JOURNAL OF BACTERIOLOGY,0021-9193/99/$04.0010

Aug. 1999, p. 4734–4740 Vol. 181, No. 16

Copyright © 1999, American Society for Microbiology. All Rights Reserved.

An Unspliced Group I Intron in 23S rRNA Links Chlamydiales,Chloroplasts, and Mitochondria

KARIN D. E. EVERETT,1* SIMONA KAHANE,2 ROBIN M. BUSH,3 AND MAUREEN G. FRIEDMAN2

Avian and Swine Respiratory Diseases Research Unit, National Animal Disease Center, USDA Agricultural ResearchService, Ames, Iowa 500101; Department of Virology, Faculty of Health Sciences, Ben Gurion University,

Beer Sheva, Israel2; and Department of Ecology and Evolutionary Biology, University of California at Irvine,Irvine, California 926963

Received 8 February 1999/Accepted 20 May 1999

Chlamydia was the only genus in the order Chlamydiales until the recent characterization of Simkanianegevensis ZT and Parachlamydia acanthamoebae strains. The present study of Chlamydiales 23S ribosomal DNA(rDNA) focuses on a naturally occurring group I intron in the I-CpaI target site of 23S rDNA from S. negevensis.The intron, SnLSU z 1, belonged to the IB4 structural subgroup and was most closely related to large ribosomalsubunit introns that express single-motif, LAGLIDADG endonucleases in chloroplasts of algae and in mito-chondria of amoebae. RT-PCR and electrophoresis of in vivo rRNA indicated that the intron was not splicedout of the 23S rRNA. The unspliced 658-nt intron is the first group I intron to be found in bacterial rDNA orrRNA, and it may delay the S. negevensis developmental replication cycle by affecting ribosomal function.

Group I introns are mobile genetic elements that have notpreviously been found in bacterial ribosomal DNA (rDNA),despite the fact that nearly all bacterial 23S rDNAs have con-served target sequences for the intron-encoded homing endo-nucleases I-CeuI (1, 35) and I-CpaI (1, 49, 50). Upon intronentry into cells, homing endonucleases are expressed and me-diate intron insertion into host DNA by cleaving intronlesstarget sites (5). Group I 23S rDNA introns are widespread inalgal chloroplasts (49), which are thought to be derived frombacterial ancestors (21). The 23S rDNA group I introns arealso found in the apparently bacterially derived mitochondria(32) of an amoeba and other lower eukaryotes (22, 24, 36).They are present in the nuclear rDNA of lower eukaryotes andarchaea (22, 24, 37, 38). It is not known why bacteria lackrDNA introns.

Some bacterial ribosomal genes encode intervening seg-ments (IVSs) that are approximately the size of small introns.These are excised from the rRNA by ribonucleases, leavingfragmented but functional rRNA. IVSs are found in highlyvariable regions, not in functionally essential domains (23). Incontrast, group I introns are located in functionally vital lociand must be removed from transcripts by autocatalytic splicingor by splicing that is facilitated by maturase protein (7, 12, 39).Splicing occurs coordinately with ligation of the RNA exons(12, 39). The intron transcript folds to form a catalytic core forcarrying out the splicing and ligation. The core structure can bepredicted by RNA folding analysis (24), and 10 complementarydomains with specific roles in core formation, P1 to P10, havebeen deduced by sequence similarity, covariance of distantpositions, and stereochemical modeling (39). Neither sequencenor folding analysis, however, predicts whether group I splicingwill be autocatalytic or maturase facilitated. Autocatalysis canbe tested by an in vitro assay (26). Maturases must be encoded

by the introns themselves or supplied endogenously or exog-enously.

Although the 16S small ribosomal subunit (SSU) genes ofspecies belonging to the bacterial order Chlamydiales are wellcharacterized, chlamydial 23S rRNA large ribosomal subunit(LSU) genes have undergone only partial and limited scrutiny(17, 47). Chlamydiae are obligately intracellular bacteria thatreplicate only within endocytic vacuoles of eukaryotic cells.Four families of chlamydiae are known to parasitize verte-brates or have been associated with vertebrates (8, 17, 18, 29,34, 40, 45), and those strains belonging to Parachlamydia acan-thamoebae also live in amoebae (2, 3). In a comprehensiveanalysis of chlamydial 23S rRNA, a group I intron was identi-fied in Simkania negevensis ZT, a Chlamydiales strain for whichthe natural eukaryotic host is not known. This is the firstbacterium that has been found to have a 23S rRNA group Iintron. The intron is characterized in this study.

MATERIALS AND METHODS

Bacteria and cell culture. S. negevensis ZT (ATCC VR-1471) (18, 28) wasgrown at 37°C in confluent monolayers of cultured Vero cells (ATCC CCL81;American Type Culture Collection, Rockville, Md.) in RPMI containing 15%fetal bovine serum, 1% glucose, 10 mg of ampicillin/ml, 100 mg of gentamicin/ml,160 mg of vancomycin/ml, and 1 mg of cycloheximide/ml. Chlamydia trachomatisL2/434/BU was similarly grown in Vero cells, but without ampicillin.

Sequence analyses. Double-stranded sequence data for Chlamydiaceae 23SrRNA genes and for the S. negevensis 23S rRNA gene were obtained by directPCR product sequencing at the Iowa State University DNA Sequencing andSynthesis Facility, Ames. Sequences were assembled with Sequencher data anal-ysis software (Gene Codes, Ann Arbor, Mich.).

Sequence analysis programs, described elsewhere (20), were used to compare23S rDNA sequences of Simkania, Parachlamydia, and Chlamydiaceae spp. toidentify the SnLSU z 1 insertion site and to identify an open reading frame(ORF). These programs were also used to identify a hairpin structure at position1931 and the probable start and stop sites of the S. negevensis 23S rRNA gene.The programs used included Reformat, Assemble, PileUp, LineUp, FoldRNA,and Squiggles. The homology of the intron and intron ORF with other genes wasdetermined by BLASTN, BLASTP, and TFASTA searching of the GenBank,PIR, and SWISSPROT databases.

ORF analysis. Endonuclease homologs were aligned with I-CreI by usingalignments by Turmel et al. (51) and structural analysis by Heath et al. (25).Phylogenetic analysis of the EndA gene sequence from SnLSU z 1 was carried outusing the tree bisection reconnection option of the maximum parsimony routineof PAUP version 3.1 (48). Input order was randomized 10 times, and 1,000bootstrap replicates were run to provide statistical support for branching order

* Corresponding author. Present address: Department of MedicalMicrobiology and Parasitology, College of Veterinary Medicine, Uni-versity of Georgia, Athens, GA 30602-7371. Phone: (706) 583-0237 or542-5823. Fax: (706) 542-5771. E-mail: keverett@calc.vet.uga.edu orkdeeverett@hotmail.com.

4734

on May 5, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

(19). A saturation plot of the phyletic distance versus the percent pairwisedistance between isolates was constructed to determine whether homoplasyinterfered with the analysis (52).

Intron structure. Intron secondary structure was inferred with the comparativesequence analysis program AE2, and the secondary structure diagrams weredrawn with the program XRNA (16). The SnLSU z 1 structure diagram wasaltered by hand to enhance readability.

RNA and DNA preparation. RNA and DNA were prepared from S. negevensisand from two negative controls, C. trachomatis and uninfected Vero cells. Nu-merous S. negevensis RNA preparations from replicating reticulate bodies (RBs)and also from metabolically inactive elementary bodies (EBs) were harvested atmany time points in the 2 to 12 days postinfection. Standard methods were usedto isolate chlamydiae (11): infected preparations were removed from flasks byusing glass beads, mildly sonicated, and centrifuged in Renografin gradients(Solvay Animal Health Inc., Mendota Heights, Minn.). C. trachomatis was har-vested 2 to 3 days postinfection. EB and RB preparations were standardized at1 mg/ml of protein before extraction of nucleic acids. RNA and DNA wereseparately extracted with the TriReagent RNA-DNA-protein isolation kit TR-118 (Molecular Research Center, Cincinnati, Ohio) according to the manufac-turer’s recommendations. RNA was also extracted by a second method, using theSV total RNA isolation system Z3101 and DNase (Promega, Madison, Wis.).

RNA analysis and in vitro autocatalysis. RNAs prepared with TriReagentfrom S. negevensis RBs, C. trachomatis RBs, and Vero cells were electrophoresedunder denaturing conditions with formaldehyde in 1.5% agarose gels (46). C.trachomatis RNA provided an intron-negative control. Vero cell RNA provideda host cell control. Each loaded sample contained 10 mmol of ethidium bromide.Electrophoresis of RNA from different preparations was repeated several times,with consistent results each time. RNA markers (G3191; Promega) were used.

In vitro autocatalytic intron splicing was attempted with RNAs prepared withTriReagent from S. negevensis RBs, under conditions that have previously beenused for in vitro autocatalysis and splicing (26). Equal volumes of S. negevensisRNA in water and 200 mM MgCl2 were separately incubated at 95°C for 2 minand then were mixed together and allowed to cool to 37°C. The preparation wasbrought to a final concentration of 60 mM MgCl2, 100 mM GTP, 100 mM KCl,and 50 mM Tris, pH 7.5 and was incubated for 1 h at 37°C. Both treated anduntreated RNAs were used as templates for reverse transcription (RT)-PCR.

RT-PCR, PCR, and electrophoresis. RT-PCR with Tth DNA polymerase wasperformed in 13 RT-PCR buffer (Boehringer Mannheim, Indianapolis, Ind.)according to the instructions of the manufacturer. Amplification of the intronfrom 23S rRNA or ribosomal DNA (rDNA) was done with primer AF (59CACAGGTAGGCATGATGA 39), which matched the 23S rDNA 319 basesupstream of the intron, and primer BR (59 CTAGCTGCGGGTAAACG 39),which complemented the 23S rDNA 122 bases downstream of the intron. Theprimers perfectly matched the S. negevensis rRNA, but primer AF had threemismatches with C. trachomatis and primer BR had five mismatches with C.trachomatis. RT was carried out in 1 cycle of 30 min at 60°C and 60 s at 94°Cfollowed by PCR cycling: 10 cycles of 30 s at 94°C, 30 s at 55°C, and 60 s at 72°C;20 cycles of 30 s at 94°C, 35 s at 55°C, and 100 s at 72°C; and finally a 7-min cycleat 72°C. RT-PCR amplification of 338 nucleotides (nt) of the SnLSU z 1 intronalone was carried out under these conditions, using primers INTF (59 TTAGATGCACAATGGATAGTTGGA 39) and INTR (59 CCATCAGCGCTCATGTGCTCA 39).

PCR amplification was performed with Taq DNA polymerase (Takara ShuzoCo., Ltd., Kyoto, Japan) according to instructions of the manufacturer. The PCRamplification conditions were 1 cycle for 6 min at 94°C; 30 cycles of 60 s at 94°C,60 s at 53°C, and 60 s at 73°C; and one cycle of 60 s at 94°C, 60 s at 53°C, and 10min at 73°C. PCR and RT-PCR products were electrophoresed on 1% agarosegels in Tris acetate-EDTA buffer and stained with ethidium bromide. Electro-phoresis of products obtained from different preparations was repeated manytimes, with consistent results each time. The AmpliSize DNA size standard(170-8200; Bio-Rad, Hercules, Calif.) was used.

Nucleotide sequence accession number. The GenBank accession number ofthe S. negevensis ribosomal operon, including EndA, is U68460.

RESULTS AND DISCUSSION

Sequence and ORF analysis. A 23S rDNA group I intron inS. negevensis Z was initially identified in a sequence survey of23S rDNAs from species belonging to the order Chlamydiales.In this survey, all 10 Chlamydiaceae strains examined werefound to have a base change at position 1923 (Escherichia colinumbering [44]) (Fig. 1) compared to nearly all other bacteria,including Simkania and Parachlamydia. This is the target in-tron insertion site for the homing endonuclease I-CeuI (5).I-CeuI is encoded by group I intron CeLSU z 5 in the 23SrRNA in chloroplasts of Chlamydomonas eugametos algae.Comparably positioned I-CeuI introns are found in eight otherspecies of algae (51). The base difference in the Chlamydiaceae

strains would make them naturally resistant to cleavage byI-CeuI (38).

S. negevensis ZT, which belongs to family II, the Simkani-aceae (18), in the order Chlamydiales, had a 658-base insertionat position 1931 in the 23S rDNA (Fig. 1) compared to otherbacteria. Position 1931 is the target site for homing endonu-clease I-CpaI (5), which is encoded by the 23S rRNA group Iintron CpLSU z 2 in chloroplasts of Chlamydomonas pal-lidostigmatica algae (50). Comparably positioned introns arefound in other species of algae (24) and in the mitochondriaof Acanthamoeba castellanii (36). The S. negevensis insertioncontained a 432-bp ORF (Fig. 1). A low-molecular-weight[35S]methionine-labeled product could be produced by in vitrotranscription-translation of a PCR product that contained thefull-length insert (not shown). Because it was not known if theproduct of the S. negevensis ORF was an active endonuclease,it could not be given a formal name and was designated EndA(5, 9, 30, 31).

EndA had 43% deduced amino acid identity with I-CpaI.EndA had 41% identity with YMF46, the I-CpaI homologencoded by AcLSU z m1 in position 1931 of A. castellaniimitochondrial 23S rDNA. These homologs are both single-motif LAGLIDADG homing endonuclease sequences. Com-parison of EndA with several LAGLIDADG endonucleases,including I-CreI, which targets 23S rRNA position 2593 and forwhich the crystal structure is known, showed conservation ofmany structural features (Fig. 2). EndA had an apparentLAGLIDADG catalytic domain, a conserved glutamine in po-

FIG. 1. 23S rRNA, bases 1851 to 1992, from several Chlamydiales strains (E.coli numbering). In S. negevensis ZT, a group I intron was located betweenpositions 1930 and 1931. The predicted intron-encoded endonuclease, EndA, isshown. The full-length 23S rRNA gene of Chlamydiaceae strains L2/434/BU,R22, MoPn, TW-183, 6BC, NJ1, FP Baker, EBA, IPA, and GPIC were se-quenced.

VOL. 181, 1999 Sn LSU z 1 FROM SIMKANIA NEGEVENSIS 4735

on May 5, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

sition 47 which is associated with Mg21 binding, functionallysimilar amino acids in four antiparallel b-sheet DNA-bindingdomains, conservation within the four overlying a-helical seg-ments, functionally similar amino acids in the turn segments,and conserved sequence deletions. A six-residue deletion inposition 32 of EndA, in the turn segment linking b1 and b2DNA-binding domains, was located well away from the a1catalytic site. EndA could thus be predicted to have possibleLAGLIDADG endonuclease activity and functional similari-ties with I-CpaI and YMF46 for recognition and cleavage ofthe 1931 target.

Both single-motif and bifunctional LAGLIDADG endo-nucleases have been identified in the LSU rDNA. I-CeuI, I-CpaI, YMF46, I-CreI, and EndA are single-motif endonucle-ase sequences, each having only one LAGLIDADG domain(5). Single-motif LAGLIDADG endonucleases are expressedonly by LSU introns (Table 1). It is thought that the singlemotif may have been ancestral to nucleases with more complexLAGLIDADG motifs (5).

Ruling out an IVS. To examine whether EndA was encodedby a group I intron, it was first essential to determine whetherthe 658-bp insert could be an IVS. IVSs are common in bac-terial rDNA and are easily identified because they are typicallylocated in nonvital loci (23) and are excised from rRNA in vivowithout ligation, producing fragmented rRNA. To rule out IVS

excision and RNA fragmentation, in vivo S. negevensis rRNAwas isolated and subjected to denaturing electrophoresis (Fig.3). In the event of IVS excision, the 3,600-nt S. negevensis 23SrRNA would be cleaved into 2,000-, 1,000-, and 658-nt frag-ments. When electrophoresis of S. negevensis rRNA was car-ried out, these sizes were not evident (Fig. 3). In both S.negevensis and C. trachomatis, only intact 23S, 16S, and 5SrRNAs were observed (Fig. 3). The S. negevensis rRNAs ap-peared to be slightly larger than the 1,558- and 2,981-nt C.trachomatis 16S and 23S rRNAs. There was no evidence ofcontamination of these rRNAs with rRNA from the Vero cellline that was the in vitro host cell for both S. negevensis and C.trachomatis. Because the 23S rRNA was not fragmented, it wasconcluded that the S. negevensis 23S rDNA insert was notexcised without ligation in vivo and was therefore not a bacte-rial IVS.

RNA folding analysis. Target and sequence analysis sug-gested that the S. negevensis 23S rDNA insertion was an I-CpaI-like intron (Fig. 1 and 2). Eleven different group I intronstructural subgroups have been identified by target sequence,

FIG. 2. Structural and sequence comparison of single-motif LAGLIDADG homing endonucleases. The proteins were aligned with I-CreI, for which the secondarystructure is known (25), with alignments by Turmel et al. (51). I-CreI numbering has been used. The LAGLIDADG catalytic domain is underlined; boldface, b-pleatedsheet (binds the DNA); italics, a helices overlying the b-sheet; T, turn structure; ●, stop codon; *, acidic residue required for catalytic activity of I-CeuI; Mg11,magnesium binding required for catalytic activity of I-CeuI; †, possible substrate recognition site in I-CeuI. GenBank accession numbers: I-CpaI, L36830; YMF46,U12386 and U03732 (the AcLSU z ml ORF in both A. castellanii SGC6 and A. castellanii Neff mitochondria) (10); CmeLSU z 1 is from reference 51; I-CeuI, Z17234(a partial sequence is shown, beginning with residue 47); PaND3 z 1, X14485 (the first half of the double-motif endonuclease in the ND3 gene of the mitochondrionin the fungus Podospora anserina is shown); SsSSU z 1, U07553 (the first half of the double-motif endonuclease in the SSU rRNA of the mitochondrion in the fungusSclerotinia sclerotiorum is shown); I-CreI sequence and structure are according to reference 25, but viewed as looking down on homodimers bound to the DNA. b-Sheetsare in direct contact with the DNA, and a-helices form the catalytic domain and overlying structure.

FIG. 3. Purified rRNA from C. trachomatis, S. negevensis, and host Verocells. The sizes of Vero cell rRNAs were consistent with the known sizes ofhuman 18S and 28S rRNAs (1,869 and 5,025 nt, respectively; GenBank accessionno. X03205 and M11167).

TABLE 1. Introns encoding single-motif,LAGLIDADG endonucleases

LSUtarget Intron ORF Host organism Splicing

subgroup

1923 CeLSu z 5 I-CeuI Algal chloroplast IB41931 AcLSU z m1 YMF46a Amoeba mitochondrion IB41931 CmeLSU z 1 a Algal chloroplast IA11931 CpLSU z 2 I-CpaI Algal chloroplast IB41931 SnLSu z 1 EndAa S. negevensis ZT IB41951 AcLSU z m2 a Amoeba mitochondrion IA32593 CrLSU z 1 I-CreI Algal chloroplast IA3

a Endonuclease activity has not been demonstrated in vitro.

4736 EVERETT ET AL. J. BACTERIOL.

on May 5, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

sequence homology, and RNA folding pattern (39). The S.negevensis 23S rDNA-insert sequence was examined by foldinganalysis to determine whether it belonged to any known sub-group. Identifiable P69 and P7 domains were present that couldform hydrogen bonds with portions of the 658-nt segment toproduce P8, P3, and P9 domains (Fig. 4A). The 59 end of theintron formed a hairpin and flawless splicing recognition sitewith the exon. Thus, the essential nucleotide sequence require-ments for intron cleavage and transesterification were presentin the S. negevensis insert. The predicted folding similarity ofthe S. negevensis insert, CpLSU z 2, and AcLSU z m1 (Fig. 4),indicated that all three belong to the IB4 structural subgroupof group I introns. Therefore, the S. negevensis segment wasgiven an appropriate intron designation, SnLSU z 1. Foldinganalysis of SnLSU z 1 also indicated that the entire 39 end ofthe IB4 splicing apparatus was the C-terminal 30% of theEndA gene (Fig. 4A). Such a large functional overlap has notpreviously been described in group I introns.

Phyletic and functional relatedness. The folding and splicingdomains and the endonuclease-encoding domain of group Iintrons are generally regarded as having evolutionarily distinctorigins, one deriving from ribozymes and the other from pro-tein-coding genes (6, 39). The 59 ribozyme domain of SnLSU z1 had little homology with other sequences, including bacterialtRNA group I introns, which belong to the IC3 folding sub-group. Phyletic analysis of the deduced EndA protein showedthat it was related to endonucleases in group I LSU introns(Fig. 5). EndA clustered with the algal chloroplast intron,I-CpaI. Algal chloroplasts are the largest currently known res-ervoir of 23S rRNA group I introns and so may at one timehave provided the ancestral SnLSU z 1 intron. Because, to a

significant extent, the endonuclease and ribozyme in S. negev-ensis are a single genetic element, an ancient duplication of anSnLSU z 1-like element in algae may have led to the separateand diverse group I ribozyme and coding elements in algae.

Absence of splicing. The ribozyme and coding overlap raisedthe question of whether splicing and translation might conflictat the 39 end of the intron. Splicing is either autocatalytic ormaturase facilitated, but folding analysis does not predictwhich. Most IB4 introns have so far been shown not to be

FIG. 4. Folding analysis of the three position-1931 LSU group I introns belonging to structural subgroup IB4. The large arrows near the 59 and 39 ends of the intronsindicate predicted splice sites. Single-motif endonuclease ORFs were located in the loops marked 485, 494, and 454 nt, but the SnLSU z 1 ORF extended out of theloop to the 39 end of the intron (boldface).

FIG. 5. Phylogeny constructed by maximum parsimony analysis of the endo-nuclease DNA sequence in SnLSU z 1 and related endonuclease genes (48) (fromFig. 2). The percent confidence in each node was determined with 1,000 boot-strap replicates, and the consistency index was 0.90. The linearity of the satura-tion plot (inset) suggested that long branch attraction did not adversely affect theresolution of this phylogeny, despite these sequences being only distantly relatedto each other. 1, points that compare S. negevensis to one of the other genes.

VOL. 181, 1999 Sn LSU z 1 FROM SIMKANIA NEGEVENSIS 4737

on May 5, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

autocatalytic (14, 26) and autocatalysis of neither CpLSU z 2nor AcLSU z m1 has been reported. S. negevensis SnLSU z 1encoded only a single-motif endonuclease and so did not sup-ply a maturase.

To determine whether SnLSU z 1 was spliced out and theexons ligated in vivo, RT-PCR of S. negevensis 23S rRNA wascarried out with purified in vivo RNA (as seen in Fig. 3) andalso with in vivo RNA that had first been subjected to in vitroautocatalytic conditions (26) (Fig. 6). RT-PCR primers AF andBR, which matched and complemented the 23S rRNA gene,would generate a 441-bp PCR product if the intron were re-moved and the exons ligated, a 1,099-bp product if the intronwere not spliced out, both PCR product sizes if spliced andunspliced RNAs were present, or no product if the intron hadbeen removed by excision without repair. RT-PCR of rRNAwith primers AF and BR produced only 1,100-bp amplicons(Fig. 6). This result was reproducible whether the S. negevensisrRNA had been purified from early, middle, or late stages ofthe S. negevensis developmental cycle (not shown). DNA-dependent PCR amplification with rRNA preparations (aftertreatment of template with RNase or without prior RT) repro-ducibly yielded no PCR product (Fig. 6). There was no ampli-fication of Vero cell or C. trachomatis template. RT-PCR ofpurified S. negevensis rRNA that was exposed to autocatalyticsplicing conditions produced only 1,100-bp amplicons withprimers AF and BR.

RT-PCR of purified S. negevensis rRNA with intron-specificprimers, INTF and INTR, produced only 338-bp amplicons(Fig. 6). The ratio of detectable AF-BR to INTF-INTR prod-uct was reduced after exposure of S. negevensis RNA to auto-catalytic conditions, indicating that limited nucleolytic attackhad occurred under these conditions. This was consistent witheither incomplete autocatalysis (cleavage at only one end of

the intron) or with template degradation under the autocata-lytic test conditions.

RT-PCR can amplify short amplicons in preference to longamplicons and is therefore sensitive to the presence of verysmall amounts of spliced rRNA. The amplicon sizes producedwith RT-PCR from purified in vivo RNA and from RNAsubjected to autocatalytic conditions indicated that the intronwas not spliced out of the 23S rRNA. Autocatalytic splicingcapability may have been lost through mutation, or the organ-ism that donated the ancestral intron may have utilized anendogenous or exogenous maturase for splicing (13, 14, 26).

Ribosome function and prolonged developmental cycle. Inribosomes, 23S rRNA base 1931 is located in domain IV at theinterface between the SSU and the LSU, in close proximity tothe highly conserved 23S peptidyl-transferase center (33). S.negevensis is a viable bacterium with functional SSU and LSU,despite the presence of SnLSU z 1 in position 1931 of the 23SrRNA. Three factors may contribute to the viability of S. ne-gevensis. First, S. negevensis is an obligately intracellular bac-terium and benefits from replicating in a nutrient-rich intra-cellular environment. Second, there is only one rRNA operonin the S. negevensis genome (27), and for survival, S. negevensishas had to unilaterally adapt to the presence of the intron.Third, in other organisms, it has been shown that point muta-tions in 23S rDNA sites 1926 or 1940 can make LSU defectivefor association with SSU (33). Experiments with recombinantE. coli have shown that 23S rRNA with a heterologous intronin position 1926 assembles into LSU but does not competeeffectively for SSU, compared to endogenous LSU withoutintrons (41). The dissociation constant for these SSU–LSU–unspliced-intron complexes is thus considerably higher than itis for SSU-LSU complexes that do not have introns. The site1931 intron in S. negevensis 23S rRNA domain IV is located onthe opposite side of the helical hairpin containing bases 1926and 1940. If the ribonucleotides in positions 1926 and 1940 areoccupied in the peptidyl-transferase center, the unsplicedSnLSU z 1 intron in position 1931 may extend away from theactive interface and out into the LSU. Yonath and Berkovitch-Yellin have, after all, observed that the ribosome is not acompact body but contains hollows, gaps, and tunnels (53). Inaddition, new evidence indicates that domain IV is less impor-tant than previously believed for peptide bond formation by23S rRNA complexes (42).

Because of the proximity of the unspliced SnLSU z 1 RNA tothe peptidyl-transferase center of the ribosome, it might besupposed that the intron would affect ribosome function inS. negevensis. As it turns out, S. negevensis has a uniquelyprolonged developmental cycle of replication (12 to 14 days)compared to other Chlamydiales (27). C. trachomatis, for ex-ample, completes a cycle of replication by damaging or rup-turing host cells just 2 or 3 days after infection. S. negevensisgrows exponentially for 2 to 3 days and then enters a 7- to10-day stationary phase. By light microscopy, changes in theappearance of an infected cell are dramatic as the cycleprogresses. During exponential growth, the infected areas inthe cytoplasm are tarry masses of tiny vacuoles. The vacuolesenlarge over time and become angular, but still appear to beempty. In the final 7 to 14 days the vacuoles fill with smallflickering particles. The long stationary phase in the S. negeven-sis replication cycle might be caused by slowing of translationand growth, due to the intron. Other explanations, such as anunknown auxotrophy, must also be ruled out. It is not knownwhether the S. negevensis growth cycle would be quite so pro-longed in the natural host. It is possible that the natural hostcells encode maturases that are transported into S. negevensisto facilitate SnLSU z 1 splicing. The discovery of SnLSU z 1 may

FIG. 6. SnLSU z 1 amplification from S. negevensis, C. trachomatis, and Verocell rRNAs. Amplification primers AF and BR were used for all lanes except thethree INTF/INTR lanes. AF and BR would amplify a 441-bp PCR product fromintronless rRNA and a 1,099-bp PCR product from intron-containing rRNA.INTF and INTR matched the intron, amplifying a 338-bp intron-only segment.All rRNA templates were used directly except for “treated” S. negevensis tem-plate, which was subjected to autocatalytic splicing conditions prior to amplifi-cation.

4738 EVERETT ET AL. J. BACTERIOL.

on May 5, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

eventually make it possible to deduce what host cells S. ne-gevensis grows in naturally, both by intron homology and by areversion of the S. negevensis phenotype to rapid growth in thathost.

Conclusions. SnLSU z 1 is the first group I intron to be foundin bacterial rDNA and the only group I intron that is notnaturally spliced out of the rRNA. EndA, which is encoded bySnLSU z 1 and which may be a functional endonuclease, alsoencodes the 39 splicing apparatus of the intron. EndA is closelyrelated to endonucleases expressed by group I introns in chlo-roplasts and mitochondria. Because Simkania is an obligateintracellular bacterium, S. negevensis ZT may have acquired therDNA intron by horizontal transfer within the eukaryotic en-vironment. Interorganellar genetic transfer of SnLSU z 1 couldoccur among chlamydiae, chloroplasts, mitochondria, or otherendosymbionts in amoebae. Such horizontal transfer would beconsistent with the recent discovery of a rich mosaic of bacte-rial, chloroplast, plant, and other eukaryotic gene homologs inC. trachomatis, a relative of S. negevensis (47). The modifiedI-CeuI target sequence in Chlamydiaceae strains suggests thatintrons may at one time have affected this lineage. C. tracho-matis, however, lacks genes for acquisition of exogenous DNA,making intron acquisition by these bacteria a dubious event(47). In comparison, the genome of Rickettsia prowazekii, amuch more distantly related obligate intracellular bacterium,does not contain plant genes or introns (4).

An alternate explanation for the presence of SnLSU z 1 in S.negevensis rDNA and, indeed, for the origin of the Chlamydia-les may be that Simkania, Chlamydia, and Parachlamydia arerelics of the dawn of eukaryotic history: their common ancestormay have participated in the ancient chimeric events that led tothe formation of the plant and animal lineages (23a). Such aproposal would be consistent with the current model for tRNAgroup I intron inheritance in cyanobacteria and other speciesof bacteria, including C. trachomatis (1, 15, 17, 43). Ancientparasitic intracellular bacteria such as chlamydiae could beviewed as vehicles that delivered packages of genetic materialto cells.

Further characterization of the presence of SnLSU z 1 in theLSU will contribute to our understanding of ribosome struc-ture and function. Experiments to mutagenize and delete alarge portion of the intron can be predicted to produce a strainof Simkania that would behave more like other chlamydiae.

ACKNOWLEDGMENTS

We thank Robin R. Gutell for folding analysis, Thomas P. Hatch forin vitro transcription-translation of the Simkania ORF, Shirley M.Halling for providing sequence analysis software and computer facili-ties, Wolfgang Baehr for constructive critique of the manuscript, andArthur A. Andersen for supporting this research.

REFERENCES

1. Altschul, S. F., T. L. Madden, A. A. Schaffer, J. Zhang, Z. Zhang, W. Miller,and D. J. Lipman. 1997. Gapped BLAST and PSI-BLAST: a new generationof protein database search programs. Nucleic Acids Res. 25:3389–3402.

2. Amann, R., N. Springer, W. Schonhuber, W. Ludwig, E. N. Schmid, K. D.Muller, and R. Michel. 1997. Obligate intracellular bacterial parasites ofancanthamoebae related to Chlamydia spp. Appl. Environ. Microbiol. 63:115–121.

3. Amann, R. I., W. Ludwig, and K. H. Scheiffer. 1995. Phylogenetic identifi-cation and in situ detection of individual microbial cells without cultivation.Microbiol. Rev. 59:143–169.

4. Andersson, S. G. E., A. Zomorodipour, J. O. Andersson, T. Sicheritz-Ponten,U. C. Alsmark, R. M. Podowski, A. K. Naslund, A. S. Eriksson, H. H.Winkler, and C. G. Kurland. 1998. The genome sequence of Rickettsiaprowazekii and the origin of mitochondria. Nature 396:133–140.

5. Belfort, M., and R. J. Roberts. 1997. Homing endonucleases: keeping thehouse in order. Nucleic Acids Res. 25:3379–3388.

6. Bell-Pedersen, D., S. Quirk, J. Clyman, and M. Belfort. 1990. Intron mobility

in phage T4 is dependent upon a distinctive class of endonucleases andindependent of DNA sequences encoding the intron core: mechanistic andevolutionary implications. Nucleic Acids Res. 18:3763–3770.

7. Biniszkiewicz, D., E. Cesnaviciene, and D. A. Shub. 1994. Self-splicing groupI intron in cyanobacterial initiator methionine tRNA: evidence for lateraltransfer of introns in bacteria. EMBO J. 13:4629–4635.

8. Birtles, R. J., T. J. Rowbotham, C. Storey, T. J. Marrie, and D. Raoult. 1997.Chlamydia-like obligate parasite of free-living amoebae. Lancet 349:925–926.

9. Bult, C. J., O. White, G. J. Olsen, L. Zhou, R. D. Fleischmann, G. G. Sutton,J. A. Blake, L. M. FitzGerald, R. A. Clayton, J. D. Gocayne, A. R. Kerlavage,B. A. Dougherty, J. F. Tomb, M. D. Adams, C. I. Reich, R. Overbeek, E. F.Kirkness, K. G. Weinstock, J. M. Merrick, A. Glodek, J. L. Scott, N. S. M.Geoghagen, and J. C. Venter. 1996. Complete genome sequence of themethanogenic archaeon, Methanococcus jannaschii. Science 273:1058–1073.

10. Burger, G., I. Plante, K. M. Lonergan, and M. W. Gray. 1995. The mito-chondrial DNA of the amoeboid protozoon, Acanthamoeba castellanii: com-plete sequence, gene content and genome organization. J. Mol. Biol. 245:522–537.

11. Caldwell, H. D., J. Kromhout, and J. Schacter. 1981. Purification and partialcharacterization of the major outer membrane protein of Chlamydia tracho-matis. Infect. Immun. 31:1161–1176.

12. Cech, T. R. 1993. Structure and mechanism of the large catalytic RNAs:group I and group II introns and ribonuclease P, p. 239–269. In R. F.Gesteland and J. F. Atkins (ed.), The RNA world. Cold Spring HarborLaboratory Press, Plainview, N.Y.

13. Cech, T. R. 1990. Self-splicing of group I introns. Annu. Rev. Biochem.59:543–568.

14. Cote, M. J., and M. Turmel. 1995. In vitro self-splicing reactions of chloro-plast and mitochondrial group-I introns in Chlamydomonas eugametos andChlamydomonas moewusii. Curr. Genet. 27:177–183.

15. Cousineau, B., and R. Cedergren. GenBank accession number U57090.16. Damberger, S. H., and R. R. Gutell. 1994. A comparative database of group

I intron structures. Nucleic Acids Res. 22:3508–3510.17. Everett, K. D. E., and A. A. Andersen. 1997. The ribosomal intergenic spacer

and domain I of the 23S rRNA gene are phylogenetic markers for Chlamydiaspp. Int. J. Syst. Bacteriol. 47:461–473.

18. Everett, K. D. E., R. M. Bush, and A. A. Andersen. 1999. Emended descrip-tion of the order Chlamydiales, proposal of Parachlamydiaceae fam. nov. andSimkaniaceae fam. nov., each containing one monotypic genus, revised tax-onomy of the family Chlamydiaceae including a new genus and five newspecies, and standards for the identification of organisms. Int. J. Syst. Bac-teriol. 49:415–440.

19. Felsenstein, J. 1985. Confidence limits on phylogenies: an approach usingthe bootstrap. Evolution 39:783–791.

20. Genetics Computer Group. 1994. Program manual for the Wisconsin pack-age, version 8. Genetics Computer Group, Madison, Wis.

21. Giovannoni, S. J., S. Turner, G. J. Olsen, S. Barns, D. J. Lane, and N. R.Pace. 1988. Evolutionary relationships among cyanobacteria and green chlo-roplasts. J. Bacteriol. 170:3584–3592.

22. Gray, M. W., B. F. Lang, R. Cedergren, G. B. Golding, C. Lemieux, D.Sankoff, M. Turmel, N. Brossard, E. Delage, T. G. Littlejohn, I. Plante, P.Rioux, D. Saint-Louis, Y. Zhu, and G. Burger. 1998. Genome structure andgene content in protist mitochondrial DNAs. Nucleic Acids Res. 26:865–878.

23. Gray, M. W., and M. N. Schnare. 1996. Evolution of rRNA gene organiza-tion. p. 49–69. In R. A. Zimmermann and A. E. Dahlberg (ed.), RibosomalRNA structure, evolution, processing, and function in protein biosynthesis.CRC Press, Boca Raton, Fla.

23a.Gupta, R. S., and G. B. Golding. 1996. The origin of the eukaryotic cell.Trends Biochem. Sci. 21:166–171.

24. Gutell, R. R. 13 March 1995, posting date. Group I intron database. [Online.]http://pundit.icmb.utexas.edu/RNA/GRPI/introns.html. [29 June 1999, lastdate accessed.]

25. Heath, P. J., K. M. Stephens, R. J. Monnat, Jr., and B. L. Stoddard. 1997.The structure of I-CreI, a group I intron-coded homing endonuclease. Nat.Struct. Biol. 4:468–476.

26. Hur, M., W. J. Geese, and R. B. Waring. 1997. Self-splicing activity of themitochondrial group-I introns from Aspergillus nidulans and related intronsfrom other species. Curr. Genet. 6:399–407.

27. Kahane, S., K. D. E. Everett, N. Kimmel, and M. G. Friedman. 1999.Simkania negevensis, strain ZT: growth, antigenic and genome characteristics.Int. J. Syst. Bacteriol. 49:815–820.

28. Kahane, S., R. Gonen, C. Sayada, J. Elion, and M. G. Friedman. 1993.Description and partial characterization of a new chlamydia-like microor-ganism. FEMS Microbiol. Lett. 109:329–334.

29. Kahane, S., D. Greenberg, M. G. Friedman, H. Haikin, and R. Dagan. 1998.High prevalence of S. negevensis, a novel Chlamydia-like bacterium, in in-fants with acute broncholitis. J. Infect. Dis. 177:1425–1427.

30. Kleman-Leyer, K., D. W. Armbruster, and C. J. Daniels. 1997. Properties ofH. volcantii tRNA intron endonuclease reveal a relationship between thearchaeal and eucaryal tRNA intron processing systems. Cell 89:839–847.

31. Klenk, H.-P, R. A. Clayton, J.-F. Tomb, O. White, K. E. Nelson, K. A.

VOL. 181, 1999 Sn LSU z 1 FROM SIMKANIA NEGEVENSIS 4739

on May 5, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

Ketchum, R. J. Dodson, M. Gwinn, E. K. Hickey, J. D. Peterson, D. L.Richardson, A. R. Kerlavage, D. E. Graham, N. C. Kryrpides, R. D. Fleisch-mann, J. Quackenbush, N. H. Lee, G. G. Sutton, S. Gill, E. F. Kirkness, B. A.Dougherty, K. McKenney, M. D. Adams, B. Loftus, S. Peterson, C. I. Reich,L. K. McNeil, J. H. Badger, A. Goldek, L. Zhou, R. Overbeek, J. D. Gocayne,J. F. Weidman, L. McDonald, T. Utterback, M. D. Cotton, T. Spriggs, P.Artiach, B. P. Kaine, S. M. Sykes, P. W. Sadow, K. P. D’Andrea, C. Bowman,C. Fujii, S. A. Garland, T. M. Mason, G. J. Olsen, C. M. Fraser, H. O. Smith,C. R. Woese, and J. C. Venter. 1997. The complete genome sequence of thehyperthermophilic, sulphate-reducing archaeon Archaeoglobus fulgidus. Na-ture 390:364–370.

32. Lang, B. F., G. Burger, C. J. O’Kelly, R. Cedergren, G. B. Golding, C.Lemieux, D. Sankoff, M. Turmel, and M. W. Gray. 1997. An ancestralmitochondrial DNA resembling a eubacterial genome in miniature. Nature387:493–497.

33. Leviev, I., S. Levieva, and R. A. Garrett. 1995. Role for the highly conservedregion of domain IV of 23S-like rRNA in subunit-subunit interactions at thepeptidyl transferase centre. Nucleic Acids Res. 23:1512–1517.

34. Lieberman, D., S. Kahane, D. Lieberman, and M. G. Friedman. 1997. Pneu-monia with serological evidence of acute infection with the chlamydia-likemicroorganism “Z.” Am. J. Respir. Crit. Care Med. 156:578–582.

35. Liu, S. L., A. Hessel, and K. E. Sanderson. 1993. Genomic mapping withI-CeuI, an intron-encoded endonuclease specific for genes for ribosomalRNA, in Salmonella spp., Escherichia coli, and other bacteria. Proc. Natl.Acad. Sci. USA 90:6874–6878.

36. Lonergan, K. M., and M. W. Gray. 1994. The ribosomal RNA gene region inAcanthamoeba castellanii mitochondrial DNA. A case of evolutionary trans-fer of introns between mitochondria and plastids? J. Mol. Biol. 239:476–499.

37. Lykke-Andersen, J., R. A. Garrett, and J. Kjems. 1997. Mapping metal ionsat the catalytic centres of two intron-encoded endonucleases. EMBO J16:3272–3281.

38. Marshall, P., and C. Lemieux. 1992. The I-CeuI endonuclease recognizes asequence of 19 base pairs and preferentially cleaves the coding strand of theChlamydomonas moewusii chloroplast large subunit rRNA gene. NucleicAcids Res. 20:6401–6407.

39. Michel, F., and E. Westhof. 1990. Modelling of the three-dimensional archi-tecture of group I catalytic introns based on comparative sequence analysis.J. Mol. Biol. 216:585–610.

40. Michel, R., B. Hauroder-Philippczyk, K.-D. Muller, and L. Weishaar. 1994.Acanthamoeba from human nasal mucosa infected with an obligate intra-cellular parasite. Eur. J. Protisol. 30:104–110.

41. Nikolcheva, T., and S. A. Woodson. 1997. Association of a group I intron with

its splice junction in 50S ribosomes: implications for intron toxicity. RNA3:1016–1027.

42. Nitta, I., Y. Kamada, H. Noda, T. Ueda, and K. Watanabe. 1998. Reconsti-tution of peptide bond formation with Escherichia coli 23S ribosomal RNAdomains. Science 281:666–669.

43. Paquin, B., S. D. Kathe, S. A. Nierzwicki-Bauer, and D. A. Shub. 1997.Origin and evolution of group I introns in cyanobacterial tRNA genes. J.Bacteriol. 179:6798–6806.

44. Raue, H. A., W. Musters, C. A. Rutgers, J. Van’t Riet, and R. J. Planta. 1990.rRNA: from structure to function, p. 217–235. In W. E. Hill, P. B. Moore, A.Dahlberg, D. Schlessinger, R. A. Garrett, and J. R. Warner (ed.), Theribosome-structure, function, and evolution. American Society for Microbi-ology, Washington, D.C.

45. Rurangirwa, F. R., P. M. Dilbeck, T. B. Crawford, T. C. McGuire, and T. F.McElwain. 1999. Analysis of the 16S rRNA gene of microorganism WSU86-1044 from an aborted bovine foetus reveals that it is a member of theorder Chlamydiales: proposal of Waddliaceae fam. nov., Waddlia chon-drophila gen. nov., sp. nov. Int. J. Syst. Bacteriol. 49:577–581.

46. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: alaboratory manual, 2nd ed. Cold Spring Harbor Press, Cold Spring Harbor,N.Y.

47. Stephens, R. S., S. Kalman, C. Lammel, J. Fan, R. Marathe, L. Aravind, W.Mitchell, L. Olinger, R. L. Tatusov, Q. Zhao, E. V. Koonin, and R. W. Davis.1998. Genome sequence of an obligate intracellular pathogen of humans:Chlamydia trachomatis. Science 282:754–759.

48. Swofford, D. L. 1993. PAUP: phylogenetic analysis using parsimony, version3.1. Illinois Natural History Survey, Champaign, Ill.

49. Turmel, M., R. R. Gutell, J.-P. Mercier, C. Otis, and C. Lemieux. 1993.Analysis of the chloroplast large subunit ribosomal RNA gene from 17Chlamydomonas taxa. J. Mol. Biol. 232:446–467.

50. Turmel, M., V. Cote, C. Otis, J.-P. Mercier, M. W. Gray, K. M. Lonergan,and C. Lemieux. 1995. Evolutionary transfer of ORF-containing group Iintrons between different subcellular compartments (chloroplast and mito-chondrion). Mol. Biol. Evol. 12:533–545.

51. Turmel, M., C. Otis, V. Cote, and C. Lemieux. 1997. Evolutionarily con-served and functionally important residues in the I-CeuI homing endonucle-ase. Nucleic Acids Res. 25:2610–2619.

52. Vuillaumier, S., B. Kaltenboeck, G. Lecointre, P. Lehn, and E. Denamur.1997. Phylogenetic analysis of cystic fibrosis transmembrane conductanceregulator gene in mammalian species argues for the development of a rabbitmodel for cystic fibrosis. Mol. Biol. Evol. 14:372–380.

53. Yonath, A., and Z. Berkovitch-Yellin. 1993. Hollows, voids, gaps and tunnelsin the ribosome. Curr. Opin. Struct. Biol. 3:175–181.

4740 EVERETT ET AL. J. BACTERIOL.

on May 5, 2021 by guest

http://jb.asm.org/

Dow

nloaded from