be divided
into two classes, namely mycotoxin binders and mycotoxin modifiers. The two classes have different
modes of action. Mycotoxin binders adsorb toxin in the gut, resulting in the excretion of toxin-binder
complex in feces, whereas mycotoxin modifiers transform the toxin into non- toxic metabolites
(Anonymous, 2009).
Mycotoxin Binders
Mycotoxin binders (adsorbing or sequestering substances) are the compounds having large
molecular weight and are able to bind the mycotoxin during its passage through the digestive tract of
the animal. The complex formed between toxin and binder is eliminated from the body through feces,
thus preventing its absorption from gut into the circulation. Mycotoxin binders have been divided
mainly into silica based inorganic compounds and carbon based organic polymers (Anonymous, 2009).
Inorganic Binders
The ability of the inorganic binder to bind the mycotoxin depends on physical and chemical
properties of the both adsorbent and the mycotoxin. Physical properties of the adsorbent i.e. surface
area, charge distribution, total charge and pore size play a vital role during the binding process. The
properties of the mycotoxin such as polarity, charge distribution, shape and solubility are important
factors playing a significant role. Generally speaking, the binding capacity increased with surface area
and chemical affinities between both binder and mycotoxin (Avantaggiato et al., 2005; Huwig et al.,
2001; Kabak et al., 2006).
Bentonite Clay
Aluminosilicate minerals (clays) have been the most studied and the largest class of mycotoxin
binders used to alleviate the deleterious effects of mycotoxins through adsorption. There are two
different subclasses of aluminosilicates i.e. phyllosilicate and tectosilicate. Phyllosilicates include the
bentonite, montmorillonite, smectite, kaolinite and illites while tectosilicates include the zeolite
(Anonymous, 2009). The structure of montmorillonite consists of layers of octahedral and
tetrahedral aluminum and silicon, respectively, which are coordinated with oxygen atoms. Bentonite
is generally impure clay consisting mostly of montmorillonite. Zeolites possess a three dimensional
structure and contains tetrahedrons of SiO4 and AlO4. In these minerals, the replacement of the
tetravalent silicon with the trivalent aluminum lead to the deficit of positive charge, so the inorganic
cations like sodium, potassium and calcium balance this deficiency. In the hydrated sodium calcium
aluminosilicate (HSCAS) the naturally occurring sodium ions were replaced by the calcium ions and
protons (Huwig et al., 2001). HSCAS is a heat processed and purified montmorillonite clay. It was
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
74
developed by Phillips et al. (1988) and commercialized as NovaSil®. Clay products, including
bentonites, zeolites and HSCAS are the most common feed additives effective in binding polar
mycotoxins, such as aflatoxins (Kabak et al., 2006). However, OTA and fusarium mycotoxins, such as
fumonisins, zearalenone (ZON) and trichothecenes do not bound to these clays because of their
fairly non-polar properties (Avantaggiato et al., 2005; Kabak et al., 2006; Phillips et al., 2008). HSCAS
has a lamellar interlayer structure in which the planar AFB1 can be bound. The interaction is based on
the negative charge of the clay with the partly positive charged dicarbonyls of AFB1 (Phillips et al.,
2008).
Silicate binders such as bentonite have been found effective to ameliorate the toxic effects of
mycotoxins (Indresh et al., 2013). A significant increase in the feed intake, body weight and FCR was
observed when chicks were offered a feed added with 0.5% of sodium bentonite in the presence of
aflatoxin. A significant increase was observed in the relative weight of the liver, heart and gizzard 5.34,
0.72 and 2.05 percent, respectively. A 40% mortality was observed on feeding aflatoxin contaminated
feed which was reversed with the incorporation of 0.5% sodium bentonite (Pasha et al., 2007). Similar
results were also published by Eraslan et al. (2004) and Rosa et al. (2001). During an in-vitro study to
check the efficacy of sodium bentonite of Argentina origin, a high binding ability was observed from
the aqueous solution of AFB1 (Rosa et al., 2001). A slight protection in broiler birds was observed
against aflatoxicosis when 0.3% of sodium bentonite was added to the feed contaminated with
aflatoxin (5 mg/kg). The body weight gain and feed intake were non-significantly different from the
control group, however, the histolopathological and biochemical data revealed that the protective
effect against the toxic effect of aflatoxin was not up to the mark. The addition of 0.5% of
montmorillonite to the broiler diet significantly decreased the deleterious effect of AFB1 when added
to the feed at a dose rate of 200 ppb (Desheng et al., 2005). The addition of 3 g modified
montmorillonite nanocomposite to diet amended with 0.1 mg AFB1/kg indicated a significant
protective effect on the relative weight of the organs, hematological and biochemical values.
However, a significant decrease in the body weight gain and feed intake was observed in the birds fed
AFB1 contaminated diet without incorporation of binder, compared to the control group (Shi et al.,
2006). Ramos and Heranadez (1997) reported that aluminosilicates like HSCAS are efficient to
detoxify the AF due to its polar nature so reduced the chances for the development of aflatoxicosis.
Dietary addition of acid bentonite (1%, 10%) and HSCAS (1%) to the OTA contaminated diet
(1mg/kg) had no effect on the blood and tissue levels of toxin in pigs (Plank et al., 1990). The use of
HSCAS in case of OTA toxicity did not improve the performance parameters of the broiler birds and
the depression of humoral immune response of broiler chicks by feeding OTA at 2 mg/kg feed with
or without aluminosilicates against NDV (Santin et al., 2002b). Addition of 0.5% HSCAS to the diet
made from moldy corn did not ameliorate the negative effects on average daily weight gain and FCR
of the broiler birds (Liu et al., 2011). Garcia et al. (2003) conducted a study to access the binding
ability of two commercial binders (Zeotek & Mycofix) against OTA (567 ppb) toxicity in the broiler
birds. The binders were not much effective in reducing the detrimental effects on the plasma
proteins, albumins, globulins and uric acid levels in the blood. Similarly the use of clay based binder
having calcium bentonite in its composition at a dose rate of 4 kg/ton reduced the level of OTA in
three fish feed samples from 15, 6 and 6 µg/kg to 1, zero and zero, respectively (Abdelaziz et al.,
2010). The use of diatomaceous earth significantly reduced the toxic effects of OTA for most of the
studied parameters except the relative weight of liver in laying hens when compared to the control
group (Denli et al., 2008).
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
75
Activated charcoal
Another sorbent of interest is activated charcoal (AC), also called active carbon. AC is an
insoluble powder and formed by an activation process of pyrolysis of various organic compounds to
develop an extremely porous structure (Galvano et al., 2001). The surface area, structure and pore
size of the mycotoxin played a critical role in the binding ability of AC. The surface-to-mass ratio of
AC varied from 500 to 3500 m2/g. AC effectively bound a wide variety of drugs and toxic substances.
Since the 19th century, it has been effectively used to treat severe intoxication problems (Huwig et al.,
2001). AC has been proven an effective adsorbent of DON, ZON, AFB1, FB1 and OTA (Huwig et al.,
2001; Avantaggiato et al., 2004; Devreese et al., 2012).
The preliminary study conducted by Decker and Corby (1980) suggested that AFB1 (1 mg) was
efficiently adsorbed during an in vitro study at neutral pH by the AC (100 mg). Edrington et al. (1997)
reported a slight protective effect of super AC against aflatoxicosis in the broiler birds. The birds
were offered a diet amended with 4 mg/kg of aflatoxin for up to 21 days of age, with or without the
addition of 0.5 % of super AC. A significant decrease in the body weight gain was observed in the
birds fed with aflatoxin alone, while a moderate protection was observed with the addition of super
AC. The addition of AC to aflatoxin contaminated diet tended to improve the body weight gain and
feed utilization (Teleb et al., 2004; Dalvi and McGown, 1984). Galvano et al. (1996) reported the
protective effect of charcoal to reduce the residues of aflatoxin in the milk of cow, however; this
protection was not less compared to the protection provided by the clay-based binders. Similarly,
Diaz et al. (2004) stated that the adding 45 g of AC in ration on a daily basis had no significant
reduction on the residues of aflatoxin in milk while the addition of binders having clay or esterified
glucan at a dose of 225 and 10g, respectively to each cow per day, lead to a significant reduction in
residues of aflatoxin in milk. Similarly, the experiments conducted on rats (Abdel-Wahhab et al.,
(1999), mink (Bonna et al., 1991) and turkey poult (Edrington et al., 1996) suggested that the clay
based binders were more efficient compared to the charcoal in case of aflatoxin toxicity. Jindal et al.
(1994) reported a moderate ameliorative effect of AC (200 ppm) against the toxic effects induced by
AFB1 (0.5 ppm) in the broiler birds fed the amended feed from day1 to 42 of age. There was a
significant reduction in the inhibitory effect of AFB1 on the body weight and feed intake of the birds.
Serum biochemical parameters were also improved, but no significant effect was observed on the
cholesterol levels. Ademoyero and Dalvi (1983) observed a considerable reduction of toxic injury to
the liver caused by AFB1. Kutlu et al. (2001) conducted a six week experiment in the broiler birds
and reported a significant increase in feed intake, body weight gain and improved FCR at different
levels of wood charcoal (0, 25, 50 and 100 g/kg) up to 28 days of age. However, no significant effect
was observed at 49 days of age except on the FCR, ash contents of carcass and carcass weight and
yield. Similarly, in the second experiment conducted on the laying hens for a 7 week period with an
initial age of 34 weeks, the dietary addition of wood charcoal at an inclusion rate of 0, 10, 20 and 40
g/kg feed did not significantly affect the performance parameters and egg quality. However, a
significant reduction in the quantity of broken eggs was observed in a dose dependent manner.
In case of OTA toxicity inclusion of 1% AC to the feed of the broiler birds did not result in
significant protection. Addition of 1% AC to the pig diet amended with 1mg OTA/kg feed resulted in
a slight decrease in the blood OTA level, however, tenfold dosage resulted in a 50% to 80% reduction
of OTA levels in both blood and tissue (Plank et al., 1990). Liu et al. (2011) reported that at 1%
inclusion rate of AC made from willow tree in the diet formulated from less moldy corn did not
improve the average daily weight gain and FCR of the broiler birds during first three weeks of age.
The inclusion rate of 2% resulted in lower average daily weight gain, poor FCR, more leg problem and
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
76
higher mortality in the broiler birds possibly due to dilution or binding of the nutrients. Describing
the results of a feeding trial Rotter et al. (1989) reported that addition of 10,000 ppm of AC in feed
contaminated with OTA (4µg/kg) had no effect on OTA toxicity. Addition of 0.24g/L of activated
carbon to the sweet wine effectively reduces up to 70% of OTA.
Mycotoxin Modifiers
Another strategy to control mycotoxicoses in animals is the application of microorganisms and
their enzymes, called mycotoxin modifiers or mycotoxin bio-transforming agents. These products
degrade or biotransform mycotoxins into less toxic metabolites. Mycotoxin modifiers can be divided
into four classes: bacteria, yeasts, fungi and enzymes. These modifiers act on the mycotoxins during
their passageway through the intestinal tract of the animal thus preventing absorption of mycotoxins
into the circulation. Effective use of mycotoxin modifiers depends upon certain properties of these
substances. These properties include their ability to rapidly degrade the toxic substance into nontoxic
compound, preserve the organoleptic and the nutritive value of the feed, safety of use and stability
during the intestinal passage at different levels of pH. One has to consider different practicable and
economical aspects for selecting mycotoxin modifiers (Awad et al., 2010; Kolosova and Stroka, 2011).
The key point for the successful modifier is that the microorganism should survive and adopt the
environment during its passage in the animal’s gut (Zhou et al., 2008).
Trichosporon mycotoxinivorans
The microorganisms isolated from the animals gut contents are usually appropriate for the
development of good modifier which will act in the animal’s intestines. Among different
microorganisms, so far tested for inactivation of OTA, only Trichosporon mycotoxinivorans (TM) has
been thoroughly investigated regarding its ochratoxin degrading abilities and feasibility for its
commercial use. This yeast, primarily derived from the hindgut of the lower termites
Mastotermesdarwiniensis, was isolated and characterized previously by Molnar et al. (2004). This yeast
was capable of modifying ZON and OTA into non-toxic metabolites.
A study by Politis et al. (2005) demonstrated that inclusion of TM (105 CFU/g) in the diet
alleviated the immunotoxic effects of OTA (0.5 mg/kg) in broiler chickens and also has the ability to
degrade zearalenone when used as a feed additive (Vekiru et al., 2010). Addition of TM at dose rate
of 1 & 2 kg/ton attenuated the harmful effects of dietary OTA (0.5 & 1mg/kg) on serum liver enzymes
and also pathomorphological and histological changes in the internal organs of broiler birds (Hanif et
al., 2008). A significant reduction in the residue of OTA in serum, kidney and liver was also reported
by Hanif et al. (2012) when TM was added at dose rate of 1 & 2 kg/ton in OTA (500 ppb and 1000
ppb) contaminated broiler diet. Similarly, the use of clay based binder having Eubacterium and TM in
its composition significantly improved the FCR compared to the groups received only OTA
contaminated diet (Hanif et al., 2008). Trichosporon mycotoxinivorans proved an efficient toxin modifier
in case of OTA toxicity as it converts the OTA to non-toxic OTα and phenylalanine (Schatzmayr et
al., 2006; Molnar et al., 2004).
Other potential OTA degrading yeast species included Phaffiarhodozyma and Xanthophyllomyces
dendrorhous (Peteri et al., 2007) but the responsible enzymes have not well been characterized and
their practical application up at present is limited. Styriak and Conkova (2002) reported that two out
of several tested Saccharomyces cerevisiae strains were able to degrade 25 or 50% of fumonisins B1
(FB1) after 5 days of incubation, which is, therefore, unusable in practice.
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
77
Milk Thistle seeds
The seeds of Milk thistle (Sylibum marianum), a medicinal herb, has been extensively used in folk
medicine for treating liver diseases. Certain active ingredients found in the seed of this plant possess
numerous medicinal properties. Earlier in 1960, a German scientist isolated a flavonoid ‘silymarin’
from MTS. Chemically, it is composed of four flavonoids- silybin, isosilybin, silydianin, and silychristin.
Silybin is the major component constituting 50 to 70% of silymarin and exhibit greater biological
activities (Dumari et al., 2014).
The bioactive extract from Silybum marianum seed, silymarin, contains a mixture of
flavonolignans and a residual fraction that has not been defined chemically in structural details
(Skottova et al., 2003). Silymarin is used in humans for the treatment of numerous liver disorders
characterized by degenerative necrosis and functional impairments (Luper, 1998). Kalorey et al.
(2005), reported that silymarin improved body weight and feed intake in the presence of aflatoxin B1
in feed, while it had no effect on the feed conversion ratio (Tedesco et al., 2004). Similarly, Gowda
and Sastry (2000) confirmed a significant improvement of silymarin on body weight gain and
attributed its effects to antioxidant activity in the protein synthesis stimulation by the bird’s enzymatic
system. The higher weight gain was reported by Chakarverty and Parsad (1991), in silymarin
supplemented group. Kalorey et al. (2005) reported the protective role of silymarin against
aflatoxicosis on the weight of bursa of Fabricius. As evident from some researches, aflatoxins reduced
lymphoid organs weight (thymus, bursa and spleen) in aflatoxicosis (Tedesco et al., 2004). Silybum
marianum was more efficient to protect the spleen against adverse effects of aflatoxin as compared
with the synthetic toxin binders (Kalorey et al., 2005). Regarding ochratoxicosis Khatoon et al. (2013)
reported improvement of different immunological responses lymphoproliferative response to avian
tuberculin and phagocytic index of circulating macrophages by silymarin in white Leghorn cockerels.
Distillery Yeast Sludge
Distillery yeast sludge (DS), a by-product of sugarcane molasses based distillery industry, is
considered a waste in East Asian countries but chemically this waste has high contents of protein
which is far higher than what found in ordinary cereals. This product can be effectively used as an
alternative feed source and studies have reported that up to 50% of it as an alternative feed source is
safe and can provide better results instead of ordinary feed (Rameshwari and Karthikeyan, 2005).
Mujahid et al. (2012) conducted a study in which they found the efficient protective efficacy of 1-2%
yeast sludge to protect aflatoxin induced alteration in poultry while Hashmi et al., (2006) reported
the efficacy of 1% yeast sludge in ochratoxin A treated birds receiving up to 200 ppb levels.
Moreover; Saccharomyces cerevisiae, being the active yeast found in sludge has the ability to adsorb
aflatoxins up to 90% in short time interval (Murthy and Devegowda, 2004). Mannan oligosaccharide
which is a derivative of yeast has also been evaluated for its protective efficacy against different
mycotoxins and has been proved highly beneficial in providing protection in birds (Baptista et al.,
2004).
CONCLUSION
The rate of poultry feed mycotoxin contamination is likely to increase in line with the trend
witnessed in preceding years. The unwanted effects of mycotoxins can be prevented with an
appropriate mycotoxin binder. Different substances including binding clays, activated charcoal,
distillery sludge, Trichosporon mycotoxivorans and milk thistle seeds extracts are the promising
substance for use as mycotoxin adsorbing or inactivating agents. The combination of adsorption and
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
78
biotransformation technologies can be used effectively to deactivate the major groups of mycotoxins
found in intensive poultry production and to prevent economic losses associated with the
contamination of these mycotoxins.
REFREENCES
Abdelaziz M, W Anwer and AH Abdelrazek, 2010. Field Study on the Mycotoxin Binding Effects of
Clay in Oreochromis niloticus Feeds and Their Impacts on the Performance as Well as the Health
Status throughout the Culture Season. Interdisciplinary Bio Central, 2: 1-6.
Abdel-Wahhab MA, SA Nada and Amra, 1999. Effect of aluminosilicates and bentonite on aflatoxin-
induced developmental toxicity in rat. J Appl Toxicol, 19: 199-204.
Abdulkadar, WHA, AA Al-Ali, MA Al-Kildi and HJ Al-Jedah, 2004. Mycotoxins in food products
available in Qatar. Food Control, 15: 543-548.
Ademoyero AA and RR Dalvi, 1983. Efficacy of activated charcoal and other agents in the reduction
of hepatotoxic effects of a single dose of aflatoxin B1 in chickens. Toxicol Lett, 16: 153-157.
Anonymous, 1993. Monographs on the Evaluation of Carcinogenic Risks to Humans: Some Naturally
Occurring Substances, Food Items and Constituents, Heterocyclic Aromatic Amines and
Mycotoxins. International Agency for Research on Cancer, Geneva, 56: 489-521.
Anonymous, 2001. Manual on the application of the HACCP system in mycotoxin prevention and
control. FAO Food and Nutition Paper No. 73, Rome, Italy.
Anonymous, 2009. Commision Regulation 386/2009/EC of 12 May 2009 amending Regulation (EC)
No 1831/2003 of the European Parliament and of the Council as regards the establishment of a
new functional group of feed additives. Official Journal of the European Union L 118, 66.
Atkins D and J Norman, 1998. Mycotoxins and food safety. Nutr Food Sci, 5: 260-266.
Avantaggiato G, M Solfrizzo and Visconti, 2005. Recent advances on the use of adsorbent materials
for detoxification of Fusarium mycotoxins. Food Addit Contam A, 22: 379-388.
Avantaggiato G, R Havenaar and A Visconti, 2004. Evaluation of the intestinal absorption of
deoxynivalenol and nivalenol by an in vitro gastrointestinal model, and the binding efficacy of
activated carbon and other adsorbent materials. Food ChemToxicol, 42: 817-824.
Awad WA, K Ghareeb, J Bohm and Zentek, 2010. Decontamination and detoxification strategies for
the Fusarium mycotoxin deoxynivalenol in animal feed and the effectiveness of microbial
biodegradation. Food Addit Contam A, 27: 510-520.
Baptista AS, J Horii, MA Calori-Domingues, EM da Gloria, JM Salgado et al., 2004. The capacity of
manno-oligosaccharides, thermolysed yeast and active yeast to attenuate aflatoxicosis.World J
Microbiol Biotechnol, 20: 475-481.
Battilani P, C Barbano and A Logrieco, 2008. Risk assessment and safety evaluation of mycotoxins in
fruits. In: Barkai-Golan, R. and Paster, N. (Eds) Mycotoxins in fruits and vegetables. Elsevier, San
Diego, CA, USA, pp. 1-26.
Bennett JW and M Klich, 2003. Mycotoxins. Clin Microbiol Rev, 16: 497-516.
Chakarverty A and JParsad, 1991. Study on the effect of Milk Thistle extract on the performance of
broiler chicks. Indian Poult Adv, 24: 37-38.
Coulombe RA, 1993. Biological action of mycotoxins. J Dairy Sci 76: 880-891.
Dalvi RR and C McGowan, 1984. Experimental induction of chronic aflatoxicosis in chickens by
purified aflatoxin B1 and its reversal by activated charcoal, Phenobarbital and reduced
glutathione. Poult Sci, 63: 485-491.
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
79
Decker WJ and DG Corby, 1980. Activated charcoal adsorbs aflatoxin B1. Vet Hum Toxicol, 22: 388-
389.
Denli M, JC Blandon, ME Guynot, S Salado and JF Perez, 2008. Efficacy of a New Ochratoxin-Binding
Agent (OcraTox) to Counteract the Deleterious Effects of Ochratoxin A in Laying Hens. Poult
Sci, 87: 2266-2272.
Desheng Q, L Fan, Y Yanhu and Niya, 2005. Adsorption of aflatoxin B-1 on montmorillonite. Poult
Sci, 84: 959-961.
Devreese M, AOsselaere, J Goossens, V Vandenbroucke, SD Baere, et al., 2012. New bolus models
for in vivo efficacy testing of mycotoxin-detoxifying agents in relation to EFSA guidelines assessed
using deoxynivalenol in broiler chickens. Food Addit Contam A, 29: 1101-1107.
Diaz DE, WM Hagler, JT Blackwelder, JA Eve, BA Hopkins, et al., 2004. Aflatoxin binders II: Reduction
of aflatoxin M1 in milk by sequestering agents of cows consuming aflatoxin in feed.
Mycopathologia, 00: 1-8.
Diener UL, RJ Cole, TH Sanders, GA Payne, LS Lee, and MA Klich, 1987.Epidemiology of aflatoxin
format ion by Aspergillus flavus.Annu Rev Phytopathol, 25: 249-270.
Dinis AMP, CM Lino and AS Pena, 2007.Ochratoxin A in nephropathic patients from two cities
ofcentral zone in Portugal. J Pharmaceut Biomed Anal 44: 553–557.
Duarte SC, CM Lino and A Pena, 2011. Ochratoxin A in feed of food-producing animals: an
undesirable mycotoxin with health and performance effects. Vet Microbiol, 154: 1-13.
Dumari MA, H Sarir, OF Makki, N Afzali, 2014. Effect of milk thistle (silybum marianum l.) on
biochemical parameters and immunity of broiler chicks fed aflatoxin b1 after three weeks. Iran J
Toxicol, 8: 1098-1103.
Edrington TS, LF Kubena, RB Harvey and GE Rottinghaus, 1997. Influence of a superactivated
charcoal on the toxic effects of aflatoxin or T-2 toxin in growing broilers. Poult Sci, 76: 1205-
1211.
Edrington, TS, AB Sarr, LF Kubena, RB Harvey and TD Phillips. 1996. Hydrated sodium calcium
aluminosilicate (HSCAS), acidic HSCAS, and activated charcoal reduce urinary excretion of
aflatoxin M1 in turkey poults. Lack of effect by activated charcoal on aflatoxicosis. Toxicol Lett,
89:115-122.
Eraslan G, M Akdogan, E Yarsan, D Essiz, F Sahindokuyucu, et al., 2004. Effects of aflatoxin and
sodium bentonite administered in feed alone or combined on lipid peroxidation in the liver and
kidneys of broilers. B Vet I Pulawy, 48: 301-304.
Frisvad JC, P Skouboe and RA Samson, 2005. Taxonomic comparison of three different groups of
aflatoxin producers and a new efficient producer of aflatoxin B1, strerigmatocystin and 3-O-
methylsterigmatocystin, Aspergillus rambellii sp. nov. Syst Appl Microbiol, 28: 442-453.
Galvano F, A Pietri, B Fallico, T Bertuzzi, S Scire, et al., 1996. Activated carbons: in vitro affinity for
aflatoxin B1 and relation of adsorption ability to physicochemical parameters. J Food Protect, 59:
545-550.
Galvano F, A Piva, ARitieni and G Galvano, 2001. Dietary strategies to counteract the effects of
mycotoxins: a review. J Food Prot, 64: 120-131.
Garcia AR, E Avila, R Rosiles and VM Petrone, 2003. Evaluation of two mycotoxin binders to reduce
toxicity of broiler diets containing ochratoxin A and T-2 toxin contaminated grain. Avian Dis, 47:
691-699.
Gowda SK and VRBSastry, 2000. Neem (Azadirachtaindica) seed cake in animal feeding-scope and
limitation-Review. Asian Australas J Anim Sci, 13: 720-728.
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
80
Hanif NQ, G Muhammad, K Muhammad, I Tahira and GK Raja, 2012. Reduction of ochratoxin A in
broiler serum and tissues by Trichosporon mycotoxinivorans. Res Vet Sci, 93: 795-797.
Hanif NQ, G Muhammad, M Siddique, A Khanum, T Ahmed, et al., 2008. Clinico-pathomorphological,
serum biochemical and histological studies in broilers fed ochratoxin A and a toxin deactivator
(Mycofix Plus). Br Poult Sci, 49: 632-642.
Hashmi I, TN Pasha, MA Jabbar, M Akram and AS Hashmi, 2006 Study of adsorption potential of
yeast sludge against aflatoxins in broiler chicks J Anim Plant Sci 16: 12-14.
Hussain Z, MZ Khan and Zl Hassan, 2008. Production of Aflatoxins from Aspergillus Flavus and Acute
aflatoxicosis in young broiler chicks. Pak J Agri Sci, 45: 95-102.
Huwig A, S Freimund, O Kappeli and H Dutler, 2001. Mycotoxin detoxication of animal feed by
different adsorbents.Toxicol Lett 122: 179-188.
Indresh HC, Devegowda G, Ruban SW and MC Shivakumar, 2013. Effects of high grade bentonite on
performance, organ weights and serum biochemistry during aflatoxicosis in broilers. Vet World,
6: 313-317.
Jard G, T Liboz, F Mathieu, AGuyonvarch and A Lebrihi, 2011. Review of mycotoxin reduction in
food and feed: from prevention in the field to detoxification by adsorption or transformation.
Food Addit Contam A, 28: 1590-1609.
Jindal N, SK Mahipal and NK Mahajan, 1994. Toxicity of aflatoxin B1 in broiler chicks and its
reduction by activated charcoal. Res Vet Sci 56: 37-40.
Kabak B, 2009. Ochratoxin A in cereal-derived products in Turkey: occurrence and exposure
assessment. Food Chem Toxicol, 47: 348-352.
Kabak B, AD Dobson and I Var, 2006. Strategies to prevent mycotoxin contamination of food and
animal feed: a review. Crit Rev Food Sci Nutr, 46: 593-619.
Kalorey DR, NV kurkure, IS Ramgaonkar, PS Sakhare, S Warke et al., 2005. Effect of polyherbal feed
supplement “Growell” during induced aflatoxicosis, ochratoxicosis and combined mycotoxicoses
in broilers. Asian Australas J Anim Sci, 18: 375-383.
Khan WA, MZ Khan, A Khan, ZU Hassan, S Rafique, et al., 2014. Dietary vitamin E in White Leghorn
layer breeder hens: a strategy to combat aflatoxin B1-induced damage, Avian Pathol, 43: 389-395.
Khatoon A, MZ Khan, A Khan, MK Saleemi and I Javed, 2013. Amelioration of Ochratoxin A-induced
immunotoxic effects by Silymarin and Vitamin E in White Leghorn Cockerels. J Immunotoxicol
10: 25-31
Kolosova A and Stroka, 2011. Substances for reduction of the contamination of feed by mycotoxins: a
review. World Mycotoxin J, 4: 225-256.
Kutlu HR, L Unsal and M Gorgulu, 2001. Effects of providing dietary wood (oak) charcoal to broiler
chicks and laying hens. Anim Feed Sci Technol, 90:213-226.
Liu YL, GQ Meng, HR Wang, HL Zhu, YQ Hou, et al., 2011. Effect of three mycotoxin adsorbents on
growth performance, nutrient retention and meat quality in broilers fed on mould-contaminated
feed. Br Poult Sci, 52: 255-263.
Luper S, 1998. A review of plants used in the treatment of liver disease: Part I. Altern Med Rev, 3:
410–421.
Molnar O, G Schatzmayr, E Fuchs and H Prillinger, 2004.Trichosporon mycotoxinivorans sp. nov., A New
yeast species useful in biological detoxification of various mycotoxins. Sys Appl Microbiol, 27:
661-671.
Mujahid H, AS Hashmi, AA Anjum, A Waris and Y Tipu, 2012 Detoxification potential of ochratoxin
by yeast sludge and evaluation in broiler chicks J Plant Anim Sci, 22: 601-604.
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
81
O'Brien E and DR Dietrich, 2005. Ochratoxin A: the continuing enigma. Crit Rev Toxicol, 35: 33-60.
Oliveira CAF, JF Rosmaninho, P Butkeraitis, B Correa, TA Reis, et al., 2002. Effect of Low Levels of
Dietary Aflatoxin B1 on Laying Japanese quail. Poult Sci, 81: 976-980.
Pasha TN, MU Farooq, FM Khattak, MA Jabbar and AD Khan, 2007. Effectiveness of sodium bentonite
and two commercial products as afalatoxin absorbents in diets for broiler chickens. Anim Feed
Sci Tech, 132: 103-110.
Peckham JC, B Doupnik and OH Jones, 1971. Acute toxicity of ochratoxins A and B in chicks. Appl
Microbiol, 21: 292-494.
Peraica M, AM Domijan, R Fuchs, A Lucic and B Radic, 1999. The occurrence of ochratoxin A in
blood in general population of Croatia. Toxicol Lett, 110: 105-112.
Peteri Z, J Teren, C Vagvolgyi, and J Varga, 2007. Ochratoxin degradation and adsorption caused by
astaxanthin-producing yeasts. Food Microbiol, 24: 205-210.
Phillips TD, E Afriyie-Gyawu, J Williams, H Huebner, NA Ankrah, et al., 2008. Reducing human
exposure to aflatoxin through the use of clay: a review. Food Addit Contam A, 25: 134-145.
Phillips TD, LF Kubena, RB Harvey, DR Taylor and ND Heidelbaugh, 1988. Hydrated sodium calcium
aluminosilicate: a high affinity sorbent for aflatoxin. Poult Sci, 67: 243-247.
Plank G, J Bauer, A Grunkemeier, S Fischer, B Gedek and H Berner, 1990. The protective effect of
adsorbents against ochratoxin A in swine. Tierarztl Prax, 18: 483-489.
Politis I, K Fegeros, S Nitsch, G Schatzmayr and D Kantas, 2005. Use of Trichosporon mycotoxinivorans
to suppress the effects of ochratoxicosis on the immune system of broiler chicks. Br Poult Sci,
46:58-65.
Quezada T, H Cuellar, F Jaramillo-Juarez, AG Valdivia and JL Reyes, 2000. Effects of aflatoxin B (1) on
the liver and kidney of broiler chickens during development. Comp Biochem Physiol C Toxicol
Pharmacol, 125: 265-272.
Raju MV and G Devegowda, 2000. Influence of esterified-glucomannan on performance and organ
morphology, serum biochemistry and haematology in broilers exposed to individual and
combined mycotoxicosis (aflatoxin, ochratoxin and T-2 toxin). Br Poult Sci, 41: 640-650.
Rameshwari KS and S Karthikeyan, 2005. Distillery yeast sludge as an alternative feed resource in
poultry Int J Poult Sci, 4: 787-789
Ramos AJ and E Hernandez, 1996.In vitro aflatoxin adsorption by means of a montmorillonite
silicate.A study of adsorption isotherms. Anim Feed Sci Technol, 62: 263-269.
Ramos AJ and E Hernandez, 1997. Prevention of aflatoxicosis in farm animals by means of hydrated
sodium calcium aluminosilicate addition to feedstuffs: A review. Anim Feed Sci Technol, 65: 197-
206.
Richard E, N Heutte, V Bouchart and D Garon, 2009. Evaluation of fungal contamination and
mycotoxin production in maize silage. Anim Feed Sci Technol, 148: 309-320
Richard JL, 2007. Some major mycotoxins and their mycotoxicoses—an overview. Int J Food
Microbiol, 119: 3-10.
Richard JL, GA Payne, AE Desjardin, C Maragos, WP Norred, et al., 2003. Mycotoxins, risks in plant,
animal and human systems. CAST Task Force Report 139. Council for Agricultural Science and
Technology. Ames, Iowa, USA, p. 101–103.
Rosa CAR, R Miazzo, C Magnoli, M Salvano, SM Chiacchiera, et al., 2001. Evaluation of the efficacy of
bentonite from the south of Argentina to ameliorate the toxic effects of aflatoxin in broilers.
Poult Sci, 80: 139-144.
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
82
Santin E, AC Paulillo, PC Maiorka, AC Alessi, EL Krabbe et al., 2002. The effects of
ochratoxin/aluminosilicate interaction on the tissues and humoral immune response of broilers.
Avian Pathol, 31: 73-79.
Schatzmayr G, F Zehner, M Taubel, D Schatzmayr, A Kilmitsch, et al., 2006. Microbiologicals for
deactivating mycotoxins. Mol Nutr Food Res, 50: 543-551.
Schrodter R, 2004. Influence of harvest and storage conditions on trichothecenes levels in various
cereals. Toxicol Lett, 153: 47-49.
Scott DB, 1965. Toxigenic fungai isolated from cereal and legume crops. Mycopath Mycol Appl, 25:
213-222.
Shi YH, ZR Xu, JL Feng and CZ Wang, 2006. Efficacy of modified montmorillonite nanocomposite to
reduce the toxicity of aflatoxin in broiler chicks. Anim Feed Sci Tech, 129: 138-148.
Shotwell OL, CW Hesseltine and ML Goulden, 1969. Ochratoxin A: Occurrence as natural
contaminant of a corn sample. Appl Microbiol, 17: 765-766.
Skottova N, R Vecera, K Urbanek, P Vana, D Walterova et al., 2003. Effects of polyphenolic fractions
of silymarin on lipoprotein profile in rats fed cholesterolrichdiets. Pharmacol Res, 47: 17–26.
Stoev SD, D Gundasheva, I Zarkov, T Mircheva, D Zapryanova, et al., 2012. Experimental mycotoxic
nephropathy in pigs provoked by a mouldy diet containing ochratoxin A and fumonisin B1. Exp
Toxicol Pathol, 64: 733-741.
Styriak I and E Conkova, 2002. Microbial binding and biodegradation of mycotoxins. Vet Hum
Toxicol, 44: 358-361.
Tedesco D, C Domeneghini, D Sciannimanico, MTameni, S Steidler et al., 2004. Efficacy of silymarin
phospholipid complex in reducing the toxicity of aflatoxin B1 in broiler chicks. Poult Sci, 83:
1839-1843.
Teleb HM, AA Hegazy and YA Hussein, 2004. Efficiency of kaolin and activated charcoal to reduce
the toxicity of low level of Aflatoxins in broilers. Sci J King Faisal Univ, 5, 1425.
Thrane U, 1989. Fusarium: Mycotoxins, Taxonomy and Pathogenicity, In J. Chelowski (Ed), Elsevier,
Amsterdam, p. 199
Turner NW, S Subrahmanyam and SA Piletsky, 2010. Analytical methods for determination of
mycotoxins: a review. Anal Chim Acta, 632: 168-180.
Underhill KL, BA Rotter, BK Thompson, DB Prelusky and HL Trenholm, 1995. Effectiveness of
cholestyramine in the detoxification of zearalenone as determined in mice. Bull Environ Contam
Toxicol, 54: 128-134.
Vekiru E, C Hametner, R Mitterbauer, J Rechthaler, G Adam, et al., 2010. Cleavage of zearalenone by
Trichosporon mycotoxinivorans to a novel nonestrogenic metabolite. Appl Environ Microbiol, 76:
2353–2359.
Whitlow LW and WM Hagler Jr, 2002.Mycotoxins in feeds. Feedstuffs, 74: 1-10.
Yunus AG, E Razzazi-Fazeli and J Bohm, 2011. Aflatoxin B1 in affecting broiler’s performance,
immunity, and gastrointestinal tract: a review of history and contemporary issues. Toxins, 3: 566-
590.
Zhou T, J He and J Gong, 2008. Microbial transformation of trichothecene mycotoxins. World
Mycotoxin J, 1: 23-30.
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
83
MOLECULAR CHARACTERIZATION OF NEWCASTLE DISEASE VIRUS ISOLATED
FROM RECENT OUTBREAKS IN JORDAN AND STRATEGIES FOR ITS CONTROL
Mohammad Q. Al-Natour1*, Nadim M. Amarin1 Hisham Al –Maa’itah1 and Ilaria Capua2
1Department of Pathology and Public Health, Faculty of Veterinary Medicine, Jordan University of
Science and Technology, P.O. Box 3030, Irbid 22110, Jordan; 2OIE/FAO Reference Laboratory for
Newcastle Disease and Avian Influenza, Istituto Zooprofilattico Sperimentale delle Venezie, Viale
dell'Università, 10, 35020, Legnaro, Padova, Italy
*Corresponding author: mqalnatour@gmail.com
ABSTRACT
A total of 46 different poultry flocks were investigated for ND virus isolation and
characterization. Samples were collected from Broiler (n=23), Layer (n=5), Broiler breeder (n=3),
Ostriches (n=1), Turkeys (n=1), Peacock (n=1), Ducks (n =2), and backyard local chicken flocks
(n=10). The majority of these flocks experiencing signs and lesions typical of airsacculitis.
Following the inoculation of embryonated fowl’s SPF eggs 39 haemagglutinating agents were
isolated, identified and then fully characterized, as described in EU Council Directive 92/66/EEC
(CEC, 1992). Thirty five out of the 39 isolates reacted with antiserum against APMV-1. The other 4
strains were inhibited by APMV-2 antiserum. Nineteen of the 39 isolates showed intracerebral
pathogenicity index (ICPI) ranging from 0.8 to 1.8. Fusion protein cleavage site amino acid sequence
analysis of these APMV-1 isolates indicated the presence of multiple basic amino acids at the C-
terminus of the F2 region and phenylalanine at the N-terminus of the F1 region {(112-117)
RRQKR*F} confirming the velogenic nature of the viruses. Sixteen out of the 35 APMV-1 isolate
were identifies as Lentogenic – B1 group according to their ICPI that ranged between 0.2 and 0.3,
thus indicating that the viruses were not virulent. Fusion protein cleavage site amino acid sequence
analysis of these APMV-1 isolates indicated the absence of multiple basic amino acids at the C-
terminus of the F2 region and phenylalanine at the N-terminus of the F1 region, {GRQGR*L}
confirming the lentogenic nature of the viruses.
APMV-1 and APMV-2 (Yucaipa) viruses were identified in 39 (85%) of the 46 examined flocks.
The prevalence rate of NDV strains for velogenic (41%), Lentogenic (35%) and Yucaipa (9%) among
the examined 46 flocks. The information reported herein appears to be that APMVs circulating
efficiently in Jordanian poultry industry and it is the first report regarding APMV-2 (Yucaipa)
circulation in Jordan. Biosecurity measures should be strictly implemented along with sound
vaccination programs and good managemental practices at the farm level and backyard flocks. The
control strategies will be discussed.
Key Words: Newcastle disease virus, Yucaipa, Poultry flocks, Jordan.
Introduction
Newcastle disease (ND) is an important viral disease of poultry affecting more than 241 different
avian species around the world (Kaleta and Baldauf. 1988). The disease may be devastating in
commercial poultry with significant economic losses because of its high mortality and the negative
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
84
effect on international trade. Virulent NDV isolates (mesogens and velogens) are notifiable agents
that require reporting to the OIE (OIE, 2000). Newcastle disease is in List-A in the OIE and its
control is the subject of legislation in many parts of the world (CEC, 1992).
Newcastle disease virus (NDV) belongs to the family Paramyxoviridae, subfamily;
Paramyxovirinae of the genus Avulavirus (ICTV. 2012). NDV is a single-stranded RNA negative-sense,
non-segmented, enveloped. Although 11 serotypes of avian paramyxoviruses (APMV-1 to APMV-11)
have been recognized (Briand et al., 2012; Fornells et al. 2012; Miller et al. 2010(a)), APMV-1 remains
the most important pathogen for poultry known as Newcastle disease virus. The pathogenicity of the
disease ranged from asymptomatic form (low virulence) to virulent which is devastating disease with
high mortality in susceptible birds. According to clinical signs in chicken it is classified as: (1)
asymptomatic enteric, (2) lentogenic, (3) mesogenic, (4) velogenic (Suarez, 2013).
Current definition of NDV according to the OIE is ‘‘Newcastle disease is defined as an infection of
birds caused by a virus of avian paramyxovirus serotype 1 (APMV-1) that meets one of the following
criteria for virulence: (a) the virus has an intracerebral pathogenicity index (ICPI) in day-old chicks
(Gallus gallus) of 0.7 or greater. Or (b) multiple basic amino acids have been demonstrated in the virus
(either directly or by deduction) at the C-terminus of the F2 protein and phenylalanine at residue
117, which is the N-terminus of the F1 protein. The term ‘multiple basic amino acids’ refers to at
least three arginine or lysine residues between residues 113 and 116. Failure to demonstrate the
characteristic pattern of amino acid residues as described above would require characterization of
the isolated virus by an ICPI test’’ (OIE, 2008, OIE. 2012). Currently, there are multiple NDV lineages
circulating worldwide that are genetically highly diverse (Aldous et al., 2003; Capua et al., 2002; Gould
et al., 2001; Miller et al., 2010b). Because DIVA strategies do not exist for ND, it is difficult to
differentiate vaccinated from infected animals. This is confusing situation in some endemic countries
that still use live mesogenic vaccine strains that are defined as virulent due to their cleavage sites
and high ICPI values (Wu et al., 2010).
The Jordanian poultry industry is growing fast and it comprises 53% of the total animal industry.
Therefore, it is considered to play an important role in the country economy. Different types of
poultry farms in Jordan including Grandparents, parents, breeders, layer, broiler, turkeys, ducks,
ostrich, quail, and different backyard birds of different bird species including Pigeons, Peacocks, in
addition to cage birds, game birds and avian species in Zoos. Avian viral diseases are of significant
importance to the poultry industry worldwide including Jordan. Newcastle disease outbreaks cause
significant economic losses to farmers and thus the economy. Therefor this paper presents our
findings regarding NDV in Jordan.
Materials and Methods
Investigated Flocks
Since 2003, suspected ND samples were obtained from different poultry sources; farm visits,
necropsy or sample submission to our laboratories for virus isolation attempts. These include
multiple outbreaks in vaccinated and no-vaccinated broiler, layer, broiler breeder, ostriches, turkeys,
peacock, ducks, and backyard local flocks.
Samples collection
Samples were collected aseptically from either freshly dead birds or after performing euthanasia
for birds before necropsy. Trachea, bronchi, lungs, livers and spleen samples were collected from 5-
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
85
10 birds/flock for Newcastle Disease virus isolation attempts. Collected samples in sterile universal
tubes stored at -20 C, and then processed for viral identification according to (OIE, 2012).
Serology and virology
All serological and virological investigations were done in accordance to EU Directive 92/
66/EEC. The HA and HI tests were conducted to detect antibodies to all avian paramyxoviruses
APMV 1-9 using 4 haemagglutination units. Virus isolation was performed in five 9 to11 day-old
emberyonating specific pathogen free (SPF) fowl’s eggs as described previously (CEC, 1992).
Extraction of viral RNA from one sample tissues, Primers used and RT-PCR assays were according to
(Ababneh et al., 2012).
Partial nucleotide sequence of suspected NDV isolates
A partial amino acids sequence at the cleavage site 112-117 was determined to all suspected
NDV isolates (CEC 1992). In addition the nucleotide sequence was done to the 375 region of the
NDV fusion (F) protein gene and the geogroup were determined according to Aldous et al. (2003).
All our NDV suspected samples were sequenced in Italy except one sample was sequenced in Jordan
(Ababneh et al., 2012).
Results and Discussion
Investigated Flocks
A total of 46 different poultry flocks with different age were investigated for ND virus isolation
and characterization. Samples were collected from Broiler (n=23), Layer (n=5), Broiler breeder
(n=3), Ostriches (n=1), Turkeys (n=1), Peacock (n=1), Ducks (n =2), and backyard local chicken
flocks (n=10). Some flocks were vaccinated with NDV vaccines once or more than once depending
on age, while other birds were not vaccinated or their vaccination history in question. Mortality
rates ranged from 1.5-25%, or 50% in vaccinated birds and 80-90% in non-vaccinated flocks. Clinical
signs vary from mild respiratory with or without nervous signs (torticollis) to sever respiratory
distress. Some birds show depression, ruffled father, green watery feces, blue comb and airsacculitis
with difficulty in breathing. Lesions ranged from mild trachietis with air sacculitis to congestion and
extensive hemorrhages in the trachea, caecal tonsils proventriculus and other parts of the digestive
system.
It is important to emphasis that clinical signs and gross lesions are not pathognomonic for ND
diagnosis. Therefore, laboratory diagnosis is very important and will allow differentiating between
velogenic ND and Highly pathogenic avian influenza.
Serology and virology
Following the inoculation of embryonated fowl’s SPF eggs 39 haemagglutinating agents were
isolated, identified and then fully characterized. Four of the HA positive isolates were identified by
monoclonal antibody as APMV2 “Yucaipa Viruses” Table 1”. All the four Yucaipa were identified in 4
broiler flocks. Other studies reported APMV-2 Yucaipa-like viruses isolation in China from the
imported Gouldian Finch (Chloebia gouldiae), while isolates from the same APMV serotype were
isolated from domestic and wild birds in Costa Rica. In general, APMV-2 was isolated from a variety
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
86
of species including robin, eagle, pheasant, parrot, canary, domestic poultry, and waterfowl (Suarez,
2013).
Twelve isolates originated from broiler flocks and 4 from backyard flocks were identified as
APM1 (Lentogenic – B1 group) based on their intracerebral pathogenicity index (ICPI) of 0.1 to 0.3,
indicating that these isolates were not virulent. The amino acid sequence at the cleavage site 112-117
of these isolates was glycine, arginine, glutamine, glycine, arginine, and leucine (Table 1). The fusion
protein cleavage site amino acid sequence analysis indicated absence of multiple basic amino acids at
the C-terminus of the F2 region and phenylalanine at the N-terminus of the F1 region (GRQGR*L)
confirming the lentogenic nature of the viruses. These are considered vaccine strains as they were
isolated from vaccinated birds with La Sota ND vaccines. It was indicated by Aldous et al. (2003) that
all lentogenic isolates were grouped together with the vaccinal La Sota strain in genetic lineage 2.
Table 1: Avian Paramtxoviruses isolated from broiler and backyard flocks in Jordan
Flock Number
of Isolates
Typing Molecular
pathotype
(F protein)
ICPIa Serum Amino acid sequence at
cleavage site (112-117)
Broiler 4 PMV2 (Yucaipa) Not applied Not applicable -
Backyard 4 PMV1(Newcastle) GRQGR*LA Lentogenic – B1
groupb
0.1
Broiler 12 PMV1(Newcastle) GRQGR*LA
Lentogenic – B1
groupb
0.2- 0.3
Total 20 aICPI = Intracerebral Pathogenicity Index; AAmino acid symbols: G=glycine, R=arginine, Q=glutamine,
and L=leucine; Basic amino acids shown in bold. bTypization by E. W. Aldous et al., (see phylogenetic
tree) as Lentogenic – B1 group. ^ All the lentogenic isolates were grouped together with the vaccinal
La Sota strain in genetic lineage 2 (Aldous et al., Avian Pathology, 2003, 32:239-257).
Velogenic APMV1 was identified in 19 flocks including broiler breeders, layer, broiler, turkeys,
Peacock, Ostriches and Backyard flocks (Table 2). These isolates showed intracerebral pathogenicity
index (ICPI) ranging from 0.8 to 1.8. The amino acid sequence at the cleavage site 112-117 of these
isolates was (RRQKR*F): arginine, arginine, glutamine, lysine, arginine, and phenylananine (Table 2).
This Fusion protein cleavage site amino acid sequence analysis of these APMV-1 isolates indicated the
presence of multiple basic amino acids at the C-terminus of the F2 region and phenylalanine at the N-
terminus of the F1 region confirming the velogenic nature of the viruses.
Phylogenetic analysis of the NDV Jordanian isolates carries motif in the cleavage site of the
fusion protein which is consistent with motif present in most velogenic NDV isolates of the 5d
lineage; class II (Rui et al., 2010). A Phylogenetic tree of the Jordanian isolate compared with other
NDV sequences is shown in (Fig. 1).
The majority of velogenic NDV strains Africa and Asia are of lineage 5d (Berhanu et al., 2010;
Bogoyavlenskiy et al., 2009). In particular, in China most isolated NDV strains are of lineage 5d (Liu et
al., 2007). The Jordanian NDV isolate (Chicken/Jordan/Jo11/2011) had a nucleotide similarity in the
sequenced fragment of fusion gene of 99.4% to the Chinese strain SG/Liaoning/2009 and 95.3% to the
NDV of lineage 5d. The Chinese strain SG/Liaoning/2009 was isolated from a broiler chicken (age 22
days) in 2009 with a MDT of 45 h. The nucleotide similarity in the sequenced fragment of the fusion
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
87
Table 2: Avian Paramtxoviruses-1 (Velogenic Newcastle) isolates from different poultry flocks
Flock Numbe
r of
Isolates
Typing Molecular
patotype
(F protein)
ICPIa Serum Amino acid sequence at
cleavage site (112-117)
Backyard 6 PMV1 (Newcastle) RRQKR*FA Velogenic 0.8- 1.6
Broiler 2 PMV1 (Newcastle) RRQKR*FA Velogenic 1.7
Layer 5 PMV1 (Newcastle) RRQKR*FA Velogenic
Breeder 3 PMV1 (Newcastle) RRQKR*FA Velogenic 1.7
Turkey 1 PMV1 (Newcastle) RRQKR*FA Velogenic 1.7
Peacock 1 PMV1 (Newcastle) RRQKR*FA Velogenic Not done
Ostriches 1 PMV1 (Newcastle) RRQKR*FA Velogenic 1.8
Total 19 a ICPI = Intracerebral Pathogenicity Index; A Amino acid symbols = F = phenylananine, G = glycine,
K= lysine, Q = glutamine, R = arginine; Basic amino acids shown in bold.
Fig. 1: Phylogenetic tree of the nucleotide sequences of the partial fusion gene fragment of NDV
isolated and the references strains from GenBank database. Sequences were aligned by using BioEdit
(v 7.0.5.3) and MUSCLE (v 3.7) programmes. Maximum likelihood (ML) phylogenetic analysis with
bootstrap values for n = 100 replicates was performed using PhyML phylogenetic interface. The
Jordanian NDV strain (NDV-Chicken/Jordan/Jo11/2011) is closely related to the Chinese strain
China/SG/Liaoning/2009 and belongs to the lineage 5d.
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
88
gene of the Jordanian NDV to other NDV lineages was in the range of 83–90.6% with the lowest
similarity to NDV lineage 2 and the highest to NDV lineage 5c. Two Israeli NDV strains
(Peacock/Israel/IS 903/2008 and Chicken/Israel/IS 875/2008) were compared to the Jordanian NDV
isolate; the nucleotide similarity between these isolates was 94.7% and both Israeli NDV strains were
of the lineage 5d.
The Jordanian NDV isolate had a MDT of 46 h, which confirms the velogenic nature of this
isolate. According to the World Animal Health Information Database (WAHID) Interface
www.web.oie.int/wahis/public.php?page=dis- ease_immediate_summary, (accessed 05.09.11), recent
NDV outbreaks were reported in Honduras (1 outbreak), Mexico (2 outbreaks), Peru (3 outbreaks),
Sweden (1 outbreak) and Israel had 84 outbreaks. The most recent NDV outbreaks in Israel started
in mid-December 2010. The high nucleotide similarity between the Chinese strain SG/Liaoning/2009
and the Jordanian NDV isolate suggests that the source of the Jordanian NDV isolates may came
from China, as NDV outbreaks of South African NDV strains, have also been demonstrated to be
closely related to Chinese strains (Abolnik et al., 2004). Wild birds are considered to be the natural
reservoir of NDV and were blamed for certain NDV outbreaks (Burridge et al., 1975). Also they may
play a role in the evolution and the transmission of NDV to domestic fowl (Jindal et al., 2009; Kim et
al., 2007) and they might be responsible for the introduction of the Chinese NDV strain to Jordan.
Prevention and control strategies
Each method of NDV spread in prevention policies regardless if the control is applied at
international, national or at farm level needs to be considered in prevention of susceptible birds from
infection. Reduction of the number of susceptible birds can be achieved by vaccination.
The importance of biosecurity and preventing domestic poultry from contacting other birds
needs reinforcement. High levels of biosecurity on the farm certainly minimize the risk of
introduction of any poultry diseases in the poultry house. Biosecurity must be designed taking into
account requirements for each location. Water and feed quality and pest and litter management are
areas that need to be tightly controlled. Routine disinfection and cleaning procedures and post-
outbreak protocols should be in place prior to an ND outbreak. Biosecurity measures also should be
employed in backyard bird situations.
Prevention of wild birds to gain access to poultry houses is probably still the main source for
virus introduction. Training programs for poultry worker on the implementation of biosecurity
practices and sound vaccination programs should be employed. Providing Quarantine stations for
imported cage birds to ensure they were not infected and shedding the viruses. Mandatory
vaccination of racing pigeons should be implemented.
In many countries ND is often controlled by identifying and culling infected birds while
simultaneously restricting the movement of birds and bird products within a defined area surrounding
the infected birds. Disposing of infected carcasses and litter without further disseminating the virus is
problematic.
Ring vaccination around an outbreak may be employed according to country control policy. Since
all APMV serotypes are known or likely to have wild bird reservoirs that can spill over to poultry,
vaccination of wild bird species should also be considered as they continue to harbor virulent NDV
worldwide. Vaccines should decrease or prevent virus shedding from vaccinated birds especially in
endemic countries as seen in avian influenza vaccine development.
Vaccination policies vary with each country. Preventative or prophylactic vaccination is allowed in
most countries of the world. Estonia, Finland, and Sweden currently do not allow preventative
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
89
vaccination of chickens. Finland also prohibits the rearing of poultry outside for portions of the year
when they are more likely to mingle with wild birds (Suarez, 2013).
Conclusion
It appears to be that APMVs circulating efficiently in Jordanian poultry industry and it is the first
report regarding APMV-2 (Yucaipa) circulation in Jordan. Newcastle is a devastating disease and
requires continuous surveillance programs to be implemented. The presence of multiple NDV strains
in the Far East and highly transmissible nature of the virus can complicate and increase the cost of
attempts to prevent the spread of infection to the Middle East and other parts of the world.
Biosecurity measures should be strictly implemented along with sound vaccination programs and
good managemental practices at the farm level and backyard flocks. Reporting system should be
implemented and needs to be upgraded by the Governmental and the private industry in Jordan.
Acknowledgments
The authors like to thank Jordan University of Science & Technology, Veterinarians in Jordan Ministry
of agriculture and Dr. Ilarea Capua research team OIE/FAO Reference Laboratory for Newcastle
Disease and Avian Influenza, Istituto Zooprofilattico Sperimentale delle Venezie, Viale dell'Università,
10, 35020, Legnaro, Padova, Italy.
References
Ababneh MK, AE Dalab, SR Alsaad, MB Al-Zghoul and MQ Al-Natour, 2012. Molecular
characterization of a recent Newcastle disease virus outbreak in Jordan. Res Vet Sci, 93: 1512-
1514.
Abolnik C, RF Horner, SP Bisschop, ME Parker, M Romito et al., 2004. A phylogenetic study of South
African Newcastle disease virus strains isolated between 1990 and 2002 suggests epidemiological
origins in the Far East. Arch Virol, 149: 603-619.
Aldous EW, JK Mynn, J Banks, DJ Alexander, 2003. A molecular epidemiological study of avian
paramyxovirus type 1 (Newcastle disease virus) isolates by phylogenetic analysis of a partial
nucleotide sequence of the fusion protein gene. Avian Pathol, 32: 239-256.
Berhanu A, A Ideris, AR Omar and MH Bejo, 2010. Molecular characterization of partial fusion gene
and C-terminus extension length of haemagglutininneuraminidase gene of recently isolated
Newcastle disease virus isolates in Malaysia. Virol J, 7: 183.
Bogoyavlenskiy A, V Berezin, A Prilipov, E Usachev, O Lyapina et al., 2009. Newcastle disease
outbreaks in Kazakhstan and Kyrgyzstan during 1998(2000), 2001, 2003. 2004, and 2005 were
caused by viruses of the genotypes VIIb and VIId. Virus Genes 39: 94-101.
Burridge MJ, HP Riemann and WW Utterback, 1975. Methods of spread of velogenic viscerotropic
Newcastle disease virus in the Southern Californian epidemic of 1971–1973. Avian Dis, 19: 666–
678.
Briand FX, A Henry, P Massinand and V Jestin, 2012. Complete genome sequence of a novel avian
paramyxovirus. J Virol, 86: 7710.
Capua I, PM Dalla, F Mutinelli, S Marangon and C Terregino, 2002. Newcastle disease outbreaks in
Italy during 2000. Vet Rec, 150: 565–568.
CEC, 1992. Council Directive 92/66/EEC of 14 July 1992 introducing Community measures for the
control of Newcastle disease. Off J Eur Comm, L260, pp: 1-20. European Union (EU).
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
90
Fornells LA, TF Silva, I Bianchi, CE Travassos, MH Liberal et al., 2012. Detection of paramyxoviruses
in Magellanic penguins (Spheniscus magellanicus) on the Brazilian tropical coast. Vet Microbiol,
156: 429–433.
Gould AR, JA Kattenbelt, P Selleck, E Hansson, A Della-Porta et al., 2001. Virulent Newcastle disease
in Australia: molecular epidemiological analysis of viruses isolated prior to and during the
outbreaks of 1998–2000. Virus Res, 77: 51–60.
International Committee on Taxonomy on Viruses. 2012. Virus Taxonomy: Ninth Report of the
International Committee on Taxonomy of Viruses. Academic Press, Waltham, MA.
Jindal N, Y Chander, AK Chockalingam, de M Abin, PT Redig et al., 2009. Phylogenetic analysis of
Newcastle disease viruses isolated from waterfowl in the upper midwest region of the United
States. Virol J, 6: 191.
Kim, LM, DJ King, PE Curry, DL Suarez, DE Swayne et al., 2007. Phylogenetic diversity among low-
virulence Newcastle disease viruses from waterfowl and shorebirds and comparison of genotype
distributions to those of poultry-origin isolates. J Virol, 81: 12641–12653.
Kaleta EF and C Baldauf, 1988. Newcastle disease in free living and pet birds. In: Newcastle Disease.
D.J. Alexander, ed. Kluwer Academic Publishers, Dordrecht, Netherlands; Boston,
Massachusetts, USA, 197–246.
Liu H, Z Wang, Y Wu, D Zheng, C Sun et al., 2007. Molecular epidemiological analysis of Newcastle
disease virus isolated in China in 2005. J Virolog Meth, 140: 206–211.
Miller PJ, EL Decanini and CL Afonso, 2010(b). Newcastle disease: evolution of genotypes and the
related diagnostic challenges. Infection, Gen Evol, 10: 26–35.
Miller PJ, EL Decanini and CL Afonso, 2010. Newcastle disease: evolution of genotypes and the
related diagnostic challenges. Infec, Gen Evol, 10: 26–35.
Miller PJ, CL Afonso, E Spackman, MA Scott, JC Pedersen et al. 2010(a). Evidence for a new avian
paramyxovirus serotype 10 detected in Rockhopper penguins from the Falkland Islands. J Virol,
84:11496–11504.
OIE, 2000. Biological Standards Commission. Report of the meeting of the OIE Standards Commission.
OIE, Paris.
OIE, 2008. Manual of diagnostic tests and vaccines for terrestrial animals. Available from:
<http://www.oie.int/eng/normes/mmanual/A_summry.htm>.
OIE, 2012. Manual of diagnostic tests and vaccines for terrestrial animals: mammals, birds and bees.
Biological Standards Commission, Vol. 1, Part 2, Chapter 2.03.14. OIE, Paris. 1–19.
Rui Z, P Juan, S Jingliang, Z Jixun, W Xiaoting et al., 2010. Phylogenetic characterization of Newcastle
disease virus isolated in the mainland of China during 2001–2009. Vet Microbiol 141: 246–257.
Suarez DL, 2013. Newcastle Disease, Other Avian Paramyxoviruses, and Avian Metapneumovirus
Infections Chapter 3 in: Diseases of Poultry, Thirteenth Edition. David E Swayne. pp: 89-138. ©
2013 John Wiley & Sons, Inc. Published 2013 by John Wiley & Sons, Inc.
World Animal Health Information Database (WAHID) Interface
www.web.oie.int/wahis/public.php?page=dis- ease_immediate_summary, (accessed 05.09.11),
Wu S, W Wang, C Yao, X Wang, S Hu et al., 2010. Genetic diversity of Newcastle disease viruses
isolated from domestic poultry species in Eastern China during 2005–2008. Arch Virol, 2: 253–
261.
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
91
RESEARCH PROGRESS ON A NOVEL DUCK FLAVIVIRUS DISEASE
Sufang LV, Guangjun GUO, Guanggang Qu, Feng LI, Ling MO and Zhiqiang SHEN*
Shandong Binzhou Animal Science & Veterinary Medicine Institute, Binzhou 256600, China; Shandong
Lvdu Bio-industry Co., Ltd., Binzhou 256600, China
*Corresponding Author: bzshenzq@163.com
ABSTRACT
A severe egg drop disease caused by the infection of a novel duck flavivirus outbroke successively
in many provinces in southeastern China since 2010. It was identified as a duck Tembusu virus
(DTMUV) and was named by Chinese Association of Animal Science and Veterinary Medicine in the
first symposium on waterfowl disease control, which was presumed to be a mosquito-borne flavivirus
of the Ntaya virus subgroup in the genus Flavivirus, family Flaviviridae. Currently, a large number of
studies have been conducted on the epidemiology, clinical symptoms and pathological changes,
etiology, and rapid diagnoses of the virus. The disease remains a constant threat to the duck industry.
In order to provide reference for subsequent in-depth study, in this paper, research progress on the
disease was summarized based on previous studies. Furthermore, the potential infection or
asymptomatic infection in humans should be evaluated as soon as possible.
Key words: Duck; Duck flavivirus; Research progress
INTRODUCTION
Since April 2010, a novel duck disease outbroke successively in Zhejiang, Fujian, Guangdong,
Guangxi, Jiangsu, Jiangxi, Anhui, Henan, Hebei, Shandong and Beijing, especially in most duck farms in
mid-eastern China. The disease mainly led to a serious decline in egg laying rate with rapid
propagation and wide range of infection. Infected ducks get a high fever at the early stage and exhibit
certain neurological symptoms at the late stage, such as paralysis, tumbling, astasia and ataxia. The
course of disease lasts 1-2 months. Resistant ducks can gradually recover laying capability, with an
elimination rate of approximately 10-30%. The disease causes serious economic losses to the duck
industry in China. According to previous studies, a new flavivirus was isolated from the tissues of
infected ducks, which was named as BYD (Bai Yang Dian) virus based on the geographical
nomenclature principle [1]. Infection of duck flavivirus will cause severe decline in egg laying rate and
ovarian inflammation in ducks. Therefore, the disease is also known as duck egg-drop syndrome, duck
infectious ovaritis, duck flavivirus infection and duck Tembusu virus infection. In the first symposium
on waterfowl disease control held by Chinese Association of Animal Science and Veterinary Medicine
in 2011, the disease was named as duck Tembusu virus disease. The pathogen is indentified as a novel
flavivirus ——duck Tembusu virus, which is a mosquito-borne flavivirus of the Ntaya virus subgroup
in the genus Flavivirus, family Flaviviridae. In this paper, the epidemiology, clinical symptoms and
pathological changes, etiology, diagnoses and detection of duck Tembusu virus disease was
summarized, which provided scientific basis for the prevention and control of this disease.
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
92
Epidemiological Analysis
Under natural conditions, duck flavivirus (DFV) can infect all varieties of wild ducks and egg-
laying ducks (such as Shaoyang duck, Shanma duck, Jinyun duck and Jinding duck) except Muscovy
duck, and the susceptible animal populations tend to expand. Duck Tembusu virus disease possesses
rapid spread speed and wide propagation range, which outbreaks successively from south to north,
showing certain epidemicity. Once propagated, laying ducks in the farm will all be infected with the
disease, which outbreaks rapidly and can generally spread throughout the duck population within 3-7
d. According to previous studies, ducks with early onset of disease exhibit relatively low mortality,
while those with late onset exhibit high mortality and serious disease condition. In general, older
meat-type breeding ducks are susceptible to the disease and recover slowly, which can recover laying
capability two weeks later post-recovery and the laying rate can achieve 90% of the original level after
a month. So far, the pathogenesis and propagation mechanism of the disease are unclear yet.
According to clinical observations, horizontal propagation through the respiratory tract is an
important pathway. Most members in genus Flavivirus can be propagated by mosquitoes. Therefore,
duck Tembusu virus may be propagated through hemophagous bugs such as mosquitoes. However,
the disease was still highly prevalent by the end of 2010, indicating that its propagation is not simply
dependent on mosquitoes (Su et al., 2011). In clinical practices, the detection rate of duck Tembusu
virus in theca folliculi of infected ducks reaches the highest, suggesting that the virus may also be
propagated vertically. Duck Tembusu virus has been isolated from cloacal swabs, which indicates that
the virus may be discharged through excrement, thus polluting the environment, feeds, equipments,
eggs, egg trays, water and conveyances.
In addition to the ducks, Tembusu virus can also infect geese, sparrows, pigeons and other
species. Huang et al. (2012) reported that a flavivirus disease occurred continuously in a goose farm of
Jiangsu Province since April 2010; the brains, lungs, livers, hearts and ovaries all exhibited different
degrees of hemorrhage, congestion, swelling and spleen necrosis after dissection; a goose flavivirus
strain JS804 was isolated from the issues of diseased geese. Therefore, flavivirus can infect both ducks
and geese, which may be one of the reasons for the rapid spread and high pathogenicity of flavivirus
diseases. Liu et al. (2012) analyzed liver, brain, kidney, spleen and ovarian samples from 245 diseased
chickens and 57 diseased geese with NS5 gene-targeting RT-PCR method and found that 56.1% of
chicken samples and 38.6% of goose samples were infected with Tembusu virus, which led to a
significant decline in egg laying in animal regression tests. Lin et al. (2012) investigated the
susceptibility of chickens to duck flavivirus and found that duck flavivirus in chickens could not form
detectable viremia due to the low viral replication load; the reproductive system of chickens was not
the target organ of flavivirus, thus the infected chickens exhibited no significant clinical symptoms or
gross lesions. Tang et al. (2012) isolated flavivirus from dead house sparrows in a duck farm of
Shandong Province that could induce serious egg-drop disease in ducks. A pathogenicity test was
conducted by injecting the isolated flavivirus into ducks; results showed that the isolated virus was a
virulent strain, which revealed that house sparrows played an important role in the spread of viruses
among various species.
Clinical Symptoms and Pathological Changes
In clinical practices, duck Tembusu virus disease leads to rapidly decreased food intake, greatly
reduction in egg laying rate, significant drop of yield or even death. The egg laying rate could decline
from 90% to below 10% within 4-5 d. The disease occurs mainly in egg-laying ducks and breeding
duck. Previous studies reported that duck Tembusu virus disease could occur in 3-21-days old ducks
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
93
(Yun et al., 2012). All varieties of ducks can be infected with Tembusu virus except Muscovy duck.
Egg-laying ducks infected with Tembusu virus exhibit increasing temperature, reducing food intake
and increasing water intake, mainly exhaust yellow-green loose stools on the 3rd d after the onset;
younger multi-batch breeding ducks are more susceptible to the disease; egg-laying ducks bred by
more than 60 weeks exhibit later onset of the disease and more serious disease condition; the
mortality rate is positively correlated with the control of secondary bacterial infection, which mainly
ranges between 3%-10%. In the incubation period, breeding ducks exhibit onset of the disease at
around 10 weeks old; disease cases first occurred in drakes, showing fervescence, depression, loss of
appetite and beak cyanosis, with the mortality rate lower than 5%. Commercial ducks exhibit onset of
the disease at around 20 days old and exhaust white watery stools.
After necropsy observations, diseased ducks mainly present ovarian dysplasia, increased
congestion in fallopian tube and hemorrhagic secretions, follicular degeneration, follicular hyperemia
and hemorrhage, a large amount of blutene chloaides on heart surface, pale myocardium, commonly
inner membrane bleeding, occasionally outer membrane bleeding, cord necrosis, liver swelling and
yellowing, mottled and marble-like spleens with occasional extreme swelling and cracking and surface
bleeding or needle-like white spotty necrosis, meningeal congestion and hemorrhage, cerebral edema,
hyperemia or bleeding, and varying degrees of pancreatic lesions in small intestines, kidneys and
pancreas.
In addition, diseased ducks exhibit various histopathological changes, including severe hepatic
steatosis, expanding bile capillary filled with bile pigments, inflammatory cells infiltrating around blood
vessels, decreased leukomonocytes in liver, intestinal villi shedding with loose lamina propria and a
large amount of inflammatory cells, significantly expanding oviduct vessels, a large amount of
erythrocytes in vessels, a large number of inflammatory cells infiltrating in epithelial tissue with loose
lamina propria, a large amount of degenerated and necrotic inflammatory cells in strata subserosum
and muscle cell layer with significant haemorrhage symptom, myocardial hemorrhage, necrosis of
myocardial fibers with occasional calcification and inflammatory cells infiltrating around fibers,
epicardial structural disorder with a large number of degenerated and necrotic inflammatory cells,
focal necrosis in pancreas, renal tubular epithelial cell swelling, cerebral vasodilation with a large
number of erythrocytes, swelling, degeneration and necrosis of nerve cells infiltrated with
inflammatory cells, significant "satellite phenomenon", inflammatory cells infiltrating in meninx,
softening and necrosis in cerebellum, partial necrosis in cerebral cortex, glandular gastric epithelial
cell degeneration and exfoliation, and a large number of inflammatory cells in the glandular cavity.
Etiological Analyses
Pathogens and taxonomic status
According to various literatures and reports, based on electron microscopy, analysis of physical and
chemical characteristics, molecular biology identification and artificial infection test, in accordance
with the international classification standards for Flavivirus members, approximately 1 kb sequence in
the 3' end of NS5 gene shares above 84% homology with the nucleotide sequence of the same species
of viruses, which indicates that the pathogen causing the serious egg-drop disease in China is a novel
duck flavivirus (DFV) that belongs to mosquito-borne flavivirus of the Ntaya virus subgroup in the
genus Flavivirus, family Flaviviridae. Flavivirus is a large group of single-strand RNA viruses, including
Japanese encephalitis virus, yellow fever virus, dengue virus, Ntaya virus and more than 70 members,
which have common antigenic determinants. Flavivirus strains can be divided into eight serum
subgroups and nine single serotypes. The incubation period of Flavivirus in mammals lasts about 12-18
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
94
h and the duration of virus proliferation exceeds 3-4 d, which commonly causes non-dominant
infection in mammals and birds. Under natural conditions, Flavivirus is mainly spread by arthropods.
Biological characteristics of the pathogen
DFV has typical morphology of flavivirus. The virions are spherical, enveloped and 40-50 nm in
size, covered with spikes on the surface, which are mainly replicated in the cytoplasm of infected
cells. DFV is sensitive to chloroform, ether and deoxycholate that can be inactivated by 5%
chloroform, which is also sensitive to acid and alkali, with the optimal pH of 6-9. DFV is not resistant
to heat that can be inactivated by heating at 56 ℃ for 20 min or heating at 60 ℃ for 15 min. DFV can
not agglutinate erythrocytes of chickens, ducks, geese, pigeons, pigs, rabbits, rats and humans. DFV
can be propagated in duck embryos, chicken embryos, duck embryo fibroblasts (DEFs) and some
continuous cell lines such as Vero, human embryonic kidney cells (HEK293), vertebrate cells (DF-
1/BHK-21) and mosquito cells (C6/36), causing significant cytopathy. The diseased cells become
round, float and disintegrate, which can not be propagated in chicken embryo fibroblasts (CEFs) (Yun
et al., 2012). Compared with chicken embryos, DFV is rapidly propagated in duck embryos with
significant lesions. Therefore, duck embryos are more suitable for the isolation of DFV. Liao et al.
(2011) inoculated SPF chicken embryos with the isolated strain and found that the virus was highly
lethal to chicken embryos; its pathogenicity to chicken embryos (10-4.4 ELD50/0.2 ml) and to duck
embryos (10-4.6 ELD50/0.2 ml) was similar.
Molecular structure characteristics of the pathogen
DFV nucleic acid belongs to unsegmented infectious single-strand positive strand RNA consisting
of approximately 10 990 nucleotides containing a single open reading frame (ORF), 5' untranslated
region (UTR) and 3' untranslated region (UTR). The genomic structure is 5'-UTR-Cv-Ci-PrM-M-E-
NS1-NS2A-NS2B-NS3-NS4A-NS4B-NS5-UTR-3'. The 5'-UTR is 142 nt in length, containing a I-type
m7GpppNp cap structure. The 3'-UTR is 618 nt in length without poly (A) tail structure. UTR is the
initiation site for replication of flavivirus genome that affects the replication, translation and
pathogenicity of DFV. The 3'-UTR contains partial conserved sequences. The single open reading
frame consists of approximately 3425 aa and encodes 11 proteins. The structural proteins are located
on the 5' end, including capsid protein C, membrane proteins PrM and M, and envelope protein E. C
proteins contain a large amount of basic amino acids and are involved in viral assembly process; E
proteins can promote the fusion between virus and host cells, and induce the production of
neutralizing antibodies. There are seven non-structural proteins, including NS1, NS2A, NS2B, NS3,
NS4A, NS4B and NS5. Specifically, NS1 is the major immunogen in virus infection process (Yan et al.,
2011; Liu et al., 2012; Liu et al., 2012; Tang et al., 2012; Yun et al., 2012). At present, little information
is available on molecular biology of DFV. The functions of various genes and the mechanism of virus
infection still require further investigation.
Liu et al. (2012) analyzed genome sequence and domain of the isolated strain and found that the
C-terminal of NS3 protein contained conserved RNA helix domain (D285-E286-A287-H288), and C-
terminal of NS5 protein contained RNA-dependent RNA polymerase domain (G667-D668-D669).
Yun et al. (2012) predicted secondary structure of three isolated strains and found that conserved
sequence of 3' untranslated region was RCS3-CS3-RCS2-CS2-CS1 (the sequence played an important
role in virus replication process), with a typical number of cysteine residues in flavivirus: the number
of PrM proteins, E proteins, NS1 proteins were 6, 12 and 12, respectively (similar to the study of Liu
et al. (2012), and the number of potential N-linked glycosylation sites were 2, 1 and 3, respectively
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
95
(different from the study of Liu et al. (2012)). Currently, the function of these sites is unclear. Some
scholars believe that these sites may play a certain role in virus replication, virulence, maturation and
release of virions, which provides important reference for subsequent research of virus replication
and pathogenesis. Li et al. (2013) cloned full-length cDNA of JXSP strain and obtained a large number
of viruses by transfecting cDNA into BHK-21 cells. The growth characteristics in BHK-21 cells and
toxicity to ducklings and BALB/c mice were similar to parental virus. The cloning of stable infectious
full-length cDNA provides valuable reference for further investigating the genetic characteristics of
the virus.
Diagnosis and Detection Methods
In general, duck flavivirus disease can be diagnosed preliminarily based on the onset age,
symptoms and pathological changes in clinical practices. By subsequent etiological and serological
diagnosis in the laboratory, duck flavivirus disease can be distinguished from other common duck
diseases including avian influenza virus and egg-drop syndrome which can also lead to egg laying
abnormality. Generally, duck Tembusu virus can not agglutinate erythrocytes of chickens, ducks,
pigeons and Bab1 / c mice. Therefore, it can be identified by 1% chicken erythrocyte hemagglutination
test and hemagglutination-inhibition test. At present, neutralization test, enzyme-linked
immunosorbent assay (ELISA), and molecular biology diagnostic technology are commonly used for
the diagnosis of DFV in laboratory.
Antibody detection method
Conventional serological method can be used to detect the level of virus-specific antibodies in
serum samples. Neutralization test targeting acute stage and recovery stage is one of the most
important methods for serological diagnosis. In addition, ELISA is also a commonly used method in
serological detection, which has been widely used. Li et al. (2012) developed E protein-specific
monoclonal antibody of FX2010 strain and established an ELISA method to block virus neutralizing
antibodies in serum that was rapid, sensitive and highly specific, with a coincidence rate of 70.6% in
serum neutralizing antibody test using chicken embryos. Ji et al. (2011) for the first time established
an indirect ELISA method for detecting DFV serum antibodies using purified DFV FX2010 strain as a
coating antigen and optimized various detection conditions; results showed that the optimal coating
concentration was 1.675 μg/hole, the optimal coating condition was placing at 37 ℃ for 2 h and at 4
℃ overnight, the optimal dilution for serum and secondary antibodies was 1:200 and 1:2000
respectively, and the threshold criteria was 0.432; according to the application results, the established
method exhibited high specificity, sensitivity and stability. Hao et al. (2012) established an indirect
ELISA method for rapid detection of DFV antibody using recombinant E protein as a coating antigen,
which provided technical means for serological monitoring of the disease.
Antigen detection method
With the continuous deepening of DFV studies, related molecular biology methods have been
constantly established and improved. Wan et al. (2011) designed primers based on NS5 gene
sequence of flaviviruss and established a RT-PCR method. Tang et al. (2012) established semi-nested
RT-PCR rapid detection method but results showed that RT-PCR and semi-nested RT-PCR exhibited
inadequate sensitivity and easily led to false positive results. Huang et al. (2012) designed two pairs of
primers according to gene sequence of goose flaviviruss JS804 strain and established a nested RT-PCR
method for detection of avian flavivirus, which exhibited strong specificity and 1 000 times higher
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
96
sensitivity than conventional RT-PCR. The established method was applied to detect clinical samples
and results showed that the positive rate was 58.14%, while that of conventional RT-PCR was only
17.44%. Hao et al. (2012) and Zhang et al. (2012) established nested PCR detection systems with 1
000 times higher sensitivity than conventional RT-PCR. Yun et al. (2012) established a real-time RT-
PCR method with strong specificity and the minimum detectable value of RNA was 1 copies/reaction;
with the established method, the experimental process including nucleic acid extraction could be
completed within 2 h, suggesting that it was an ideal method for clinical diagnosis and epidemiological
investigation. Based on the isolated duck Tembusu-like BYD virus and other viruses with close
genetic relationship, Wang et al. (2011) designed six primers according to E protein gene and
established a one-step RT-LAMP detection method for gene amplification monitoring using SYBR1
green fluorescent protein as a marker. Based on a series of clinical detection and verification, RT-
LAMP method was simple and fast, which could be completed within 50 min.
Compared with the sensitivity of conventional RT-PCR (190 copies/μl), the minimum detection
limit for RNA of RT-LAMP method was 2 copies/μl. Therefore, RT-LAMP method was more suitable
for detection in basic laboratories or common laboratories without special equipments. Jiang et al.
(2012) established RT-LAMP method and SYBR Green1 real-time quantitative RT-PCR method for
laboratory evaluation and detection of clinical samples. Results showed that these two methods
possessed good specificity and high sensitivity, with the minimum detection limit of 1 × 10 -4 and 1×10-
3 PFU/reaction, respectively. The fluorescence method was more suitable for quantitative analysis.
The study also found that the spleen might be a major target organ for virus replication, which
provided a powerful tool for the diagnosis and epidemiological investigation of Tembusu virus. Yan et
al. (2011) and Gao et al. (2013) accurate, rapid, quantitative TaqMan real-time quantitative RT-PCR
methods. The RT-PCR method established by Yan et al. (2011) showed 100 times higher sensitivity
than conventional RT-PCR method; the method established by Gao et al. (2013) could detect 1.9
TCID50 viral nucleic acids at least. Yan et al. (2012) established a real-time RT-LAMP method and a
real-time RT-PCR method for comparison; results indicated that these two methods exhibited similar
sensitivity and good specificity with the minimum detection limit of 0.01 ELD50; in addition, the
reproducibility of RT-PCR method was slightly higher than that of RT-LAMP method. Overall, RT-
LAMP method was more convenient and easier with good sensitivity and high specificity, which could
be popularized and applied in resource-limited grassroots. Tang et al. (2012) also established an RT-
LAMP method for rapid detection; SYBR Green1 fluorescent dye was added and incubated at 64℃
for 45 min. Results showed that the minimum detection limit for RNA was 10 copies/μl; the
established method shared no cross reactions with other similar viruses, which was more convenient,
time-saving and labor-saving, with good specificity. Gao et al. (2012) amplified NS3 gene fragment of
DFV with RT-PCR technology and prepared digoxigenin-labeled nucleic acid probes; results indicated
that the probes had good specificity and the minimum detection limit for RNA was 100 μg/L. The
liver, lung, spleen, theca folliculi and cloacal swabs of suspected flavivirus-infected ducks were
detected; results indicated that the detection rate in theca folliculi was the highest, which provided a
reliable method for the studies of epidemiology and etiology of DFV.
Prevention and Control Measures
Currently, it is difficult to prepare inactivated vaccines of DFV due to its low reproducibility in
chicken and duck embryos and extremely low titer. No genetically engineered vaccines have been
developed for the prevention and control of DFV. Some research institutes produced vaccines using
the isolated virus and achieved some results. Recovered ducks will no longer be infected with the
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
97
disease. Therefore, infected ducks can be treated by injecting egg yolk antibody of recovered ducks.
In our laboratory, specific serums of diseased ducks were collected one week after the onset for
treating DFV disease. Results showed significant prevention and control effect; injecting the specific
serums could rapidly relieve the symptoms of diseased ducks, improve appetite, and accelerate the
recovery of egg-laying capacity. Based on pathogenicity test and whole-genome sequence analysis,
Wan et al. (2011) selected highly pathogenic and stably propagated WR strain from five DFV strains
and developed inactivated oil emulsion vaccine; results showed that the developed inactivated oil
emulsion vaccine was safe, non-toxic and side effect-free, exhibiting good immune protection effects
on DFV virulent strain. Xu et al. (2012) confirmed that immunizing mice with E gene-encoding
recombinant plasmid DNA could induce effective immune responses, which laid foundation for
subsequent development of DNA vaccine. Han et al. (2012) investigated the formation and fluctuation
laws (virusemia period) of virusemia in Pekin ducklings and sheldrakes infected with duck flavivirus,
which provided reference for evaluation of vaccine potency and determination of the specific blood
collection time after infection. Pekin ducklings infected with flavivirus exhibited short-term (1-8 d)
virusemia at the early stage, the virus load in duck blood reached the maximum at 3.8 d post-infection
(91 h). The positive isolation rate of flavivirus from chicken embryos inoculated with serum samples
of female Pekin ducklings was significantly higher than that of male Pekin ducklings; virusemia in SPF
ducks (sheldrakes) reached the peak at 4 d post-infection.
At present, flavivirus disease is mainly prevented and controlled by strengthening the feeding and
management, standardizing common vaccine immunization programs, implementing all-in / all-out
system, forbidding mixed feeding of chickens, ducks and geese, appropriately adding antibiotics to
reduce secondary (concurrent) bacterial infection, and using detoxifying, heat-clearing and
dehumidifying herbal preparations to improve immunity. Specifically, the farm should be constructed
far away from the highway, slaughterhouses and live animal markets; stocking density should be
reduced, ventilation and insulation should be strengthened; the surrounding environment should be
cleaned and disinfected regularly; mosquitoes should be repelled by establishing mosquito-proof
window; no breeding poultry can be introduced from infected areas; all-in / all-out system should be
implemented; the daily feeding and management should be strengthened by selecting high-quality
feeds; the poultry house and warehouse should be managed strictly to prevent the invasion of house
sparrows; diseased, dead poultry and feces should be removed by innocent treatment.
References
Gao F, KX Yu, XL Ma et al., 2013. Development and application of real-time RT-PCR assay for duck
flavivirus. Chin J Vet Sci, 33: 16-19.
Gao XH, YX Diao, Y Tang, et al., 2012. Preparation of digoxigenin-labeled DNA probe for detection
of duck flavivirus and its application. Chin J Vet Sci, 32: 525-528.
Han CH, J Lin, YH Liu, et al., 2012. Study on the viremia changes of duck infectious by duck
hemorrhagic ovarian inflammation virus (Flavivirus). Proceedings of The 16th Symposium Poultry
Health Branch, Chinese Association of Animal and Veterinary Science, 10:116.
Hao MF, 2012. Development and application of the nested PCR assay for duck tembusu virus and
Recombinant Protein indirect ELISA Assa. Taian: Shandong Agricultural University: 41-44.
Huang X, K Han, D Zhao, et al., 2012. Identification and molecular characterization of a novel
flavivirus isolated from geese in China. Res Vet Sci, pii: S0034-5288(12)00347-5.
Huang XM, DM Zhao, YZ Liu et al., 2012. Establishment and application of a nested RT-PCR method
for detection of avian flavivirus. Anim Husb Vet Med, 44:1-5.
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
98
Ji XW, LP Yan, PX Yan, et al., 2011. Establishment of an indirect ELISA for detection of antibody
against duck Tembusu virus. Chin J Prev Vet Med, 33: 630-634.
Jiang T, J Liu, YQ Deng et al., 2012. Development of RT-LAMP and real-time RT-PCR assays for the
rapid detection of the new duck Tembusu-like BYD virus. Arch Virol, 157: 2273-2280.
Li S, L Zhang, Y Wang et al., 2013. An infectious full-length cDNA clone of duck Tembusu virus, a
newly emerging flavivirus causing duck egg drop syndrome in China. Virus Res, 171: 238-241.
Li X, G Li, Q Teng et al., 2012. Development of a blocking ELISA for detection of serum neutralizing
antibodies against newly emerged duck Tembusu virus. PLoS One, 7: e53026.
Liao M, XD Mu, Y Geng, et al., 2011. The primary study on virus isolation of duck infectious egg
failings. Chin J Anim Infec Dis, 19: 22-26.
Lin J, CH Han, YH Liu et al., 2012. Study on the susceptibility of chicken for duck hemorrhagic ovarian
inflammation virus (Flavivirus). Proceedings of The 16th Symposium Poultry Health Branch,
Chinese Association of Animal and Veterinary Science.
Liu M, C Liu, G Li et al., 2012. Complete genomic sequence of duck flavivirus from China. J Virol, 86:
3398.
Liu M, S Chen, Y Chen et al., 2012. Adapted tembusu-like virus in chickens and geese in China. J Clin
Microbiol, 50: 2807-2809.
Liu P, H Lu, S Li et al., 2012. Genomic and antigenic characterization of the newly emerging Chinese
duck egg-drop syndrome flavivirus: genomic comparison with Tembusu and Sitiawan viruses. J
Gen Virol, 93: 2158-2170.
Su J, S Li, X Hu et al., 2011. Duck egg-drop syndrome caused by BYD virus, a new Tembusu-related
flavivirus. PLoS One, 2011,6(3):e18106.
Tang Y, Y Diao, C Yu et al., 2012. Characterization of a tembusu virus isolated from naturally infected
house sparrows (Passer domesticus) in Northern China. Transbound Emerg Dis, 20.
Tang Y, Y Diao, C Yu et al., 2012. Rapid dsetection of Tembusu virus by reverse-transcription, loop-
mediated isothermal amplification (RT-LAMP). Transbound Emerg Dis, 59: 208-213.
Tang Y, Y Diao, X Gao et al., 2012. Analysis of the complete genome of Tembusu virus, a flavivirus
isolated from ducks in China. Transbound Emerg Dis, 59: 336-343.
Tang Y, YX Diao, XH Gao et al., 2012. Development of a semi-nested RT-PCR assay for detection of
duck flavivirus. Chin J Vet Sci, 32: 517-520.
Wan CH, SH Shi, GH Fu et al., 2011. Development and immune effects determination of duck
flavivirus oil emulsion inactivated vaccine. Poult Husb Dis Cont, 10: 20-22.
Wan CH, SH Shi, LF Cheng et al., 2011. Establishment of RT-PCR for detecting duck hemorrhagic
ovaritis causing abrupt egg-laying reduction in ducks. F J Agri Sci, 26: 10-12.
Wang YL, XY Yuan, YF Li et al., 2011. Rapid detection of newly isolated Tembusu-related Flavivirus
by reverse-transcription loop-mediated isothermal amplification assay. Virol J, 8: 553.
Xu DW, GX Li, XS Li et al., 2012. Construction and immunogenicity of DNA vaccine encoding E gene
of duck Tembusu virus. Chin J Pre Vet Med, 34: 305-308.
Yan L, P Yan, J Zhou et al., 2011. Establishing a TaqMan-based real-time PCR assay for the rapid
detection and quantification of the newly emerged duck Tembusu virus. Virol J, 8: 464.
Yan L, S Peng, P Yan et al., 2012. Comparison of real-time reverse transcription loop-mediated
isothermal amplification and real-time reverse transcription polymerase chain reaction for duck
Tembusu virus. J Virol Meth, 182: 50-55.
Yan P, Y Zhao, X Zhang et al., 2011. An infectious disease of ducks caused by a newly emerged
Tembusu virus strain in mainland China. Virology, 417:1-8.
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
99
Yun T, D Zhang, X Ma et al., 2012. Complete genome sequence of a novel flavivirus, duck tembusu
virus, isolated from ducks and geese in china. J Virol, 86: 3406-3407.
Yun T, W Ye, Z Ni et al., 2012. Identification and molecular characterization of a novel flavivirus
isolated from Pekin ducklings in China.Vet Microbiol, 157: 311-319.
Yun T, Z Ni, J Hua et al., 2012. Development of a one-step real-time RT-PCR assay using a minor-
groove-binding probe for the detection of duck Tembusu virus. J Virol Methods, 181: 148-154.
Zhang L, BX Hu, SG Yan et al., 2012. Development and application of the nested PCR assay for duck
flavivirus. F J Agri Sci, 27: 124-129.
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
100
TOXICOPATHOLOGICAL EFFECTS OF SUB LETHAL DOSES OF
THIAMETHOXAM IN COCKERELS
Shafia Tehseen Gul*, Muhammad Farooq, Ahrar Khan and Maqbool Ahmad1,
Riaz Hussain2 and Shoaib Niaz
Department of Pathology, 1Department of Theriogenology, University of Agriculture, Faisalabad-
38040, Pakistan; 2University College of Veterinary and Animal Science, Islamia University of
Bahawalpur, Bahawalpur-63100, Pakistan.
*Corresponding Author: drshafia66@yahoo.com
ABSTRACT
Thiamethoxam belonged to the sub-class of the nicotinoid insecticide, is a second-generation
neonicotinoid. It provides excellent control of a wide variety of commercially important insect pests
on a variety of crops. The aim of present project was to find out the toxic effects of sub lethal doses
of thiamethoxam in cockerels. A total of 40 cockerels having age about 14 weeks were procured
from local market and divided into five equal groups. Group A was kept as a control and other four
were treated with thiamethoxam. Different doses (mixed in distilled water) were administered
through crop tubing, containing 250, 500, 750 and 1000 mg/kg of body weight to group B, C, D and E,
respectively on daily basis. Four birds from each group were euthanized at 15th and 30th day of
experiment. The blood samples with anticoagulant were collected for hematological parameters like
erythrocyte (RBC) and leukocyte counts (TLC), packed cell volume and hemoglobin concentration
(Hb. Conc.). Different organs like liver, kidney, proventriculus and intestine were also collected for
histopathology. The data thus collected were analyzed through ANOVA and different group means
were compared by Duncan’s multiple range tests using M-stat statistical software package. A
significant decrease in the numbers of RBC was observed in thiamethoxam treated birds as compared
to the control group. In Group D lowest RBC count was noted. The hematocrit values and Hb.
Conc. of groups B, C and D were significantly lower than control group and lowest values were
observed in group D. TLC decreased significantly in group C and D as compared to control group. In
the present study, the specific clinical signs of toxicity were observed in thiamethoxam treated birds.
Typical gross lesions were observed in kidneys, liver and intestine. Relative weight of the liver and
kidneys was increased significantly in groups C and D as compared to control group at day 15 and
30th of trial. Highest relative weights of liver and kidneys were observed in group D. Marked
Microscopic lesions were also noticed in liver, kidney and intestines of treated birds. It was concluded
that sub lethal doses of thaimothaxam can induce toxicity in cockerels.
Keywords: Thiamethoxam, Toxicopathology, Cockerels
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
101
EXPERIMENTAL ADMINISTRATION OF CHLORPYRIFOS AND ARSENIC IN
BROLIER CHICKS: TOXICOPATHOLOGICAL EFFECTS
Muhammad Zishan Ahmad1,2, Ahrar Khan1*, Maqbool Ahmad3,
Muhammad Imran Arshad4 and Sami-Ullah5
1Department of Pathology, University of Agriculture, Faisalabad, Pakistan. 2School of Forensic
Sciences. The University of Faisalabad, Pakistan, 3Department of Theriogenology; 4Institute of
Microbiology, University of Agriculture, Faisalabad, Pakistan. 5Department of Applied Statistics,
University College of Agriculture, University of Sargodha, Pakistan.
*Corresponding Author: ahrar1122@uaf.edu.pk
ABSTRACT
Arsenic (As) is the major contaminant of water leading to deterioration of drinking water quality
in Pakistan. Arsenic results in acute and chronic toxicity that can be exacerbated by exposure to
environmental contaminants. The pesticides are the major contaminants, which are frequently
present in various feeds and food stuffs. In Pakistan the use of insecticides increased in last decade,
which is dangerous to human health. Organophosphate (OP) insecticides the chlorpyrifos (CPF) due
to its broad spectrum activity has a major role agriculture farming. The purpose of present study was
to investigate the concurrent feeding of pesticide CPF in broiler birds and its effects on health
biomarkers. A total of 150 broiler chicks were used in the present study. Arsenic was fed at a dose
rate of 50 mg/kg orally in combination with CPF. The CPF was reconstituted in corn oil as vehicle (1
ml/kg) and it was fed orally through stomach tube at a dose of 5, 10 and 20 mg/kg body weight of
birds for 2 weeks. Birds in control group received corn oil 1ml/kg only. After 2 weeks of feeding, the
birds showed signs of toxicity including salivation, lacrimation, gasping, convulsions, frequent
defecation and tremors in (CPF-20 mg/kg+ As-50mg/kg BW) group. Significant decrease in body
weight was also observed in treated groups as compared with control group. Alterations in
hematological parameters i.e. total erythrocyte counts; hemoglobin concentration, hematocrit and
total leukocyte were observed in high dosed treated group (CPF-20 mg/kg+ As-50mg/kg BW) than
control birds or other low dosed fed birds. Significant decrease in acetylcholinesterase (AChE)
activity and higher levels of serum alanine aminotransferase (ALT) were found in (CPF-20 mg/kg+ As-
50mg/kg BW) fed birds compared to control birds. Moreover, histopathological changes including
necrotic and degenerative changes were observed in various internal organs of As-CPF exposed
birds. It is concluded that the co-exposure of chlorpyrifos and arsenic induced toxico-pathological
changes in broiler birds.
Key Words: Arsenic, Environmental Intoxication, Broiler Birds, Health Biomarkers
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
102
POST MORTEM BASED STUDY ON BROILER DISEASES IN TRADITIONALLY
MANAGED FARMS OF AZAD KASHMIR
Zaheer Hanif1, Asim Shamim2* and Azar Hayat1
1Ittfaq Poultry Disease Diagnostic Laboratory and Clinic® Private Limite, Muzaffarabad, Azad
Kashmir, 2Department of Pathobiology, Faculty of Veterinary and Animal Sciences, The University of
Poonch, Rawalakot, Azad Kashmir
*Corresponding Author: asimshamimuajk@gmail.com
ABSTRACT
Broiler rearing is a source of income for farmers and its consumption is cradle of protein for
consumers. Diseases of viral, bacterial and protozoal origin effect broiler production and economics
of business. The present study designed to evaluate the frequency of diseases in broiler rearing
traditionally in and around of Muzaffarabad, capital of Azad Kashmir for the period of one year from
January, 2014 to December, 2014. For the said purpose, a random sampling technique was applied for
the collection of samples. A total of 1000 broiler were collected from more than hundred farms
which is located at different places of Muzaffarabad, Azad Kashmir. Broiler were kept in separate
polythene bags which were properly labelled and brought to the Ittfaq poultry disease diagnostic
laboratory and clinic® located in the heart of Muzaffarabad city for clinical examination. Postmortem
was performed in order to get clear picture of diseases. The following diseases were observed and
recorded during the study period in decreasing trend on the basis of their clinical manifestation and
lesions present on their affected parts including, Infectious Bursal Disease, Collibacilois, Enteritis,
Chronic Respiratory Disease, Coccidiosis, New Castle Disease and Hydropericardium Syndrome.
The frequency of observed diseases were significantly different at each farm levels, in different age
groups and seasonally. However, ratio of viral origin diseases was significantly higher in wet season,
whereas bacterial diseases pattern was hig--h in dry season in the study area. Timely vaccination,
treatment and proper management for better health and production are recommended.
Key Words: Broiler, Post-Mortem, Diseases, Muzaffarabad, Azad Kashmir
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
103
CLINICO-HEMATO-BIOCHEMICAL STUDIES OF NEWCASTLE DISEASE IN
ARSENIC INTOXICATED BROILER CHICKS
Hafiz Iftikhar Hussain1, Ahrar Khan1*, Cheng He2, Adeel Sattar1, M. Zargham Khan1, Shen Zhiqiang3
Jiakui Li4 and Aisha Khatoon1
1Department of Pathology, University of Agriculture, Faisalabad, Pakistan; 2Key Lab of Animal
Epidemiology and Zoonosis of Ministry of Agriculture; College of Veterinary Medicine, China
Agricultural University, Beijing, China; 3Shandong Binzhou Animal Science and Veterinary Medicine
Academy, Shandong 256600, China; 4College of Veterinary Medicine, Huazhong Agricultural University,
Wuhan, PR China
*Corresponding Author: ahrar1122@uaf.edu.pk
ABSTRACT
This study was planned to evaluate the clinical, hematological and biochemical alterations of ND in
arsenic intoxicated broilers. Total 240 one-day old broiler chicks were purchased from a local hatchery
and kept on basal feed and water available ad libitum. Vaccination schedule for broilers was followed.
After seven days of acclimatization, the birds were divided randomly into eight equal groups. The
treatment was carried out in groups as, group 1 acted as control while groups 4, 6, 7, and 8 were given
the selected dose of disodium hydrogen arsenate from day 7 to 42. Groups 2, 5, 7 and 8 were
challenged by field isolated Newcastle disease virus at day 24th of experiment. Normal vaccination
schedule will be carried out in group 3, 5, 6 and 8. The dilution of arsenic (disodium hydrogen arsenate)
was administered orally through crop tubing. Slaughtering was done on experimental days 7th, 14th, 21st,
28th and 35th for the collection of blood and organs. Some physical parameters, hemato-biocemical and
histopathological studies were carried out. Data obtained were analyzed statistically.
Clinical signs exhibited by treated birds were salivation, frequent defecation, gasping, lacrimation,
convulsion and tremor. These clinical signs were more severe in arsenic intoxicated and NDV
challenged groups. Feed intake, absolute and relative weight gain significantly decreased in treated
groups. Gross lesions observed were shrunken liver, swollen kidneys, congested lungs and hemorrhagic
intestine. Microscopically necrosis of hepatocytes, cytoplasmic vacuolization, mononuclear cell
infiltration and hemorrhages in liver were observed. Congestion was present in intestine and sloughing
of epithelium was common. In kidney necrosis of tubular epithelium, cytoplasmic vacuolization, cellular
infiltration and atrophy of glomeruli were present. Different hematological parameters, TLC, TEC, Hb,
PCV, MCV, and MCHC were decreased in arsenic intoxicated and NDV challenged groups while the
condition was more severe with their combine exposure. Biochemical parameters like total serum
protein, albumin and globulin decreased significantly in treated groups. Serum creatinine, urea, ALT and
LADH were significantly increased from that of control group. The results so obtained clearly
demonstrated that arsenic treatment induce adverse effects on clinical, hematological and biochemical
parameters in broiler chicks and NDV challenge enhanced these conditions.
Key Words: Arsenic Intoxication, Broiler Chicks, Newcastle Disease virus Challenge, Hemato-
Biochemical Studies
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
104
THE NUTRITION OF BROILERS IN MOROCCO AND THE HAND
ENCOUNTERED PROBLEMS – A CASE STUDY
Mohamed HACHIMI
Laboratoire de Biologie et Santé, Équipe de Recherche en Environnement et Parasitologie, UFR
Doctorale Parasitologie comparée : Applications médicales et vétérinaires, Faculté des Sciences,
Université Ibn Tofaïl, BP 133, 14000 Kénitra, Morocco
*Corresponding Author: mhachimi@gmail.com
ABSTRACT
The interest accorded to the animal feeding quality is a result of the food crises involvement.
Many stakeholders have developed during last decades a quality system and traceability tools to
enhance the risks control and monitoring at the level of the producing units. The coccidiosis, whose
pathogen belongs to the genus Eimeria parasites is prevalent in the intensive livestock and poultry are
among the major constraints hampering the development of the poultry sector in Morocco. A
parasitological study on 149 breeding of flesh chicken in the Gharb region demonstrated 19.5% of
suspected cases of coccidiosis. The location of the lesions and the microscopic aspect of the oocysts
involved three coccidial species, Eimeria necatrix, E. maxima and E. tenella. The breeding success
requires good control of medication and optimal hygienic measures. Our study aimed to explore
cecal and intestinal coccidiosis and to conduct a prospective epidemiological study on the parasitic
disease in chickens farmed in the region of Gharb. The coccidiosis increased the consumption index,
retarded growth and generated lots heterogeneous. The main causes of the development of the
disease were poor control conditions and food quality. The results of the parasitological chicken
breeding study, based on the location of lesions and the appearance of microscopic oocysts allowed
considering the involvement of three different coccidian species on all 290 samples examined: Eimeria
maxima, Eimeria necatrix and Eimeria tenella. The results presented concluded that coccidiosis is a real
economic threat to poultry. HACCP (Hazard Analysis Critical Control Point), or Hazard Analysis,
Critical Control Points (ADMPC) is an effective method for controlling hazards in this sector.
Key Words: Quality, Crisis, Traceability, Control, Morocco, Coccidiosis, Eimeria, Gharb, HACCP
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
105
PROGRESSION OF IBH-HPS IN EXPERIMENTALLY INFECTED BROILERS
Shahid Ali1,*, Muhammad Shahid Mahmood2, Muhammad Asif Zahoor1 and Zeeshan Nawaz1
1Department of Microbiology, Government College University, Faisalabad-Pakistan. 2Institute of
Microbiology, University of Agriculture, Faisalabad-Pakistan.
*Corresponding Author: shahidali@gcuf.edu.pk
ABSTRACT
Infectious diseases are the leading cause of morbidity and mortality in domestic and commercial
poultry throughout the world. Among these, Inclusion Body Hepatitis-Hydro-Pericardium Syndrome
(IBH-HPS) is considered as one of the fatal diseases which cause high mortality in broilers. In the
current study, well isolated, purified and sequenced fowl adenovirus serotype-4 (Accession number:
DQ 264728) was used to induce experimental infection in broilers. The birds (15 days of age) were
divided into three groups consisting of 30 birds each i.e. group A: inoculated subcutaneously, group B:
inoculated through drinking water whereas group C was kept as control. All the birds were housed
under same controlled conditions and environment. Non-medicated feed and water was supplied ad
libitum throughout the experiment. Infected groups showed clinical signs of the disease as early as 5
days post infection (dpi). In group B mortality started 7 dpi which continued up to 11 dpi, whereas
birds in group A showed mortality 10 dpi which continued up to 14 dpi. All the remaining birds were
sacrificed at 15 dpi. Liver and kidney tissues were collected from all birds for the identification of
IBH-HPS virus using agar gel precipitation test (AGPT) and reverse passive haemagglutination assay
(RPHA). Mortality in group B was 83% and in group A was 60%, whereas no morbidity and mortality
has been noticed in control group.
Altogether, it is concluded from the results of present findings that IBH-HPS is highly contagious
disease of broilers which causes high mortality through oral route as compared to subcutaneous
route of infection. Furthermore, AGPT and RPHA are good diagnostic tools for identification of re-
isolated IBH-HPS virus from infected birds.
Key Words: Inclusion Body Hepatitis, Hydro-pericardium syndrome, Fowl Adenovirus, Broilers
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
106
ANTIVIRAL ACTIVITY OF VIRO CARE GZ-08 AGAINST NEWCASTLE DISEASE
VIRUS IN POULTRY AND ITS IN-VITRO CYTOTOXICITY ASSAY
Abuzar Muhammad Afzal*, Muhammad Hidayat Rasool, Abu Bakar Siddique and Muhammad Saqalein
Department of Microbiology, Government College University, Faisalabad, Pakistan
*Corresponding Author: abuzar_336@ yahoo.com
ABSTRACT
Newcastle disease (ND), regarded as one of the most important disease of poultry throughout
the World caused by Newcastle Disease Virus (NDV); it causes huge economic losses to poultry
industry of Pakistan. Regardless of vaccination, other prevention and control measures are necessary
to prevent ND outbreaks. Natural resources were exploited to obtain antiviral compounds in several
latest studies. In this study, the antiviral activity of Viro Care GZ-08™ (a commercial product made by
Shigadry with earth a Japanese company) was checked in-vitro, in-ovo and in-vivo. The cytotoxicity assay
of the product was performed using Vero cell line. Based on overall results, from in-vitro, in-ovo and in-
vivo trials it was found that the stock solution and 1:2 dilution of GZ-08™ did have some antiviral
activity but at the same time these concentrations are cytotoxic too. During in-vivo trials it was
observed that stock solution and 1:2 dilution of GZ-08™ shown better results when it was used in
combination with conventional vaccine. As the concentration decreased, cytotoxicity lost but with
the loss of antiviral activity as well. Based on these findings, it may be endorsed that GZ-08™
sanitizer/spray can be used as antiviral agent to clean or disinfect some non-living surfaces against
different viruses in general and NDV in particular. However, for in-vivo use of GZ-08™ in poultry
against NDV, its dose adjustment is necessary in order to get maximum antiviral activity with least
toxicity.
Key Words: Newcastle disease, Viro Care GZ-08™, Cytotoxicity, Vero cell line
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
107
IMMUNO-PATHOLOGICAL STUDIES OF NEWCASTLE DISEASE IN ARSENIC
INTOXICATED BROILER CHICKS
Adeel Sattar1, Ahrar Khan1, Hafiz Iftikhar Hussain1, Riaz Hussain2, Jiakui Li3, Muhammad Kashif
Saleemi1, Cheng He4, Shafia Tahseen Gul1 and Shen Zhiqiang5
1Department of Pathology, University of Agriculture, Faisalabad, Pakistan.2University College of
Veterinary and Animal Science, The Islamia University of Bahawalpur-63100, Pakistan; 3College of
Veterinary Medicine, Huazhong Agricultural University, Wuhan, China; 4Key Lab of Animal
Epidemiology and Zoonosis of Ministry of Agriculture; College of Veterinary Medicine, Agricultural
University, Beijing, China; 5Shandong Binzhou Animal Science and Veterinary Medicine Academy,
Shandong 256600, China
*Corresponding Author: ahrar1122@uaf.edu.pk
ABSTRACT
This study was carried out on 240 one-day old broiler chicks. After seven days of acclimatization,
the birds were divided in to eight equal groups. Group 1 was kept as control and groups 4, 6, 7 and 8
were given the selected dose of disodium hydrogen arsenate from 7 to 35 days @50 mg.kg-1 BW.
Groups 2, 5, 7 and 8 were challenged by field isolated ND virus at day 24. The normal vaccination
schedule was carried out in Groups 3, 5, 6 and 8. The birds were closely monitored for clinical signs.
Randomly selected six birds from each group were slaughtered humanely on 7th, 14th, 21st, 28th and
35th days. Serum samples were collected for determination of cellular and humoral immune response
and morbid tissues (bursa, spleen and thymus) were collected for histopathology. Different
immunological parameters were studied. The collected data were analyzed statistically.
The arsenic treated groups exhibited more prominent signs as compared to control and
vaccinated groups. Grossly thymus was hemorrhagic and bursa was regressed in arsenic treated birds.
Microscopically, bursa revealed increased interfollicular connective tissue, lymphoid cells depletion,
vacuolation in bursal epithelium and lymphoid cells in both cortex and medullary region. In challenged
groups, increased fibrosis and inter-follicular connective tissue proliferation was observed. In spleen
there was severe congestion, cytoplasmic vacuolation in some areas, disorganization of white and red
pulp, mild to moderate necrosis and hyperplasia of reticular cells was observed. In thymus severe
congestion, vacuolation of cytoplasm in modularly region and necrosis of monocytes were noticed.
The absolute and relative weight of spleen was increased significantly, whereas decreased in case of
bursa and thymus due to arsenic intoxication. The antibody titers against ND were decreased due to
arsenic treatment and response to SRBCs was also lowered in treated groups with respect to control
group. The phagocytic ability and lymphoproliferative response was decreased in case of arsenic
treatment and challenged groups with respect to control group. It can be concluded that arsenic is
capable of inducing immunotoxicity and histopathological alterations in broiler chicks and ND virus
has capabilities of increasing the harmful effects of arsenic either alone or in combination.
Key Words: Arsenic Intoxication, Broiler Chicks, Newcastle Disease virus Challenge, Immuno-
Pathological Studies
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
108
DETECTION OF AVIAN POX VIRUS FROM FIELD CASES OF PIGEONS AND ITS
PATHOGENESIS IN EXPERIMENTALLY INDUCED INFECTION
Tayyaba Shafiq1, Farzana Rizvi1*, Tahir Habib Rizvi2, ShafiaTahseen Gul1, Muhammad Numan3,
Mudasser Habib4 and Nouman Amjad1
1Department of Pathology, University of Agriculture, Faisalabad, Pakistan. 2District Head Quarter
Hospital, Faisalabad, Pakistan. 3Livestock Production Research Institute, Okara, Pakistan. 4Nuclear
Institute for Agriculture and Biology, Faisalabad, Pakistan.
*Corresponding Author: farzana.rizvi@uaf.edu.pk
ABSTARCT
Pigeon pox is an infectious and contagious disease of young birds, spreads horizontally and
outbreaks have been reported in several countries. A field survey of 20 pigeon farms suspected for
pigeon pox disease was carried out in and around district Faisalabad. Samples from skin lesions of
diseased birds were collected and subjected to Polymerase chain reaction (PCR) for confirmation.
Experimental infection in pigeons was induced by confirmed isolated virus. For this purpose, twenty-
birds of approximately four weeks of age were randomly selected and divided into two equal groups..
The pox virus was inoculated through wing web puncture method in pigeons of 1st group and they
were observed till the gross lesions development on skin. However, the 2nd group was kept as
control. Then these birds from both groups were euthanized humanely to collect blood samples with
and without anticoagulant for hematological and serum parameters. Tissue samples from skin lesions
were collected for histopathology. A significant increase in total leukocyte count, total protein and
globulin concentration was observed in the diseased pigeons as compared to healthy pigeons.
However, a non-significant difference was observed in red blood cell count, hemoglobin
concentration, packed cell volume and serum albumin concentration among pox infected and healthy
pigeons. Microscopically, several changes like hperkeratosis and hyperplasiain stratum corneum,
lymphocytic infiltration in stratum spinosum, bollinger bodies and vacuolization in the epithelial cells
of skin tissues were observed.
Key Words: Pigeon Pox, Wing Web Puncture, Bollinger bodies, Vacuolization.
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
109
COMPARATIVE PROTECTIVE EFFECT OF GLYCYRRHIZINIC ACID AND PURIFIED
IMMUNOGLOBULINS (IgG) IN NEWCASTLE DISEASE INFECTED BROILER
CHICKS
Nouman Amjad1, Farzana Rizvi1, Muhammad Kashif Saleemi1, Muhammad Numan1,3
Tayyaba Shafiq1 and Tahir Habib Rizvi2
1Department of Pathology, University of Agriculture, Faisalabad, Pakistan. 2District Head Quarter
Hospital, Faisalabad, Pakistan. 3Livestock Production Research Institute, Okara, Pakistan.
*Corresponding Author: frizivi@yahoo.com
ABSTRACT
Newcastle Disease (ND) included in list A of World Organization for Animal Health and cause of
economic disasters of poultry. Vaccination is major source of prevention but outbreaks in vaccinated
flocks lead to huge economic losses. Certain biochemical and herbal are agents used to reduce the
devastating effects of ND, such as antiviral peptides and antibodies combination against certain viral
proteins. Immunoglobulins (IgG) were raised in broiler chicks by inoculating La Sota vaccine and IFA.
IgG were purified by successive precipitations with Ammonium Sulphate [(NH4)2 SO4], and its
efficacy was compared with antiviral agent Glycyrrhizinic Acid (VIUSID®). A total of 75 day old chicks
were divided in to five equal groups i.e. A, B, C, D and E. At age of 15 days, all groups were
inoculated with ND Virus except group E. Group A and B were treated with IgG 2 ml/bird, I/M 6
hours post infection (PI) and IV 5 days PI, respectively. Group C was treated with Glycyrrhizinic Acid
(VIUSID®) @ 1ml/liter of drinking water. Birds of groups D and E were designated as Positive and
Negative control respectively. Birds of group A showed lowest morbidity and mortality, while group
D showed highest morbidity and mortality. Group D was kept as positive control without treatment,
showed maximum clinical signs. During postmortem examination hemorrhages in proventriculus,
intestinal ulcers and congested trachea were observed. All groups showed high values of GMT, group
A showed high values due to treatment of purified IgG while group D showed high values of GMT
due to onset of disease. This trial concluded that purified IgG were used to decrease the lethal effects
in initial phase of disease. Glycyrrhetinic Acid (VIUSID®) reduced the mortality but unable to stop
mortality in infected flock.
Key Words: Newcastle Disease, Purified Immunoglobulins, Glycyrrhetinic Acid, GMT
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
110
A NOVEL ANTIVIRAL EXTRACT OF RHIZOMA DRYOPTERIS CRASSIRHIZOMAE
BY ENHANCING IMMUNE SYSTEM IN SPF CHICKEN MODEL
Qiang Zhang, Jun Chu, Tianyuan Zhang and Cheng He
Key Lab of Animal Epidemiology and Zoonosis of Ministry of Agriculture, China. College of
Veterinary Medicine, China Agricultural University, Beijing 100193, China.
ABSTRACT
Rhizoma Dryopteris Crassirhizomae (RDC) is used widely in traditional medicine, prescriptions and
recorded both in Chinese Pharmacopoeia and Chinese Veterinary Pharmacopoeia. It fortifies general
vitality, improves digestion and builds up the body's defense against viruses. However, active extracts
for veterinary medicines are unavailable due to lack of further investigation. Our current study aims
to evaluate immune response post administration of Rhizoma Dryopteris Crassirhizomae extract in SPF
chicken model. One hundred and fifty three-week-old SPF chickens were randomly divided into 6
groups. Birds orally received 750 mg/kg, 500 mg/kg and 250 mg/kg of RDC granulations for 14 days.
Meanwhile chickens were administered with 100 mg/kg of Levamisole as the positive control while
birds were given intramuscularly 100 mg/kg of cyclophosphamide for 5 times with one-day interval as
the negative control. Chickens given physiological saline were included as the health control. Prior to
treatment, all above groups received one dose of attenuated vaccine against Newcastle Diseases
Virus (NDV) and Infectious Bronchitis Virus (IBV). Post administration RDC granulation, body weight,
and immune organ index, antibody levels, lymphocyte proliferation, monocytes-macrophage activity,
cytokines and NK cell activity were monitored on day 7, day 14 and day 21. With respect to whole
immune system booster, higher fabricius index were induced in the chickens with 250-500mg/kg of
RDC granulations from day 7 to day 14 while an increasing thymus index was determined in the
500mg/kg of RDC group on day 14 in comparison with the positive control group.As for humoral
boosting, both RDC groups and Levamisole were able to induce high positive NDV and IBV specific
antibodies as compared to the negative control group and healthy control. More important,
lymphocytes proliferation index increased significantly in the birds with 750 mg/kg of RDC
granulations as compared to that of Levamisole group. Also, significant increase in macrophage and
NK cell activity was also detected in the SPF chickens administered with 250 mg/kg of RDC
granulations. Based on the standard module associated with immune enhancing herbs, RDC
granulations are able to boost the immune system by both humoral and cellular response in chickens.
Our studies indicated that the RDC granulation is a promising antiviral herb extract against poultry
viral diseases.
Key Words: Rhizoma Dryopteris Crassirhizomae, immune system booster, humoral response, cellular
response, chickens
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
111
PRIMARY INFECTION WITH CHLAMYDIA PSITTACI EXACERBATES RESPIRATORY
DISEASES OF AVIAN INFLUENZA VIRUS H9N2 BY SUPPRESSING IMMUNE
RESPONSE
Jun Chu1, Qiang Zhang1, Tianyuan Zhang1, E Han1, Peng Zhao1, Cheng He1 and Yongzheng Wu2
1Key Lab of Animal Epidemiology and Zoonosis of Ministry of Agriculture, College of Veterinary
Medicine, China Agricultural University, Beijing 100193, China; 2Unit of Innate Defense
& Inflammation, INSERM U874, Institut Pasteur, 75015 Paris, France
ABSTRACT
Both Chlamydia psittaci (C. psittaci) and avian influenza H9N2 subtype virus pose a huge threat to
avian respiratory distress in poultry industry and are potential zoonotic agents. Clinically, H9N2 and
C. psittaci were isolated and identified frequently from the diseased chickens with severe respiratory
diseases. However, an association between con-infection with above two pathogens and pathogenesis
is unknown, resulting in the delay of the effective control strategy.
In Experiment 1, SPF chickens were administered intratracheally with highly virulent C. psittaci HJ
strain and low virulent C. psittaci CB3 strain, respectively. Meanwhile, all birds received intra-nasally
with one dose of the attenuated vaccine against Newcastle disease virus (NDV). Post inoculation, body
weight, immune organ index and T cell subsets were significantly elevated at days 7 and decreased at
days 10, whereas NDV-specific antibody levels were found lower in the chickens with C. psittaci HJ
group. Experiment 2: Birds were divided into 5 groups, Group A intratracheally received C. psittaci HJ
and H9N2 simultaneously; Group B were administered with C. psittaci HJ, then received H9N2 after 3
days later; Group C received H9N2 firstly then inoculated with C. psittaci HJ after 3 days later; Group
D and Group E received C. psittaci HJ or H9N2 alone, respectively. Consequently, lower body weight
gain, immune organ index and higher lesion score were detected in C. psittaci/ H9N2 group and C.
psittaci+H9N2 group in comparison with H9N2 alone. Moreover, 65%, 80% and 90% birds survived
in the combination of C. psittaci/ H9N2 group, C psittaci+H9N2 group and H9N2/ C. psittaci group as
compared to 100% survival rate in C. psittaci group and H9N2 group. Our studies indicate that
primary infections with C. psittaci contributes to severe respiratory disease by H9N2 infection
because of suppression of humoral immunity and due to alteration in Th1 balance.
Key Words: C. psittaci, H9N2, Co-infection, Respiratory disease, Immunosuppression
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
112
THE ADJUVANT EFFECT OF BETA-1,3/1,6 GLUCAN ON NDV INACTIVATED
VACCINE
Tianyuan Zhang, Qiang Zhang, Jun Chu, Zonghui Zuo, Zhenhai Han, Jia Li,
Er Han and Cheng He
Key Lab of Animal Epidemiology and Zoonosis of Ministry of Agriculture, China. College of
Veterinary Medicine, China Agricultural University, Beijing 100193, China
ABSTRACT
β-Glucans from fungal and yeast sources have been widely used in enhancing protective immunity
against infectious agents. Moreover, β-glucan improves the antibody response in poultry immunized
by the avian influenza A H5N1 and H5N2 vaccines. However, the mechanism of the beta-1,3/1,6
glucan is unclear due to lack further research. Our research aims to evaluate both humoral response
and cellular response post immunization with the inactivated vaccine Newcastle Diseases Virus
(NDV).
Prior to vaccination, the inactivated NDV antigens were blended with 1%,2%,5%,10% of
beta-1,3/1,6 glucan and then emulsified with mineral oil into water-oil form vaccines. Sixty 21-day-old
SPF chickens were randomly divided into 6 groups. Chickens were administrated with the above
NDV inactivated vaccine with beta-glucan as the adjuvants while birds inoculated with the commercial
NDV inactivated vaccine as the positive control and the chickens received physiological saline as
negative control. Body weight gain, immune organ index, NDV antibodies, lymphocyte proliferation
and cytokines were monitored post immunization two weeks. With respect to whole immune system
boosting, spleen, thymus and bursa indices were significantly increased on day 14 and on day 21. Post
challenge with virulent NDV strain, all the birds were survived in the vaccines with 1% and 2% beta-
1.3/1,6 glucan as compared to 80% live birds with the commercial vaccine. In terms of humoral
response, the significant increasing NDV antibodies were also detected in the chickens inoculated the
vaccine with 2% beta-1.3/1,6 glucan compared to those of the commercial vaccine on two-time
points. As for lymphocyte subsets and cytokines, CD3+ T cells, CD4+T cells,IL-2,IL-6, IFN-γand IL-10
were significantly increased in the birds with 2% Β-1,3/1,6 glucan in comparison with other vaccines
with the beta glucans and the commercial vaccine. It may be concluded that beta-1,3/1,6 glucan is a
promising adjuvant in the inactivated vaccine against poultry viral diseases.
Key Words: beta-1,3/1,6 glucan, Newcastle Diseases Virus, adjuvant, Inactivated vaccine
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
113
MOLECULAR DETECTION OF CHICKEN INFECTIOUS ANEMIA IN DAY OLD
BROILER CHICKS FROM FAISALABAD PAKISTAN
Saif-ur-Rehman, Muhammad Kashif Saleemi*, Muhammad Zargham Khan, Ahrar Khan, Bilal Aslam1,
Aisha Khatoon, Zain-ul-Abidin2 and Asim Shahzad
Department of Pathology; 1Institute of Physiology, Pharmacology, and Pharmacy, University of
Agriculture, Faisalabad; 2Veterinary Research Institute, Zarar Shaheed Road Lahore Cantt, Pakistan
*Corresponding Author: drkashif313@gmail.com
ABSTRACT
Chicken infectious anemia (CIA) is an emerging immunosuppressive infectious disease of poultry
in Pakistan. It results in high mortality, poor growth, immunosupression and poor response to vaccine
in young birds. In Pakistan, information regarding disease status of CIA in different types of birds
including commercial layers, broilers and parent stock is not yet available. Therefore, present field
study was designed to investigate the molecular epidemiology of chicken infectious anemia in day old
broiler chicks, because the detection of CIA in young chicks may also represent the status of disease
in parent flocks. For this purpose, a total 254 blood samples were collected from different farms and
hatcheries located in Faisalabad, Punjab, Pakistan. These samples were analyzed for chicken anemia
virus (CAV) through PCR, using specific primers (CAV1 & CAV2) of highly conserved VP-2 coding
gene. Total 38 (14.96 %) samples from 17 farms were found positive for CAV through PCR assy. The
hematological parameters like RBC, Hb and PCV of all samples were also determined and the
hematological values of CAV positive birds showed (RBC(X106/µl) 1.99 ± 0.37, Hb (g/dl) 5.88 ± 0.77,
PCV (%) 18.74 ± 2.97) severe anemia. The results of present study suggested that CIA is prevalent in
Pakistan. Further epidemiological and molecular investigations are required to design and implement
control strategies for this important immunosuppressive disease.
Key Words: Chicken Infectious anemia, Immunosuppression, PCR, Broilers, Epidemiology
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
114
USE OF ETHNO-VETERINARY PRACTICES IN POULTRY DISEASES
Aamir Sharif1, Tanveer Ahmad2 and Jahan Zeb Ansari1
1Government Poultry Farm, Bahawalpur, Livestock and Dairy Development Department, Punjab,
Lahore – Pakistan, 2Department of Clinical Medicine and Surgery,
University of Agriculture, Faisalabad – Pakistan.
*Corresponding Author: aamirsharifcheema@gmail.com
ABSTRACT
In developing countries like Pakistan, the poultry sector is encountered with the high incidence of
infectious diseases. The use of chemical medicines is costly, have toxic effect in birds, pose the
serious threat of microbial resistance and involve risk of hazards of drug residues in poultry meat and
eggs. The use of ethno-veterinary medicine is one of the alternatives for treatment and control of
poultry diseases. The use of herbal extracts, homemade remedies, use of different parts of plants like
bark, stem, root, fruits, leaves, seeds, alone or in combination with other substances are the cheap,
economical, accessible and efficient substitutes of chemical medicines. The commonly used ethno-
veterinary practices include the use of leaves or bark of Azadirachta indica for endoparasites,
Kalanchoe crenata for coccidiosis, leaves of Carica papaya (pawpaw) for diarrhoea and endo-parasitism,
Piper guineese (pepper) for cough, use of Allium sativum (garlic) as repellent and use of Khaya
senegalensis (mahogany), Solanum nofiflorum (wild garden egg), Vernonia amygdalina (bitter leaf) and
Capsicum frutescens (pepper) for the treatment of Newcastle disease. It is required that more findings
regarding validation of ethnoveterinary medicines be documented by the researchers for
substantiating the results for potential and multipurpose uses of ethno-veterinary practices in the
treatment and control of poultry diseases.
Key Words: Ethno-veterinary practices, Poultry, Diseases, Treatment, Control
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
115
JAPANESE QUAIL (Coturnix coturnix Japonica) GROW BETTER ON FEED
SUPPLEMENTED WITH NEOMYCIN RATHER THAN ORGAINC ACID
Umar Farooq*, Muhammad Farooq Khalid, Muhammad Khalid Bashir, Muhammad Amer Shehzad,
Muhammad Arslan, Muhammad Auon and Pervez Akhtar
University of Agriculture Faisalabad Sub-Campus, Toba Tek Singh, Pakistan
*Corresponding Author: u.farooq@uaf.edu.pk
ABSTRACT
Organically produce poultry products are consumer’s choice and there is also a huge demand to
eliminate use of antibiotic growth promoters from the animal feed. Hence the demand for scientific
research to find suitable natural growth promoter is intensifying. In this regard the present study was
planned to investigate the use of natural vs antibiotic growth promoter in Japanese quail diet. Mixed
sex Japanese quail chicks (n=280; 1 week old) were housed in an open sided house with floor pens
containing sand as a litter material. The following treatments were used: group A (2.5 g Neomycin
per kg feed), B (2.5 g organic acid comprised of formic acid, lactic acid, propionic acid, fatty acid,
propyleneglycol, oregano oil) and C (Control). Each treatment was applied to two replicates of 45
chicks each. Quails were reared under uniform conditions of humidity, temperature (33-38 ◦C),
ventilation, 18/6 hours light/dark cycle, ad-libitum feed (Table 2) and water supply. The data were
recorded on 14, 21 and 28 of age and following parameters were studied: Body weight, feed
conversion ratio, dressing percentage and giblet weights digestibility coefficients for CP (crude
protein), EE (ether extract), CF (crude fiber), and NFE (nitrogen free extract), and nutritive value of
TDN % (total digestible nutrients), DCP % (digestible crude protein), ME (metabolizable energy) and
mortality. The results showed significantly (P < 0.05) higher body weight (121.4±15) for Neomycin
compared with both, i.e., organic acid (112.2±11) and control (110.4±13). However, no statistical
difference was observed for any other parameter, i.e., FCR, dressing percentage, giblets weight,
digestibility coefficients and mortality. We concluded that use of Neomycin in quail diet is beneficial
for its growth.
Key Words: Growth promoters, Growth rate, Broiler quails
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
116
INHIBITION OF CHICKEN RECOMBINANT FREEZE-DRIED INTERFERON TO NDV
F48E10 IN CHICKEN EMBRYOS1
Guo Shijin1,2, Wang Yanping1,2, Fu Shijun1, Zhang Zhimei1,2, Xu Qianqian1,2 and Shen Zhiqiang1,2*
1Shandong Binzhou Animal Science and Veterinary Medicine Academy, Shandong 256600, China; 2Shandong Lvdu Ante Veterinary Drug Co., Ltd., Shandong 256600, China
*Corresponding Author: bzshenzq@163.com.
ABSTRACT
This study was to investigate the inhibiting effect of chicken recombinant freeze-dried interferon
against Newcastle Disease Virus (NDV) F48E10 through vaccinating 9-day-old chicken embryo allantoic
cavity. After 24 hours of the reorganization, the 10 day chicken embryos established their own
immune system and then were infected with the NDV F48E10 to study the protection effect of
interferon to chick embryo in vivo. The Newcastle disease virus F48E10 (Virulent virus) was diluted
100 times with normal saline under aseptic conditions and inoculated in 10 pieces 10-day-old SPF
chicken embryo, 0.2 ml per egg. All the embryo died within 36-48 hours and the allantoic fluid was
collected. The hemagglutination titer of the recovery disease was 28. The virulence of Newcastle
disease (ELD50) showed that there was no chicken embryo death within 24-48 hours. In 48-72hours
mortality was 5, 4 and 1 in groups of titer 10-7, 10-8 and 10-9respectively. According to the Reed-
Muench method calculating median lethal dose, ELD50 was -8.5/ml, when the virus was diluted in 10-
8.5, 0.1 ml of each chicken embryo inoculation could make 50% of the chicken embryo death. Antiviral
activity increased with the increase of the inoculation content of interferon, the protection ratio
could reach 90% when the inoculation content was 1.28 mg/chicken embryos, when the inoculation
dose of more than 1.28 mg, the protection ratio of recombinant interferon on chicken embryo
decreased. The results showed that the recombinant F48E10 had a good anti F48E10 effect in a certain
range, and the protective ratio of chicken with 1.28mg/ chicken embryos was 90%.
Key Words: Chicken recombinant freeze-dried interferon; Chick embryo; F48E10; Protection ratio
1 This work was financially supported by the Shandong Modern Agricultural Technology & Industry
System, China (SDAIT-13-011-10) and Shandong Technical Innovation Project (201210916001).
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
117
PREVENTIVE EFFECT OF QINGWEN BAIDU GRANULES ON THE ARTIFICIAL
CHICKENS INFECTIOUS BRONCHITIS2
GUO Shi-jin1,2,WANG Yan-ping1,2, FU Shi-jun1, ZHANG Zhi-mei1,2, YANG Li-mei1,2,ZHOU Chun-
feng1,2, XU Qian-qian1,2 and SHEN Zhi-qiang1,2*
1Shandong Binzhou Animal Science and Veterinary Medicine Academy, Shandong 256600, China;
2Shandong Lvdu Ante Veterinary Drug Co., Ltd., Shandong 256600, China
*Corresponding Author: bzshenzq@163.com
ABSTRACT
Chicken infectious bronchitis (IB) is an acute respiratory and highly contagious disease, which
affected the egg production and egg quality. IBV strains of serotype and mutation as well as the strong
vaccine limitations are one of the large-scale farms frequent diseases. Therefore, rapid and effective
treatment of the IB is of great significance for large-scale farms. Qingwen Baidu granules are
composed of many kinds of traditional Chinese medicine such as rhizoma coptidis, buffalo horn,
rehmanniae, gypsum and radix scrophulariae by the combination process of traditional and modern
technology and provided by Shandong Lvdu Ante Veterinary Drug Co., Ltd (No. 20120210). In this
study, seven hundred 21-day-old Hy-line variety brown chickens were infected artificial by IB of
standard IBV M41 strain and then divided into seven groups at random. Before or after inoculation,
different dosages of Qingwen Baidu granules were added into drinking water to observe the clinical
symptom, incidence rate, pathological alterations and fatality rate, and with Qingwen Baidu powder as
positive control drug. The results showed that addition of 0.25‰ Qingwen Baidu granules in the
drinking water could protect the chickens from IBV strains M41 attacking significantly compared with
that of positive control group, the disease incidence of granule prevention group was only 9.0%,
which was significantly lower than the positive control group (P<0.01). 0.25‰ Qingwen Baidu
granules in drinking water can effectively cure the artificial chickens IB by standard M41 strain of IBV,
and the curative rate was 98.00%, and significantly higher than that of Qingwen Baidu powder treated
group and low dose treatment group and positive control group (P<0.01). In conclusion, the
recommended dose for preventing the chicken infectious bronchitis was 0.25‰, the curing dose was
0.5‰ in drinking water for 5 d.
Key Words: Qingwen Baidu granules; Artificial chickens infectious bronchitis; M41; Preventive
treatment
2 This work was financially supported by the Shandong Modern Agricultural Technology & Industry
System, China (SDAIT-13-011-10) and Shandong Technical Innovation Project (201210916001).
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
118
PROTECTIVE EFFECTS OF BERBERINE IN DITHIO-CARBAMATE INDUCED-LIVER
OXIDATIVE STRESS AND TOXICITY IN CHICKEN BROILERS
Muhammad Shahzad1*, Riaz Hussain1, Zhi Wang2, Mudassar Iqbal1 and Jiakui Li2*
1University College of Veterinary & Animal Sciences, The Islamia University of Bahawalpur
2College of Veterinary Medicine, Huazhong Agricultural University Wuhan, China
*Corresponding Authors: m.shahzad@iub.edu.pk, lijk210@sina.com
ABSTRACT
Dithio-carbamates are organic compounds being used as fungicide, pest and rodent repellents in
agricultural fields and thus occur as contaminants in products being employed for litter material and
poultry feed. Berberine, generally administered as chloride is an isoquinoline alkaloid of the
protoberberine type being used as an antifungal, antioxidative, anti-inflammatory and antitumor agent.
A study was conducted to investigate the protective effects of berberine chloride in dithio-carbamate
(thiram) induced-liver oxidative stress and toxicity in chicken broilers. One hundred and fifty
commercial chicken broilers were allocated into three groups: control group, thiram-induced group
(50mg/kg) and berberine (25mg/kg/day) treated group. Serum samples were collected on day 07, 11
and 14 post-hatch to determine the ALT (alanine aminotransferase), AST (aspartate
aminotransferase) and ALP (alkaline phosphatase) activity. The liver samples were collected at the
end of trial to determine the activity of SOD (superoxide dismutase), GSH-Px (glutathione
peroxidase) and MDA (malondialdehyde) contents. The results depicted that thiram increased the
level of serum ALT, AST and liver MDA contents while decreased the serum ALP and liver
antioxidant enzymes (SOD, GSH-Px); however, by treating the birds with berberine chloride, the
level of transferases (ALT, AST) and MDA contents were in normal range and the activity of ALP and
both antioxidants were detected close to normal as compared to control group. Moreover, different
stages of degeneration were also observed in liver histology in thiram-induced birds which became
normal on treating with berberine. In conclusion, our findings suggest that the oxidative imbalance
and damage to liver induced by dithio-carbamate can be restored by using berberine in chicken
broilers.
Key Words: Dithio-carbamate, Berberine, Liver toxicity, Antioxidants
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
119
APPLICATION OF CHICKEN LITTER IN AGRICULTURE: PROPER MANAGEMENT
PRACTICE IS NECESSARY TO AVOID ENVIRONMENTAL CONTAMINATIONS BY
PATHOGENS
Muhammad Waseem* and Muhammad Asif Zahoor
Department of Microbiology, Government College University, Faisalabad, Pakistan
*Corresponding Author: muhammad.waseem@gcuf.edu.pk
ABSTRACT
In agriculture, poultry manure is being used as organic fertilizers to improve the soil structure
and fertility. In spite of as nutrients source for crop production, chicken litter may also contains a
variety of pathogens; either host-specific or zoonotic, such as prions, viruses, bacteria, protozoa, and
helminthes. These pathogens are difficult to eradicate from poultry production facilities because some
are endemic to poultry and may have a resistant stage in their life cycle (e.g., a cyst or spore) that
enhances their survival in the environment and facilitates transmission to other animals or humans
through ingestion of fecal-contaminated water or food. Survival times in manure vary according to
pathogens, the medium and environmental conditions resulting in use of different manure
management practices depending upon the pathogens anticipated. Composting of manure, especially
when properly aerated, is an effective management practice that can generate the heat needed to
inactivate a number of pathogens, including Salmonella, Campylobacter, E. coli, and protozoa. Ultraviolet
light promotes die-off, and spreading manure on the surface during land application can promote
greater die off through exposure to UV light and desiccation. However, a small population of
pathogenic cells may survive or regrow in the finished compost products under favorable conditions.
Physical, chemical, and biological treatments can be alternative ways for pathogen inactivation, but
may not always lead to the complete elimination of foodborne pathogens in chicken litter. Based on
the hurdle concept, each kind of treatment can be used in combination alongwith other disinfection
strategies to potentiate microbial lethality.
Key Words: Chicken, Zoonotic, Pathogens, Food Borne, Litter treatment
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
120
IMMUNE FUNCTION OF CHINESE FORMULA QINGWEN BAIDU GRANULES IN
BROILERS
Guo Shi-jin1, 2, Fu Shi-jun1, Xu Qian-qian1,2, Zhang Zhi-mei, Wang Yan-ping1,2 and Shen Zhi-qiang1,2*
1Shandong Binzhou Animal Science and Veterinary Medicine Academy, Shandong-256600, China
2Shandong Lvdu Ante Veterinary Drug Co., Ltd., Shandong-256600, China
*Corresponding Author: bzshenzq@163.com
ABSTRACT
This study was designed to investigate the effects of Qingwen Baidu granules on the antibody
level, immune organ index and the lymphocyte transformation of broilers. Hy-line variety white cocks
of 30 days were used to evaluate the antibody titer of Newcastle Disease in each group, and MTT
method to determine the T lymphocyte proliferation, and organ weighing methods to measure the
immune organ index 21 days after immunization. Qingwen Baidu granules were provided by Shandong
Lvdu Ante Veterinary Drug Co., Ltd (No. 20120210). The birds were divided into 3 groups: (1) test
drug group birds were administered Qingwen Baidu granules @ 0.5 g/l dosage for 3 days through
drinking water at; (2) a positive control was treated with levamisole (1%) and a negative control
group without any treatment. After treatment, Live (Clone 30) ND Vaccine was administered by eye
drops/nasal inhalation.
The valence of ND antibody of test drug group was significantly higher than those of positive
control group and negative control group (P<0.05). However, there was no significant difference
between positive control group and negative control group, which indicated that Qingwen Baidu
granules could prolong the residue time in the body and improve the lymphocyte conversion ratio.
The test drug group and the positive control group both improved the lymphocyte conversion ratio
(P<0.05), and enhanced the cellular immune function. These results indicated that the Qingwen Baidu
granules could raise the disease resistance, improve the serum ND antibody level and peripheral
blood lymphocyte proliferation, enhance the cellular immune function, and elevate the immune organ
index and growth, in order to raise the immune function. Results indicated that Qingwen Baidu
granules can significantly potentiate cellular and humoral immunity. In conclusion, the Chinese
Qingwen Baidu granules can improve serum ND antibody level, improve peripheral blood lymphocyte
proliferation, enhance cellular immune function and elevate immune organ index and growth.
Key Words: Qingwen Baidu, Immunity, Broiler, ND antibody, Lymphocyte
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
121
EFFECTS OF ELECTROLYTES IMBALANCE ON IMMUNITY AGAINST
NEWCASTLE DISEASE VIRUS INFECTION
Muhammad Hassan Mushtaq*1, Farrukh Ali Khan1, Aqeel Javeed1, Amjad Riaz1,
Hussain Filza2 and Amjad Khan1
1University of Veterinary and Animal Sciences, Lahore, Pakistan, 2Medical University of Vienna,
Vienna, Austria
*Corresponding Author: hassan.mushtaq@uvas.edu.pk
ABSTRACT
Sodium (Na) and chloride (Cl) function with phosphate and bicarbonate to maintain optimum pH of
the body. The minimum level of Na in poultry rations is 0.15%. Low Na level affect ration consumption,
while high level has laxative effect. The recognition of Na towards causing edema has shown the
importance of balance of electrolytes in the body. Taking in consideration the importance of Na salts in
broiler ration, present project was designed to observe the effect of excessive dietary Na salts on weight
gain, FCR, serum Na concentration, edematous lesions and on the immune status of the broiler against
NDV infection. For this purpose 100 broiler chicks were randomly divided into 4 groups. Group A, B, C
and D were fed on diet with 0.36% NaCl, 0.36% sodium bicarbonate, 0.18% NaCl and 0.18% sodium
bicarbonate and 0.18% sodium salts (routine) respectively. On day 8 and 28 ND vaccine was
administered to all groups. All the birds were weekly weighed to calculate FCR. Blood samples were
collected on days 14, 28 and 42 day age to determine the antibody titer against ND virus through
Haemagglutination Inhibition (HI) Test and for the estimation of serum sodium concentration through
spectrophotometry. Results showed that birds of group A had better feed conversion ratio and weight
gain as compared others, whereas birds of group D had poor FCR as compared to the birds of group B
and C. On analysis of serum Na concentration by spectrophotometer, the birds of group A had
maximum Na concentration and birds of group D had lowest serum Na concentration. Statistical analysis
showed a significant (P<0.05) difference in the serum Na levels of all groups except within group B and C.
The highest GMHI titer against ND virus was observed in sera of birds of group D and the lowest in the
sera of birds from group A. No edematous lesions were observed in birds of any group. It is also
interesting that electrolytes imbalance may influence not only performance but also the immune response
of broilers against ND virus.
Key Words: NDV, Vaccine, FCR, Immune response.
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
122
A CROSS-SECTIONAL SURVEY ON PARASITES OF BACKYARD POULTRY IN
PUNJAB PAKISTAN
Ghazala Nawaz1, Muhammad Nawaz Malik2, Muhammad Hassan Mushtaq*3, Fraz Munir Ahmad4, Ali
Abdullah Shah5, Farooq Iqbal6, Shinawar Waseem Ali7, Aqeel Javed8 and Amjad Khan9
1Veterinary research institute Lahore, Pakistan, 2Project Director (Diagnostic Laboratories) L&DD,
Punjab, Pakistan, 3Department of Epidemiology and Public Health, University of Veterinary and Animal
Sciences, Lahore, Pakistan, 4Assistant Disease Investigation Officer Rahim Yar Khan, Punjab Pakistan, 5Pathobiology PMAS Arid Agriculture University, Rawalpindi, Pakistan, 6Department of livestock
production and management, PMAS Arid Agriculture University, Rawalpindi, Pakistan, 7Institute of
agriculture sciences, Punjab University, Lahore, Pakistan, 8Department of Pharmacology, University of
Veterinary and Animal Sciences, Lahore, Pakistan, 9Department of Epidemiology and Public Health,
University of Veterinary and Animal Sciences, Lahore, Pakistan.
*Corresponding Author: hassan.mushtaq@uvas.edu.pk
ABSTRACT
In Pakistan, backyard poultry rearing amongst rural communities is one of the important venture
and essential part of the mixed farming system. Same is the case in many developing Asian and African
countries. Very few studies have been conducted regarding the prevalence of endoparasites in free
ranging poultry in Pakistan. The present cross sectional survey was designed to compute
endoparasites prevalence in backyard poultry in rural communities’ small holder farming system in
Punjab province. This is the first in its nature in Pakistan as a model survey conducted parallel to mass
vaccination against Newcastle disease virus in Poultry. The study area was divided into three
zones/regions, i.e., northern, southern and central Punjab for spatial distribution pattern of
endoparasites to unveil the most infested areas. A total of 17,061 villages and 55,586 rural households
were visited and faecal samples (n=242106) were collected and were tested for different egg/ova type
and parasitic worm loads. Cumulative higher prevalence of 86.69% was recorded in southern,
followed by central and northern Punjab, respectively. While at specie level 47.88% samples were
found positive for nematode and 38.8% for coccidian parasites in southern Punjab. Furthermore the
highest burden of parasitic infestation of 100% prevalence rate was estimated in the backyard poultry
population of district Khanewal in the southern Punjab. It was concluded that southern and central
Punjab rural communities were infested the most, therefore, prioritization regarding control
strategies should be focused on these areas.
Key Words: Backyard poultry, Rural, Coccidian, Nematodes, Pakistan.
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
123
REGULATION EFFECTS OF PROTOCATECHUIC ACID ON CELL APOPTOSIS
CAUSED BY INFECTIOUS BURSAL DISEASE
Changbo Ou1 and Cheng He2*
1College of Animal science, Henan Institute of Science and Technology, Xinxiang 453003, Henan,
China, 2Key Lab of Animal Epidemiology and Zoonosis of Ministry of Agriculture, China. College of
Veterinary Medicine, China Agricultural University, Beijing 100193, China
*Corresponding Author: chenghe@cau.edu.cn
ABSTRACT
Infectious Bursal Disease Virus (IBDV), one of important avian pathogens, could cause immuno-
suppressions in 3- or 6-week-old chickens and bursal B lymphocytes apoptosis. In our previous
studies, protocatechuic acid (PCA) could effectively increase survival rates and improve bursal injury
of chickens artificially infected with IBDV. Therefore, the current study was to investigate the
regulation effects of PCA on bursal damage caused by IBDV infection. Thirty-five 21-day-old SPF
chickens were randomly divided into two groups with the PCA group 20 and infection group 15.
These chickens were inoculated intraocularly with 0.2 ml of 102.5 EID50 of IBDV strain CJ801. The
birds were orally administered with 20 mg/kg body weight of PCA and saline water respectively, for 5
days and then monitored daily for 10 days uptill 24 hours post infection. Bursae were collected from
chickens on days 3, 6 and 9 after infection for immunohistochemistry. These paraffin sections were
then analysed for protein determination of Bax and Bcl-2. TdT-mediated dUTP nick end labeling
(TUNEL) was also used to quantify apoptosis of bursa lymphocytes. The immunohistochemistry
results displayed that the ratio of Bax/Bcl-2 in the PCA group significantly increased (P<0.01)
compared to that of the infection group. However, the pro-apoptotic protein Bax and anti-apoptotic
protein Bcl-2 in the infection group simultaneously reduced from days 3 to 9. The TUNEL results
showed that the apoptotic percentage of lymphocytes in the PCA group was non significantly lower
than that of the infection group at third day, but the apoptotic percentage increased a little in the
PCA group at day 9. These results indicated that PCA could promote cell apoptosis at the early stage
of IBDV infection, while it delayed cell apoptosis at the later stage of IBDV infection.
Key Words: Protocatechuic acid, Infectious bursal disease virus, Apoptosis, Bax, Bcl-2
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
124
PREPARATION AND EXPERIMENTAL EVALUATION OF BIVALENT INACTIVATED
AVIAN INFLUENZA (H9N2) AND THERMOSTABLE NEWCASTLE DISEASE
VACCINE AGAINST CHALLENGE IN BROILERS
Rabia Sabir and M Shahid Mahmood*
Institute of Microbiology, University of Agriculture, Faisalabad, Pakistan
*Corresponding Author: shahiduaf@gmail.com
ABSTRACT
Avian Influenza virus (AIV) and Newcastle Disease virus (NDV) are responsible for causing Avian
Influenza (AI) and Newcastle Disease (ND) respectively in birds, both of which detrimentally affect
the poultry birds in terms of significant economic losses. Biosecurity and immunization are the
promising ways to combat viral infection. Bivalent vaccines provide protective immunity against these
two major diseases and are more economical than monovalent vaccines.
The goal of current research was production of bivalent montanoid adjuvanted-inactivated
Newcastle Disease (ND) and Avian Influenza (AI) vaccine. Research was carried out in three phases.
Primarily the antigens (I2strain of Newcastle Disease, H9N2 serotype of Avian Influenza) were verified
quantitatively and qualitatively using biological and serological assays. Second phase of research was
preparation of bivalent AI-ND vaccine. Quality control tests such as safety and sterility tests were
executed according to standard protocols. In third phase of research broiler chicks were grouped as
follows: Group A were immunized with bivalent inactivated vaccine prepared during the study, Group
B received commercially available bivalent inactivated vaccine and Group C received no vaccine (PBS).
Later on, 35 days old birds were challenged with AIV and NDV and at 14, 21, 28 and 40 days of
vaccination, sera were collected from each group and antibody titers were determined through HI
and ELISA.
Results of HI test and ELISA indicated that maximum antibody titers of self-made bivalent vaccine
were achieved at 28 days of age that was 128 and 1.784 for AI; 124.8 and 1.951 for ND respectively.
However, antibody titers at day 40 (after virus challenge) were 73.60 and 1.619 for AI; 73.60 and
1.650 for ND, respectively. Similarly results of commercially available bivalent vaccine were at 28 days
of age was 56 and 1.123 for AI; 36.80 and 1.235 for ND respectively. However, antibody titers at day
40 (after virus challenge) were 22.40 and 0.825 for AI; 22.40 and 0.704 for ND, respectively.
Research data was statistically analyzed through T-test and the results for HI test of self-made
bivalent vaccine were significant however, the results were highly significant for ELISA. Towards the
end, it was concluded that bivalent vaccine prepared during this study yielded better and long lasting
antibody titers as compared to commercially available bivalent vaccine for ND and AI.
Key Words: Newcastle Disease virus, Avian Influenza virus, Broilers, Bivalent vaccine, ELISA.
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
125
BLADDER BLOCKAGE AND TESTICULAR CHANGES IN MALE OSTRICH
(STRUTHIO CAMELUS) ASSOCIATED WITH ASPERGILLOSIS
Riaz Hussain1, Fazal Mahmood2, Sajid Hameed1 and Mudassar Iqbal1
1University College of Veterinary and Animal Science, The Islamia University of Bahawalpur-63100,
Bahawalpur; 2Department of Pathology, Faculty of Veterinary Sciences, University of Agriculture,
Faisalabad-38040, Pakistan
*Corresponding Author: driazhussain@yahoo.com
ABSTRACT
Huge economic losses occur in terms of poor growth, decrease production and mortality in different
species of birds including ostrich throughout the worlds due to aspergillosis. The present report
elaborates the simultaneous occurrence of blocked bladder associated with penile protrusion,
proventriculus impaction and testicular changes in a five years old male ostrich (Struthio camelus) died
of aspergillosis infection. Prior to death different clinical signs such as anorexia, dysponea and
coughing were observed. Necropsy of male ostrich revealed significant enlargement of urinary
bladder impacted with yellow color and amorphous material. Spherical grayish white raised areas of
caseous necrotic foci of variable diameter were sparsely spread over the air sacs. Multiple solitary
well circumscribed nodules with hard consistency, hanging with fibrous threads in air sacs were
packed with yellow cheesy material. Grossly the testes were smaller in size and hard in consistency.
Histologically, the testes were significantly atrophied; there were increased connective tissue
proliferation with chronic inflammatory cell infiltration. Moreover, seminiferous tubules were lined by
one to two layers of cells exhibiting degenerative and necrotic changes. Some tubules showed
obliterated lumen and multinucleated giant cells with engulfed necrotic cells were also observed.
Aspergillus samples were collected and stained with lactophenol, Giemsa’s and florescent stain
revealed prominent hyphae and sporangium, histologically lungs tissue revealed multiple areas of
caseous necrosis. Proventriculus was full of gravel, iron bars corn cobs and plastic bottles.
Key Words: Ostrich, Aspergillosis, Bladder, Testes, Histopathology
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
126
SERUM BIOCHEMICAL AND HISTOPATHOLOGICAL CHANGES INDUCED BY
CONCURRENT EXPOSURE OF ARSENIC AND COPPER SULPHATE IN ADULT
MALE BIRDS
Abdul Ghaffar1*, Riaz Hussain2 and Ahrar Khan3
1Department of Life Sciences (Zoology); 2University College of Veterinary and Animal Sciences, The
Islamia University of Bahawalpur- 63100; 3Department of Pathology, University of Agriculture,
Faisalabad-38040, Pakistan
*Corresponding Author: zoologistag@gmail.com
ABSTRACT
The present experimental study was conducted to determine the clinico-heamatological and
serum biochemical impacts induced by concurrent oral administration of arsenic and copper sulphate
in adult male birds. After seven days of acclimatization a total of 28 adult male birds were randomly
divided into 7 groups each having four birds. Arsenic and copper sulphate alone and in different
combinations was given to birds for 30 days. Blood samples were collected from each bird at days 10,
20 and 30 of the experiment. Various clinical signs like decreased feed intake, body weight, ruffled
feather, depression, dullness, ocular discharge, open mouth breathing, diarrhea and pale comb were
observed at higher levels of arsenic and copper sulphate. Absolute and relative weight of liver testes,
kidneys, spleen, lungs trachea and thymus were significantly different in treated birds as compared to
control group. Serum biochemical parameters such as aspartate aminotransferase, alkaline phosphate,
creatine-kinase, cholesterol, triglyceride and malondialdehyde concentrations were significantly (P<
0.05) higher in different treated groups at different experimental days. From the results of this study
it can be concluded that arsenic and copper sulphate alone at higher levels and in combination even at
lower levels poses serious clinico-biochemical effects in avian species.
Key Words: Birds, Copper sulphate, Arsenic, Serum Biochemistry
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
127
EFFECTS OF DIFFERENT LEVELS OF DAP AND ARSENIC ON SOME HAEMATO-
BIOCHEMICAL AND HISTOPATHOLOGICAL CHANGES IN LAYERS
Riaz Hussain1*, Abdul Ghaffar2, Ahrar Khan3 and Muhammad Shahzad1
1University College of Veterinary and Animal Sciences; 2Department of Life Sciences (Zoology), The
Islamia University of Bahawalpur- 63100; 3Department of Pathology, University of Agriculture,
Faisalabad, Pakistan-38000
*Corresponding Author: driazhussain@yahoo.com
ABSTRACT
In present experimental study some hemato-biochemical and histopathological effects of DAP
and Arsenic were observed in layers birds. For this purpose a total of 72 chicks of same age and
weight were purchased from local hatchery and were kept under similar conditions. After one week
of acclimatization all the birds were randomly divided into six equal groups (A-F) having twelve birds
each. Different levels of diammonium phosphate and arsenic in combinations were given to birds
orally for 39 days. Four birds from each group were killed at days, 13, 26 and 39 of the experiment
for collection of blood. A significant decrease in hematological parameters such as erythrocyte
counts, hemoglobin concentration and hematocrit values were recorded as compared to control
group. A significant increase in serum cholesterol and creatinine phospho kinase concentration was
also recorded at higher level of DAP and arsenic. Histopathological examination of different tissues
exhibited various microscopic changes in thymus, kidneys, bursa, liver and kidneys. Moderate to
severe congestion in thymus, increased urinary space and tubular degenerations in kidneys,
vaccuolation in bursa and liver were the prominent features. The results of this study shows that
different levels of DAP and arsenic poses adverse impacts even at low levels in combination in birds.
Key Words: Birds, Arsenic, Diammonium phosphate, Blood, Serum, Histology
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
128
SEROLOGICAL SCREENING OF BROILER AND LAYER FLOCKS FOR MYCOPLASMA
SYNOVIAE INFECTION IN PAKISTAN
Madiha Kiran, Syed Ehtisham-ul-Haque*, Usman Waheed and Muhammad Younus
Department of Pathobiology, College of Veterinary and Animal Sciences Jhang-35200, Pakistan
Corresponding Author: ehtishamsyed@uvas.edu.pk
ABSTRACT
Mycoplasma synoviae (MS) is an economically significant and second most important avian
Mycoplasma pathogen for the worldwide poultry production. It has been associated with subclinical
upper respiratory tract infection and infectious synovitis in broiler, layer and breeder flocks. The
most effective control measure is to maintain MS free breeder flocks through good biosecurity and
regular monitoring with serology. The present study was carried out to monitor MS infection in the
poultry farms located in Districts Jhang and Layyah of Punjab, Pakistan by serological technique i.e.
rapid serum agglutination (RSA) test. A total of 104 sera samples were collected from broiler and
layer birds with the history of respiratory disease and analyzed for antibodies against MS. RSA was
performed using SPAFAS MS Plate Antigen (Charles River Lab., CT, USA) for Plate Agglutination
Test. Mycoplasma synoviae reagent serum (SPMS0312) (Charles River Lab., CT, USA) served as
control positive sera. Results of RSA revealed 51% positivity for MS. In conclusion, serological
screening is the best tool to detect the infection in a flock. This was a preliminary study and the
positive results will be further confirmed through molecular detection of MS. The present study was
completed under financial grant by International Foundation for Science (IFS), Stockholm, Sweden
Grant Ref. Number. B/5365-1 on “Development of Loop-mediated isothermal amplification (LAMP)
assay: a simple and cost effective diagnostic test for the molecular detection of economically
important Mycoplasma pathogens of chickens” granted to Chief Investigator Dr. Syed Ehtisham-ul-
Haque.
Key Words: Mycoplasma synoviae, Serological screening, RSA, Pakistan
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
129
CHEMICAL COMPOSITION, BIOLOGICAL ACTIVITY AND APPLICATION IN
ANIMAL SCIENCE OF PROPOLIS- A REVIEW
Shijun Fu, Shijin Guo, Guanggang Qu and Zhiqiang Shen*
Shandong Binzhou Animal Science and Veterinary Medicine Academy, Binzhou 256600, China
*Corresponding Author: bzshenzq@163.com
ABSTRACT
Propolis is a resinous hive product collected by honeybees from various plant sources. Several
groups of researchers have focused their attention on the biological activity of propolis and its active
principles. Many scientific articles are published every year in different international journals related
to the plant sources and extraction technology of propolis. This review article compiles recent
findings concerning the plant origin, extraction technology, main constituents, bioactivity, applications
in animal husbandry and quality control of propolis.
Key Words: Propolis; bioactivity; application; animal science
INTRODUCTION
Propolis is the generic name for the resinous product of complex composition collected by
honey bees from bud and exudates of various plants (Banskota et al., 2001; Sforcin, 2007). More than
300 constituents have been identified so far, among which phenolic compounds, including flavonoids,
are major components (Hegazi et al., 2000). Propolis has attracted researchers’ interest in the last
decades because of several biological and pharmacological properties, such as immunomodulatory
(Sforcin, 2007), antitumor (Khalil, 2006), antimicrobial (Bankova et al., 2000), antitrypanosomal
activities (Da Silva et al., 2004; Syamsudin et al., 2009), antioxidant (Ozguner et al., 2005) and
angiogenesis (Ahn et al., 2009). This review describes recent findings concerning the plant origin,
extraction technology, main constituents, bioactivity, applications in animal science as well as quality
control of propolis.
Plant Origin and Extraction Technology
Plant Origin
To understand what causes the differences in chemical composition, it is necessary to keep in
mind the plant origin of propolis. For propolis production, bees use materials resulting from a variety
of botanical processes in different parts of plants (Bankova, 2005). Poplar and Baccharis are well
known as the source plants of European and Brazilian propolis, respectively. With further research,
there are several new plant sources continued to be found. For instance, the propolis from Okinawa
and Okayama, Japan, contain some prenylflavonoids not seen in other regions such as Europe and
Brazil. The plant origins of Okinawa and Okayama propolis are Macaranga tanarius (Kumazawa et al.,
2008) and Rhus javanica var. chinensis (Murase et al., 2008), respectively.
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
130
Extraction Technology
Propolis cannot be used as a raw material; it must be purified by extraction with solvents. This
process should remove the inert material and preserve the polyphenolic fractions (Gomez-Caravaca
et al., 2006). Various extraction techniques were applied to extract the biologically active constituents
of propolis. Extraction with ethanol is particularly suitable to obtain dewaxed propolis extracts rich in
polyphenolic components and this is the most commonly used solvent (Park and Ikegaki, 1998; Pietta
et al., 2002; Popova et al., 2004). In addition, extraction with pure water (Woisky and Salatino, 1998)
(these extracts are likely to contain phenolic acids which are very soluble in water), methanol (Cao et
al., 2004), hexane and acetone (Pereira et al., 2000) and chloroform (Negri et al., 2003) have also
been used.
Recently, several modern extraction methods such as ultrasound, microwave and supercritical
carbon dioxide (SC-CO2) have been developed for the fast and efficient extraction. Chen et al.
(2009b) applied supercritical carbon dioxide (SC-CO2) extraction and obtained 3,5-diprenyl-4-
hydroxycinnamic acid (DHCA) from propolis. Traditional maceration extraction, ultrasound
extraction, and microwave assisted extraction were employed to compare their efficiency (Trusheva
et al., 2007). The results shown that microwave assisted extraction was very rapid but led to the
extraction of a large amount of non-phenolic and non-flavonoid material; ultrasound extraction gave
the highest percentage of extracted phenolics. Compared to the maceration extraction, microwave
assisted extraction and ultrasound extraction methods provided high extraction yield, requiring short
timeframes and less labour; ultrasound extraction was shown to be the most efficient method based
on yield, extraction time and selectivity.
Main Constituents and Activity of Propolis
Main Constituents of Propolis
Propolis is a complex mixture of substances collected by honeybees from buds or exudates of
plants (resin), beeswax and other substances, such as pollen and sugars (Teixeira et al., 2010). The
chemical composition of the propolis significantly depends on the collecting location, time and plant
source (Park et al., 2002; Bankova, 2005; Melliou et al., 2005; Alencar et al., 2007). As a consequence,
more than 300 components have been identified so far, among which phenolic compounds, including
flavonoids, are major components (Hegazi et al., 2000; Khalil, 2006).
Due to the different climate, there are different plant distributions in temperate, subtropical and
tropical regions. Consequently, the plant sources of propolis source are quite different. Leaf-buds of
Populus nigra (black poplar) are sources of propolis resin in temperate regions (Bankova et al., 1992).
Propolis resin from Europe and China contain predominantly flavonoids and secondarily phenolic acid
esters (Bankova, 2000). Iranian propolis has been shown to contain aromatic acids (benzoic and
benzenepropanoic), esters of caffeic and phenylethyl-trans-4-coumaric acids, flavonoids (pinocembrin,
chrysin), among other constituents (Mohammadzadeh et al., 2007).
The seasonal variations in the chemical composition of propolis have also been demonstrated.
Brazilian propolis contents of all compounds varied along the year (Teixeira et al., 2010). Chemical
composition of Brazilian propolis detected a pattern, according to which diterpenes started appearing
in summer and reached a maximum in autumn, being absent along other seasons (Bankova et al.,
1998).
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
131
Bioactivity of Propolis
Antimicrobial activity of propolis
More and more publications are appearing which combine antimicrobial and other biological
studies with chemical analyses of the tested propolis samples. Although different propolis origins lead
to distinct chemical composition, propolis is the defense of bees against infections, therefore, the
antibacterial and antifungal activity of propolis are present (Bankova, 2005).
Propolis antimicrobial properties have been widely investigated and demonstrated. Propolis
extract showed in vitro antibacterial activity, inhibition of cell adherence and inhibition of water-
insoluble glucan formation (Koo et al., 2000). Propolis also showed antiviral (Huleihel and Isanu, 2002;
Gekker et al., 2005), antifungal (Sforcin et al., 2001; Salomão et al., 2004), antiparasite (Salomao et al.,
2004; Freitas et al., 2006) and antitrypanosomal activities (Da Silva et al., 2004).
Immunoregulation and antiproliferative activity of propolis
In vitro and in vivo assays demonstrated that propolis may activate macrophages, increasing their
microbicidal activity. Propolis enhances the lytic activity of natural killer cells against tumor cells
(Sforcin et al., 2007). Besides, caffeates of the Netherlands propolis were considered to be active
constituent’s antiproliferative activity (Banskota et al., 2002).
Antioxidant activity of propolis
Propolis with strong antioxidant activity contained antioxidative compounds such as kaempferol
and phenethyl caffeate. Propolis exerts its antioxidative effect where it is assumed to accumulate,
such as on the kidney, where it is excreted, and on the gastrointestinal tract, where propolis
influences these tissues even from the outside of the cell (Sun et al., 2000). Ethanol extracts of
propolis from Argentina, Australia, China, Hungary and New Zealand had relatively strong antioxidant
activities, and were also correlated with the total polyphenol and flavonoid contents (Kumazaw et al.,
2004). Caffeic acid phenethyl ester exhibits a protective effect on mobile phone-induced and free
radical mediated oxidative renal impairment in rats (Ozguner et al., 2005).
Application of Propolis in Animal Science
Application of Propolis as Feed Additive
Dietary supplementation of laying hens exposed to heat stress with propolis (5 g/kg diet) can
attenuate heat stress-induced oxidative damage and increase growth performance and digestibility,
improve eggshell thickness and egg weight (Tatli Seven, 2008, 2009). Propolis supplementation as
alternative to antibiotics in broilers in heat stress conditions may be used as redound to performance
and digestibility (Tatli Seven and Seven, 2008). Addition of propolis at 3g/kg in the laying hens diet
resulted in significant increases in the serum IgG and IgM levels and erythrocyte count, significant
decrease in the peripheral blood T-lymphocyte percentage. Hemoglobin and hematocrit values and
total leucocyte and differential leucocytes counts were not influenced by propolis supplementation
(Çetin et al., 2010). Supplementation of lambs with propolis improved weight gain, feed utilization,
percentage of dressed meat, meat digestibility and tenderness (Bonomi, 2002a). Weight gain and feed
consumption of pregnant sows with propolis supplementation were improved (Bonomi, 2003). The
live weight gain, feed utilization, carcass yield, meat digestibility and tenderness of young bulls fed with
mixed feeds with propolis were improved (Bonomi and Bonomi, 2002). The addition of 30 ppm
propolis to feed improved egg production in laying hens. Speed of growth and use and digestibility of
feed were enhanced by the inclusion of 40-60 ppm propolis in feed for hen, turkeys, and by 20-40
ppm in feed for guinea fowl, ducks, broilers and rabbits (Bonomi, 2002b).
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
132
Therapeutic Properties of Propolis
It is known that propolis possesses antimicrobial, antioxidative, antiulcer and antitumor activities.
Therefore, propolis has attracted much attention in recent years as a useful or potential substance
used in medicine and cosmetics products. Furthermore, it is now extensively used in foods and
beverages with the claim that it can maintain or improve human health (Khalil, 2006; Syamsudin et al.,
2009). Recently, propolis had gained popularity application in veterinary such as treatment of young
cattle dermatophytosis (Cam et al., 2009).
Application of propolis as vaccine adjuvant
Propolis can stimulate higher antibody production, suggesting its use in vaccines, as an adjuvant
(Sforcin, 2007). Phenolic compounds such as artepillin C and the derivatives of cinnamic acid besides
other flavonoid substances were abundant in the propolis extract, and they could be the main
substances with adjuvant action (Fischer et al., 2007). In recent years, it has been used as an adjuvant
for mammals, poultry and fish. Propolis could stimulate leucocyte activity and antibody titre in
vaccinated fish and increased the survival rate following challenge (Chu, 2006). Because of unique
ultrastructure, vaccines with propolis as adjuvant have many advantages such as high stability, slowly
release in the body and long storage stage (Shen et al., 2000).
Quality Control of Propolis
Pesticide Residues in Propolis
The most important contaminants in propolis are the substances used for control of bee pests.
Chemical protection of beehives is commonly carried out by treatment with different kinds of
pesticide (Bogdanov, 2006). Therefore, monitoring of pesticide residues in propolis is of particular
concern to consumer safety. A method based on matrix solid-phase dispersion (MSPD) was
developed to determine bifenthrin, buprofezin, tetradifon, and vinclozolin in propolis using gas
chromatography-mass spectrometry in selected ion monitoring mode (dos Santos et al., 2008). Chen
et al. (2009b) employed gas chromatography-electron capture detection using double column series
solid-phase extraction for the simultaneous determination of 17 organochlorine pesticides in propolis.
An analytical method in propolis was developed and validated for the determination of four
tetracyclines by high performance liquid chromatography (Zhou et al., 2008).
Toxicity Analysis of Propolis
Products containing propolis have been used increasingly as dietary supplements. Although
reports of allergic reactions are not uncommon, propolis is relatively non-toxic, with a no-effect level
(NOEL) in a 90-mouse study of 1400 mg/kg body weight/day (Burdock, 1998). Subchronic toxicity
study of oral propolis extract indicated that no significant behavioral and clinical toxicity has been
seen in male rats (Mohammadzadeh et al., 2007).
Propolis’s systemic toxicity is rarely reported and hence may be underestimated. It is also a
potent sensitizer and should not be used in patients with an allergic predisposition, in particular an
allergy to pollen (Menniti-Ippolito et al., 2008). Besides, propolis could induce acute renal failure and
emphasizes the need for vigilance and care when propolis is used as a medicine or dietary supplement
(Li et al., 2005).
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
133
Conclusions
Propolis has a wide range of biological activity and pharmacological effects, and has attracted
considerable attention from both scientists and entrepreneurs. The chemical composition of the
propolis significantly depends on the collecting location, time and plant source. Dietary
supplementation of animal with propolis can increase growth performance and digestibility.
Furthermore, propolis is a useful substance used in veterinary medicine and acts as an excellent
adjuvant. It needs to be noted that pesticide residues in propolis should be paid more attention
during furture applications.
With the continuous development of science and technology, the chemical composition,
pharmacological effects, extensive applications and quality control of propolis will be constantly
studied.
Acknowledgments
This work was supported by the Shandong Science and Technology Development Project
(2009GG10009001) of China. The authors wish to express their gratitude to Professor Shirley Wang
for her valuable guidance and suggestions of this paper.
References
Acikgoz Z, B Yucel and O Altan, 2005. The effects of propolis supplementation on broiler
performance and feed digestibility. Archiv für Geflügelkunde, 69: 117-122.
Ahn MR, K Kunimasa, S Kumazawa, T Nakayama, K Kaji et al. 2009. Correlation between
antiangiogenic activity and antioxidant activity of various components from propolis. Mol Nutr
Food Res, 63: 643-651.
Alencar SM, TLC Oldoni, ML Castro, ISR Cabral, CM Costa-Neto et al., 2007. Chemical composition
and biological activity of a new type of Brazilian propolis: red propolis. J Ethnopharmacol, 113:
278-283.
Bankova V, G Boudourova-Krasteva, S Popov, JM Sforcin and SRC Funari, 1998. Seasonal variations of
the chemical composition of Brazilian propolis. Apidologie, 29: 361–367.
Bankova V, SL de Castro and MC Marcucci, 2000. Propolis: recent advances in chemistry and plant
origin. Apidologie, 31: 3-15.
Bankova V, Dyulgerov A, Popov S, Evstatieva L, L Kuleva et al., 1992. Propolis produced in Bulgaria
and Mongolia-phenolic compounds and plant-origin. Apidologie, 23: 79–85.
Bankova V, 2005. Recent trends and important developments in propolis research. Evid-based Compl
Alt, 2: 29-32.
Banksota AH, Y Tezuka and SH Kadota, 2001. Recent progress in pharmacological research of
propolis. Phytother Res, 15: 561-571.
Banskota AH, T Nagaoka, LY Sumioka, Y Tezuka, S Awale et al., 2002. Antiproliferative activity of the
Netherlands propolis and its active principles in cancer cell lines. J Ethnopharmacol, 80: 67-73.
Bogdanov S, 2006. Contaminants of bee products. Apidologie, 37: 1-18.
Bonomi A, BM Bonomi, A Mazzotti and A Sabbioni, 2002a. The use of propolis in light lamb feeding.
La Rivista di Scienza dell’Alimentazione, 31: 65-75.
Bonomi A and BM Bonomi, 2002. The use of propolis in feeding young bulls. La Rivista di Scienza
dell’Alimentazione, 31: 91-103.
Bonomi A, 2002b. Propolis in the feed of small species. Informatore Agrario, 58: 41-43.
Bonomi A, 2003. Use of propolis in the feeding of sows. Rivista di Suinicoltura, 2: 101-106.
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
134
Burdock GA, 1998. Review of the biological properties and toxicity of bee propolis (propolis). Food
Chem Toxicol, 36: 347-363.
Cam Y, AN Koç, S Silici, V Günes, H Buldu et al., 2009. Treatment of dermatophytosis in young cattle
with propolis and Whitfield’s ointment. Vet Rec, 165: 57-58.
Cao YH, Y Wang and Yuan, Q 2004. Analysis of flavonoids and phenolic acid in propolis by capillary
electrophoresis. Chromatographia, 59: 135-140.
Çetin E, S Silici, N Çetin and BK Güçlü, 2010. Effects of diets containing different concentrations of
propolis on hematological and immunological variables in laying hens. Poult Sci, 89: 1703-1708.
Chen CR, YN Lee, MR Lee and Chang, CM 2009a. Supercritical fluids extraction of cinnamic acid
derivatives from Brazilian propolis and the effect on growth inhibition of colon cancer cells. J
Taiwan Instit Chem Eng, 40: 130-135.
Chen F, LZ Chen, Q Wang, JH Zhou, XF Xue and J Zhao, 2009b. Determination of organochlorine
pesticides in propolis by gas chromatography-electron capture detection using double column
series solid-phase extraction. Anal Bioanalytical Chem, 393: 1073-1079.
Chu WH, 2006. Adjuvant effect of propolis on immunisation by inactivated Aeromonas hydrophila in
carp (Carassius auratus gibelio). Fish Shellfish Immun, 21: 113-117.
Da Silva CIB, K Salomao, M Shimizu, S Bankova, AR Custodio et al., 2004. Antitrypanosomal activity
of Brazilian propolis from Apis mellifera. Chem Pharm Bull, 52: 602-604.
dos Santos TFS, A Aquino, HS Dórea and S Navickiene, 2008. MSPD procedure for determining
buprofezin, tetradifon, vinclozolin, and bifenthrin residues in propolis by gas chromatography-
mass spectrometry. Anal Bioanalyt Chem, 390: 1425-1430.
Fischer G, MB Cleff, LA Dummer, N Paulino, AS Paulino et al., 2007. Adjuvant effect of green propolis
on humoral immune response of bovines immunized with bovine herpesvirus type 5. Vet
Immunol Immunop, 116: 79-84.
Freitas SF, L Shinohara, JM Sforcin and S Guimarães, 2006. In vitro effects of propolis on Giardia
duodenalis trophozoites. Phytomedicine, 13: 170-175.
Gekker G, SX Hu, M Spivak, JR Lokensgard and PK Peterson, 2005. Anti-HIV-1 activity of propolis in
CD4+ lymphocyte and microglial cell cultures. J Ethnopharmacol, 102: 158–163.
Gomez-Caravaca AM, M Gomez-Romero, D Arraez-Roman, A Segura-Carretero and A Fernandez-
Gutierrez, 2006. Advances in the analysis of phenolic compounds in products derived from bees.
J Pharmaceut Biomed, 41: 1220-1234.
Hegazi AG, FK Abd El Hady and FA Abd Allah, 2000. Chemical composition and antimicrobial activity
of European propolis. Z Naturforsch, 55: 70-75.
Huleihel M and V Isanu, 2002. Anti-herpes simplex virus effect of an aqueous extract of propolis. Isr
Med Assoc J, 4: 923–927.
Khalil ML, 2006. Biological activity of bee propolis in health and disease. Asian Pac J Cancer Prev, 7:
22-31.
Koo H, BP Gomes, PL Rosalen, GM Ambrosano, YK Park et al., 2000. In vitro antimicrobial activity of
propolis and Arnica montana against oral pathogens. Arch Oral Biol, 45: 141-148.
Kumazaw S, T Hamasaka and T Nakayama, 2004. Antioxidant activity of propolis of various
geographic origins. Food Chem, 84: 329-339.
Kumazawa S, J Nakamura, M Murase, M Miyagawa, MR Ahn et al., 2008. Plant origin of Okinawan
propolis: honeybee behavior observation and phytochemical analysis. Naturwissenschaften, 95:
781-786.
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
135
Melliou E, E Stratis and I Chinou, 2007. Volatile constituents of propolis from various regions of
Greece-Antimicrobial activity. Food Chem, 103: 375-380.
Menniti-Ippolito F, G Mazzanti, A Vitalone, F Firenzuoli and C Santuccio, 2008. Surveillance of
suspected adverse reactions to natural health products: the case of propolis. Drug Saf, 31: 419-
423.
Mohammadzadeh S, M Shariatpanahi, M Hamedi, R Ahmadkhaniha, N Samadi et al., 2007. Chemical
composition, oral toxicity and antimicrobial activity of Iranian propolis. Food Chem, 103: 1097–
1103.
Murase M, Kato A Sun, T Ono, J Nakamura et al., 2008. Rhus javanica var. chinensis as a new plant
origin of propolis from Okayama, Japan. Biosci, Biotech, Biochem, 72: 2782-2784.
Negri, G, MLF Salatino and A Salatino, 2003. Green propolis: unreported constituents and a novel
compound from chloroform extracts. J Apicult Res, 42: 39-41.
Ozguner F, F Oktem, A Ayata, A Koyu and HR Yilmaz, 2005. A novel antioxidant agent caffeic acid
phenethyl ester prevents long-term mobile phone exposure-induced renal impairment in rat:
Prognostic value ofmalondialdehyde, N-acetyl-β-D-glucosaminidase and nitric oxide
determination. Mol Cell Biochem, 277: 73-80.
Park, YK, SM Alencar and CL Aguiar, 2002. Botanical origin and chemical composition of Brazilian
propolis. J Agri Food Chem, 50: 2502-2506.
Park YK and M Ikegaki, 1998. Preparation of water and ethanolic extracts of propolis and evaluation
of the preparations. Biosci, Biotech, Biochem, 62: 2230-2232.
Pereira AS, M Norsell, N Cardoso and FR Aquino Neto, 2000. Rapid screening of polar compounds
in Brazilian propolis by High-Temperature High-Resolution gas chromatography-mass
spectrometry. J Agric Food Chem, 48: 5226–5230.
Pietta PG, C Gordana, and AM Pietta, 2002. Analytical methods for quality control of propolis.
Fitoterapia, 73: S7-S20.
Popova M, V Bankova, D Butovska, V Petkov, B Nikolova-Damyanova et al., 2004. Validated methods
for the quantification of biologically active constituents of poplar-type propolis. Phytochem
Analysis, 15: 235-240.
Salomão K, AP Dantas, CM Borba, LC Campos, DG Machado et al., 2004. Chemical composition and
microbicidal activity of extracts from Brazilian and Bulgarian propolis. Lett Appl Microbiol, 38:
87-92.
Sforcin JM, JA Fernandes, CAM Lopes, SRC Funari and V Bankova, 2001. Seasonal effect of Brazilian
propolis on Candida albicans and Candida tropicalis. J Venom Anim Toxins, 7: 139-144.
Sforcin JM, 2007. Propolis and the immune system: a review. J Ethnopharmacol, 113: 1-14.
Shen ZQ, XX Zhang, CW Lin, JS Liu, KL Xu et al., 2002. Development of preparation technology,
safety and potency tests of the vaccine of propolis adjuvant inactivated vaccine against Newcastle
disease in poultry. Chin J Prev Vet Med, 22: 275-277.
Sun F, S Hayami, S Haruna, Y Ogiri, K Tanaka et al., 2000. In vivo antioxidative activity of propolis
evaluated by the interaction with vitamins C and E and the level of lipid hydroperoxides in rats. J
Agric Food Chem, 48(5): 1462-1465.
Syamsudin Dewi RM and Kusmardi, 2009. Immunomodulatory and in vivo antiplasmodial activities of
propolis extracts. Am J Pharmacol Toxicol, 4: 75-79.
Tatli Seven P, S Yilmaz, I Seven, IH Cerci, MA Azman et al., 2009. Effects of propolis on selected
blood indicators and antioxidant enzyme activities in broilers under heat stress. Acta Vet Brno,
78: 75-83.
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
136
Tatli Seven P, 2008. The Effects of dietary Turkish propolis and vitamin C on performance,
digestibility, egg production and egg quality in laying hens under different environmental
temperatures. Asian-Austral J Anim Sci, 21: 1164-1170.
Tatli Seven P and I Seven, 2008. Effect of dietary Turkish propolis as alternative to antibiotic on
performance and digestibility in broilers exposed to heat stress J Appl Anim Res, 34: 193-196.
Teixeira ÉW, D Message, G Negri, A Salatino and PC Stringheta, 2010. Seasonal variation, chemical
composition and antioxidant activity of Brazilian propolis samples. Evid-based Compl Alt, 7: 307-
315.
Trusheva B, D Trunkova and V Bankova, 2007. Different extraction methods of biologically active
components from propolis: a preliminary study. Chem Cent J, 1: 13-16.
Woisky RG and A Salatino, 1998. Analysis of propolis: some parameters and procedures for chemical
quality control. J Apicult Res, 37: 99-105.
Zhou JH, XF Xue, Y Li, JZ Zhang, F Chen et al., 2009. Multiresidue determination of tetracycline
antibiotics in propolis by using HPLC-UV detection with ultrasonic-assisted extraction and two-
step solid phase extraction. Food Chem, 115: 1074-1080.
Li YJ, JL Lin, CW Yang and CC Yu, 2005. Acute renal failure induced by a Brazilian variety of propolis.
Am J Kidney Dis, 46: 125-129.
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
137
DETECTION OF SINGLE NUCLEOTIDE POLYMORPHISMS (SNPS) IN KIT GENE
IN DUCKS (ANAS PLATYRHYNCHOS DOMESTICUS) AND ANALYSIS OF THEIR
RELATIONSHIP WITH DUCK FEATHER COLOR
Li Xuechan1*, Muhammad Shahzad2*, Zahid Iqbal3 and Li Shijun1
1Key Lab of Agriculture Animal Genetics, Breeding, and Reproduction of Ministry of Education,
Huazhong Agricultural University, Wuhan, People’s Republic of China; 2University College of Veterinary
& Animal Sciences, The Islamia University of Bahawalpur, Pakistan; 3National Reference Laboratory of
Veterinary Drug Residues, Huazhong Agricultural University, Wuhan, People’s Republic of China
*Corresponding authors: 414304114@qq.com, m.shahzad@iub.edu.pk
ABSTRACT
Plumage color control is essential for the uniform appearance of birds in poultry industry. White
plumage is the most favorable color for meat-type commercial bird producers not only because ducks
with unpigmented feathers are easy to clean, but also genes involved in melanogenesis may have
pleiotropic effects on other phenotypes. It is well established that in avian species, KIT gene is related
with melanocyte growth and development but the mechanism is not clear yet. Our previous study
found that KIT gene expression in black and white bulbs have very significant differences, suggesting
that there might be some KIT gene mutation correlated with duck feather color variation. In this
study, through the duck KIT gene fragment sequencing, two SNPs have been found to be restricted
genotype which later was confirmed through PCR. In this study, Enshi Ma duck, Jingjiang Ma duck,
Liancheng white duck, Baigai duck, Yingtaogu duck and Muscovy were used for genotyping and
determining the allelic frequency. Statistical analysis indicated the presence of an intermediate
difference between these two SNPs; however, no relation had been observed in these SNPs with the
plumage color.
Key Words: Duck, Feather, SNPs, KIT gene
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
138
AVIAN REO-VIRAL INFECTIONS: AN EMERGING VIRAL THREAT TO POULTRY
INDUSTRY OF PAKISTAN
Bahar-e-Mustafa, Sibtain Ahmad*, Muhammad Tariq and Umair Hassan Khan
University of Agriculture, Faisalabad-Sub campus Toba Tek Singh, Pakistan
*Corresponding Author: dr_sibtainhmd6@uaf.edu.pk
ABSTRACT
Avian reoviruses are associated with the diseases in several species of the wild birds like geese,
ducks and turkeys but currently in commercial poultry they are posing a serious threat by viral
arthritis. These viruses belong to family Reoviridae and specifically genus is Orthoreovirus. They
derive their name from the respiratory enteric orphan as firstly they were observed from the
respective tracts in humans but they were not associated with any of the diseases. These viruses are
RNA in nature (double stranded) and possess a segmented genome (10 segments), icosahedral
symmetry and a double capsid. Due to these characteristics of the virus, it is liable to mutate its
genome frequently and therefore, numerous serotypes exist. Viral arthritis is particularly problem of
the broilers and it affects the joints of the birds. Several complications associated with the disease e.g.
poor FCR, decreased uniformity in the growth and body weights and moreover, the reduced quality
of the carcass. In case of breeder, the onset of the disease prior to the production leads to the
reduced production and hatchability. Virus has also got capability to be vertically transmitted to the
next generation. All of these factors make this disease economically important and emphasize the
rapid diagnosis and control of the disease. The disease can be readily diagnosed on the basis of the
molecular methods e.g. RT-PCR and serological assays such as ELISA and IFA. However control of
the disease is much important and should be implanted by the scrupulous biosecurity and vaccination
by the homologous virus.
Key Words: Reovirus, Viral Arthritis, Vertical Transmission, Poultry
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
139
LOOP MEDIATED ISOTHERMAL AMPLIFICATION (LAMP) BASED DETECTION
OF POULTRY DISEASES: CURRENT SCENARIO AND FUTURE PERSPECTIVES
Sibtain Ahmad*, Bahar-e-Mustafa and Riaz Mustafa
University of Agriculture, Faisalabad-Sub campus Toba Tek Singh, Pakistan
*Corresponding Author: dr_sibtainhmd6@uaf.edu.pk
ABSTRACT
Newcastle disease (ND), Infectious Bursal disease (IBD) and Infectious Bronchitis (IB) are the
most disastrous viral diseases of poultry industry. Various techniques employed for the diagnosis of
these diseases are although, useful yet it takes too long time to diagnose. Moreover, it is difficult to
employ them under field circumstances. So there arises the importance of LAMP as a diagnostic
technique that may be easily carried out under field conditions and takes less time to diagnose a
disease. Loop-mediated isothermal amplification (LAMP) was developed by Japanese scientists
Notomi and his colleagues in 2000. This technique encompasses both of the requirements i.e. it is
quick to perform and can be very efficiently adapted to the field conditions provided appropriate
primers are designed. Being isothermal the test is so simple to carry out that it can be performed in a
water bath/ hot plate at 60◦C in a much less time (almost 45-60 mins.) than by other tests. As this
technique is less subjective and has no requirements of expensive laboratory facilities, this approach
can improve chicken health and welfare by improving the diagnosis of already prevalent diseases and
emerging diseases of economic importance.
Key Words: Isothermal, Viral Diseases, Molecular Diagnosis, Health.
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
140
MYCOTOXINS: A HIDDEN THREAT TO WILD AND FANCY BIRDS
Bahar-E-Mustafa1, Umair Hassan Khan1*, Waseem Abbas1 and Muhammad Saad Zubair2
1University of Agriculture, Faisalabad, Sub-Campus Toba Tek Singh; 2Government College University,
Faisalabad, Pakistan.
*Corresponding Author: umair1143@gmail.com
ABSTRACT
Under certain circumstances (temperature and moisture), several species of the fungi produce
several toxins collectively known as mycotoxins. Several pet birds are highly susceptible to these
mycotoxins and depend upon the certain physiological status of the birds. Birds in stress are
particularly prone to develop characteristic signs of mycotoxicosis. Studies have shown that ducklings
have been more susceptible to the aflatoxins than the commercial poultry indicating role of specie
variation. Efforts should be made to avoid offering birds with damaged or broken seeds as they may
contain higher levels of mycotoxins. Corn and peanuts are notorious for having higher levels of
mycotoxins. Until now four major types of mycotoxins have been identified which are dangerous to
poultry and they include aflatoxin, trichothecenes, deoxynevalenol (DON) and ochratoxin. Aflatoxins
are produced by the Aspergillus parasiticus. These toxins inhibit the protein and nucleic acid synthesis.
These are potent hepatotoxin and it causes anorexia, depression, reduced growth in birds.
Characteristic lesions include enlarged and friable liver, enlarged pancreas and spleen. It is also
associated with a severe drop in the immune status of the birds. Trichothenenes are produced by the
Fusarium spp. And this has deleterious effects on the mucous membranes of the birds, producing
several ulcerative lesions. Moreover, it is also associated with the flaccid paralysis of neck and wings
of the birds. This toxin is also associated with the development of the contact dermatitis, gangrene of
peripheral organs, poor feather growth and even nervous disorders. These signs are also occasionally
observed in the wild birds exposed to the peanuts. Ochratoxins are produced by the Aspergillus have
been associated with the renal and liver failure in birds, bone marrow suppression and nervous
manifestations. This toxin has also been associated with the reduced functioning of immune system.
Key Words: Mycotoxins, Fancy birds, Aflatoxin, Ochratoxin, Trichothecenes, Wild birds
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
141
HEMATOLOGICAL AND MUTAGENIC CHANGES INDUCED BY CONCURRENT
ARSENIC AND COPPER SULPHATE IN ADULT POULTRY MALES
Abdul Ghaffar1*, Riaz Hussain2 and Ahrar Khan3
1Department of Life Sciences (Zoology); The Islamia University of Bahawalpur- 63100; 2University
College of Veterinary and Animal Sciences, The Islamia University of Bahawalpur- 63100, Pakistan;
3Department of Pathology, Faculty of Veterinary Science, University of Agriculture, Faisalabad,
Pakistan-38040, Pakistan
*Corresponding Author: zoologistag@gmail.com
ABSTRACT
The present experimental study was conducted to determine the clinico-hematological and
mutagenic impacts induced by concurrent oral administration of arsenic and copper sulphate in adult
male birds. After acclimatization, male birds were randomly divided into equal seven groups. All the
experimental birds received arsenic and copper sulphate alone and in different combinations for 30
days. Blood samples were collected from each bird at days 10, 20 and 30 of the experiment. Various
clinical signs like decreased feed intake, body weight, ruffled feather, depression, dullness, ocular
discharge, open mouth breathing, diarrhea and pale comb were observed at higher levels of arsenic
and copper sulphate. In treated birds the values of total erythrocytes counts, leukocyte counts,
hemoglobin concentration and mean corpuscular hemoglobin concentration were significantly
decreased while packed cell volume and mean corpuscular volume increased. Results showed that
frequency of erythrocytes with micronuclei, blabbed, lobed, notched and cells with nuclear remnants
were significantly increased. From the results of this study it can be concluded that arsenic and
copper sulphate alone at higher levels and in combination even at lower levels pose serious clinico-
hematological and mutagenic effects in adult male birds.
Key Words: Birds, Copper sulphate, Arsenic, Hematology, Micronuclei, Nuclear remnants
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
142
EFFECTS OF DIFFERENT LEVELS OF DAP AND ARSENIC ON SOME HAEMATO-
BIOCHEMICAL AND HISTOPATHOLOGICAL CHANGES IN LAYERS
Riaz Hussain1*, Abdul Ghaffar2 and Ahrar Khan3
1University College of Veterinary and Animal Sciences, The Islamia University of Bahawalpur- 63100,
Pakistan; 2Department of Life Sciences (Zoology). The Islamia University of Bahawalpur- 63100; 3Department of Pathology, Faculty of Veterinary Science, University of Agriculture, Faisalabad,
Pakistan-38040, Pakistan
*Corresponding Author: driazhussain@yahoo.com
ABSTRACT
In present experimental study some hemato-biochemical and histopathological effects of DAP
and Arsenic were observed in layers birds. For this purpose a total of 72 chicks of same age and
weight were purchased from local hatchery and were kept under similar conditions. After one week
of acclimatization all the birds were randomly divided into six equal groups (A-F) having twelve birds
each. Different levels of diammonium phosphate and arsenic in combinations were given to birds
orally for 39 days. Four birds from each group were killed at days, 13, 26 and 39 of the experiment
for collection of blood. A significant decrease in hematological parameters such as erythrocyte
counts, hemoglobin concentration and hematocrit values were recorded as compared to control
group. A significant increase in serum cholesterol and creatinine phospho kinase concentration was
also recorded at higher level of DAP and arsenic. Histopathological examination of different tissues
exhibited various microscopic changes in thymus, kidneys, bursa, liver and kidneys. Moderate to
severe congestion in thymus, increased urinary space and tubular degenerations in kidneys,
vaccuolation in bursa and liver were the prominent features. The results of this study showed that
different levels of DAP and arsenic poses adverse impacts even at low levels in combination in birds.
Key Words: Birds, Arsenic, Diammonium phosphate, Blood, Serum, Histology
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
143
THE ANTIVIRAL ACTIVITY FROM ELEVEN SELECTED CHOLISTANI
PLANTS AGAINST INFECTIOUS BURSAL DISEASE VIRUS
AND INFECTIOUS BRONCHITIS VIRUS
Mirza I Shahzad1*, Amna Aslam2, Sabeeha Parveen2, Hina Ashraf3, Zahid Kamran1, Nargis Naz1, Syeda S
Zehra1, and Muhammad Mukhtar3
1University College of Veterinary and Animal Sciences, The Islamia University of Bahwalpur;
2Department of Life Sciences, The Islamia University of Bahawalpur; 3Cholistan Institute of Desert
Studies, The Islamia University of Bahawalpur, Pakistan
*Corresponding Author: mirza.imran@iub.edu.pk
ABSTRACT
In the recent past there has been a tremendous increase in the use of plant based health
products in developing as well as developed countries resulting in an exponential growth of herbal
products globally. An upward trend has been observed in the research on herbals. Herbal medicines
have a strong traditional or conceptual base and the potential to be useful as drugs in terms of safety
and effectiveness leads for treating different diseases. World Health Organization has made an
attempt to identify all medicinal plants used globally and listed more than 20,000 species. Present
study is based on evaluation of antiviral potential of methanolic extracts of Achyranthes aspera,
Haloxylon recurvum, Haloxylon salicornicum, Oxystelma esculentum, Ochthochloa compressa, Neurada
procumbens, Panicum antidotale ,Salsola baryosma, Suaeda fruticosa, Sporobolos icolados and Solanum
surattense. These plants are well reported for their antibacterial, antifungal, anticancerous,
antiperiodic, diuretic, purgative, laxative, antiasthmatic, hepatoprotective, anti-allergic and various
other important medicinal properties. According to literature these plant are rich source of
phytochemical and pharmacological compounds. But their antiviral activity especially against poultry
pathogens like Infectious Bronchitis Virus (IBV) and Infectious Bursal Disease Virus (IBDV) was not
reported before. In this study antiviral compounds from dried whole plants were extracted in
methanol and later concentrated by rotary evaporator. The concentrated drug was air dried and
finally dissolved in autoclaved water, filtered through 0.22µ syringe filter and use in antiviral assay
against different viruses in 7-11 days chicken embryonated eggs. To check antiviral activity the drug
was mixed with live virus in varying concentrations and propagated into 7-11 days embryonated eggs.
Eggs were opened after 48-72 hours in sterile conditions and allantoic fluid was collected. HA test
was performed to quantify the titer of IBV and IHA test for IBDV after each passage and after
challenge with drug. Almost all plant extracts were effective against IBV except S. surattense, which
has shown slight decrease in HA titer as compared to control. Some plant extracts were very
effective like O. compressa and S. icolados, which kept the HA titer of virus at 0. Similarly other plants
control the virus in varying degree and kept their titers at 8 in case of H. salicornicum, N. procumbens
and S. baryosma, 16 in case of A. aspera, H. recurvum and P. antidotale, 32 in case of O. esculentum and
64 in case of S. fruticosa.
Key Words: Antiviral Activity, IBDV, IBV, Cholistan, Medicinal Plants, Pakistan
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
144
EFFECT OF CHICORY (CICHORIUM INTYBUS) LEAVES EXTRACT
ON GROWTH, NUTRIENT DIGESTIBILITY, HEMATOLOGY
AND IMMUNE RESPONSE OF BROILERS
Saima Liaqat,, Muhammad Shazad Sarwar, Farah Ali1 and Riaz Hussain1
University College of Veterinary and Animal Sciences,
The Islamia University Bahawalpur 63100-Pakistan
*Corresponding Author: saima_liaqat@yahoo.com
ABSTRACT
The present study was conducted to evaluate the effects of Chicory (Cichorium intybus) leaves
extract on growth, nutrient digestibility, hematology and immune response in broiler chicks. Two
separate trials were conducted in this research project, first was performance and the second was
digestibility trial. For this purpose one hundred fifty day old broiler chicks were randomly divided
into five equal groups (A-E) each having 15 birds in performance trial. Group A (positive control) was
offered diet supplemented with an antibiotic growth promoter and coccidiostat. Group B, C, D and E
(negative control) were offered diet without supplementation of any coccidiostat and antibiotic
growth promoter and given water supplemented with chicory leaves extract @ 10ml/liter; extracted
in distilled water at three different pH levels i.e. 3 pH (HCl), 7 pH (distilled water) and 12 pH
(NaOH), respectively. Group E (negative control) was given water without supplementation of
chicory leaves aqueous extract. The blood samples with and without anticoagulant (EDTA) were
collected from all the birds for hematological, immune response and serum biochemical analysis. The
digestibility trial was simultaneously conducted on twenty-five individually caged birds to check the
digestibility of crude protein, crude fat and crude fiber. Significant results were recorded for weight
gain, feed conversion ratio, serum metabolites, immune response against Newcastle disease and
digestibility of crude protein among others. The results of present study revealed that use of chicory
extracts in broiler production is recommended as an in expensive but efficient alternative antibiotic
growth promoter without residual effects.
Key Words: Broiler, Chicory leaves, Hematology, Immune response
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
145
STUDY ON SELECTION OF RIEMERELLA ANATIPESTIFER STRAINS AND
OPTIMIZATION OF HIGH DENSITY FERMENTATION OF THE ISOLATES
WANG Yan, MIAO Li-zhong, ZHUANG Jin-qiu, FU Qiang and WEI Feng
Shandong Binzhou Animal Science & Veterinary Medicine Academy, Binzhou, Shandong, 256600,
China
ABSTRACT
Riemerella anatipestifer disease, namely the infectious serositis of duck, is one of the most
important infectious diseases which caused duck farming economic loss; it’s widely distributed in the
world country and duck feeding area. This research is based on the 11 strains of Riemerella
anatipestifer separated from a duck farm, through a series of tests in the dominant serotype strains
with strong pathogenicity and good immunogenicity as the study object, through the contrast test to
determine the medium which have an enrichment effect, using single factor test and research the
orthogonal test of Riemerella anatipestifer liquid culture medium formula, and discussed the optimum
medium composition of Riemerella anatipestifer growth, and the optimization results are applied to
the high density fermentation, optimization of fermentation conditions, lay a good foundation for
vaccine development of high-quality, efficient next. The main research contents are as follows. The
results showed that: 11 isolated strains of bacteria can be divided into three serotypes, infection of
type I and type II; cytotoxicity test indicated that the 11 isolates of 14 day old Cherry Valley duckling
pathogenic differences, from 4/10 to 10/10 range; immunogenicity test results showed that isolates
JX-2, JX-6 and the JX-10 based vaccine protection against challenge infection rate can reach more
than 80%. It should consider the use of containing the strains of 3 serotypes made polyvalent vaccine
vaccination on the farm. This study compares the effect of four medium enrichment The results show
that, the improved yeast broth enrichment effect is the best in the four kinds of medium, the results
of single factor experiment and orthogonal test showed that when the selected 20% yeast extract 5%;
pig stomach digestion solution 10%; 8% soybean peptone; get horse serum 5% the bacterial
concentration was the highest. High density fermentation conditions optimization results display:
0.1L/S.L ventilation; speed 150 R / min; medium pH of 7.4 the number of live bacteria and bacteria
concentration was highest. The optimization of fermentation process of formulation and optimization,
mass production of 3 batches of Riemerella anatipestifer semi-finished antigen in GMP workshop,
living bacteria number is about 30% higher than that before optimization, thus the research provides
experimental basis for the study of high density fermentation production of Riemerella anatipestifer
antigen.
Key Words: Riemerella anatipestifer, Strain selection, Medium optimization, Big pots fermentation
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
146
EFFICACY OF TOXIN BINDER IN REDUCING INDUCED AFLATOXIN B1 AND
OCHRATOXIN A IN BROILER CHICKENS
Muhammad Umer Zahid1, Anjum Khalique1, Saima1, Jibran Hussain2, Aftab Ahmad3, Muhammad
Hassan Mushtaq*4, Aqeel Javeed5 and Amjad Khan4
1Department of Animal Nutrition, University of Veterinary and Animal Sciences, Ravi Campus,
University of Veterinary and Animal Sciences, Lahore.2Department of Poultry Production, University
of Veterinary and Animal Sciences, Lahore.3Department of Microbiology, University of Veterinary and
Animal Sciences, Ravi Campus, University of Veterinary and Animal Sciences, Lahore.4Department
of Epidemiology and Public Health, University of Veterinary and Animal Sciences, Lahore. 5Department of Pharmacology and Toxicology, University of Veterinary and Animal Sciences, Lahore.
*Corresponding Author: hassan.mushtaq@uvas.edu.pk
ABSTRACT
Aflatoxin B1 and Ochratoxin A (OTA) two of the most prevalent and lethal forms of aflatoxons,
is a growing problem affecting poultry industry and as well as a serious hazard for public health
consuming infected poultry meat. Efficacy of toxins binder in ameliorating induced Aflatoxin B1 and
ochratoxin A was evaluated in broilers. The most commonly avaialable commercial mycotoxin
binders were evaluated in vivo. Birds were distributed randomly into 8 groups each containing 20
birds. Each group was raised on different dietary treatment during the study period. Data were
collected regarding production performance (feed intake (g), body weight gain (g), FCR, Mortality),
toxin binding ability (fecal sample), and incidence of disease and carcass characteristics (dressing %
age, keel and shank length, giblet weight (g), bursa, spleen and thymus weight (g). Generalized linear
model was used to evaluate the combine impact of different variables. However supplementation of
mycotoxin binder feed supplement proved amelioration with significant (P<0.05) impact in the tested
mycotoxicosis in broilers. Analysis of data revealed significantly (P<0.05) higher dressing %, thymus
and bursa weight in birds fed on 1g/kg toxin binder, 220ppb ochratoxin + 1g/kg toxin binder and
200ppb aflatoxin + 100 ppb ochratoxin + 1g/kg toxin binder respectively. Feed consumption ratio
was observed unaffected in all the groups fed on different combination of dietary treatments. Non-
significant differences among different treatment groups might show the admirable efficacy of the
toxin binder. It was concluded that mycotoxin binders had a significant effect in plunging the level of
Aflatoxin B1 and ochratoxin A in broilers.
Key Words: Broiler, Toxin binder, Aflatoxin, Ochratoxin
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
147
ASSOCIATION OF SELECTED PATHOGENICITY GENES OF ESCHERICHIA COLI
WITH GROSS AND HISTOPATHOLOGICAL LESIONS OF COLIBACILLOSIS
IN BROILERS
Abdul Wadood Jan, M. Tariq Javed, Sameen Qayoom Lone, Aisha Khatoon, Zafar Iqbal Qureshi, Aziz-
ur-Rehman and M. Sohaib Aslam
Department of Pathology, Faculty of Veterinary Science,
University of Agriculture, Faisalabad, Pakistan
ABSTRACT
Escherichia coli (E. coli) infections are widely reported in the poultry sector across the globe. The
studies on pathogenicity genes of E. coli are available but no effort has been made to find an
association of pathogenicity genes with gross and microscopic lesions in broilers. The present study
was conducted on commercial broilers to detect different pathogenicity genes (fimC, tsh, iucD, papC,
fyuA, irp2, ECO) of E. coli and associated lesions in broilers. The lesions were noted with different
levels of severity in various body organs of birds infected with E. coli. In overall, the liver
histopathology showed inflammation, congestion, degenerative changes with vacuolation in the
cytoplasm. Heart histopathology showed degenerative changes in the muscles along with
accumulation of inflammatory cells. Spleen histopathology showed depletion of lymphocytes with
necrotic changes in the splenic nodules and intestine showed necrotic and inflammatory changes in
the intestine with sloughing of epithelium. The genes detected were fimC (92%), tsh (80%), iucD (72%),
fyuA (60%), papC (48%) and irp2 (32%) in cases, respectively. The results showed that there was
positive correlation between fyuA gene with liver gross lesions (P<0.05). The fimC, tsh, iucD, fyuA,
papC and irp2 genes were detected in 64, 56, 56, 36, 36 and 28% cases showing severe microscopic
changes in liver. The same genes were detected in 56, 48, 44, 36, 36 and 28% cases showing severe
microscopic changes in heart; in 24, 16, 20, 4, 16 and 28% cases showing severe microscopic changes
in spleen; in 24, 16, 20, 4, 16 and 28% cases, respectively showing severe microscopic changes in
intestine. It can be concluded from the present results that there is an association of some genes with
the induction of lesions in different body organs of broilers and further studies are required to
strengthen these findings.
Key Words: E. coli, Broilers, Pathogenicity genes, Pathology
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
148
ISOLATION OF METHICILLIN RESISTANT STAPHYLOCOCCUS AUREUS (MRSA)
FROM LIVE COCKERELS (PAKISTAN)
Zaytoon Zaheer*, Iftikhar Hussain, and Sajjad ur Rahman
Institute of Microbiology, University of Agriculture Faisalabad, Pakistan.
*Corresponding Author: zaytoonzaheer@gmail.com
ABSTRACT
Methicillin-resistant Staphylococcus aureus (MRSA) has been isolated several times from raw
poultry meat or carcasses; however, these were mainly the human-associated strains. Hence, the
possible human involvement in contamination of poultry carcasses by the slaughterhouse workers
may not be ruled out in such cases. During this study efforts were focused on the isolation of MRSA
from the live poultry. Samples were collected with the help of sterile swabs from oropharynx of 30
live cockerels. The swabs were inserted into the oropharynx of the birds and rotated for nearly 15-
30 seconds. The sample swabs were enriched in the mannitol-salt broth at 370C for 24 hours. The
enriched swabs were subsequently cultured at 370C for 24 hours on the Staph-110 medium. Upon
observing the results of macroscopic morphology (round, convex, opaque), microscopic morphology
(gram positive, cocci arranged in the form of clusters) and biochemical test (negative indole test,
positive methyl red, mannitol fermentation, catalase and coagulase test with rabbit plasma within 4
hours), 25 samples were found to be positive for Staphylococcus aureus. The hemolysis pattern of
these 25 S.aureus isolates was confirmed by culturing them on the blood agar. On the blood agar 15
isolates displayed β-hemolysis and 10 isolates displayed α/β hemolysis. These 25 S.aureus isolates
were then cultured on the chromagar and incubation was carried out at 370C for 24 hours. Four out
of 25 S.aureus isolates produced red to mauve colored, glistening, convex, round and mucoid colonies
of MRSA on the chromagar. The four MRSA isolates were further confirmed by performing
methicillin- disc susceptibility test on the Muller-Hinton agar. After confirming methicillin resistance of
the isolates latex agglutination test was performed to detect the aberrant protein of MRSA called
penicillin binding protein 2a (PBP2a), encoded by mecA gene of the positive MRSA isolates. All of the
MRSA isolates showed a positive catalase test, positive tube coagulase test with the rabbit plasma
within 4 hours, red to mauve colored colonies on the chromagar, β-hemolysis on the blood agar,
methicillin resistance in the disc susceptibility testing against methicillin disc and a positive latex
agglutination test for the detection of PBP2a.
Key Words: Methicillin-resistant Staphylococcus aureus, MRSA, live poultry, latex agglutination test.
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
149
PATHOGENESIS OF CLOSTRIDIUM PERFERINGENS (NECROTIC ENTERITIS) IN
EXPERIMENTALLY INFECTED BROILER CHICKENS
Arif Mahmood1*, Muti ur Rehman Khan1, Mushtaq Ahmad2, M. Zahid Khan1 and Mustafa Ahmed1
1Department of Pathology; 2Department of Theriogenology, University of Veterinary and Animal
Sciences, Lahore, Pakistan
*Corresponding Author: arif_vet@yahoo.com
ABSTRACT
Clostridium perferingens-induced disease is considered as the most lethal bacterial enteric
disease of poultry which causes multiple lesions in small intestine containing tightly adhered pseudo
membrane. The present study was designed to observe development of lesions in C. perferingens
induced enteritis in chicken being fed with normal or high energy diet. The day old chicken hatchlings
(n=105) were procured and divided into three groups (n=35 each): control (cont), clostridium (cols)
and clostridium with wheat (colsw). All the birds were vaccinated using standard protocol against
other diseases. Con and cols groups were fed normal feed while colsw group was fed with wheat
mash as high energy diet to favor bacterial growth. Cols and colsw groups were fed orally 1 mL
(3×1010 CFU/ml) culture of C. perfringens overnight to induce the infection in birds. Birds (n=8) were
sacrificed from each group after every 10 days and random samples of intestine were procured for
histo-pathological examination to determine villus size in intestine. the responses in birds challenged
orally with C. perfringens could be placed into two categories: (1) no apparent pathological changes
in the intestinal tissue and (2) sub-clinical inflammatory responses with focal, multi-focal, locally
extensive, or disseminated distribution throughout various sections of duodenum, jejunum, and ileum.
In birds that responded with intestinal lesions, hyperemia and occasional hemorrhages were the main
gross changes. The data were analyzed using one way ANOVA. The results indicate that none of the
challenge trials produced overt clinical signs of NE and mortalities associated with oral exposure of
C. perfringens. It was observed that length and height of cont group was higher (P<0.05) the cols and
colsw groups at 10, 20, 30 and 40 day of examination. It was noted that distinctly pronounced
pathological lesions developed more in colsw group at 30 and 40th day of examination. The
architecture of villi gradually decreased (P<0.05) in groups having oral administration of clostridium
while size remained same in control group. It can be concluded that C. perferingens reduced the size
of villi owing to lesser intestinal function; and this lethal effect of C. peferinges is favored by presence
of high energy component in diet of chicken.
Key Words: Clostridium perfringens, Broiler chicken, Intestinal villi, Wheat mash
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
150
GROWTH PROMOTING AND POSSIBLE TOXICOPATHOLOGICAL EFFECTS OF
SANGUINARINE (SANGROVIT®) IN GROWING BROILERS
Abdul Qayyum1, M. Kashif Saleemi*, M. Zargham Khan, Ahrar Khan, Aisha Khatoon, Farzana Rizivi,
Asim Sultan1, Zahid Hussain1, Tanvir Ahmed2 and M. Sohail Sajjid3, Zain-ul-Abidin4
Department of Pathology, University of Agriculture, Faisalabad; 1Department of Livestock and Dairy
Development Punjab, Pakistan; 2Department of Clinical Medicine and Surgery, University of
Agriculture, Faisalabad; 3Department of Parasitology, University of Agriculture, Faisalabad; 4Veterinary
Research Institute (VRI), Zarar Shaheed Road, Lahore, Pakistan
*Corresponding Author: drkashif313@gmail.com
ABSTRACT
Sanguinarineis a plant extract obtained from Macleayacordata plant belonging to family
Papaveracae. It is used as antibacterial growth promoter for poultry, livestock and pig industry. The
present experimental study was planned to investigate the growth promoting and possible
pathological effects (if any) of Sanguinarine available as commercial product Sangrovit®. One hundred
day old broiler chicks were procured from commercial hatchery and divided into 5 equal groups, i.e.,
A-E. The commercial feed and water was offered to the chicks ad libitum. The group E was kept as
control group, while group A Sangrovit @ 1 gm/10 lit drinking water (DW) 24 hours daily, group B
Sangrovit @ 1 gm/10 lit for 12 hours daily, group C 50 mg/kg feed, group D 1 gm/5 lit DW 24 hours
daily. The duration of experiment was 42 days. Physical and some hemato-biochemical and
pathological parameters were studied. The data thus obtained was subjected to analysis of variances
(ANOVA) test and group means were compared by Duncan’s multiple range test (DMR).
Birds administrated with Sangrovit 1gm/5 lit drinking water 24 hours were depressed, less
attractive towards feed, water and loose drooping were observed and this situation remained for two
weeks. Mortality in group A and D was 25 and 35%, respectively. Feed intake of group D was
significantly lower than the control group E. The body weight of group B and C were significantly
higher than the control group while group D showed lower body weight as compared to control
group. In serum biochemical parameters total protein and globulin were significantly higher in groups
C and D as compared to control group. Urea of groups B, C and D were significantly higher than
control group. ALT was lower in C group while AST was lower in groups A, C and D. cholesterol of
groups A and C were significantly higher and group D was significantly lower than the control group.
Grossly the kidneys of the group D were swollen. Microscopically mild to moderate degree of
congestion was present in the liver of group D. In kidneys of group A mild degree of congestion was
present throughout parenchyma, while in group D urinary spaces were condensed and hazy in
appearance. In the duodenum goblet cell secretion was higher in groups B and C, these changes were
observed in dose related manner. From the above mentioned findings of the present study it is
concluded that Sangrovit should be used @ 1gm/10 lit through drinking water 12 hours daily or
50mg/kg feed. At this dose it is an excellent replacement of antibiotic growth promoters (AGPs).
Key Words: Broilers, Sanguinarine (Sangrovit®), Toxicopathological effects
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
151
EMERGING THREAT OF NECROTIC ENTERITIS IN POULTRY BIRDS: A REVIEW
Fayyaz-ul-Hassan1, Muhammad Kashif Saleemi2*, Masood Akhtar3, Zain-ul-Abidin4 and Shahid Rafique5
1National University of Science and Technology Islamabad; 2Department of Pathology, University of
Agriculture Faisalabad; 3Faculty of Veterinary Science, Bahauddin Zakariya University Multan; 4Veterinary Research Institute (VRI), Zarar Shaheed Road, Lahore; 5Animal Sciences Division, Pakistan
Agricultural Research Council Islamabad, Pakistan
*Corresponding Author: drkashif313@gmail.com
ABSTRACT
Necrotic enteritis (NE) is an emerging economically significant problem of broiler industry
caused by a bacterium Clostridium Perfringens. NE is one of the top ranked intestine damaging bacterial
disease of poultry birds. Under normal conditions, the bacteria live harmlessly in the gut but
whenever there are drastic changes in the environment of gut, it quickly leads to proliferation of
bacteria. C. perfringens possess novel toxins such as alpha and β toxins which are considered key
virulence factors for the pathogenesis of NE. Moreover. It is clearly known that Necrotic enteritis is
produced under specific conditions only by specific strains of C. perfringens. Favorable environment
for the growth of C. perfringens is produced by mucosal damage inducing factors such as parasitism
(coccidiosis) high fiber diets, poor hygienic and housing conditions in addition to toxins. Moreover,
excessive use of antibiotic growth promoters (AGP) enhance the capability of C. perfringens to induce
disease. C. perfringens possess plc gene that encode for the Alpha toxin. A toxoid vaccine using alpha
toxin produced antibody response which was transferred to the progeny as well and resulted into
partial protection from NE. These toxoid vaccines are still in debate and needs a deep insight of
mechanisms involving the role of alpha toxin in development of immunity and pathogenesis. This
review has three purposes. First, it is designed to summarize the currently available information about
necrotic enteritis in chicken. Second, it is aimed to elaborate the pathogenesis of necrotic enteritis at
molecular level. Finally, future prospects of vaccination against necrotic enteritis and other possible
novel methods for the control of necrotic enteritis are suggested.
Key Words: Chicken, Necrotic Enteritis, Clostridium, Alpha Toxin
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
152
INCREASING IN VIVO ISOLATION OF PHOSPHORUS FROM MYO-INOSITOL-
HEXA-PHOSPHORIC ACID (IP6) OF SORGHUM USING PHYTASE ENZYME
Asad Sultan*, Sarzamin Khan, Muhammad Subhan Qureshi and N Imtiaz
Department of Poultry Science, The University of Agriculture, Peshawar-Pakistan 25210
*Corresponding Author: asadzia2003@yahoo.com
ABSTRACT
Enormous amount of nutrients losses occur due partial digestion and presence of certain anti-
nutritional factors in different poultry feed ingredients. Phosphorus is mainly leached from poultry
wastes due to presence of phytate bound P in cereal grains and lack of phytase enzyme in
monogastrics. An effective strategy to improve nutrient utilization is the application of feed enzymes
that target different anti-nutritional factors. This could effectively enhance nutrients bioavailability.
Sorghum, a less common cereal has higher amount of phytate compared to other cereal and has poor
nutritive value. In this study the impact of phytase was assessed in improving the availability of
nutrients. Three bioassay diets with and without enzymes of sorghum (918 g/kg, sole source of
protein) in mash form were prepared to observe phosphorus and nitrogen availability by broilers at
day-21. Diets in mash form were prepared with (Acid insoluble ash; AIA) as an indigestible marker.
Three diets, a control (PH-0) and to other were added phytase enzyme (10000 FTU/g) at level of
0.01% (PH-1) and 0.015% (PH-2). Feed, digesta and faecal samples were collected, processed and
analyzed using standard lab protocols for nitrogen, phosphorus and phytate. Ileal nitrogen digestibility
was significantly enhanced (1.2 and 2.9 %, respectively) and faecal nitrogen loses were significantly
reduced (42%) by birds in PH-2 group. Ileal phosphorus digestibility coefficient in treated groups were
0.51 (PH-1) and 0.53 (PH-2), respectively, to non-treated control group (PH-0; 0.40). Similarly
enzymes supplemented groups had higher phytate digestibility (0.0.72 and 0.76, respectively). pH of
the bedding material in phytase treated group was similar and numerically lower (6.6) to control
group (7.4). These findings revealed that feed enzymes improved nutrient digestibility of sorghum and
potentially can minimize nutrient losses to soil.
Key Words: Sorghum, Broilers, Phytase, Nutrient Digestibility
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
153
A PRELIMINARY ASSESSMENT OF THE NUTRIENT DIGESTIBILITY AND
APPARENT METABOLIZABLE ENERGY OF WHEAT, SORGHUM AND MAIZE BY
MIGRATORY DEMOISELLE CRANE (ANTHROPOIDES VIRGO)
Sarzamin Khan*, Asad Sultan, Mohammad Numan Khan and Rafiullah Khan
Department of Poultry Science, The Agriculture University Peshawar, Pakistan
*Corresponding Author: dr.zaminaup@gmail.com
ABSTRACT
Anthropoides virgo are on the verge of extinct due to diverse ecological factors. Raising demoiselle
cranes in captivity to propagate their population needs a better understanding of their nutrient
requirements and digestibility. In present study total tract nutrient digestibility and apparent
metabolizable energy of wheat, sorghum and maize was assessed by adult demoiselle cranes. Thirty
six adult demoiselle cranes were fed whole wheat, sorghum or maize in three replicated (n=12; 3
birds/replicate) groups (WC, SC and MC) in standard size pens fitted with rubber mats on floor for
faeces collection. All birds were fed these grains for 10 days including 3 days of adaptation. During
last seven days grain intake and faeces output was measured. Gross energy and other nutrients of
grains and feces were determined using standard lab procedures and digestibility coefficients and
apparent metabolizable energy were calculated. Digestibility coefficient of dry matter (0.72) and crude
protein (0.69) and apparent metabolizable energy (14.13MJ kg-1) was significantly higher for wheat
followed by maize and sorghum. Calcium and phosphorus digestibility coefficient was greater for
sorghum and maize compared to wheat. Cranes digested fat more from maize in comparison to
other type of cereal grains. These findings revealed that crane digestibility pattern for cereal grains is
different and need further work to accurately assess their nutrients requirements.
Key Words: Crane, Cereal Grains, Digestibility, Apparent Metabolizable Energy
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
154
MYCOTOXINS: TRANS-GENERATIONAL IMMUNOTXIC COMPOUNDS
Zahoor Ul Hassan1,* and Muhammad Zargham Khan2
Department of Animal Health, The University of Agriculture, Peshawar; 2Department of Pathology,
Faculty of Veterinary Sciences, University of Agriculture, Faisalabad, Pakistan
*Corresponding author email: zahoor82@gmail.com
ABSTRACT
Among the many toxicities, immune-modulatory effects of aflatoxin B1 (AFB1) and ochratoxin A
(OTA) are well documented in avian and mammalian spps. In this study, we summarize the findings of
two independent experiments, in which immunological status of chicks hatched from the mycotoxins
contaminated eggs was assessed. In experiment 1, breeder hens were exposed to OTA and AFB1
contaminated feed. The graded doses of mycotoxins were given alone and in combination. The
hatching eggs were collected and incubated under standard conditions to have progeny chicks. The
hatchlings were maintained on mycotoxins free diet and assessed for their immunological status using
macrophage function assay, immune-localization of antibodies bearing cells in spleen and bursa,
antibodies titers against sheep RBC and carbon clearance assay by circulatory macrophages. In
experiment 2, different levels of OTA were placed on to the air cells of the hatching eggs prior to
incubation. These eggs were incubated till hatching. The chick obtained from the eggs were evaluated
for the humoral and cell mediated immune responses. The chicks obtained in the experiment 1,
showed a severe depression in the immune responses both for humoral and cell mediated immunity.
An ameliorative immuno-toxicological responses was noted in the chicks from the hens co-exposed
to two mycotoxins. As in experiment 1, the chicks hatched from the eggs in experiment 2, also
showed immuno-suppression. The findings of these studies clearly showed that immunotoxic
activities of mycotoxins are not limited to the directly exposed animals, but these are transferred to
the progeny of exposed spps, at least in the avian.
Key Words: Mycotoxins, Breeder Hens, Immune System, Progeny Chicks
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
155
PATHOLOGICAL EFFECTS OF IN OVO VACCINATION AGAINST NEWCASTLE
DISEASE IN CHICKEN AND COMPARISON OF ITS IMMUNE RESPONSE WITH
POST-HATCH VACCINATION
Aisha Khatoon1*, Javaria Nazeer1, Muhammad Zargham Khan1, Ahrar Khan1, Muhammad Kashif
Saleemi1, Zain ul Abidin2 and Bilal Aslam3
1Department of Pathology, University of Agriculture, Faisalabad, Pakistan;
Veterinary Research Institute, Zara Shaheed Road Lahore; Institute of Physiology and Pharmacology,
University of agriculture, Faisalabad, Pakistan
*Corresponding Author: aisha.khatoon@uaf.edu.pk
ABSTRACT
New castle disease (ND) is an endemic and prevalent disease in Pakistan. Prevention of disease is
mainly practiced by vaccination. Killed and live attenuated vaccines are being used through drinking
water or oculo-nasal route. In ovo vaccination for ND is not being carried out in Pakistan and this
study was designed to investigate the pathological effects of in ovo vaccination of different strains of
ND and comparison of its immunogenic potential with post hatch vaccination against NDV. Total 150
embryonated eggs were divided in five groups A, B, C, D, and E. Group A was kept as negative
control (unvaccinated against ND). Group B (shamed group) injected with 0.1ml normal saline. The
embryonated eggs of groups C, D and E were in ovo vaccinated with 0.1 ml of Lasota, Mukteswar and
Hitchner B1 strains at day 18 of incubation, respectively. After hatching group B was given vaccination
at day 7 and 21 while group C, D and E received booster vaccination of ND with Lasota strain
through oculo nasal route only at day 21. Group A remained unvaccinated. Development of
immunity following pre-hatch or post-hatch vaccination was examined through HI test by collecting
the serum samples from all the birds in all the groups on day 1st, 7th, 14th, 21st, and 28th of age. Six
birds from each group were slaughtered at 1st day of age and day 35 of the experiment. Organs were
observed and collected for any pathological lesions. Results of the experiment revealed hatchability in
all groups above 90%. All the birds showed normal behavioral and clinical signs. Lymphoid organs of
all the birds including spleen, thymus and bursa of Fabricius were normal in gross appearance.
Absolute and relative weights of bursa, spleen and thymus were significantly high in Group D as
compared to control and other vaccinated groups. At day 1 and 7 highest antibody titers against ND
were observed in group D followed by C and E. at day 14, 21, 28 and 35 titers were highest in group
D followed by C, B, E and A. it can be concluded that in ovo vaccination gives better immunological
responses as compared to post hatch vaccination and there are no detrimental effect of this
procedure on chicks.
Key Words: Newcastle disease, In ovo, Immunity, Antibody titers, Post hatch
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
156
AMELIORATIVE EFFECTS OF CARNITINE AND VITAMIN E UPON OCHRATOXIN
INDUCED IMMUNO-TOXICOLOGICAL EFFECTS IN WHITE LEGHORN
COCKERELS
Sheraz Ahmed Bhatti*, Muhammad Zargham Khan, Ahrar Khan, Muhammad Kashif Saleemi, Aisha
Khatoon and Muhammad Noman Naseem
Department of Pathology, University of Agriculture, Faisalabad, Pakistan
*Corresponding Author: dr_sheraz03@yahoo.com
ABSTRACT
This study aimed to evaluate the effect of different dietary levels of ochratoxin A (OTA), in the
presence and absence of carnitine and vitamin E, on the humoral immune responses of White
Leghorn cockerels. Day old birds were divided into 12 groups having 20 birds each and were offered
diets contaminated with OTA (1.0 mg/kg and 2.0 mg/kg feed) alone and concurrently with carnitine
(1.0 g/kg feed) and/or vitamin E (0.2 g/kg feed) for 42 days. The humoral immune responses were
accessed by lymphoproliferative response to avian tuberculin, carbon clearance assay and antibody
response to the SRBCs. The dietary addition of OTA alone suppressed the humoral immune
responses, however, the dietary exposure of birds to 1.0 mg/kg OTA in the presence of carnitine
and/or vitamin E ameliorated the toxic effects of OTA. The ameliorative response was absent in the
birds fed 2.0 mg/kg OTA in the presence and absence of carnitine and vitamin E. The relative weight
of the bursa of Fabricius and thymus of the birds exposed to the higher dietary level of OTA alone or
in combination with carnitine and vitamin E was reduced and microscopically, degenerative changes
were observed in the lymphoid organs. Both carnitine and vitamin E partially ameliorated the toxic
effect of OTA on the immune responses of the White Leghorn cockerels.
Key Words: Ochratoxin, Immunotoxicity, Carnitine, Vitamin E
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
157
MEAL WORM (Tenebrio molitor) AS POTENTIAL ALTERNATIVE SOURCE OF
PROTEIN SUPPLEMENTATION IN BROILER
Ibrar Hussain, Sarzamin Khan*, Asad Sultan, Naila Chand and Rafiullah Khan
Department of Poultry Science, Faculty of Animal Husbandry and Veterinary Sciences,
The University of Agriculture, Peshawar, Pakistan
*Corresponding Author: dr.zaminaup@gmail.com
ABSTRACT
Present study determined the effect of meal worm supplementation on feed intake, body weight gain,
feed conversion ratio (FCR), dressing percentage, and mortality, acceptability and HI antibody titer
against Newcastle disease in broilers. Meal worm larvae were produced in the lab, killed with
concentrated salt solution and dried in the oven at 40 0C for 24 hrs. Proximate analysis, amino acid
and mineral profile of the dried meal worm meal was conducted before use. A total of 120 day old
broiler chicks were divided into 4 groups (A, B, C and D) of three replicates each containing ten
birds. The study used 4 treatments at inclusion levels of meal worm A (50g), B (100g), C (150g) and
D (Control) and continued for four weeks. Proximate composition of worm meal showed crude
protein value (45.83%), crude fats (34.2%) and ash content (3.51%), essential amino acid as lysine
(4.51±0.3) and Methionine (1.34±0.4) with substantial amount of calcium 4.1gm/kg and phosphorus
7.06gm/kg. No significant effect was found (P≥0.05) on the mean feed intake. Body weight gain was
significantly higher in all supplemented groups. Overall FCR was significantly (p ≥ 0.05) higher for
control group. Compared with other groups the decreasing trend of FCR was declining as (1.99±0.01
to 1.75±0.01) with the increasing level of meal worm meal. Dressing percentage was significantly
(P≤0.05) higher for supplemented groups as compared to control. Non-significant differences were
observed in acceptability, hemagglutination antibody titer against Newcastle disease and mortality
among groups. It was concluded that meal worm meal could be safely used in broiler ration for better
performance without any loss to antibodies titer and acceptability of chicken meat.
Key Words: Worm meal, Proximate Analysis, Amino Acid Analysis, Broilers, Overall Performance
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
158
PATHOGENESIS AND MOLECULAR CHARACTERIZATION OF MYCOPLASMA
GALLISEPTICUM IN NATURALLY INFECTED BROILER CHICKENS
Azmat Ullah1, Umar Saddique1*, Zahoor ul Hassan1, Muhammad Kamal Shah1, Hanif Ur Rehman1,
Shakoor Ahmed Qureshi1 and Sadeeq ur Rahman1,2
1Department of Animal Health, Faculty of Animal Husbandry and Veterinary Sciences,
The University of Agriculture, Peshawar-Pakistan; 2College of Veterinary Sciences and AH Abdul Wali
Khan University, Garden Campus, Mardan, Khyber Pakhtunkhwa-Pakistan
*Corresponding author: druskhattak@yahoo.com
ABSTRACT
The current study was designed to get incite on pathogenesis and molecular characterization of
locally isolated Mycoplasma gallisepticum (MG) from naturally infected broiler chicken. For this
purpose, a total of 250 tracheal swab samples from broiler chicken suspected of respiratory
infections were processed for culturing onto pleura-pneumonia like organism (PPLO) medium for MG
identification. Phenotypically, typical fried egg and nipples like colonies with positive glucose
fermentation and inability to hydrolyze arginin were further subjected to DNA extraction for
molecular identification using polymerase chain reaction (PCR). The results indicated that 64/250
(25.6 %) were confirmed MG positive using PCR. Interestingly, the data indicated that more (50%) of
adult (>20 days of age) birds were MG-culture positive as compared (46%) to younger (<20 days of
age) chicken. Similarly, PCR indicated that 38/120 (31.6%) of MG-culture-positive were adults and
26/130 (20.0%) were younger indicating older birds are apparently dominant carriers of MG.
Histopathology of lungs of MG-infected birds revealed emphysema, leukocytic infiltration and
thickening of interlobular septa. There was focal necrosis and infiltration of leukocytes in the liver and
sloughing of tracheal epithelium was the predominant feature of finding. The data revealed that MG is
more prevalent in older age broiler chicken with systemic manifestation.
Key Words: PPLO, PCR, DNA, Mycoplasma gallisepticum, Histopathology
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
159
MOLECULAR EPIDEMIOLOGY AND PATHOLOGY OF CHICKEN INFECTIOUS
ANEMIA IN LAYER CHICKS IN FAISALABAD PAKISTAN
Muhammad Saleem1, Aisha Khatoon1*, Muhammad Zargham Khan1, Muhammad Kashif Saleemi1,
Zain ul Abidin2 and Zia ud Din Sindhu 3
1Department of Pathology, University of Agriculture, Faisalabad; 2Veterinary Research Institute, Zara
Shaheed Road Lahore; 3Department of Parasitology, University of agriculture, Faisalabad.
*Corresponding Author: aisha.khatoon@uaf.edu.pk
ABSTRACT
Chicken anemia virus (CAV) is the causative agent for chicken infectious anemia (CIA) disease in
poultry which is an economically important disease. CIA is responsible for anemia,
immunosuppression, decrease weight gain and low production. CAV is emerging worldwide and has
got considerable attention. In Pakistan only one outbreak report is available on CAV implicating study
of disease at wider scale. This study was designed to check the prevalence of chicken anemia virus
through PCR in layer chicks of less than 7 day of age in district Faisalabad. And it is the first
epidemiological study on CAV in layer chicks in Pakistan. For this purpose, 245 samples of different
organ (liver, spleen and thymus) and blood from live birds were collected from five tehsils of
Faisalabad. The average values of hemoglobin and pack cell volume were 4.72g/d and 18.35%
respectively. Out of 245 pooled samples 65 were found positive for PCR assay. An overall prevalence
of 26% was found in district Faisalabad. Histopathologically, CAV positive birds showed moderate to
severe congestion of blood vessel in liver. Thymus and spleen of CIAV positive birds showed marked
lymphocytic depletion. It was concluded that there was high prevalence of disease. The prevalence of
CIAV was significantly different among different areas of Faisalabad, in different age group and with
respect to different environmental conditions, while there was no significant difference of prevalence
in cockerels and females. This study shows that there is need to study this disease at much wider
scale in order to access the prevalence of disease in country and to reduce the economic losses
occurring due to chicken infectious anemia.
Key Words: Chicken infectious anemia, Layer chicks, PCR, Prevalence
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
160
EFFECT OF LACTIC ACID BACTERIA ON MUCOSAL FRONT AGAINST E.coli
INFECTION IN POULTRY BIRDS.
M. Abubakar Siddique*, Sajjad ur Rahman, Babar Hayat, Ahsan Naveed, Hafiz Sohaib Mazhar, Aitezaz
Ahsan, Hassan Zafar, Fakhar Hayat, Noorulain, Naila Afzal and Faisal Rasheed
Institute of Microbiology, University of Agriculture, Faisalabad, Pakistan.
*Corresponding author: Abubakars974@gmail.com
ABSTRACT
Poultry is a well-developed sector of agriculture industry in Pakistan. Poultry industry plays a
major role in the GDP of Pakistan. Many food borne pathogens play role in causing different digestive
problems in poultry and influence the production of eggs and meat. In poultry industry extensive
antibiotics are used to control these pathogens for the improvement of meat and egg production
.Present study was conducted to evaluate the impact of lactic acid producing bacteria on the immune
status against E.coli infection in poultry birds. Lactic acid bacteria i.e. lactobacillus fermentum was
isolated from conventional yoghurt sample. Out of 20 samples 13 samples were positive for
lactobacillus fermentum which were identified on the basis of their morphological characteristics as it is
gram positive rod shaped bacteria with small white round colonies on MRS agar. Lactobacillus
fermentum was furthered identified on the basis of their biochemical tests as it was catalase negative
and sugar fermentation tests. After identification three concentrations were maintain that were 104,
105,106 cfu/ml. A trial was conducted on the poultry birds. They were divided into four groups A, B,
C and D. Different concentration of probiotics which were Control, 104, 105and106 cfu/ml were given
to each group respectively. Birds were kept for 15 days. At day 7 and 15 plasma were collected from
respective groups of poultry. Macrophages were collected from the peritoneal cavity of poultry birds.
Macrophages migration inhibition factor assay were performed invitro. The results of this assay
showed that group administered with high probiotic concentration i.e 106 cfu/ml showed that immune
response was increased more effectively against E.coli as compared to other poultry groups. Because
% inhibition of macrophages was 64, 52, 44 and 31% for D, C, B and A, respectively. The results
showed that the group with high % inhibition of macrophages show significantly high cell mediated
immune response against E.coli.
Key Words: Poultry, lactic Acid Bacteria, E.coli, Mucosa, Macrophages, Migration Inhibition Factor,
Mucosal immunology
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
161
IMMUNOLOGICAL CROSS REACTIVITY AMONG SALMONELLA TYPHIMURIUM
ISOLATES FROM POULTRY AND NON-AVIAN ORIGIN
Hafiz Sohaib Mazhar*, Sajjad ur Rahman, Babar Hayat, Ahsan Naveed, Abubakar Saddique, Aitezaz
Ahsan, Hassan Zafar, Fakhar Hayat, Aqsa Bukhari, Naila Afzal and Faisal Rasheed
Institute of Microbiology, University of Agriculture, Faisalabad, Pakistan.
*Corresponding author: sohaibmazhar786@gmail.com
ABSTRACT
Salmonella is transferred to the human by animals and their byproducts contaminated with meat,
eggs, and dust, and also by contaminated water. In present study the immunological cross reactivity
was determined among isolates of Salmonella recovered from poultry birds, other animals and human
enteritis cases. Total of 40 samples were processed. Complete identification showed that 60%
Salmonella typhimurium was isolated from droppings of enteric cases of poultry birds, 60% from cattle,
60 % from sheep, 60% from dog, 40 % from cat, 40% from human and 20% from horse, and 40% from
honey bee. Agar gel precipitation test and Serum Neutralization Assay were performed to find out
common antigenic moieties among Salmonella typhimurium isolates. In serum neutralization assay,
antigen from poultry birds exhibited maximum cross reactivity with antiserum from sheep and honey
bee 1:16, besides homologous cross as 1:64. Antiserum from human, cattle and cat presented
comparatively less affiliation with poultry antigen with titer 1:8 followed by antiserum from horse and
dog as 1:4. Poultry antigen displayed strong precipitation bands (+ + +) in agar gel precipitation test
with sheep and cattle antiserum while medium strength precipitation bands (+ + -) were observed
with human and honey bee antiserum followed by no immunological cross reactivity with cat dog and
horse antiserum. Concludingly, the poultry antigen showed maximum cross reactivity with sheep and
honey bee while poultry antiserum displayed maximum affiliation with human antigen.
Key Words: Poultry, Salmonella typhimurium, Serum Neutralization Assay, AGPT, Interspecies Cross
reactivity, Antibiotic Susceptibility
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
162
COMPARATIVE EFFICACY OF COMMERCIALLY AVAILABLE ANTIMICROBIALS
AGAINST LOCAL ISOLATES OF MYCOPLASMA GALLISEPTICUM
Farida Tahir1, Umer Saddique1, Shakoor Ahmad1, Zahoor Ul Hassan1, Sadeeq Ur Rehman2, Muhammad
Kamal Shah1*, Hamayun Khan1, Murad Ali Khan1, Sajjad Ali Shah1 and Hanif Ur Rehman3
1Department of Animal Heath, the University of Agriculture Peshawar; 2College of Veterinary
Sciences & Animal Husbandry, Abdul Wali Khan University, Mardan; 3Veterinary Research Institute,
Peshawar, Pakistan
*Corresponding Author: kamaluaf560@gmail.com
ABSTRACT
Avian mycoplasmosis is an important respiratory disease causes heavy economic losses in poultry
industry throughout the country. The present study was carried out in different farms of the district
Peshawar, Khyber Pakhtun Khwa, Pakistan to investigate the different antibiotic efficacy against PCR
confirmed local isolates of Mycoplasma gallisepticum. Five different commercially available
antimicrobials like Enrofloxacin, Tylosin, Gentamycin, Oxytetracycline and Sulphonamides were
tested in vitro by gel diffusion assay and micro broth dilution method for zone of inhibition and
minimum inhibitory concentration (MIC) respectively. Drugs sensitivity results showed that
Enrofloxacin was the most efficacious drug having the least MIC of 0.002±0.0001 mg/ml and
maximum zone of inhibition 17±02 mm among the tested drugs followed by Sulphonamide
0.02±0.001 mg/mI and 15±1.6 mm zone of inhibition. Interestingly Tylosin, Oxytetracycline and
Gentamycin showed resistant against all isolates of mycoplasma gallisepticum. This resistance might be
due to indiscriminative uses of theses antibiotics in the study area. Our findings suggest that
Enrofloxacin is the drug of choice for the treatment of Mycoplasma gallisepticum.
Key Words: Mycoplasma gallisepticum, Gel diffusion, Antibiotics, Micro broth dilution, MIC
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
163
PREPARATION OF OIL BASED VACCINE AGAINST PIGEON PARAMYXOVIRUSES
Muhammad Samiullah1, Farzana Rizvi2*, Muhammad Noman Naseem2 and Muhammad Imran2
1Livestock Dairy Development Department, Punjab, Pakistan. 2Department of Pathology, University of Agriculture, Faisalabad, Pakistan.
*Corresponding author: frizivi@yahoo.com
ABSTRACT
Pigeons are one of few domesticated bird species which are raised by the humans for their
homing ability and for purposes such as food (meat), entertainment/hobby (racing), and for treatment
of various diseases. The study was conducted to prepare an oil-emulsified formalized PPMV-1 vaccine
using local field isolate and vaccine was evaluated in experimental conditions. A mesogenic strain of
PPMV-1 was used to prepare the vaccine and propagated in embryonated eggs. HA titer of the
pooled AAF was measured as 1:2048. Regarding the physical properties, the color of the vaccine was
milky-white and the flow time of the vaccine was 3.0 seconds. The vaccine remained stable for 20
weeks at room temperature. For the safety test vaccine was inoculated intramuscularly in pigeons.
The birds remained healthy, only a small granulomatous lesion was seen by the fourth day of
inoculation. These results suggested that the vaccine is quite safe and could be evaluated in the
experimental trial. This evaluation was based upon the ability of the vaccine to produce a humoral
antibody response against the field isolate of PPMV-1. For this reason, vaccine was inoculated in
pigeons and humoral immune response was determined against PPMV-1. Maximum GMT was
increased upto 139.58 at 21 days post-vaccination and it was 279.17 in single shot and 234.75 at
double shot vaccination. Vaccine was also evaluated by challenge protection. Mortality in pigeons with
single vaccinated was 10% while it was 7.5% in pigeon vaccinated with booster dose. From this trial it
can be concluded that PPMV-1 (double dose) vaccine was helpful in protection of pigeons against
Newcastle disease.
Key Words: Pigeon, Newcastle Disease, Oil-emulsified formalized vaccine, GMT
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
164
DETECTION OF PIGEON PARAMYXOVIRUSES FROM NEWCASTLE DISEASE
OUTBREAKS IN PIGEONS
Muhammad Samiullah1,2, Farzana Rizvi2*, Muhammad Noman Naseem2 and Muhammad Imran2
1Livestock Dairy Development Department, Punjab, Pakistan 2Department of Pathology, University of Agriculture, Faisalabad, Pakistan
*Corresponding author: frizivi@yahoo.com.
ABSTRACT
Pigeons are universally kept by humans on all parts of the world since centuries along with
chickens. Newcastle disease locally called Jholah in Punjab is worldwide distributed disease causing
sever outbreaks in pigeon lofts throughout the world. The project comprised of different phases.
Seroprevelance of Jholah was observed in Faisalabad, Lahore, Karachi, Peshawar and Rawalpindi. Virus
from diseased pigeons was isolated and identified and its pathotyping was done. Monoclonal
antibodies against APMV-1 & PPMV-1 were procured from Defra, the department for Enviorment,
food and Rural Affairs, UK. Theses monoclonal antibodies were used to develop a rapid diagnostic
test for the diagnosis of Jholah in field. Clinical signs and lesions in pigeons were recorded during the
study. The clinical signs observed among naturally infected pigeons were wing paralysis, blindness,
shivering of head and neck i.e., tortticollis and greenish mcucoid diarrhea. Postmortem lesions
observed in infected pigeons were ulcers in intestine and hemorrhages in proventriculus, enlarged
spleen and airsacculitis. Hhistopathological studies showed edema in proventriculus and emphysema
in aliveoli, pulmonary congestion and edematous fluid in air sacs and lymphatic infiltration and
hyperplasia in spleen.
Key Words: Pigeon, Newcastle Disease, Jholah, Monoclonal antibodies
Proceedings of the “International Seminar on Poultry Diseases” 14-15 Dec, 2015, Department of Pathology, University of Agriculture, Faisalabad, Pakistan
165
ASSOCIATION OF SELECTED PATHOGENICITY GENES OF ESCHERIACHIA COLI
WITH GROSS AND HISTOPATHOLOGICAL LESIONS IN CASES OF
EARLY CHICK MORTALITY
Sameen Qayoom Lone, M. Tariq Javed, Abdul Wadood Jan, Farzana Rizvi, Zafar Iqbal Qureshi,
Aziz-ur-Rehman and M. Sohaib Aslam
Department of Pathology, Faculty of Veterinary Science, University of Agriculture Faisalabad, Pakistan
ABSTRACT
Avian pathogenic E. coli (APEC) strains cause diseases in birds at various ages. It can cause
extensive mortality in poultry flocks leading to great economic losses. Recent reports showed that
the APEC pathogenicity is associated with certain virulence genes are located within the bacterial
genome and/or their ColV plasmids. Identification and characterization of these genes are essential to
implementing efficient disease control and prevention systems. The aim of this study was to identify
the virulence associated genes in cases of early chick mortality. Study included the poultry farms
within Faisalabad region suspected for of Escherichia coli infections. The postmortem findings of
various organs collected from morbid poultry birds of age ten or less than ten days revealed that
gross lesions on liver were present in all the confirmed cases of E. coli infections. Out of which 25%
showed severe gross lesions, 45.83% showed moderate and 29.17% showed mild lesions. On gross
examination, 79.17% lungs showed abnormality, 87.50% cases of heart, out of which 45.83%, 33.33%
and 8.33% were mild, moderate and severe lesions, respectively. Study showed that in 79.17% cases
lesions were present in spleen out of which 50%, 20.83% and 8.33% were mild, moderate and severe,
respectively. Results showed that in 87.50% cases gross lesions were present in the intestine, out of
which 4.17%, 66.67% and 16.67% were mild, moderate and severe, respectively. The genes fimC,
papC, iucD, fyuA and tsh were positive at the rate of 41.67%, 16.67%, 54.17%, 20.83% and 37.50%,
respectively. However, no irp2 gene was detected from the samples positive for E. coli infections. The
gene fimC was detected in 58.33% of cases which showed severe microscopic changes in liver while
gene tsh was detected in 37.50% and iucD was detected in 54.17% cases each showing severe
microscopic changes in liver. The gene fyuA was detected in 20.83% and papC gene was detected in
16.67% cases each showing severe microscopic changes in liver. The genes fimC, tsh, iucD, fyuA and
papC were not detected in 41.67, 62.50, 45.83, 79.17 and 83.33% of cases, though microscopic
changes of variant degree were seen in liver.
Key Words: E. coli, early chick, broiler, pathogenicity genes,
top related