apoptosisinducedbythekinaseinhibitorbay43 …2 the abbreviations used are: mek, mitogen-activated...

Apoptosis Induced by the Kinase Inhibitor BAY 43-9006 inHuman Leukemia Cells Involves Down-regulation of Mcl-1through Inhibition of Translation*

Received for publication, June 16, 2005, and in revised form, August 15, 2005 Published, JBC Papers in Press, August 18, 2005, DOI 10.1074/jbc.M506551200

Mohamed Rahmani‡, Eric Maynard Davis‡, Cheryl Bauer‡, Paul Dent§, and Steven Grant‡§¶1

From the Departments of ‡Medicine, §Biochemistry, and ¶Pharmacology, Virginia Commonwealth University, School of Medicine,Richmond, Virginia 23298

BAY 43-9006 is a kinase inhibitor that induces apoptosis in avariety of tumor cells. Here we report that treatment with BAY43-9006 results in marked cytochrome c and AIF release into thecytosol, caspase-9, -8, -7, and -3 activation, and apoptosis in humanleukemia cells (U937, Jurkat, and K562). Pronounced apoptosis wasalso observed in blasts from patients with acute myeloid leukemia.These events were accompanied by ERK1/2 inactivation andcaspase-independent down-regulation of Mcl-1. Inducible expres-sion of a constitutively active MEK1 construct did not preventMcl-1 down-regulation, suggesting that this event is not related toMEK/ERK pathway inactivation. Furthermore, BAY 43-9006 didnot inducemajor changes inMcl-1mRNA levelsmonitored by real-time PCR or Mcl-1 promoter activity demonstrated by luciferasereporter assays, but it did enhance Mcl-1 down-regulation in acti-nomycin D-treated cells. Inhibition of protein synthesis by cyclo-heximide or proteasome function with MG132 and pulse-chasestudies with [35S]methionine demonstrated that BAY 43-9006 didnot diminishMcl-1 protein stability, nor did it enhanceMcl-1 ubiq-uitination, but instead markedly attenuated Mcl-1 translation inassociation with the rapid and potent dephosphorylation of theeIF4E translation initiation factor. Finally, ectopic expression ofMcl-1 in leukemic cells markedly inhibited BAY 43-9006-mediatedcytochrome c cytosolic release, caspase-9, -7, and -3 activation, aswell as cell death, indicating that Mcl-1 operates upstream of cyto-chrome c release and caspase activation. Together, these findingsdemonstrate that BAY 43-9006 mediates cell death in human leu-kemia cells, at least in part, through down-regulation of Mcl-1 viainhibition of translation.

TheRas/Raf/mitogen-activated protein kinase (MEK)2/extracellular-signal-regulated kinase (ERK) cascade plays a critical role in relayingsignals from cell surface receptors to various cytoplasmic and nuclearproteins involved in diverse biological process such as cell growth,

transformation, differentiation, and apoptosis (1). Aberrant activationof this pathway has been implicated in the development of many tumortypes, and constitutive activation of this pathway has been observed in�30% of all human cancer. The serine/threonine Raf kinase family,which consists of three proteins, C-Raf (also referred to as Raf-1), B-Raf,and A-Raf, is an essential component of this pathway (1, 2). Strikingly,B-Raf-activating mutations have been observed in �70% of malignantmelanomas (3, 4) and at lower frequencies in a number of other humancancer types, including colorectal (3, 5), ovarian, and papillary thyroidcarcinomas (3, 6, 7). Moreover, overexpression of constitutively activec-Raf is sufficient to induce transformation of NIH 3T3 cells (8).Increased Raf/MEK/ERK activity has also been observed in a variety ofleukemias, including acute myeloid leukemia (AML) and chronic mye-loid leukemia (9, 10). In addition, constitutive activation of this pathwaydiminishes apoptosis in hematopoietic cells (11) and abrogates the cyto-kine dependence of several human and murine cytokine-dependenthematopoietic cells lines (e.g. TF-1, FDC-P1, and FL5.12) (12). Con-versely, inhibition of this pathway by pharmacologic MEK inhibitorssuch as PD98059 or U0126 enhances apoptosis induction by a variety ofagents, including paclitaxel (13) UCN01 (14), STI571 (15), proteasomeinhibitors (16), and lovastatin (17). For these reasons, disrupting theRas/Raf/MEK/ERK pathway represents an attractive anticancer strat-egy, particularly in leukemia cells.BAY 43-9006, a novel bi-aryl urea, has shown promising preclinical

activity against a variety of tumor cell types and is currently undergoingphase II/III clinical evaluation (18–20). Although it was initially devel-oped as a specific inhibitor of C-Raf and B-Raf, subsequent studiesrevealed that this compound also inhibits several other important tyro-sine kinases involved in tumor progression, including vascular epider-mal growth factor receptor-2, vascular epidermal growth factor recep-tor-3, platelet-derived growth factor receptor-�, Flt3, and c-Kit (21).Interestingly, BAY 43-9006 has been shown to inhibit C-Raf and wildtype as well as mutant V600E B-Raf kinase activities in vitro and todiminish MEK/ERK activation in various tumor cell lines, includingthose harboring mutant Ras or B-Raf (21–23).Several studies have shown that myeloid cell leukemia-1 (Mcl-1), a

Bcl-2 family member, plays a pivotal role in cell survival, particularly inhematopoietic cells. For example, depletion of Mcl-1 using antisenseoligonucleotides rapidly triggers apoptosis inU937 cells (24).Moreover,inducible deletion ofMcl-1 inmice resulted in loss of early bonemarrowprogenitor populations, including hematopoietic stem cells (25). Dele-tion of Mcl-1 during early lymphocyte differentiation also increasedapoptosis and arrested development at the pro-B-cell and double-neg-ative T-cell stages. In addition, specific ablation of Mcl-1 in peripheralB- and T-cell populations resulted also in their rapid loss (26). On theother hand, selective overexpression of Mcl-1 in hematopoietic tissuesof transgenic mice promotes the survival of hematopoietic cells and

* This work was supported by Public Health Service Grants CA-63753, CA-93738,CA-100866, and CA-88906 from NCI, National Institutes of Health (NIH), GrantDK52825 from NIH, Award 6045-03 from the Leukemia and Lymphoma Society ofAmerica, Award DAMD 17-03-1-0209 from the Department of Defense, and a Trans-lational Research award from the V-foundation. The costs of publication of this articlewere defrayed in part by the payment of page charges. This article must therefore behereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely toindicate this fact.

1 To whom correspondence should be addressed: Division of Hematology/Oncology,MCV Station Box 230, VA Commonwealth University, Richmond, VA 23298. Tel.: 804-828-5211; Fax: 804-828-8079; E-mail: [email protected].

2 The abbreviations used are: MEK, mitogen-activated protein kinase/extracellular sig-nal-regulated kinase kinase; ERK, extracellular signal-regulated kinase; AML, acutemyeloid leukemia; Mcl-1, myeloid cell leukemia-1; PARP, poly(ADP-ribose) polymer-ase; z-VAD-FMK, benzyloxycarbonyl-VAD-fluoromethyl ketone; HA, hemagglutinin;JNK, c-Jun N-terminal kinase; mTOR, mammalian target of rapamycin; CA, constitu-tively active; AIF, apoptosis inducing factor; FAB, French-American-British.

THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 280, NO. 42, pp. 35217–35227, October 21, 2005© 2005 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A.

OCTOBER 21, 2005 • VOLUME 280 • NUMBER 42 JOURNAL OF BIOLOGICAL CHEMISTRY 35217

by guest on August 11, 2020

http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

enhances the outgrowth of myeloid cell lines (27). Finally, overexpres-sion of Mcl-1 protects cells from apoptosis induced by a variety ofagents, including UV, tumor necrosis factor-related apoptosis-inducingligand, etoposide, staurosporine, actinomycin D, among others (28–31). Such evidence suggests that Mcl-1 may play a critical role in thesurvival of leukemia and possibly other malignant hematopoietic cells.Interestingly, expression of Mcl-1 has been shown to be dependentupon an intactMEK/ERK pathway in both hematopoietic (32) and non-hematopoietic cells (33).Currently, the one or more mechanisms by which BAY 43-9006

induces cell death in human leukemia cells remain to be fully elucidated.Here we report that BAY 43-9006 potently induces mitochondrialinjury and apoptosis in these cells in association with a pronounced andMEK/ERK-independent reduction inMcl-1 expression.Moreover, pre-vention of BAY 43-9006-mediated Mcl-1 down-regulation by ectopicexpression of an Mcl-1 construct substantially diminishes BAY43-9006-induced mitochondrial injury and apoptosis. Finally, the pres-ent results indicate that BAY 43-9006 down-regulatesMcl-1 expressionthrough inhibition of translation, rather than through a transcriptional,post-translational, or caspase-dependent mechanism.

MATERIALS AND METHODS

Cells—The human leukemia U937, Jurkat, and K562 cells were cul-tured as previously reported (34). U937 cells stably overexpressingMcl-1 were kindly provided by Dr. Ruth Craig (Dartmouth MedicalSchool, Hanover). These cells were obtained by transfecting U937 cellswith a pCEP4-Mcl-1construct that encodes for the 40-kDa Mcl-1 pro-tein. Stable single cell clones were selected in the presence of 400 �g/mlhygromycin. Thereafter, cells from each clone were analyzed for Mcl-1expression byWestern blot. ATet-On Jurkat cell line inducibly express-ing constitutively active MEK1 under doxycycline control was previ-ously described (34).

Isolation of Patient-derived Leukemic Blasts—Leukemic blasts wereobtained with informed consent from the peripheral blood of severalpatients with acute myeloblastic leukemia (AML), FAB subtype M2.These studies have been sanctioned by the Investigational ReviewBoardof Virginia CommonwealthUniversity/Medical College of Virginia, andall patients provided informed consent. In each case, the percentage ofblasts in the peripheral blood was �70%. Blood was collected into hep-arinized syringes, diluted 1:3 with RMPI 1640 medium, and transferredas an overlayer to centrifuge tubes containing 10 ml of Ficoll-Hypaque(specific gravity, 1.077–1.081). After centrifugation at room tempera-ture for 30 min, the interface layer, containing predominantly leukemicblasts, was extracted with a sterile Pasteur pipette, suspended in RPMImedium, and washed three times. Leukemic blasts, which displayed�90% viability by trypan blue exclusion, were then diluted into RPMImedium containing 10% fetal calf serum at a concentration of 106 cells/ml, and exposed to drugs as described in the case of continuously cul-tured cell lines.

Reagents—BAY 43-9006 (Bayer, West Haven, CT) was provided byDr. John Wright, Cancer Treatment and Evaluation Program, NCI,National Institutes of Health (Bethesda, MD). It was dissolved inMe2SO, and aliquots were maintained at �80 °C. MG132 was pur-chased from Calbiochem; cycloheximide and actinomycin D were pur-chased from Sigma. SB202190 was purchased from Alexis Corp. (SanDiego, CA). Rapamycin and U0126 were purchased from Cell SignalingTechnology (Beverly,MA). The broad spectrum cell-permeable caspaseinhibitor, z-VAD-FMK was purchased from Enzyme Systems Products(Livermore, CA). All reagents were prepared and used as recommendedby their suppliers.

Assessment of Apoptosis—Apoptotic cells were routinely identified byAnnexin V-fluorescein isothiocyanate staining as previously described(35). Briefly, 105 cells were collected, washed in cold phosphate-bufferedsaline, and then resuspended in binding buffer (10 mM Hepes/NaOH,pH 7.4, 140 mM NaCl, 2.5 mM CaCl2) containing fluorescein-labeledannexin V (BD Pharmingen) and propidium iodide. Samples were incu-bated for 15 min and then analyzed by flow cytometer (BD BiosciencesFACScan).

Quantitative Real-time PCR—U937 cells were left untreated ortreated with 10 �M BAY 43-9006 for the indicated period after whichthey were lysed and total RNA was extracted using the RNeasy mini kit(Qiagen). Quantitative real-time PCR analysis was carried out on theABI Prism� 7900 SequenceDetection System (AppliedBiosystems, Fos-ter City, CA) using the TaqMan� One Step PCR Master Mix ReagentsKit (polynucleotide: 4309169) as recommended by the manufacturer.The cycling conditions were: 48 °C/30 min; 95 °C/10 min; and 40 cyclesof 95 °C/15 s and 60 °C/1 min. The cycle threshold was determined toprovide the optimal standard curve values (0.98–1.0). The probes (5�-TCAAGTGTTTAGCCACAAAGGCACCAAAAG-3�) and Mcl-1-specific primers (forward, GGGCAGGATTGTGACTCTCATT;reverse, 5�-GATGCAGCTTTCTTGGTTTATGG-3�) were designedusing the Primer Express� 2.0 version. The probes were labeled at the5�-end with 6-carboxyfluoresceine and at the 3�-end with 6-carboxytet-ramethylrhodamine. Ribosomal RNA (18 S rRNA) was used as endog-enous control. Each sample was tested in triplicate, and the Mcl-1mRNA level was normalized to that of 18 S rRNA.

Transient Transfection and Reporter Gene Assay—K562 cells weretransiently transfected using Amaxa nucleofectorTM (Koeln, Germany)as previously described (36). Constitutively active MNK1 T332D andeIF4E (wild type) were kindly provided by Dr. J. A. Cooper (FredHutchinsonCancer ResearchCenter, Seattle,WA) (37). PcDNA3.1-Mcl-1was a generous gift from Dr. R. W. Craig. Empty vector pcDNA3.1 waspurchased from Invitrogen. Reporter gene assays were carried out aspreviously described (38). Briefly, cells were cotransfected with a�203/�10-Mcl-1-pGL2 plasmid (39) in which firefly luciferase is driven bythe �203 to �10 element of the Mcl-1 gene promoter, or the pGL2-basic empty vector (Promega, Madison, WI) and pRL-TK-luc plasmidencoding for Renilla luciferase. Cells were incubated for 6 h and thentreated with BAY 43-9006 for an additional 20 h, after which the activityof firefly andRenilla luciferaseswasmeasured using theDual-Luciferasereporter assay system (Promega). Values for firefly luciferase activitywere normalized to those obtained for Renilla luciferase activity.

Immunoprecipitation and Immunoblotting—For immunoprecipita-tion, cells were lysed in buffer containing 20 mM Tris (pH 7.5), 150 mM

NaCl, 1 mM EDTA, 1 mM EGTA, antiproteases (10 �g/ml of leupeptinand aprotinin, 1 mM phenylmethylsulfonyl fluoride), and 1% TritonX-100 after which 500 �g of protein lysate was subjected to immuno-precipitation using the designated antibodies. Immunoblottingwas per-formed using the immunoprecipitates or the whole cells lysates as pre-viously described in detail (35). The primary antibodies used in thisstudy were as follows: caspase-3, Bax, caspase-7, Bcl-2, and Mcl-1 (BDPharmingen); Caspase-8 (Alexis Corp.); poly(ADP-ribose) polymerase(PARP, Biomol Research Laboratories, Plymouth Meeting, PA); Bcl-xLXIAP, total and Phospho-ERK1/2 (Thr-202/Tyr-204), ubiquitin,cleaved caspase-9, cleaved caspase-3, phospho-4EBP1 (Ser-65), phos-pho-eIF4E (Ser-209), phospho-eIF4G (Ser-1108), phospho-p90RSK(Ser-380), phospho-p70S6K (Thr-389), phospho-p38 (Thr-180/Tyr-182), and phospho-JNK1 (Thr-183/Tyr-185) (Cell Signaling Technol-ogy); eIF4G (BD Transduction Laboratories); Bim, HA, cytochrome c,AIF, total and phosphorylated Bcr-abl, eIF4E, p70S6K, myc, JNK1, and

BAY 43-9006-mediated Apoptosis Involves Mcl-1

35218 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 280 • NUMBER 42 • OCTOBER 21, 2005


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

p38 (SantaCruzBiotechnology, SantaCruz, CA); andBak and�-tubulin(Calbiochem).

Mcl-1 Protein Stability—U937 cells were washed in phosphate-buff-ered saline and cultured at a density of 5 � 106 cells, in methionine-freeRPMI for 15 min, then labeled with 100 �Ci/ml [35S]methionine (ICN,Biomedicals, Inc., Irvine, CA) for 60 min. Cells were then washed inphosphate-buffered saline and cultured in complete RPMI containingfetal bovine serum and excess of cold methionine (10 mM) and cysteine(5 mM) for the indicated periods in the presence or absence of BAY43-9006with orwithout the proteasome inhibitorMG132. At the end ofthe indicated intervals, 107 cells were collected and subsequently sub-jected to immunoprecipitation using Mcl-1 antibodies as describedabove. The immunoprecipitates were subjected to SDS-PAGE followedby autoradiography.

m7-GTP-Sepharose Chromatography—Following stimulation, cellswere lysed in lysis buffer as indicated above. 500 �g of protein lysateswas incubated with 50�l of m7-GTP-Sepharose beads (Amersham Bio-sciences) for 2 h at 4 °C after which the beads were washed three timesand boiled in Laemmli buffer for 5 min, and following centrifugation,the supernatants containing the proteins were subjected to Westernblot analysis.

Subcellular Fractionation—Leukemic cells (4� 106) were lysed usingdigitonin buffer (35), after which cytosolic and membrane fractionswere separated by centrifugation, solubilized in Laemmli buffer, andboiled for 5 min. Proteins were analyzed by Western blot to evaluatecytochrome c release into the cytosol.

Statistical Analysis—The significance of differences between exper-imental conditions was determined using the Student’s t test forunpaired observations.

RESULTS

Treatment with BAY 43-9006 Results in aMarked Induction of Mito-chondrial Injury and Apoptosis in Human Leukemia Cells—To charac-terize the effects of BAY 43-9006 inU937 cells, dose-response and time-course studies were performed (Fig. 1). As shown in Fig. 1A, exposure ofU937 cells to increasing concentrations of BAY 43-9006 for 24 hrevealed a moderate induction of apoptosis at concentration as low as 5�M as indicated by annexin V analysis. Higher concentration of BAY43-9006 resulted in more pronounced cell death (e.g. 80% at 15 �M).Virtually identical results were obtained in Jurkat lymphoid leukemiacells (Fig. 1B). Exposure of U937 cells to 10 �M BAY 43-9006 at varyingintervals resulted in induction of apoptosis that was detected as early as4 h after drug treatment. Longer exposure intervals resulted in amarkedincrease in cell death (e.g. 55 and 70% at 24 and 48 h, respectively).Essentially equivalent findings were observed when Jurkat cells wereexamined (data not shown). Furthermore, exposure to BAY 43-9006resulted in a release of cytochrome c and AIF into the cytosol (Fig. 1D)accompanied by cleavage of caspases-7, -8, -9, and -3 as well as PARP(Fig. 1E). These events were readily apparent after 8 h of treatment andbecame more pronounced after 20 h. Together, these findings indicatethat BAY 43-9006 results in a striking induction of caspase activation,mitochondrial injury, and apoptosis in human myeloid and lymphoidleukemic cells.

Exposure of U937 Cells to BAY 43-9006 Is Associated with a Decreasein ERK Phosphorylation—Dose-response studies (Fig. 2) revealed thatexposure of U937 cells to BAY 43-9006 at concentration as low as 5 �M

resulted in a discernable decrease in ERK phosphorylation as early ashalf an hour after beginning of exposure, and this decrease persisted at 4and 8 h of drug administration. Exposure to 7.5 and 10�MBAY 43-9006produced even more pronounced reductions in ERK phosphorylation.

In contrast, total levels of ERKwere unchanged. These findings confirmthat, as previously described in other cell types (21, 22) BAY 43-9006inactivates ERK in human leukemia cells.

Treatment of U937 Cells with BAY 43-9006 Results in Rapid DecreaseinMcl-1 Protein Level and Late Bcl-2, Bax, andXIAPCleavage—In viewof the critical role that Bcl-2 family proteins play in apoptosis regulation(40, 41), expression of these proteins was monitored in U937 cells fol-lowing treatment of cells with BAY 43-9006 (10 �M) for varying inter-vals (Fig. 3A). After 20 h of treatment, a decline in protein levels ofBcl-xL, Bak, Bim, as well as cleavage of Bcl-2, Bax, and XIAP weredetected, however, no major changes were observed at earlier intervals.

FIGURE 1. Treatment with BAY 43-9006 results in a striking mitochondrial damage,caspase activation, and apoptosis in human leukemia cells. U937 (A) and Jurkat (B)cells were exposed to the designated concentration of BAY 43-9006 for 24 h after whichthe percentage of apoptotic cells was determined by annexin V analysis as describedunder “Materials and Methods.” C, U937 cells were exposed to 10 �M BAY 43-9006 for thedesignated period after which apoptosis was determined as above. D, U937 cells weretreated with BAY 43-9006 for the designated period, after which mitochondria-free cyto-solic fractions were obtained as described under “Materials and Methods” and subjectedto Western blot analysis to monitor release of cytochrome c and AIF. Alternatively, wholecell lysates were obtained, and subjected to Western blot analysis to monitor expressionof procaspase-3, caspase-8, caspase-7, cleaved caspase-9 (c-casp-9), and PARP. The blotswere subsequently re-probed with anti-tubulin (Tub) antibodies to document equiva-lent loading and transfer. The results of a representative study are shown; two additionalexperiments yielded equivalent results.

FIGURE 2. Treatment with BAY 43-9006 resulted in a dose-dependent dephospho-rylation of ERK1/2. U937 cells were exposed to BAY 43-9006 for 0.5, 4, and 8 h, afterwhich protein lysates were prepared and subjected to Western blot analysis to monitorERK1/2 phosphorylation. Each lane was loaded with 20 �g of protein; the blots weresubsequently reprobed with antibody directed against tubulin to control for equal load-ing and transfer of proteins. Two additional experiments yielded similar results.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

The finding that these changes were detected after caspase activationargues against the possibility of a primary role for these phenomena inBAY 43-9006-mediated cell death. In addition, no change in Bid proteinlevel was noted. In striking contrast, levels of the anti-apoptotic proteinMcl-1 protein declined rapidly (e.g. over 2 h) following treatment withBAY 43-9006, and by 8 h expression was essentially absent (Fig. 3A).Further analysis revealed that treatment with BAY 43-9006 for 4 hresulted in the dose-dependent down-regulation of Mcl-1, whichroughly paralleled the extent of lethality (Fig. 3B). Furthermore, thepan-caspase inhibitor z-VAD-FMKwas ineffective in preventing down-regulation of Mcl-1 protein following 4 or 8 h of treatment with BAY43-9006. In contrast, late changes in expression of other Bcl-2 familymembers in cells exposed to BAY 43-9006 were clearly diminished byz-VAD-FMK (data not shown). Similar results were obtained in Jurkatcells (data not shown). Together, these findings demonstrate that BAY43-9006 induces the rapid and dose-dependent down-regulation ofMcl-1 protein through amechanism independent of caspase activation.

Treatment with BAY 43-9006 Enhances Cell Death in Bcr-abl� Cellsas Well as in Human Leukemia Blasts in Association with ERK Dephos-phorylation and Mcl-1 Down-regulation—To determine whether BAY43-9006-mediated lethality could be extended to include human Bcr-Abl� leukemia cells, parallel studies were performed in K562 cells. Asshown in Fig. 4A, 24-h exposure to BAY 43-9006 resulted in a dose-de-pendent cell death as monitored by annexin V staining assay. Apoptosiswas initially detected at BAY 43-9006 concentrations � 2.5 �M, and at10 �M, the large majority of cells was apoptotic (�75%). Time-coursestudies revealed a time-dependent cleavage of PARP that was firstdetected at 4 h of treatment and became more apparent at later expo-sure intervals (8, 16, and 24 h) (Fig. 4B). Notably, a rapid decline in ERKphosphorylation and Mcl-1 protein levels were also observed, analo-gous to results in U937 cells. In contrast, no major changes were notedin Bcr-abl expression or phosphorylation until considerably later inter-vals (e.g. 24 h) when the large majority of cells were apoptotic (Fig. 4B).Lastly, attempts were made to determine whether BAY 43-9006 also

triggered cell death in primary human leukemia blasts, or whether thisphenomenon was restricted to continuously cultured cell lines. Signifi-cantly, treatment with BAY 43-9006 resulted in amarked dose-depend-ent increase in cell death in human leukemia blasts isolated from 2

patients with AML (FAB classification M2; Fig. 4C). An increase inapoptosis at 24 hwas detected at a BAY 43-9006 concentration as low as2.5 �M (35–45%) and further increases in cell death were observed athigher concentrations. For example, at 10 �M BAY 43-9006 induced 60and 80% apoptosis in blasts from patient #1 and patient #2, respectively.Studies involving blasts from two additional patients yielded essentiallyidentical results (data not shown). These events were accompanied bypronounced PARP cleavage (Fig. 4D). Notably, a marked decrease inMcl-1 protein levels and in ERK phosphorylation was also observed inboth samples, whereas the total ERK1/2 level remained unaffected.Thus, exposure to BAY43-9006 leads to amarked increase in lethality inprimary human AML blasts in association with diminished ERK phos-phorylation and Mcl-1 down-regulation, analogous to findings in con-tinuously cultured leukemia cell lines.

Mcl-1Down-regulation by BAY 43-9006 Is Independent ofMEK/ERK,p90RSK, mTOR, and p70S6K Inactivation—Previous studies have indi-cated that interruption of the Raf/MEK/ERK pathway by the MEKinhibitor PD98059 decreases basal levels of Mcl-1 (42) and attenuatesMcl-1 protein accumulation in response to various cytokines, includingepidermal growth factor, interleukin-5, and stem cell factor (33). Con-sequently, the possibility that BAY 43-9006 down-regulates Mcl-1through inhibition of the Raf/MEK/ERK pathway appeared plausible.To test this possibility, Jurkat cells (MT6) inducibly expressing a con-stitutively active MEK1 under the control of a doxycycline-responsivepromoter was employed.Western blot analysis revealed that addition ofdoxycycline resulted in a substantial increase in expression of constitu-tively active MEK1 and phospho-ERK1/2 in both control and BAY43-9006-treated cells (Fig. 5A). However, exposure to BAY 43-9006resulted in equivalent decreases in Mcl-1 expression in the absence orthe presence of doxycycline. Similar results were obtained in two addi-tional MEK1-inducible clones and in U937 cells stably expressing con-

FIGURE 3. BAY 43-9006 caused a time- and dose-dependant but caspase-independ-ent down-regulation of Mcl-1. A, U937 cells were exposed to 10 �M BAY 43-9006 for theindicated periods after which protein lysates were prepared and subjected to Westernblot analysis as described under “Materials and Methods” using the indicated antibodies.B, U937 cells were treated with BAY 43-9006 at the designated concentration for 4 h, afterwhich cells lysates were prepared and subjected to Western blot analysis using anti-Mcl-1 antibodies. C, U937 cells were treated with 10 �M BAY 43-9006 in the presence orabsence of 25 �M z-VAD-FMK for 4 and 8 h, after which Mcl-1 protein level was monitoredby Western blot analysis. For all studies, each lane was loaded with 20 �g of protein; theblots were subsequently reprobed with antibody directed against tubulin to control forequal loading and transfer of proteins. Arrows indicate cleavage fragments (CF). Twoadditional experiments yielded similar results.

FIGURE 4. Exposure to BAY 43-9006 results in a marked increase in apoptosis inassociation with down-regulation of Mcl-1 and inactivation of ERK1/2 in K562 cellsas well as in primary human leukemia blasts. A, K562 cells were exposed to the indi-cated concentrations of BAY 43-9006 for 24 h after which the extent of apoptosis wasdetermined using annexin V staining. B, K562 cells were treated with 6 �M BAY 43-9006for the designated intervals after which cell lysates were prepared and subjected toWestern blot analysis using the indicated antibodies. C, leukemia blasts were isolated asdescribed under “Materials and Methods” from the peripheral blood of two patients withAML (FAB classification M2), exposed to the designated concentration of BAY 43-9006for 24 h, after which the extent of apoptosis was determined using annexin V analysis.Each sample was performed in duplicate, and the means � S.D. were calculated. D,alternatively, blasts were lysed after 6 h of treatment and subjected to Western blotanalysis to monitor the level of phosphorylated ERK1/2, total ERK1/2, and Mcl-1 proteins.The protein lysates were also prepared after 24 h of exposure to monitor PARP cleavageby Western blot analysis. Total ERK in these experiments also serves as control for loadingand transfer of proteins.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

stitutively active MEK1 (43) (data not shown). Effects of BAY 43-9006on p90RSK and p70S6K were also examined. As shown in Fig. 5B, atime-course study revealed that BAY 43-9006 did not have a majoreffect on p90RSK phosphorylation. Expression and phosphorylation ofp70S6K were also unperturbed by treatment with BAY 43-9006. Con-sistent with these findings, induction of constitutively active MEK1resulted in increased phosphorylation of p90RSK (Fig. 5C), whereasBAY 43-9006 continued to down-regulate Mcl-1 (Fig. 5A). In addition,pretreatment of cells with the MEK inhibitor U0126 (10 �M), whichclearly decreased ERK and p90RSK phosphorylation, resulted in only avery modest decline in Mcl-1 protein levels (Fig. 5D). Notably, treat-ment of cells with the mTOR inhibitor rapamycin (20 nM) also failed todecrease Mcl-1 protein levels despite markedly diminishing phospho-rylation of p70S6 kinase (Fig. 5E). Together, these findings argue againstthe possibility that BAY 43-9006 down-regulates Mcl-1 through inhibi-tion of Raf/MEK/ERK1/2, p90RSK, mTOR, or p70S6K.Finally, activation of the stress-activated protein kinases p38 and JNK

were examined. Consistent with previous studies (19), BAY 43-9006induced a marked decrease in p38 phosphorylation without affectingtotal protein levels. This was associated with an increase in JNK phos-phorylation (Fig. 5F). However, inhibition of p38 or JNK activation withSB202190 or SP600125, respectively, did not result in major change inMcl-1 protein levels (data not shown), arguing against the possibilitythat BAY 43-9006 down-regulates Mcl-1 through a p38- or JNK-de-pendent mechanism.

Mcl-1 Down-regulation by BAY 43-9006 Is Largely Independent ofTranscription—Mcl-1 is known to be regulated at the transcriptionallevel by a variety of transcription factors, including E2F1, CREB, and

ETS (44–46). Consequently, Mcl-1 promoter activity was monitoredusing a reporter gene assay. As shown in Fig. 6A, treatment with BAY43-9006 had no significant effect on luciferase driven by anMcl-1 pro-moter (p � 0.05). Essentially equivalent results were obtained in K562cells (data not shown). These findings argue against the possibility thatBAY 43-9006 inhibits Mcl-1 transcription. Next, Mcl-1 mRNA wasquantified using real-time PCR. Notably, treatment of U937 cells withBAY 43-9006 resulted in a very modest and transient decline in Mcl-1mRNA levels after 2 h of treatment (Fig. 6B). After 4 h of treatment,Mcl-1 mRNA returned to near basal levels. In addition, inhibition oftranscription using actinomycin D (5 �g/ml) resulted in a decrease inMcl-1 protein levels, and co-treatment with BAY 43-9006 resulted in afurther decline (Fig. 6C), suggesting an alternative, transcription-inde-pendent mechanism of Mcl-1 down-regulation by this agent. Collec-tively, these and the preceding findings are most consistent with thenotion that BAY 43-9006 down-regulates Mcl-1 protein at either thetranslational or at the post-translational level.

BAY 43-9006 Down-regulates Mcl-1 through Inhibition ofTranslation—Because Mcl-1 protein has a short half-life and is knownto be degraded by the proteasome system (47, 48), we first investigatedwhether Mcl-1 ubiquitination was modified by treatment with BAY43-9006. Immunoprecipitation followed by Western blot analysis (Fig.7A) revealed nomajor changes inMcl-1 ubiquitination in BAY43-9006-

FIGURE 5. Mcl-1 down-regulation by BAY 43-9006 is independent of MEK/ERK,p90RSK, mTOR, and p70S6K inactivation. A and C, Jurkat cells (MT6) inducibly express-ing constitutively active HA-tagged MEK1 were left untreated or treated for 24 h with 2�g/ml doxycycline and then exposed to 10 �M BAY 43-9006 for an additional 4 h. Cellswere then analyzed for HA-MEK1, phospho-ERK1/2, phospho-p90RSK, and Mcl-1 expres-sion by Western blot. B, D, E, and F, U937 cells were treated with 10 �M BAY 43-9006 (B andF), U0126 (D), or 20 nM rapamycin (E) for the designated intervals after which proteinlysates were prepared and subjected to Western blot using indicated antibodies. Foreach experiment, at least two additional studies yielded equivalent results.

FIGURE 6. BAY 43-9006 does not substantially diminish Mcl-1 mRNA levels or Mcl-1promoter activity. A, Jurkat cells were cotransfected with (�203/�10-Mcl-1-pGL2) orpGL2-Basic and pRL-TK-luc plasmids. Cells were incubated for 6 h and then treated withBAY 43-9006 for an additional 20 h after which activity of firefly and Renilla luciferase wasmonitored as described under “Materials and Methods.” Values for firefly luciferase activ-ity were normalized to those obtained for Renilla luciferase activity, after which valuesobtained for (�203/�10-Mcl-1-pGL2) transfected cells were divided by the correspond-ing values obtained for pGL2-Basic transfected cells. The graph shown represents theaverage of four experiments performed in triplicate � S.D. *, not significantly differentfrom values for the control (p � 0.05). B, U937 cells were treated with BAY 43-9006 at thedesignated intervals, after which total RNA were isolated and Mcl-1 mRNA were quanti-fied using real-time PCR as described under “Materials and Methods.” Values representthe means � S.D. for three separate experiments performed in triplicate and areexpressed as a -fold increase relative to the non-treated cells. C, U937 cells were treatedwith 5 �g/ml actinomycin D (Act D) in the presence or absence of BAY 43-9006 (10 �M) for2 and 4 h, after which cells lysates were prepared and subjected to Western blot analysisto monitor Mcl-1 protein level. Each lane was loaded with 20 �g of protein; blots weresubsequently reprobed with antibodies directed against tubulin to control for equalloading and transfer of proteins; two additional experiments yielded similar results.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

treated U937 cells after 30 min, 1 h, or 4 h, whereas the total level ofMcl-1 protein displayed a progressive decline. In contrast, 1�MMG132resulted in a profound increase in Mcl-1 ubiquitination. These findingssuggest, albeit indirectly, that Mcl-1 degradation by the proteasomesystem may not be enhanced by BAY 43-9006. To test in a more directway whether BAY 43-9006 decreases Mcl-1 stability, we hypothesizedthat if this were the case, then BAY 43-9006 should accelerate Mcl-1elimination under conditions in which translation is blocked by a pro-tein synthesis inhibitor such as cycloheximide. As shown in Fig. 7B,although cycloheximide by itself reducedMcl-1 protein levels, therewasno discernible effect on the rate or extent of Mcl-1 down-regulationfollowing the addition of BAY 43-9006. In contrast, cycloheximide,either alone or in combination with BAY 43-9006, had no effect ontubulin protein levels. Consistent with these findings, the stability ofMcl-1 protein in cells prelabeled with [35S]methionine was not dimin-ished following treatment with BAY 43-9006 (Fig. 7C). More impor-tantly, and consistent with previous studies, including ours (47, 48),blockade of proteasome system by 1 �M MG132 resulted in a time-de-pendent accumulation of Mcl-1. However, this phenomenon was com-pletely abrogated by concomitant addition of 10 �M BAY 43-9006 (Fig.8A). Furthermore, consistent with blockade of Mcl-1 protein synthesisby BAY 43-9006, 1 �M MG132 was unable to prevent Mcl-1 down-regulation in U937 cells pretreated for 30 min with BAY 43-9006 (Fig.8B). In addition, measurement of protein synthesis by [35S]methionineincorporation (Fig. 8C) revealed that BAY 43-9006 inhibitedMcl-1 pro-tein synthesis in a dose-dependent manner, whereas no major changeswere observed in protein synthesis of the housekeeping genes hsp90 andtubulin.

Finally, the effects of BAY 43-9006 on Mcl-1 protein synthesis wereexamined under conditions in which proteasome function was inhib-ited by MG132. These studies yielded several findings. First, BAY43-9006 markedly decreased the extent of [35S]methionine incorpora-tion into Mcl-1 in the presence of MG132, arguing against the possibil-ity that proteasomal degradation was responsible for diminishedmethi-onine uptake (Fig. 8D). Moreover, in the absence of MG132, BAY43-9006 largely down-regulated total Mcl-1 levels, whereas MG132resulted in a clear increase, presumably by opposing proteasomal deg-radation. However, co-administration of BAY 43-9006 and MG132resulted in no change in total Mcl-1 levels, consistent with the conceptsthat (a) BAY 43-9006 blocks MG132-mediated Mcl-1 accumulation bypreventing new synthesis and (b) MG132 opposes BAY 43-9006-medi-ated Mcl-1 down-regulation by preventing degradation of already syn-thesized Mcl-1. Together, these findings argue strongly that BAY43-9006-mediated Mcl-1 down-regulation stems from a blockade ofprotein synthesis rather than diminishedMcl-1 protein stability. Takenin conjunction with the observation that BAY 43-9006 exerted minimaleffects on Mcl-1 promoter activity and mRNA levels, these findingsindicate that this compound primarily inhibits Mcl-1 translation.

Treatment with BAY 43-9006 Results in Striking Dephosphorylationof the eIF4E Protein—Protein synthesis is primarily controlled at theinitiation phase inwhich assembly of eIF4F represents a critical step (49,50). To investigate further mechanisms by which BAY 43-9006 mightinhibit Mcl-1 translation, we examined the status of the initiation com-plex eIF4F, which consists of eIF4E (a mRNA cap-binding protein),eIF4G (a scaffolding protein), and eIF4A (an ATP-dependent RNAheli-case). As shown in Fig. 9A, treatment with BAY 43-9006 resulted in arapid and striking suppression of eIF4E protein phosphorylation, whichpersisted over the entire treatment interval. On the other hand, levels oftotal eIF4E protein remained unchanged following BAY 43-9006 treat-ment. In contrast to eIF4E, levels of both total and phosphorylatedeIF4G were increased following treatment with BAY 43-9006, whereasphosphorylation of the eIF4E-binding protein 1 exhibited no majorchanges over the initial 4 h of treatment, although phosphorylationdeclined slightly at later intervals.To test whether BAY 43-9006 has an effect on the eIF4F assembly and

cap structure recognition process, eIF4E and associated factors wereisolated with m7-GTP-Sepharose and subjected to Western blot analy-sis. As shown in Fig. 9B, BAY 43-9006 did not affect the ability of eIF4Eto recognizem7-GTP,whichmimics themRNAcap structure, nor did itmodify eIF4E and eIF4G binding. This observation is in agreement withprevious studies demonstrating that eIF4E dephosphorylation does notdiminish its ability to recognize the mRNA cap structure (51).It has been shown recently that phosphorylation of eIF4E enhances

the expression of cyclin D1 by potentiating cyclin D1 mRNA nucleocy-toplasmic transport (52). Consequently, attempts were made to deter-mine whether dephosphorylation of eIF4E might be involved in Mcl-1down-regulation. As shown in Fig. 9C, transfection of K562 cells withconstitutively active MNK1 (CA-MNK1), an eIF4E kinase, alone ortogether with eIF4E resulted in a pronounced increase in phosphoryl-ated eIF4E protein levels. Interestingly, treatment with BAY 43-9006potently inhibited eIF4E phosphorylation in cells in which phosphoryl-ation of eIF4E was enforced by ectopic expression of CA-MNK1 and/oreIF4E. Notably, induction of constitutively active MEK1 failed to pre-vent BAY 43-9006mediated eIF4E dephosphorylation (Fig. 9D). Finally,BAY 43-9006 continued to suppress eIF4E phosphorylation in the pres-ence of the phosphatase inhibitor okadaic acid (data not shown), argu-ing against the possibility that BAY 43-9006 accelerates eIF4E dephos-phorylation by activating PP2A, a protein phosphatase that has been

FIGURE 7. Treatment with BAY 43-9006 does not decrease Mcl-1 protein stability inU937 cells. A, U937 cells were treated with 10 �M BAY 43-9006 for the designated peri-ods after which cells were lysed and subjected to immunoprecipitation using anti-Mcl-1antibodies. The immunoprecipitates were then subjected to Western blot analysis usinganti-ubiquitin or Mcl-1 antibodies. B, U937 cells were pretreated with 10 �g/ml cyclohex-imide (CHX) for 30 min then exposed to 10 �M BAY 43-9006 for the designated periods, afterwhich protein lysates were prepared and subjected to Western blot analysis to monitor Mcl-1protein level. C, U937 cells were labeled with [35S]methionine as described in detail under“Materials and Methods” and chased for the designated periods in the presence or absenceof BAY 43-9006. At the end of the indicated intervals, cells were lysed and Mcl-1 protein wasimmunoprecipitated using Mcl-1 antibodies. The immunoprecipitates were subjected toSDS-PAGE followed by autoradiography. Alternatively, the immunoprecipitates were sub-jected to Western blot analysis using Mcl-1 antibodies. For each experiment, the blots shownare representative of three separate experiments.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

implicated in eIF4E dephosphorylation (53). Together these observa-tions suggest that BAY 43-9006 potently suppresses eIF4E phosphoryl-ation through aMEK/ERK-independent mechanism, and raise the pos-sibility that this phenomenon may be involved in inhibition of Mcl-1translation. Whether BAY 43-9006 directly inhibits the activity ofMNK1 or other unknown eIF4E kinases remains to be determined.

Enforced Expression of Mcl-1 Substantially Blocks BAY 43-9006-me-diated Mitochondrial Injury, Caspase Activation, and Apoptosis inHuman Leukemia Cells—To determine whether down-regulation ofMcl-1 protein plays a functional role in BAY 43-9006-induced apopto-sis, U937 cells were stably transfected with an Mcl-1 construct. Twoseparate clones, Mcl-14 and Mcl-16, which displayed 2- to 3-fold

FIGURE 8. Treatment with BAY 43-9006 inhibits Mcl-1 translation in U937 cells. A, U937 cells were exposed to 1 �M MG132 in the presence or absence of 10 �M BAY 43-9006 forthe designated periods, after which protein lysates were prepared and subjected to Western blot analysis to monitor Mcl-1 protein level. B, U937 cells were exposed to 1 �M MG132alone, MG132, and BAY 43-9006 (Bay) added simultaneously or treated for 30 min with BAY 43-9006 before adding MG132. After 4 h of treatment, cells were lysed, and Western blotperformed as above. In all cases, lanes were loaded with 20 �g of protein, and the blots were reprobed with anti-tubulin antibodies to ensure equivalent loading and transfer. C, U937cells were treated with the designated concentrations of BAY 43-9006 for 1 h, then radiolabeled with [35S]methionine for 2 h. At the end of the indicated intervals cells were lysed andMcl-1, tubulin, and hsp90 proteins were immunoprecipitated. The immunoprecipitates were subjected to SDS-PAGE followed by autoradiography. D, U937 cells were treated with 10�M BAY 43-9006 and 1 �M MG132 individually or in combination for 2 h, and then pulsed with [35S]methionine for an additional 2 h. The cells were subsequently lysed, and proteinlysates were subjected to immunoprecipitation using Mcl-1 antibodies followed by electrophoresis and autoradiography. Alternatively the immunoprecipitates were subjected toWestern blot analysis using Mcl-1 antibodies. The blots shown are representative of three separate experiments.

FIGURE 9. Exposure to BAY 43-9006 is associated with the potent dephosphorylation of the eIF4E translation initiation factor. A, U937 cells were exposed to 10 �M BAY43-9006 for the indicated periods after which protein lysates were prepared and subjected to Western blot analysis using the indicated antibodies (CF � cleavage fragment). B, U937cells were treated with 10 �M BAY 43-9006 for 2 or 4 h after which eIF4E was pulled down using m7-GTP-Sepharose column as described under “Materials and Methods,” and subjectedto Western blot analysis using eIF4E and eIF4G antibodies. C, K562 cells were transiently transfected with pSR� empty vector, HA-eIF4E, or myc-CA-MNK1 plasmids, cultured for 20 h,and then treated with 6 �M BAY 43-9006 for 4 h, after which protein lysates were prepared and subjected to Western blot analysis using designated antibodies. D, Jurkat cells induciblyexpressing constitutively active MEK1 were left untreated or treated for 24 h with 2 �g/ml doxycycline and then exposed to 10 �M BAY 43-9006 for an additional 4 h, after which cellswere lysed and a Western blot was performed to monitor phospho-eIF4E levels. The blots were subsequently reprobed with antibody directed against �-tubulin to control for equalloading and transfer of proteins. The blots shown are representative of three separate experiments.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

increases in Mcl-1 protein levels compared with empty vector controlcells (pCEP4, Fig. 10A), were employed. Significantly, apoptosis moni-tored after 24- and 48-h exposure to 10 �M BAY 43-9006 was substan-tially attenuated in both Mcl-14 and Mcl-16 cells compared with theirempty vector counterpart (pCEP4) (p 0.001 in each case; Fig. 10B).Western blot analysis revealed that, although BAY 43-9006 reducedprotein levels of Mcl-1 in both clones, as one would expect of an inhib-itor of translation, Mcl-1 expression in treated mutant cells was com-parable to that of untreated empty vector cells (Fig. 10C).To investigatewhetherMcl-1 down-regulation also plays a functional

role in BAY 43-9006-mediated lethality in Bcr-abl� cells, transient andstable transfection approaches were employed. First, K562 cells weretransiently transfected with an Mcl-1 construct. As shown in Fig. 10D,cells transfected with Mcl-1 construct displayed a robust increase inMcl-1 protein level compared with controls transfected with the emptyvector (pcDNA3.1). Analogous to results obtained in U937 cells, expo-sure to BAY 43-9006 resulted in a marked decrease in Mcl-1 proteinlevel in empty vector cells; however, levels of Mcl-1 in Mcl-1-trans-fected cells remained higher than those of untreated empty vector con-trols. Notably, a significant reduction in BAY 43-9006-mediated lethal-ity was observed in Mcl-1-transfected cells (Fig. 10E, p 0.02). Parallelstudies were carried out in K562 cells stably transfected with an Mcl-1construct, and virtually identical protection from BAY 43-9006-medi-ated lethality was noted (data not shown). Finally, an attempt was madeto investigate whether Mcl-1 overexpression prevents BAY 43-9006-mediated mitochondrial injury and caspase activation. As shown in Fig.10F, release of cytochrome c into the cytosol was completely abrogated

in Mcl-1-overexpressing U937 cells. In addition, exposure to BAY43-9006 for 8, 16, and 24 h failed to promote caspase-9 cleavage andresulted only in minimal cleavage of caspase-3 and -7, and PARP deg-radation in these cells (Fig. 10G). In contrast, pronounced cytochrome crelease, and marked cleavage of caspase-7, -9, and -3 as well as PARPdegradationwere observed in empty vector controls (pCEP4). Together,these findings support the notion that elimination of Mcl-1 is requiredfor BAY 43-9006 to promote mitochondrial injury, caspase activation,and apoptosis in human leukemia cells.

DISCUSSION

The results of the present study indicate that treatment with BAY43-9006, an agent currently undergoing phase II/III clinical evaluation(18–20), results in a striking increase in mitochondrial injury, caspaseactivation, and apoptosis in human leukemia cells, events that are asso-ciated with inactivation of the MEK/ERK pathway. Furthermore, thisagent was effective in inducing cell death inmultiple leukemia cell lines,including those expressing the Bcr-abl oncogene, as well as in primaryAML blasts. Notably, the present studies demonstrate that treatment ofsuch cells with BAY 43-9006 results in a marked decrease in Mcl-1protein levels through inhibition of translation and that this event playsan important functional role in BAY 43-9006-mediated lethality.In view of extensive evidence that Mcl-1 plays a critical role in the

survival of malignant hematopoietic cells, including leukemia andmyeloma cells (24, 25), the development of compounds that diminishMcl-1 protein levels has been the focus of intense interest. Indeed, anumber of studies have documented down-regulation of Mcl-1 protein

FIGURE 10. Enforced expression of Mcl-1 blocks BAY 43-9006-mediated apoptosis in U937 cells. A, protein lysates were prepared from two clones (Mcl-14 and Mcl-16) of U937cells ectopically expressing Mcl-1 or an empty vector (pCEP4), and subjected to Western blot analysis using Mcl-1 antibody. B, Mcl-14, Mcl-16, and the empty vector pCEP4 cells wereexposed to 10 �M BAY 43-9006 for 24 and 48 h, after which the extent of apoptosis was determined using annexin V staining assay. Values represent the means for three separateexperiments � S.D. *, significantly lower than values for empty vector pCEP4 cells (p 0.001 in each case). Alternatively, total cells lysates (C) were prepared after 4 h of treatment andsubjected to Western blot analysis to monitor Mcl-1 protein level. D, K562 cells were transiently transfected with pcDNA3.1 or pcDNA3.1-Mcl-1 plasmids, cultured for 20 h, thentreated with 6 �M BAY 43-9006 for 4 and 8 h, after which protein lysate were prepared and subjected to Western blot analysis using Mcl-1 antibody as above. The blots weresubsequently reprobed with antibodies directed against �-tubulin to control for equal loading and transfer of proteins. The blots shown are representative of three separateexperiments. Annexin V staining was also performed at 24 h of treatment to determine the extent of cell death (E). Values represent the means for three separate experiments � S.D.*, significantly lower than values for empty vector pcDNA3.1 cells (p 0.001). F and G, Mcl-14, Mcl-16, and pCEP4 cells were exposed to 10 �M BAY 43-9006 for 24 h (F) or thedesignated intervals (G), after which cytosolic fractions (F) or total cell lysates (G) were prepared and subjected to Western blot analysis. Each lane was loaded with 20 �g of protein.Blots were subsequently reprobed with antibody directed against tubulin to control for equal loading and transfer of proteins. Two additional experiments yielded similar results.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

during apoptosis induced by a variety of agents, including, UV, �-irra-diation, etoposide, staurosporine, STI-571, and growth factor with-drawal (28, 31, 54, 55) among others. Interestingly, several cyclin-de-pendent kinase inhibitors, such as flavopiridol and roscovitine, alsodown-regulate Mcl-1 expression in leukemia and myeloma cells (56,57). This phenomenonmay reflect the capacity of these agents to inhibitRNA polymerase II, and thus to act as transcriptional repressors (56,58). The present results reveal that BAY 43-9006 induces a rapid andsharp decline in Mcl-1 protein levels. A critical question then arisesregarding the mechanism by which Mcl-1 down-regulation occurs. Inthis regard, Mcl-1 protein levels are known to be regulated throughseveral different mechanisms, including those operating at the tran-scriptional, translational, and post-translational levels.It has been shown thatMcl-1, like other Bcl-2 familymembers, can be

the target of degradation by caspase-3 (29, 59). However, the findings,that decreases in Mcl-1 protein levels substantially preceded activationof caspases and that Mcl-1 down-regulation was not attenuated bycaspase inhibition, argue strongly against this possibility. It has also beenreported that interruption of theMEK/ERK pathway by pharmacologicMEK inhibitors (e.g. PD98059) diminish Mcl-1 basal levels (42) andattenuate Mcl-1 protein accumulation in response to various cytokines(32, 33). Consequently, the possibility that BAY 43-9006 down-regu-lates Mcl-1 protein levels through MEK/ERK inactivation appearedplausible. However, the inability of enforced activation of MEK/ERK toprevent Mcl-1 down-regulation suggests that BAY 43-9006 down-reg-ulates Mcl-1 protein levels through aMEK/ERK-independent pathway.Several studies have implicated diverse transcriptional factors in the

control of Mcl-1 gene expression. For example, E2F1 binds to andrepresses Mcl-1 promoter activity (46). It has also been reported thatactivation of Mcl-1 gene transcription in response to interleukin-3 ismediated through CREB and ETS transcription factors (44, 45). In thepresent study, using real-time PCR,we found that BAY43-9006 failed todecrease substantiallyMcl-1mRNA levels. Furthermore, results of acti-nomycin D studies, in which BAY 43-9006 decreased Mcl-1 expressiondespite inhibition of transcription, as well as luciferase gene reporterassays, were most compatible with transcription-independent effects.Collectively, these findings argue against the possibility that BAY43-9006 down-regulates Mcl-1 protein through promoter activityrepression or mRNA destabilization.Another major mechanism by which Mcl-1 protein level can be reg-

ulated is degradation by the proteasome system (28, 47, 48). Consistentwith these findings, pharmacologic inhibition of the proteasome func-tion byMG132 resulted in markedMcl-1 protein accumulation. Signif-icantly, however, MG132 failed to induce Mcl-1 accumulation in thepresence of BAY 43-9006. Moreover, MG132 was unable to preventdown-regulation of Mcl-1 in U937 cells when these cells were pre-treated with BAY 43-9006. Notably, treatment with BAY 43-9006 didnot accelerate the clearance of Mcl-1 protein after inhibition of proteinsynthesis by cycloheximide, nor did BAY 43-9006 enhance the degra-dation/loss of pre-existing Mcl-1 protein in cells pre-labeled with[35S]methionine, suggesting that BAY 43-9006 does not affect the sta-bility of already synthesized Mcl-1. Consistent with this notion, BAY43-9006 prevented the accumulation of Mcl-1 in cells exposed to theproteasome inhibitor MG132, presumably by blocking new synthesis.Thus, in cells co-exposed to BAY 43-9006 and MG132, the effects ofconcomitant inhibition of protein synthesis and proteasomal degrada-tion effectively counteracted each other, resulting in no change in totalprotein levels. Collectively, these findings argue strongly against thepossibility that BAY 43-9006 acts at the post-translational level todiminish Mcl-1 protein stability. This interpretation is also consistent

with the failure of BAY 43-9006 to significantly enhanceMcl-1 ubiquiti-nation, a phenomenon that precedes degradation by the proteasomesystem (54).Having ruled out a significant role for alteredMcl-1 transcription, the

stability of mRNA, or the stability of the protein, the major remainingpossibility is that translation of Mcl-1 must decrease in cells exposed toBAY 43-9006. Indeed, as noted above, assessment of protein synthesisrevealed amarked inhibition ofMcl-1 translation following exposure toBAY 43-9006. Diminished Mcl-1 translation has been implicated inMcl-1 down-regulation in several systems, includingHeLa cells exposedto UV (28) and Jurkat cells exposed to salicylate (54), although the pre-cise mechanism underlying these actions remains to be elucidated. Ingeneral, translation is primarily regulated at the initiation phase, a mul-tistep process orchestrated by a several initiation factors. Translation ofmost of mRNAs is dependent upon the cap structure m7-GTP which isfound at the 5� terminus of all cellular eukaryoticmRNAs. The initiationcomplex eIF4F, a heterotrimeric protein composed of eIF4E, eIF4G, andeIF4A, plays a critical role in the translation of thesemRNAs. eIF4E, alsoknown as the cap-binding protein, represents the rate-limitingmemberof the eIF4F complex and binds directly to the 5�-terminal m7-GTP cap,resulting in recruitmentof ribosomes to the5�-endofmRNAtranscripts. Inaddition, emerging evidence indicates that eIF4E is an important targetof translation regulation through several functional post-translationalmodifications, including phosphorylation and ubiquitination (61, 62).Increased expression of eIF4E has been observed in various human can-cer cells (63) and is associated with increased translation of severalmRNAs, including Bcl-xL, ornithine decarboxylase, and c-myc, amongothers (64). Although the role of eIF4E phosphorylation in translationinitiation is incompletely understood, it has recently been shown toenhance expression of cyclin D1 by increasing mRNA nucleocytoplas-mic transport (65), suggesting that, for at least some mRNAs, eIF4Ephosphorylation promotes translation. In this context, it is noteworthythat BAY 43-9006 rapidly and potently suppressed phosphorylation ofeIF4E, although no apparent effect on eIF4F assembly or m7-GTP affin-ity could be detected. A clearer characterization of the functional role ofeIF4E dephosphorylation in disruption of Mcl-1 translation by BAY43-9006, as well as the possible participation of additional translationinitiation factors (e.g. eIF2�), await further study.

The control of translation has also been linked to various signal trans-duction cascades. For example, eIF4E is known to be phosphorylated byMAP kinase-interacting kinases MNK1 and MNK2, factors that liedownstream of MEK/ERK1–2 and p38 MAP kinases (37, 66). Interest-ingly, enforced expression of constitutively active MEK1 or MNK1failed to prevent BAY 43-9006-mediated suppression of eIF4E phos-phorylation. Significantly, enforced activation of these kinases alsofailed to block BAY 43-9006-inducedMcl-1 down-regulation. Althoughthe mechanism by which BAY 43-9006 suppresses eIF4E phosphoryla-tion and the functional role of this phenomenon in Mcl-1 down-regu-lation remain to be determined, these data suggest that in addition to itswell characterized role in Raf/MEK/ERK inhibition, BAY 43-9006 mayalso modify translation initiation factors independently of its effects onthis signaling cascade to disrupt Mcl-1 translation. It should be notedthat such translation initiation factors are not selective for Mcl-1 trans-lation. However, because the half-lives of Mcl-1 mRNA and protein arerelatively short (e.g. 2.5 h and 30min, respectively) (67, 68), interferencewith Mcl-1 synthesis is likely to have a major effect on protein levels.Finally, other signaling cascades (e.g. p90RSK, mTOR, and p70S6K),including those related to stress responses (e.g. p38), have been linked tothe regulation of protein synthesis (69–71). However, the data pre-sented here argue that these factors are unlikely to be primarily involved




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

in BAY 43-9006 mediated Mcl-1 down-regulation. Nevertheless, thepossibility that other stress-related pathways (e.g.PKR-like endoplasmicreticulum kinase) may be implicated in the inhibition of Mcl-1 transla-tion by BAY 43-9006 cannot be completely excluded, and such path-ways are currently the subject of ongoing investigation.It is significant that enforced expression of Mcl-1 markedly dimin-

ished BAY 43-9006-mediated lethality in both U937 and K562 cells,arguing that down-regulation of this protein played a critical functionalrole in BAY 43-9006 lethality. In accord with this notion, Mcl-1 overex-pression largely inhibited caspase activation and release of cytochromec into the cytosol. These findings are consistent with the studiesdescribed by Nijhawan et al. (28), who demonstrated that Mcl-1 oper-ates upstream of Bax and Bcl-xL translocation to the mitochondria,cytochrome c release, and caspase activation in UV-treated HeLa cells.Interestingly, in this study, a decline in Mcl-1 protein was not sufficientby itself to induce apoptosis, suggesting that one or more additionalperturbations are involved in lethality. Similar results have beenobserved in Jurkat cells (54). However, other studies have demonstratedthat down-regulation of Mcl-1 through the use of antisense oligonu-cleotides or small interference RNA is sufficient to induce apoptosis inU937 (24) and myeloma cells (30, 72, 60). In the present study, it shouldbe noted that Mcl-1 overexpression did not completely block BAY43-9006-induced lethality. Consequently, the possibility that other BAY43-9006-mediated actions contribute to induction of apoptosis cannotbe completely excluded. In summary, the present findings indicate thatthe Raf inhibitor BAY 43-9006 effectively induces cell death in Bcr/Abl�

or Bcr/Abl� human leukemia cells, as well as in primary AML blasts.Furthermore, these events occur in association with the rapid down-regulation of Mcl-1 primarily through inhibition of translation, ratherthan through a transcriptional or post-translational mechanism. More-over, this phenomenon is associated with the rapid and potent dephos-phorylation of the eIF4E translation initiation factor, which has beenimplicated in protein synthesis regulation. Significantly, enforcedexpression of Mcl-1 was able to block cytochrome c release, caspaseactivation, and apoptosis in U937 and K562 cells exposed to BAY43-9006, arguing that down-regulation of this anti-apoptotic proteinplays a critical functional role in the lethality of this agent. Althoughprevious studies have focused on the inhibitory effects of BAY 43-9006on the Raf/MEK/ERK pathway as the possible basis of action of thiscompound (2), the finding that BAY 43-9006 promotes apoptosisthrough the MEK/ERK-independent inhibition of Mcl-1 translationsuggests an additional dimension to its mode of cell killing, at least inhuman leukemia cells. Further efforts to elucidate the mechanism(s) bywhich BAY 43-9006 inhibits translation of anti-apoptotic proteinMcl-1, and the possible role of disruption of translation initiation fac-tors in this process, could provide a more rational basis for developingthis compound either alone or in combination with established chemo-therapeutic agents in leukemia and potentially other hematologicmalignancies.

Acknowledgments—We thank Dr. Ruth Craig for providing the Mcl-1-overex-presing U937 cells and the pcDNA3.1-Mcl-1 plasmid, Drs. Mark Lynch(Bayer) and John Wright (Cancer Treatment and Evaluation Program, NCI,National Institutes of Health) for critical reading of the manuscript and pro-viding us with BAY 43-9006, Dr. J. A. Cooper for providing us with CA-MNK1and eIF4E constructs, andDr. Douglas Cress (H. LeeMoffitt Cancer Center) forproviding us with the (�203/�10)Mcl-1-pGL2 plasmid.

REFERENCES1. Chang, F., Steelman, L. S., Lee, J. T., Shelton, J. G., Navolanic, P. M., Blalock, W. L.,

Franklin, R. A., and McCubrey, J. A. (2003) Leukemia 17, 1263–1293

2. Sridhar, S. S., Hedley, D., and Siu, L. L. (2005)Mol. Cancer Ther. 4, 677–6853. Davies, H., Bignell, G. R., Cox, C., Stephens, P., Edkins, S., Clegg, S., Teague, J., Wof-

fendin, H., Garnett, M. J., Bottomley, W., Davis, N., Dicks, E., Ewing, R., Floyd, Y.,Gray, K., Hall, S., Hawes, R., Hughes, J., Kosmidou, V.,Menzies, A.,Mould, C., Parker,A., Stevens, C., Watt, S., Hooper, S., Wilson, R., Jayatilake, H., Gusterson, B. A.,Cooper, C., Shipley, J., Hargrave, D., Pritchard-Jones, K., Maitland, N., Chenevix-Trench, G., Riggins, G. J., Bigner, D. D., Palmieri, G., Cossu, A., Flanagan, A., Nichol-son, A., Ho, J. W., Leung, S. Y., Yuen, S. T., Weber, B. L., Seigler, H. F., Darrow, T. L.,Paterson, H.,Marais, R.,Marshall, C. J.,Wooster, R., Stratton,M. R., and Futreal, P. A.(2002) Nature 417, 949–954

4. Pollock, P. M., Harper, U. L., Hansen, K. S., Yudt, L. M., Stark, M., Robbins, C. M.,Moses, T. Y., Hostetter, G.,Wagner, U., Kakareka, J., Salem,G., Pohida, T., Heenan, P.,Duray, P., Kallioniemi, O., Hayward, N. K., Trent, J. M., andMeltzer, P. S. (2003)Nat.Gene 33, 19–20

5. Rajagopalan, H., Bardelli, A., Lengauer, C., Kinzler, K. W., Vogelstein, B., and Vel-culescu, V. E. (2002) Nature 418, 934

6. Singer, G., Oldt, R., III, Cohen, Y.,Wang, B. G., Sidransky, D., Kurman, R. J., and Shih,I. (2003) J. Natl. Cancer Inst. 95, 484–486

7. Cohen, Y., Xing, M., Mambo, E., Guo, Z., Wu, G., Trink, B., Beller, U., Westra,W. H.,Ladenson, P. W., and Sidransky, D. (2003) J. Natl. Cancer Inst. 95, 625–627

8. Kerkhoff, E., and Rapp, U. R. (1997)Mol. Cell. Biol. 17, 2576–25869. Kang, C. D., Yoo, S. D., Hwang, B.W., Kim, K.W., Kim, D.W., Kim, C.M., Kim, S. H.,

and Chung, B. S. (2000) Leuk. Res. 24, 527–53410. Okuda, K., Matulonis, U., Salgia, R., Kanakura, Y., Druker, B., and Griffin, J. D. (1994)

Exp. Hematol. 22, 1111–111711. Hoyle, P. E., Moye, P. W., Steelman, L. S., Blalock, W. L., Franklin, R. A., Pearce, M.,

Cherwinski, H., Bosch, E., McMahon, M., and McCubrey, J. A. (2000) Leukemia 14,642–656

12. Blalock, W. L., Pearce, M., Steelman, L. S., Franklin, R. A., McCarthy, S. A., Cherwin-ski, H., McMahon, M., and McCubrey, J. A. (2000) Oncogene 19, 526–536

13. Poruchynsky, M. S., Giannakakou, P., Ward, Y., Bulinski, J. C., Telford,W. G., Robey,R. W., and Fojo, T. (2001) Biochem. Pharmacol. 62, 1469–1480

14. Dai, Y., Yu, C., Singh, V., Tang, L., Wang, Z., McInistry, R., Dent, P., and Grant, S.(2001) Cancer Res. 61, 5106–5115

15. Yu, C., Krystal, G., Varticovksi, L.,McKinstry, R., Rahmani,M., Dent, P., andGrant, S.(2002) Cancer Res. 62, 188–199

16. Orlowski, R. Z., Small, G. W., and Shi, Y. Y. (2002) J. Biol. Chem. 277, 27864–2787117. Wu, J., Wong,W.W., Khosravi, F., Minden,M. D., and Penn, L. Z. (2004)Cancer Res.

64, 6461–646818. Strumberg, D., and Seeber, S. (2005) Onkologie 28, 101–10719. Ahmad, T., and Eisen, T. (2004) Clin. Cancer Res. 10, 6388S–6392S20. Kramer, B. W., Gotz, R., and Rapp, U. R. (2004) BMC Cancer 4, 2421. Wilhelm, S. M., Carter, C., Tang, L., Wilkie, D., McNabola, A., Rong, H., Chen, C.,

Zhang, X., Vincent, P., McHugh, M., Cao, Y., Shujath, J., Gawlak, S., Eveleigh, D.,Rowley, B., Liu, L., Adnane, L., Lynch, M., Auclair, D., Taylor, I., Gedrich, R.,Voznesensky, A., Riedl, B., Post, L. E., Bollag, G., andTrail, P. A. (2004)Cancer Res. 64,7099–7109

22. Karasarides,M., Chiloeches, A., Hayward, R., Niculescu-Duvaz, D., Scanlon, I., Fried-los, F., Ogilvie, L., Hedley, D., Martin, J., Marshall, C. J., Springer, C. J., and Marais, R.(2004) Oncogene 23, 6292–6298

23. Sharma, A., Trivedi, N. R., Zimmerman, M. A., Tuveson, D. A., Smith, C. D., andRobertson, G. P. (2005) Cancer Res. 65, 2412–2421

24. Moulding, D. A., Giles, R. V., Spiller, D. G., White, M. R., Tidd, D. M., and Edwards,S. W. (2000) Blood 96, 1756–1763

25. Opferman, J. T., Iwasaki, H., Ong, C. C., Suh, H., Mizuno, S., Akashi, K., and Kors-meyer, S. J. (2005) Science 307, 1101–1104

26. Opferman, J. T., Letai, A., Beard, C., Sorcinelli, M. D., Ong, C. C., and Korsmeyer, S. J.(2003) Nature 426, 671–676

27. Zhou, P., Qian, L., Bieszczad, C. K., Noelle, R., Binder,M., Levy, N. B., andCraig, R.W.(1998) Blood 92, 3226–3239

28. Nijhawan, D., Fang, M., Traer, E., Zhong, Q., Gao, W., Du, F., and Wang, X. (2003)Genes Dev. 17, 1475–1486

29. Weng, C., Li, Y., Xu, D., Shi, Y., and Tang, H. (2005) J. Biol. Chem. 280, 10491–1050030. Zhang, B., Gojo, I., and Fenton, R. G. (2002) Blood 99, 1885–189331. Zhou, P., Qian, L., Kozopas, K. M., and Craig, R. W. (1997) Blood 89, 630–64332. Huang, H. M., Huang, C. J., and Yen, J. J. (2000) Blood 96, 1764–177133. Leu, C. M., Chang, C., and Hu, C. (2000) Oncogene 19, 1665–167534. Rahmani, M., Yu, C., Reese, E., Ahmed, W., Hirsch, K., Dent, P., and Grant, S. (2003)

Oncogene 22, 6231–624235. Rahmani, M., Dai, Y., and Grant, S. (2002) Exp. Cell Res. 277, 31–4736. Dai, Y., Rahmani, M., Corey, S. J., Dent, P., and Grant, S. (2004) J. Biol. Chem. 279,

34227–3423937. Waskiewicz, A. J., Johnson, J. C., Penn, B., Mahalingam, M., Kimball, S. R., and Coo-

per, J. A. (1999)Mol. Cell. Biol. 19, 1871–188038. Rahmani, M., Reese, E., Dai, Y., Bauer, C., Kramer, L. B., Huang, M., Jove, R., Dent, P.,




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

and Grant, S. (2005)Mol. Pharmacol. 67, 1166–117639. Croxton, R., Ma, Y., and Cress, W. D. (2002) Oncogene 21, 1563–157040. Chao, D. T., and Korsmeyer, S. J. (1998) Annu. Rev. Immunol. 16, 395–41941. Gross, A., McDonnell, J. M., and Korsmeyer, S. J. (1999) Genes Dev. 13, 1899–191142. Selzer, E., Thallinger, C., Hoeller, C., Oberkleiner, P., Wacheck, V., Pehamberger, H.,

and Jansen, B. (2002)Mol. Med 8, 877–88443. Rahmani,M., Reese, E., Dai, Y., Bauer, C., Payne, S. G., Dent, P., Spiegel, S., andGrant,

S. (2005) Cancer Res. 65, 2422–243244. Wang, J. M., Lai, M. Z., and Yang-Yen, H. F. (2003)Mol. Cell. Biol. 23, 1896–190945. Wang, J. M., Chao, J. R., Chen, W., Kuo, M. L., Yen, J. J., and Yang-Yen, H. F. (1999)

Mol. Cell. Biol. 19, 6195–620646. Croxton, R., Ma, Y., Song, L., Haura, E. B., and Cress, W. D. (2002) Oncogene 21,

1359–136947. Dai, Y., Rahmani, M., and Grant, S. (2003) Oncogene 22, 7108–712248. Derouet, M., Thomas, L., Cross, A., Moots, R. J., and Edwards, S. W. (2004) J. Biol.

Chem. 279, 26915–2692149. Richter, J. D., and Sonenberg, N. (2005) Nature 433, 477–48050. Proud, C. G. (2005) Cell Death. Differ. 12, 541–54651. Knauf, U., Tschopp, C., and Gram, H. (2001)Mol. Cell. Biol. 21, 5500–551152. Topisirovic, I., Ruiz-Gutierrez, M., and Borden, K. L. (2004) Cancer Res. 64,

8639–864253. Xu, Z., and Williams, B. R. (2000)Mol. Cell. Biol. 20, 5285–529954. Iglesias-Serret, D., Pique, M., Gil, J., Pons, G., and Lopez, J. M. (2003) Arch. Biochem.

Biophys. 417, 141–15255. Aichberger, K. J., Mayerhofer, M., Krauth, M. T., Skvara, H., Florian, S., Sonneck, K.,

Akgul, C., Derdak, S., Pickl, W. F., Wacheck, V., Selzer, E., Monia, B. P., Moriggl, R.,Valent, P., and Sillaber, C. (2005) Blood 105, 3303–3311

56. Gojo, I., Zhang, B., and Fenton, R. G. (2002) Clin. Cancer Res. 8, 3527–353857. Alvi, A. J., Austen, B.,Weston, V. J., Fegan, C., Maccallum, D., Gianella-Borradori, A.,

Lane, D. P., Hubank, M., Powell, J. E., Wei, W., Taylor, A. M., Moss, P. A., and

Stankovic, T. (2005) Blood 105, 4484–449158. Chao, S. H., Fujinaga, K., Marion, J. E., Taube, R., Sausville, E. A., Senderowicz, A. M.,

Peterlin, B. M., and Price, D. H. (2000) J. Biol. Chem. 275, 28345–2834859. Han, J., Goldstein, L. A., Gastman, B. R., Froelich, C. J., Yin, X.M., and Rabinowich, H.

(2004) J. Biol. Chem. 279, 22020–2202960. Le Gouill, S., Podar, K., Amiot, M., Hideshima, T., Chauhan, D., Ishitsuka, K., Kumar,

S., Raje,N., Richardson, P.G., Harousseau, J. L., andAnderson, K. C. (2004)Blood 104,2886–2892

61. Graff, J. R., and Zimmer, S. G. (2003) Clin. Exp. Metastasis 20, 265–27362. Othumpangat, S., Kashon, M., and Joseph, P. (2005) J. Biol. Chem. 280, 25162–2516963. De Benedetti, A., and Harris, A. L. (1999) Int. J. Biochem. Cell Biol. 31, 59–7264. Mamane, Y., Petroulakis, E., Rong, L., Yoshida, K., Ler, L. W., and Sonenberg, N 23,

3172–317965. Rousseau, D., Kaspar, R., Rosenwald, I., Gehrke, L., and Sonenberg, N. (1996) Proc.

Natl. Acad. Sci. U. S. A. 93, 1065–107066. Ueda, T.,Watanabe-Fukunaga, R., Fukuyama, H., Nagata, S., and Fukunaga, R. (2004)

Mol. Cell. Biol. 24, 6539–654967. Moulding, D. A., Akgul, C., Derouet, M., White, M. R., and Edwards, S. W. (2001)

J. Leukoc. Biol. 70, 783–79268. Chao, J. R.,Wang, J.M., Lee, S. F., Peng, H.W., Lin, Y. H., Chou, C. H., Li, J. C., Huang,

H.M., Chou, C. K., Kuo,M. L., Yen, J. J., and Yang-Yen, H. F. (1998)Mol. Cell. Biol. 18,4883–4898

69. Martin, K. A., and Blenis, J. (2002) Adv. Cancer Res. 86, 1–3970. Wang, X., Li, W., Williams, M., Terada, N., Alessi, D. R., and Proud, C. G. (2001)

EMBO J. 20, 4370–437971. Hirasawa, K., Kim, A., Han, H. S., Han, J., Jun, H. S., and Yoon, J.W. (2003) J. Virol. 77,

5649–565672. Derenne, S., Monia, B., Dean, N. M., Taylor, J. K., Rapp, M. J., Harousseau, J. L.,

Bataille, R., and Amiot, M. (2002) Blood 100, 194–199




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Mohamed Rahmani, Eric Maynard Davis, Cheryl Bauer, Paul Dent and Steven GrantCells Involves Down-regulation of Mcl-1 through Inhibition of Translation

Apoptosis Induced by the Kinase Inhibitor BAY 43-9006 in Human Leukemia

doi: 10.1074/jbc.M506551200 originally published online August 18, 20052005, 280:35217-35227.J. Biol. Chem.

10.1074/jbc.M506551200Access the most updated version of this article at doi:

Alerts:

When a correction for this article is posted•

When this article is cited•

to choose from all of JBC's e-mail alertsClick here

http://www.jbc.org/content/280/42/35217.full.html#ref-list-1

This article cites 71 references, 41 of which can be accessed free at


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/lookup/doi/10.1074/jbc.M506551200

http://www.jbc.org/cgi/alerts?alertType=citedby&addAlert=cited_by&cited_by_criteria_resid=jbc;280/42/35217&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/280/42/35217

http://www.jbc.org/cgi/alerts?alertType=correction&addAlert=correction&correction_criteria_value=280/42/35217&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/280/42/35217

http://www.jbc.org/cgi/alerts/etoc

http://www.jbc.org/content/280/42/35217.full.html#ref-list-1

http://www.jbc.org/

apoptosisinducedbythekinaseinhibitorbay43 …2 the abbreviations used are: mek, mitogen-activated...

Documents