read pages 204- 211, and answer numbers 18 – 22, and then numbers 2, 4, 7 in the standardized test...
Post on 13-Dec-2015
214 Views
Preview:
TRANSCRIPT
Read pages 204-211, and answer
numbers 18 – 22, and then
numbers 2, 4, 7 in the
Standardized Test Prep Section
Your Homework Tonight Honors
JQ: If you were to wake up on a deserted island tomorrow,
how would you survive?
Atmosphere was filled with hydrogen cyanide, carbon dioxide, carbon monoxide, nitrogen, hydrogen sulfide & water vapor
1st Some Organic molecules formed (Proteins, Carbs. Lipids & Nucleic Acids) – Molecules that make up living organisms.
2nd Proteinoid Microspheres formed – grouping of organic molecules forming what looks like primitive cell.
3.5 bya fossils show presence of prokaryotic cells (cells w/o a nucleus).
Formed in the absence of oxygen and underwater. (Chemosynthesis)
Organisms then became photosynthetic = food & oxygen released into atmoshphere. Ozone Layer (O3) formed.
Oxygen rose and became deadly for organisms = change became a must.
Organisms learned to use oxygen to generate energy.
2 bya Eukaryotic cells (cells with a nucleus) formed from the joining of several prokaryotic organisms (endosymbiotic theory).
Questions to answer when watching the movie:
1. Do you believe in soul mates? Do the navi believe in soul mates? Provide example(s).
2. Do any of the ikran (banshee’s) look or act the same? Provide examples.
3. Do any of the navi look or act the same? Provide examples.
4. If any of the organisms from above look and act different develop an explanation as to why?
5. Provide examples from the movie demonstrating how Jake is able to ensure the survival of his
avatar.
As a young Evolutionary biologist you are on a quest to understand how organisms ensure their survival.
To do this you will have to obtain one of the banshee eggs found within this room. Once found you will have to grow and test your banshee to understand it.
Find an egg. Return to your seat. DO NOT OPEN THE EGG!
Mountain Banshee Research
Mountain Banshee Research
1. Open your egg.2. What is inside?3. What do these codes
do?4. Compare with someone
near you, are the codes identical?
5. How will you decode the language of the banshee’s genes?
Banshee Genome
1.Inside your eggs there is a list of codes for 11 traits.
2.Each trait has two sequences of DNA, representing homologous genes.
3.To build your banshee you will have to decode the genes.
BACKGROUND
1. Genome – refers to the full diploid set of DNA for an organism
2. You can get a genome from almost every somatic cell in your body.
3. Human Genome Project-completed in 2003
Do Now: Form two lines in the
classroom. (Roughly 12 students in one line, and 12 in the
other)
Journal Question:(after the game is done) What is the
purpose of this activity? Explain.
Telephone Game1.Gather into two even lines.
2.To win the game, the last person in the line has to act out the message being passed along.
A) In order to get an A on this activity the last person in the line must hop to the front lab desk and open up the 2nd draw from the right side of the desk. Pull out an object and then bark like dog three times. When finished wink at the teacher with your left eye.
B) In order to get an A on this activity the last person in the line must skip to the front of the room, turn around and face the desks. Locate the chair in the 4th row, 3rd column. Sit in the desk chair backwards and moo like a cow one time. When finished wink at the teacher with your right eye.
Telephone Game Scenario’s
Telephone Game Questions
1. How important is effective communication in society?
2.Do you think your cells/molecules ever play the telephone game?
Journal Question:
With the person sitting near you, describe the basic steps of transcription and translation
Take out homework
Lets recall some information for a
minute:
1.What is a gene?
2.What do genes code for?
3.What is the function of a protein (examples)?
4.What determines the function of a protein?
5. What are all proteins made of?
How are proteins made? Proteins are
created in two steps called
transcription & translation.
AKA: Gene Expression
Link to Animation (go to 7:06 – 17:33)
STEP 1: Transcription
Instructions on how to make the protein are copied from the gene into a messenger RNA molecule. (Make a “Xerox copy” of the gene)
Link to Animation
What is RNA?
RNA similar to DNA, BUT it is single stranded instead of double stranded.
Monomer Unit:
nucleotide {ribose sugar instead of deoxyribose, and Uracil (U) instead of Thymine (T)}
Function: DNA’s helper – carries out DNA’s instructions for making proteins (mRNA, tRNA, rRNA)
Transcription -In Depth1. Transcription factor
is a protein that binds to the Promoter to regulate transcription
2. In many genes, Promoter begins with TATAAA sequence called TATA Box
3. Once transcription factors are in place, RNA polymerase makes mRNA transcript
Transcription -In Depth Two types of Transcription
factors:
Activator: protein that recruits RNA polymerase to bind to the promoter
Repressor: protein that blocks RNA polymerase from binding to the promoter
GENE: TACAGACTCCGGCCCATT
Transcription PracticeDNA:
GTTGAATAACTATAAACCCGCGCAATCTGGCTTACAGACTCCGGCCCAT
TGCGCCGCAGATTACT
Pre-mRNA:AUGUCU
GAG
GGGGCC UAAPre-
mRNA:AUGUCU
GAG
GGGGCC UAA
IntronsExons
Transcription -In Depth4. We now have pre-mRNA! The introns of Pre-mRNA must be removed (spliced out) by spliceosomes
5. mRNA leaves nucleus and travels to ribosome for translation
GENE: TACAGACTCCGGCCCATT
Spliceosomes in Action
Pre-mRNA:
AUGUCU GAG
GGGGCC UAA
Spliceosome
mRNA:AUGUCUGCCUAA
When does RNA polymerase stop transcribing the gene?
There are 3 sequence that end a gene:
1. ACT2. ATT3. ATC
Journal Question:As you come in take one of the packets from the
front of the room. Working with a partner complete pages 1 & 2. Once finished we will
reconvene up front and finish decoding your banshee genes and
determine what it will look like and how it will
act.
Have fun and we shall talk in about 20 minutes.
Step 2: Translation
*Goal is to read mRNA & construct the protein*
1. mRNA is read by ribosomes in groups of 3 letters called codons. (AUG, ACC)
2. Codon tells tRNA which amino acid to get.
Translation1. Initiation
How does translation begin?
2. Elongation How does the
ribosome help translation continue?
3. Termination How does the
ribosome know when to stop the process of translation?
Link toAnimation
*Conclusions*Now, can you expand on your
answers to the questions?
“How does the telephone game relate to protein synthesis?”
“What happens if the message changes in any step of the
process?”
“Are these changes good or bad?”
Journal Question:Are the enzymes in your body
able to think? Explain.
Review Questions:1. How is a sex chromosome
different from an Autosome?
2. How many pieces of DNA does your banshee have?
3. What is the diploid number for your banshee’s cells?
4. How many homologous pairs of DNA does your banshee genome have?
5. How was your banshee’s genome created?
+ =
Fertilized Banshee Egg
1st CellDiploid Cell
2(4) = 8
Male Banshee Sperm
DadN = 4
Female Banshee Egg
MomN = 4
Creating a Banshee Genome
1. Paired?
2. Banding?
3. Arrangement?
4. XX vs. XY?
5. How do sex cells compare?
Karyotyping Recall
Closer look at DNA in a Karyotype
CGGACTAAAAGGCATTTACCCTATAAATTAAAAACGAACTACCCCTCTGTTTGTATTAAAAGGAATCGGATTGGGAATATAAACAATGGGGGTACTTATTTCAGCGTCCCATCTATAAACGGATTGGGTACAAGACTGGACACGCAATGGGCCGC
AAAAGGAATCGGATTGGGAATATAAATTAAAAACGAACCGTACCCCGTTTGTATTCGGACTAAAAGGCATTTACCCTATAAACAATGGGGGAAGGATACTTATTTCAGCGTCCCATCCAATGGGATATAAACGGATTGGGTACGGGAATACTGGACACGCAATGGGCCG
TACCCCGTTTGTATTCGGACT
TACCCCTCTGTTTGTATT
TACTTATTTCAGCGTCCCATC
TACTTATTTCAGCGTCCCATC
Creating a Banshee Karyotype1. Using your banshee genome
identify homologous chromosomes.
2. Determine how long each piece homologous chromosome will be. Develop your own scale so that it can fit on one piece of paper.
3. Draw bands (genes) within the homologous chromosome. They will have to be scaled as well.
4. Insert the letter used to represent each gene in the bands. Be sure to use either upper of lower case.
5. Label the phenotype of each gene.
bshor
t
DLong
YYello
w
Body LengthLong
Wing SpanLong/Long
Color PatternYellow/Blue
BBlue
BLong
DLong
JQ: No Journal Question. Have a seat and take out the
“Decoding the Banshee Genome” Packet
Journal Question:
If you flip a coin 100 times, will you always get
50 heads and 50 tails?
NO Journal Question Today!
Take some time to review for
your quest! You will need a
pencil.
What is the weirdest
looking animal you have ever
seen?
Leafy Seadragon
Sloth – Native to Central & South AmericaHave a very slow metabolism so they need very little
food. Often stay in one tree their entire lives. They give birth to their babies upside down.
Tarsier Monkey Native to
Philippines
3.5 to 6.25 inches in height & about 6oz
in weight
Probiscus Monkey – Native Borneo in Southeast Asia
Its nose swells and turns red when excited or angry. Make loud honking sounds when they
sense danger.
Aye-aye– Native to Madagascar (Africa)They are related to chimps, apes and humans.
Nocturnal and often thought of as bad luck.
Blobfish – Native to Australia & Tasmania They have no muscles and wait in one spot for
their food to pass by. Because of this action they are referred to as lazy fish.
Why do organisms look
and act the way they do?
Emperor Tamarin
top related