Read pages 204-211, and answer

numbers 18 – 22, and then

numbers 2, 4, 7 in the

Standardized Test Prep Section

Your Homework Tonight Honors

JQ: If you were to wake up on a deserted island tomorrow,

how would you survive?

Essential Question:

How do organisms

ensure their survival?

Atmosphere was filled with hydrogen cyanide, carbon dioxide, carbon monoxide, nitrogen, hydrogen sulfide & water vapor

Miller/Urey ExperimentRecreated early Earth atmosphere & passed electric spark into environment.

1st Some Organic molecules formed (Proteins, Carbs. Lipids & Nucleic Acids) – Molecules that make up living organisms.

2nd Proteinoid Microspheres formed – grouping of organic molecules forming what looks like primitive cell.

3rd RNA & DNA formed – molecules that describe how to make living organisms.

RNADNA

3.5 bya fossils show presence of prokaryotic cells (cells w/o a nucleus).

Formed in the absence of oxygen and underwater. (Chemosynthesis)

2 Types of Prokaryotes:

Archaea Bacteria

Extremophiles Common Cold

Organisms then became photosynthetic = food & oxygen released into atmoshphere. Ozone Layer (O3) formed.

Oxygen rose and became deadly for organisms = change became a must.

Organisms learned to use oxygen to generate energy.

2 bya Eukaryotic cells (cells with a nucleus) formed from the joining of several prokaryotic organisms (endosymbiotic theory).

Avatar Continued…Exploring Evolutionary Concepts

Questions to answer when watching the movie:

1. Do you believe in soul mates? Do the navi believe in soul mates? Provide example(s).

2. Do any of the ikran (banshee’s) look or act the same? Provide examples.

3. Do any of the navi look or act the same? Provide examples.

4. If any of the organisms from above look and act different develop an explanation as to why?

5. Provide examples from the movie demonstrating how Jake is able to ensure the survival of his

avatar.

As a young Evolutionary biologist you are on a quest to understand how organisms ensure their survival.

To do this you will have to obtain one of the banshee eggs found within this room. Once found you will have to grow and test your banshee to understand it.

Find an egg. Return to your seat. DO NOT OPEN THE EGG!

Mountain Banshee Research

Mountain Banshee Research

1. Open your egg.2. What is inside?3. What do these codes

do?4. Compare with someone

near you, are the codes identical?

5. How will you decode the language of the banshee’s genes?

Banshee Genome

1.Inside your eggs there is a list of codes for 11 traits.

2.Each trait has two sequences of DNA, representing homologous genes.

3.To build your banshee you will have to decode the genes.

BACKGROUND

1. Genome – refers to the full diploid set of DNA for an organism

2. You can get a genome from almost every somatic cell in your body.

3. Human Genome Project-completed in 2003

Do Now: Form two lines in the

classroom. (Roughly 12 students in one line, and 12 in the

other)

Journal Question:(after the game is done) What is the

purpose of this activity? Explain.

Telephone Game1.Gather into two even lines.

2.To win the game, the last person in the line has to act out the message being passed along.

A) In order to get an A on this activity the last person in the line must hop to the front lab desk and open up the 2nd draw from the right side of the desk. Pull out an object and then bark like dog three times. When finished wink at the teacher with your left eye.

B) In order to get an A on this activity the last person in the line must skip to the front of the room, turn around and face the desks. Locate the chair in the 4th row, 3rd column. Sit in the desk chair backwards and moo like a cow one time. When finished wink at the teacher with your right eye.

Telephone Game Scenario’s

Telephone Game Questions

1. How important is effective communication in society?

2.Do you think your cells/molecules ever play the telephone game?

Journal Question:

With the person sitting near you, describe the basic steps of transcription and translation

Take out homework

Lets recall some information for a

minute:

1.What is a gene?

2.What do genes code for?

3.What is the function of a protein (examples)?

4.What determines the function of a protein?

5. What are all proteins made of?

How are proteins made? Proteins are

created in two steps called

transcription & translation.

AKA: Gene Expression

Link to Animation (go to 7:06 – 17:33)

STEP 1: Transcription

Instructions on how to make the protein are copied from the gene into a messenger RNA molecule. (Make a “Xerox copy” of the gene)

Link to Animation

What is RNA?

RNA similar to DNA, BUT it is single stranded instead of double stranded.

Monomer Unit:

nucleotide {ribose sugar instead of deoxyribose, and Uracil (U) instead of Thymine (T)}

Function: DNA’s helper – carries out DNA’s instructions for making proteins (mRNA, tRNA, rRNA)

Transcription -In Depth1. Transcription factor

is a protein that binds to the Promoter to regulate transcription

2. In many genes, Promoter begins with TATAAA sequence called TATA Box

3. Once transcription factors are in place, RNA polymerase makes mRNA transcript

Transcription -In Depth Two types of Transcription

factors:

Activator: protein that recruits RNA polymerase to bind to the promoter

Repressor: protein that blocks RNA polymerase from binding to the promoter

GENE: TACAGACTCCGGCCCATT

Transcription PracticeDNA:

GTTGAATAACTATAAACCCGCGCAATCTGGCTTACAGACTCCGGCCCAT

TGCGCCGCAGATTACT

Pre-mRNA:AUGUCU

GAG

GGGGCC UAAPre-

mRNA:AUGUCU

GAG

GGGGCC UAA

IntronsExons

Transcription -In Depth4. We now have pre-mRNA! The introns of Pre-mRNA must be removed (spliced out) by spliceosomes

5. mRNA leaves nucleus and travels to ribosome for translation

GENE: TACAGACTCCGGCCCATT

Spliceosomes in Action

Pre-mRNA:

AUGUCU GAG

GGGGCC UAA

Spliceosome

mRNA:AUGUCUGCCUAA

When does RNA polymerase stop transcribing the gene?

There are 3 sequence that end a gene:

1. ACT2. ATT3. ATC

Journal Question:As you come in take one of the packets from the

front of the room. Working with a partner complete pages 1 & 2. Once finished we will

reconvene up front and finish decoding your banshee genes and

determine what it will look like and how it will

act.

Have fun and we shall talk in about 20 minutes.

Step 2: Translation

*Goal is to read mRNA & construct the protein*

1. mRNA is read by ribosomes in groups of 3 letters called codons. (AUG, ACC)

2. Codon tells tRNA which amino acid to get.

Translation1. Initiation

How does translation begin?

2. Elongation How does the

ribosome help translation continue?

3. Termination How does the

ribosome know when to stop the process of translation?

Link toAnimation

The Codon Chart

*Conclusions*Now, can you expand on your

answers to the questions?

“How does the telephone game relate to protein synthesis?”

“What happens if the message changes in any step of the

process?”

“Are these changes good or bad?”

Journal Question:Are the enzymes in your body

able to think? Explain.

Review Questions:1. How is a sex chromosome

different from an Autosome?

2. How many pieces of DNA does your banshee have?

3. What is the diploid number for your banshee’s cells?

4. How many homologous pairs of DNA does your banshee genome have?

5. How was your banshee’s genome created?

+ =

Fertilized Banshee Egg

1st CellDiploid Cell

2(4) = 8

Male Banshee Sperm

DadN = 4

Female Banshee Egg

MomN = 4

Creating a Banshee Genome

1. Paired?

2. Banding?

3. Arrangement?

4. XX vs. XY?

5. How do sex cells compare?

Karyotyping Recall

Closer look at DNA in a Karyotype

CGGACTAAAAGGCATTTACCCTATAAATTAAAAACGAACTACCCCTCTGTTTGTATTAAAAGGAATCGGATTGGGAATATAAACAATGGGGGTACTTATTTCAGCGTCCCATCTATAAACGGATTGGGTACAAGACTGGACACGCAATGGGCCGC

AAAAGGAATCGGATTGGGAATATAAATTAAAAACGAACCGTACCCCGTTTGTATTCGGACTAAAAGGCATTTACCCTATAAACAATGGGGGAAGGATACTTATTTCAGCGTCCCATCCAATGGGATATAAACGGATTGGGTACGGGAATACTGGACACGCAATGGGCCG

TACCCCGTTTGTATTCGGACT

TACCCCTCTGTTTGTATT

TACTTATTTCAGCGTCCCATC

TACTTATTTCAGCGTCCCATC

Creating a Banshee Karyotype1. Using your banshee genome

identify homologous chromosomes.

2. Determine how long each piece homologous chromosome will be. Develop your own scale so that it can fit on one piece of paper.

3. Draw bands (genes) within the homologous chromosome. They will have to be scaled as well.

4. Insert the letter used to represent each gene in the bands. Be sure to use either upper of lower case.

5. Label the phenotype of each gene.

bshor

t

DLong

YYello

w

Body LengthLong

Wing SpanLong/Long

Color PatternYellow/Blue

BBlue

BLong

DLong

JQ: Are we the product of nature, or nurture? Explain.

JQ: No Journal Question. Have a seat and take out the

“Decoding the Banshee Genome” Packet

Journal Question:

If you flip a coin 100 times, will you always get

50 heads and 50 tails?

NO Journal Question Today!

Take some time to review for

your quest! You will need a

pencil.

What is the weirdest

looking animal you have ever

seen?

Leafy Seadragon

Sloth – Native to Central & South AmericaHave a very slow metabolism so they need very little

food. Often stay in one tree their entire lives. They give birth to their babies upside down.

Komodor Dog– Native to Hungary

Tarsier Monkey Native to

Philippines

3.5 to 6.25 inches in height & about 6oz

in weight

Probiscus Monkey – Native Borneo in Southeast Asia

Its nose swells and turns red when excited or angry. Make loud honking sounds when they

sense danger.

Aye-aye– Native to Madagascar (Africa)They are related to chimps, apes and humans.

Nocturnal and often thought of as bad luck.

Blobfish – Native to Australia & Tasmania They have no muscles and wait in one spot for

their food to pass by. Because of this action they are referred to as lazy fish.

Why do organisms look

and act the way they do?

Emperor Tamarin