appl. environ. microbiol. doi:10.1128/aem.02547-15 copyright © … · frpsohphqwdu\ kate2 jhqh lq...

$: Appl. Environ. Microbiol. doi:10.1128/AEM.02547-15 Copyright © … · frpsohphqwdu\ kate2 jhqh lq wkh Þndw( vwudlq voljkwo\ diihfwhg lwv jurzwk hvshfldoo\ hqkdqfhg wkh jurzwk ri$
1

Function of VPA1418 and VPA0305 Catalase Genes in Growth of Vibrio 1

parahaemolyticus under Oxidative Stress 2

3

Ching-Lian Chen, Shin-yuan Fen, Chun-Hui Chung, Shu-Chuan Yu, 4

Cheng-Lun Chien, and Hin-chung Wong* 5

6

Department of Microbiology, Soochow University, Taipei, Taiwan 111, 7

Republic of China 8

9

Running title: KatE of Vibrio parahaemolyticus 10

Key words: Vibrio parahaemolyticus; catalase; mutant; oxidative stress 11

12

* Corresponding author. Mailing address: Department of Microbiology, 13

Soochow University, Taipei, Taiwan 111, Republic of China. Phone: 14

(886) 2-28819471, ext. 6852. Fax: (886) 2-28831193. E-mail: wonghc@ 15

scu.edu.tw. 16

17

Aug. 5, 2015 18

Revised: Nov. 23, 2015 19

20

AEM Accepted Manuscript Posted Online 8 January 2016Appl. Environ. Microbiol. doi:10.1128/AEM.02547-15Copyright © 2016, American Society for Microbiology. All Rights Reserved.

on June 8, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

http://aem.asm.org/

2

ABSTRACT 21

22

The marine foodborne enteropathogen, Vibrio parahaemolyticus, has 23

four putative catalase genes. The function of two katE-homologous genes, 24

katE1 (VPA1418) and katE2 (VPA0305), in the growth of this bacterium 25

was examined using gene deletion mutants with or without 26

complementary genes. The growth of the mutant strains in static or 27

shaken cultures in a rich medium at 37oC or low temperatures (12 and 28

4oC), with or without competition from Escherichia coli, did not differ 29

from that of the parent strain. When 175 μM of extrinsic H2O2 was added 30

to the culture medium, bacterial growth of the ΔkatE1 strain was delayed 31

and those of the ΔkatE1E2 and ΔkatE1-ahpC1 double mutant strains were 32

completely inhibited at 37oC for eight hours. The sensitivity of the 33

ΔkatE1 strain to the inhibition of growth by H2O2 was higher at low 34

incubation temperatures (12 and 22oC) than at 37oC. The determined gene 35

expression of these catalase and ahpC genes revealed that katE1 was 36

highly expressed in wild-type strain at 22oC under H2O2 stress, while the 37

katE2 and ahpC genes may play an alternate or compensatory role in the 38

ΔkatE1 strain. This study demonstrated that katE1 was the chief 39


.asm.org/

Dow

nloaded from

http://aem.asm.org/

3

functional catalase for detoxifying extrinsic H2O2 during logarithmic 40

growth, and the function of these genes was influenced by incubation 41

temperature. 42

43

Key words: Vibrio parahaemolyticus; catalase; mutant; oxidative stress, 44

hydrogen peroxide 45

46


.asm.org/

Dow

nloaded from

http://aem.asm.org/

4

47

Various reactive oxygen species (ROS), such as superoxide anion 48

(O2-), hydrogen peroxide (H2O2) and hydroxyl radical (.OH), are 49

generated by intrinsic metabolic activity in bacteria or induced by 50

environmental stresses (1-3). ROS are detrimental to cellular components, 51

including proteins, DNA and membrane lipids (4). 52

Most bacteria are equipped with various antioxidative enzymes for 53

scavenging ROS. Superoxide dismutase (SOD) transforms superoxide 54

anions into hydrogen peroxide, while catalase decomposes hydrogen 55

peroxide into oxygen and water. Two families of catalases, HPI (KatG) 56

and HPII (KatE), have been identified in Escherichia coli and some other 57

enteric bacteria (5). HPI, which is the family of bifunctional 58

catalases/peroxidases, is transcriptionally induced during logarithmic 59

growth in response to low concentrations of hydrogen peroxide. This 60

induction requires the positive activator OxyR, which directly senses 61

oxidative stress. HPII, the family of monofunctional catalases, is not 62

peroxide-inducible and is transcribed at the transition from exponential 63

growth to the stationary phase by the product of the rpoS gene, which is a 64

critical factor in the survival of bacteria in the stationary phase or under 65


.asm.org/

Dow

nloaded from

http://aem.asm.org/

5

other stresses (6, 7). OxyR also regulates the transcription of the alkyl 66

hydroperoxide reductase subunit C (ahpC) gene, which encodes a 67

2-cysteine peroxiredoxin for detoxifying organic peroxides (8, 9). 68

Food processing commonly imposes stresses on foodborne pathogens 69

and these stresses may account for the formation of ROS. Campylobacter 70

accumulates hydrogen peroxide under freeze-thaw treatment (10). 71

Environmental stresses lower the level of cellular SOD and catalase in 72

Vibrio parahaemolyticus, while increasing the susceptibility of this 73

pathogen to oxidative stress (11, 12). We have previously demonstrated 74

that the level of intracellular ROS is related to the survival of V. 75

parahaemolyticus under a combination of cold, starvation and low 76

salinity (13). Therefore, the functions of antioxidative factors may be 77

crucial to the persistence of these foodborne pathogens in the 78

environment. Also, extracellular ROS may be generated by other bacteria 79

or host of bacterial infection (14-16), and the presence of extracellular 80

catalase has been demonstrated in V. cholerae (17). The functions of 81

antioxidative factors may enhance the virulence of infectious bacteria in 82

human beings, establish natural symbionts in aquacultured animals (16), 83

and enable the successful growth of bacteria in the presence of 84


.asm.org/

Dow

nloaded from

http://aem.asm.org/

6

competitors. 85

V. parahaemolyticus is a halophilic Gram-negative bacterium that 86

frequently causes foodborne gastroenteritis in Taiwan and some Asian 87

countries (18), and has become a pathogen of global concern following 88

the appearance of the first pandemic O3:K6 strain in 1996 (19). In a 89

search of the genome sequence of the V. parahaemolyticus strain 90

RIMD2210633 (20), two katE- and two katG-homologous genes were 91

identified, namely, katE1 (VPA1418), katE2 (VPA0305), katG1 92

(VPA0768) and katG2 (VPA0453). VPA0768). Recently, four proteins 93

exhibiting catalase or catalase/peroxidase activity are demonstrated using 94

zymogram in V. parahaemolyticus, whereas two catalases are induced in 95

the exponential/early stationary phase (21). Unfortunately, the identities 96

of these proteins are not determined (21) and the functions of specific 97

catalase genes remain unclear. In addition to these catalase genes, 98

alkylhydroperoxide reductase subunit C gene (ahpC1) was also 99

responsive to different peroxides (22, 23). To understand the role of 100

specific catalase genes in the growth of V. parahaemolyticus under the 101

challenge of peroxides, low temperature and the presence of competitive 102

bacterium, the deletion mutants of katE1 and katE2 with and without 103


.asm.org/

Dow

nloaded from

http://aem.asm.org/

7

complementary genes were constructed and characterized. 104

105

MATERIALS AND METHODS 106

107

Bacterial strains and culture conditions. V. parahaemolyticus strain 108

KX-V231 (Kanagawa phenomenon positive, serotype O3:K6), isolated in 109

Thailand from a clinical specimen, was used in this study (Table 1). It 110

was stored frozen at -85°C in beads in Microbank cryovials (PRO-LAB 111

Diagnostics, Austin, TX, USA). It was cultured at 37°C on Tryptic Soy 112

Agar (Becton-Dickinson Diagnostic Systems, Sparks, MD, U.S.A.) that 113

was supplemented with 3% sodium chloride (TSA-3% NaCl), or in 114

Tryptic soy broth-3%NaCl (TSB-3%NaCl) in a 5 ml tube, which was 115

shaken at 160 rpm. A 50 μl aliquot of the 16 h broth culture was 116

inoculated into 5 ml of fresh TSB-3% NaCl and incubated at 37°C with 117

shaking for 2 h, to enter the exponential phase (around 108 CFU/ml) and 118

this culture was used as the inoculum in the following experiments. E. 119

coli was cultured in Luria-Bertani Broth (LB, Becton-Dickinson) at 37oC 120

and shaken at 160 rpm. Chloramphenicol (final concentration of 6 μg/ml) 121

or chloramphenicol (20 μg/ml)/ampicillin (50 μg/ml) was added to the 122


.asm.org/

Dow

nloaded from

http://aem.asm.org/

8

media as required for the cultivation of some of the V. parahaemolyticus 123

or E. coli strains, respectively. 124

125

Construction of deletion mutants. Deletion mutants of the catalase 126

genes (katE1 and katE2) were constructed following the published 127

methods (23, 24). For constructing ΔkatE2 mutant strain, two DNA 128

fragments were amplified by PCR with V. parahaemolyticus KX-V231 129

chromosomal DNA as the template – one with the primer pair 130

VPA0305-1 and VPA0305-2 and the other with the primer pair 131

VPA0305-3 and VPA0305-4 (Table 2). These two amplified fragments 132

were then used as templates for a second PCR with the primers 133

VPA0305-1 and VPA0305-4, resulting in the construction of a fragment 134

with a deletion in the VPA0305 gene. Such a fragment, that contained the 135

deletion was purified, and cloned into the pGEMT-easy vector and 136

transformed into E. coli XL1 blue, following the protocol of the 137

manufacturer (Promega Co., Madison, WI, U.S.A.). The inserted 138

sequence was verified by sequencing. This fragment was then removed 139

from the pGEMT-easy vector by digestion using SacI and SphI and 140

cloned into a suicide vector, pDS132, which contained the 141


.asm.org/

Dow

nloaded from

http://aem.asm.org/

9

chloramphenicol-resistant gene and the sacB gene, conferring sensitivity 142

to sucrose. This plasmid (pDS132-katE2-deletion) was introduced into E. 143

coli SM10-pir and then mated with V. parahaemolyticus strain KX-V231. 144

Thiosulfate-citrate-bile-sucrose (TCBS) agar that contained 145

chloramphenicol was used to screen the V. parahaemolyticus cells 146

containing the inserted plasmid. The V. parahaemolyticus clones were 147

isolated and cultured in LB broth that was supplemented with 2% NaCl 148

and chloremphenicol. DNA was extracted from these cultures and the 149

inserted sequence was detected by PCR using the VPA0305-1 and 150

VPA0305-4 primers. The culture that contained pDS132-katE2-deletion 151

plasmid was incubated at 37oC for 3 hours in the LB broth that contained 152

2% NaCl and then plated on an LB agar plate that contained 2% NaCl 153

and 10% sucrose. The colonies isolated that were unable to grow on LB 154

agar plate that contained chloremphenicol were selected, and the 155

homologous recombination of the deleted fragment was verified by PCR 156

(Table 2). Amplification of the katE2 gene with the primers VPA0305-0 157

and VPA0305-5 yielded amplicons of 3,275 bp or 1,733 bp in the 158

wild-type strain or ΔkatE2 strain, respectively. The mutated gene was also 159

verified by the nucleotide sequencing of the amplified fragments. 160


.asm.org/

Dow

nloaded from

http://aem.asm.org/

10

Following the same procedures using different primers (Table 2), the 161

ΔkatE1 strain was also constructed. The ΔkatE1E2 double mutant was 162

prepared similarly by construction of the katE2 gene deletion in strain 163

ΔkatE1, while ΔkatE1-ahpC1 was prepared similarly by construction of 164

the ahpC1 gene deletion in strain ΔkatE1. 165

Sequencing service was provided by Genomics BioSci & Tech, Inc., 166

Taipei, using Sanger’s method with Applied Biosystems 3730 analyzer. 167

168

Construction of complementary strains. The entire length of katE2 169

gene was amplified by PCR with V. parahaemolyticus KX-V231 170

chromosomal DNA as the template using primer pairs VPA0305-C1 and 171

VPA0305-C2 with restriction enzyme linkers (SalI, SphI) (Table 2). The 172

amplicon was digested with SalI and SphI, and ligated to the shuttle 173

vector pSCB01 which had been digested with the same enzymes (23). 174

The plasmid, pSCB01-katE2, containing the entire lengths of katE2 gene, 175

was propagated in E. coli SM10 λ-pir and conjugated to the 176

corresponding ΔkatE2 strain to generate gene complementation, which 177

was selected by their chloramphenicol resistance (Table 1). The presence 178

of entire length of katE2 gene in these strains was verified by PCR. 179


.asm.org/

Dow

nloaded from

http://aem.asm.org/

11

Following the same procedures, the complementation of katE1 gene in 180

the ΔkatE1 strain was also constructed (Table 1). 181

182

Effects of peroxides on bacterial growth. The V. parahaemolyticus 183

cultures in the exponential phase (200 μl) were dispensed into the wells 184

of a microtiter plate, to which various concentrations of H2O2 (Santoku 185

Chemical Industries, Tokyo, Japan), cumene hydroperoxide (cumene, 186

Alfa Aesar, Ward Hill, MA, U.S.A.) or tert-butyl hydroperoxide 187

(t-BOOH, Tokyo Kasei Chemicals, Tokyo, Japan) were added; the 188

cultures were then incubated statically at 37oC or 22oC for 8 h, or at 12 oC 189

for 56 h. Bacterial growth was determined by measuring the absorbance 190

of the culture at 590 nm using an MRXII microplate reader (Dynex 191

Technologies, Chantilly, VI, U.S.A.). 192

193

Low temperature stress. V. parahaemolyticus cultures in the 194

exponential phase (200 μl) were dispensed into the wells of a microtiter 195

plate, and statically incubated at 12oC. Bacterial growth was determined 196

by measuring the absorbance at 590 nm. In another experiment, the V. 197

parahaemolyticus cultures in the exponential phase were tenfold diluted 198


.asm.org/

Dow

nloaded from

http://aem.asm.org/

12

in TSB-3% NaCl and 100 ml volumes of these diluted cultures were 199

incubated at 4oC. At intervals, the survivors were counted on TSA-3% 200

NaCl agar. 201

202

Growth competition. Wild-type and mutant V. parahaemolyticus 203

strains were grown in a co-culture with E. coli SM10λ-pir that was 204

harboring pDS132. The V. parahaemolyticus culture in the exponential 205

phase was diluted tenfold in fresh TSB-1% NaCl. E. coli were cultured in 206

LB that contained chloramphenicol (20 μg/ml) until they reached the 207

exponential phase. The V. parahaemolyticus and E. coli cultures were 208

inoculated separately into TSB-1% NaCl or mixed in a 1:40 (v/v) ratio 209

and then inoculated; they were subsequently incubated statically or with 210

shaking at 160 rpm for 8 h. The V. parahaemolyticus and E. coli cells 211

were counted on TSA-3% NaCl that was supplemented with 15 μg/ml 212

ampicillin and Luria-Bertani (LB) agar that was supplemented with 5 213

μg/ml chloramphenicol, respectively, following incubation at 37oC for 16 214

h. To count the bacteria with the complementary gene, LB agar was used, 215

on which V. parahaemolyticus formed pale yellow, large colonies while 216

the E. coli formed white, small colonies. 217


.asm.org/

Dow

nloaded from

http://aem.asm.org/

13

218

Quantitative reverse transcription polymerase chain reaction. The 219

expression of genes (Table 3) was determined in the wild-type and 220

ΔkatE1 using the real-time quantitative reverse transcription-polymerase 221

chain reaction (RT-qPCR)(23). Briefly, bacterial strains were cultivated 222

statically in TSB-3% NaCl at 22 or 37oC, and the cultures in exponential 223

phase were challenged with 175 μM H2O2 for 1.5 h. Bacterial cells were 224

harvested by centrifugation, broken by TRIzol®Reagent (Invitrogen, U.K.) 225

and RNA samples were extracted using an RNApure kit (Genesis Biotech 226

Inc., Taipei, Taiwan), following the manufacturer's instructions. RNA 227

samples were treated with DNase I (Takara Bio Inc., Shiga, Japan) and 228

then reverse-transcribed using a SuperScript® III First-Strand Synthesis 229

SuperMix (Invitrogen, U.K.), following the instructions of the 230

manufacturer. Primers (Table 3) were designed using the Primer Express 231

Sequence Editor (http://www.fr33.net/seqedit.php) and Oligo Calculator 232

(http://www.sciencelauncher.com/oligocalc.html), and 16S rRNA was 233

used as the internal control. Real-time PCR was performed using the 234

StepOnePlus Real-Time PCR system v.2.0 (Applied Biosystems) with a 235

IQ2 SYBR Green Fast qPCR System Master Mix – High ROX (DBU-008) 236


.asm.org/

Dow

nloaded from

http://aem.asm.org/

14

and RT-PCR reagents. All the data were normalized with the 16S gene 237

expression levels of the culture at each time point and the normalized 238

values for each gene were compared (Applied Biosystems). Expression of 239

each target gene of the experimental group in relative to the expression of 240

the corresponding gene of the control was presented. Recombinant 241

plasmids for the target genes were used as a calibration standard (Table 242

1)(23). The quality of the RNA samples and the quantification protocols 243

that were adopted herein was evaluated by previously described methods 244

(23). 245

246

Statistical analysis. Triplicate experiments were performed, and the 247

data of the bacterial growth experiments were obtained from triplicate 248

determinations. The data were analyzed by performing one-way ANOVA 249

or t-test at a significance level of α = 0.05, using SPSS for Windows 250

version 11.0 (SPSS Inc., Chicago, IL, USA). 251

252

RESULTS 253

254

Growth and survival of catalase gene mutants. To evaluate the 255


.asm.org/

Dow

nloaded from

http://aem.asm.org/

15

significance of these katE-homologous genes in the growth of V. 256

parahaemolyticus under normal growth condition, the growth of the 257

single (ΔkatE1, ΔkatE2) and double (ΔkatE1E2) catalase gene mutants, 258

gene complementary strains (ΔkatE1/katE1, ΔkatE2/katE2) and the 259

wild-type strain (Table 1) in TSB-3% NaCl at 37oC under either shaking 260

or static conditions was determined. Bacterial growth was promoted by 261

shaking at 160 rpm, which approached the late exponential phase after 4 262

h of incubation, when they reached a maximal absorbance of about 4 at 263

590 nm (Supplementary Fig. S1) and cell density of about 1010 CFU/ml 264

(data not shown). In the static culture, the growth of bacterial cells 265

approached the stationary phase after 3 h of incubation, exhibiting a 266

maximal absorbance of about 0.7 at 590 nm (Fig. S1). No defective 267

growth was observed for these mutants under these conditions as 268

compared to the growth of the wild-type strain. Nevertheless, presence of 269

complementary katE2 gene in the △katE2 strain slightly affected its 270

growth, especially enhanced the growth of the shaking culture after 271

incubating for 6-8h (Fig. S1A). It suggests that the shaking culture 272

instead of the static culture may generate oxidative stress that activates 273

the expression of the katE2 gene. 274


.asm.org/

Dow

nloaded from

http://aem.asm.org/

16

Incubating these cultures statically at 12oC slowed down the growth 275

of the bacterial cells, and the cultures approached the late exponential 276

phase after 25 h of incubation; and reached a maximal absorbance of 0.5 277

after 55 h (data not shown). 278

Population of the culturable cells of the wild-type strain, ΔkatE1, 279

ΔkatE1E2 and ΔkatE1/ katE1 in TSB-3％ NaCl were equal following 280

static incubation at 4oC. A slow decline in the number of culturable cells 281

was observed over time, and 108-109 CFU/ml remained culturable and 282

about 0.5x108 CFU/ml had been killed after 52 h of incubation (data not 283

shown). Results revealed that deletion mutations of these 284

katE-homologous genes did not influence on the growth and survival of 285

this pathogen in rich medium under growth-permitting (12-37oC) or 286

refrigerating temperatures. These results also suggest the presence of 287

efficient compensatory mechanism in these catalase-deficient mutants 288

under these conditions. 289

290

Growth of catalase gene mutant in co-culture with E. coli. 291

Extracellular ROS are produced by some bacteria species, such as 292

Enterococcus faecalis (25), while efflux of H2O2 also occurs in E. coli 293


.asm.org/

Dow

nloaded from

http://aem.asm.org/

17

(26). The catalase-deficient cells have a growth disadvantage over 294

catalase-proficient cells in a mixed culture (26). Thus, these catalase gene 295

mutations may decrease the competition of V. parahaemolyticus in 296

co-cultures and influences on its persistence in natural environment. In 297

this study, the growth of wild-type and different catalase mutants 298

co-cultured with E. coli was assayed. The TSB-1% NaCl medium 299

provided rapid growth for both species in shaken culture (Fig. 1A). In the 300

co-culture, the initial density of E. coli was ten times that of the V. 301

parahaemolyticus strains. In the shaken single culture, both the V. 302

parahaemolyticus strains and E. coli grew rapidly. In the co-culture, V. 303

parahaemolyticus strains, at much lower initial density than those of E. 304

coli, multiplied rapidly and became the dominant population after two to 305

three hours of incubation, after which the growth of E. coli was inhibited. 306

The cell densities of the V. parahaemolyticus strains at 6-8 h of 307

incubation were significantly lower in the co-culture than in the single 308

culture, nevertheless, deletion mutation of these catalase genes did not 309

significantly affected their growth competition (Fig. 1). 310

In the static culture, the population of E. coli remained at 107 CFU/ml 311

for 8 h of incubation when they were cultured separately or in the 312


.asm.org/

Dow

nloaded from

http://aem.asm.org/

18

co-culture. The V. parahaemolyticus strains, with a much lower initial 313

density in the co-culture, rapidly reached the maximal density of 109 314

CFU/ml after 4 h of incubation. Deletion mutation of these catalase genes 315

did not significantly affect its growth and competition under static culture 316

(Fig. S2). 317

318

Growth of catalase gene mutants in presence of extrinsic H2O2. The 319

addition of 175 or 200 μM of H2O2 to the TSB-3％ NaCl medium 320

significantly slowed the growth of the wild-type strain of V. 321

parahaemolyticus at 37oC, and delayed the reaching of the exponential 322

and stationary phase (Fig. 2A). The concentrations of H2O2 used in this 323

study were not lethal to V. parahaemolyticus and it did not significantly 324

decay during the incubation time (data not shown). When 175 μM of 325

H2O2 was applied to catalase mutant strains, the bacterial growth of 326

ΔkatE2 was slightly delayed in, of ΔkatE1 was markedly delayed in, and 327

of the double mutants ΔkatE1E2 and ΔkatE1-ahpC1 was completely 328

inhibited (Fig. 2B). The growth of the ΔkatE1 strain that was inhibited by 329

H2O2 was restored in the complementary katE1 gene, while the growth of 330

ΔkatE2 in the presence of the complementary katE2 gene did not differ 331


.asm.org/

Dow

nloaded from

http://aem.asm.org/

19

significantly from that of the wild-type strain that harbored the cloning 332

vector (KX-V231V)(Fig. 2C). When considering the cultivation of 333

ΔkatE1/katE1, ΔkatE2/katE2 and KX-V231V in medium containing 334

chloramphenicol to maintain the plasmids in the cells, growth of 335

ΔkatE1/katE1 under extrinsic H2O2 was accelerated and reached late 336

exponential phase about one hour earlier than the other two strains 337

containing plasmids (Fig. 2C). Experimental results of Fig. S1 and Fig. 2 338

demonstrated that both katE1 and katE2 were functional, while katE1 was 339

more important than katE2 as the protective gene in the exponential phase 340

of V. parahaemolyticus against extrinsic H2O2, and the presence of 341

complementary katE1 in plasmid may provide sufficient protection 342

against extrinsic H2O2 and the growth inhibitory effect of 343

chloramphenicol. These results also suggest that ahpC1 may be the H2O2 344

detoxifier in the absence of katE1 (Fig. 2B). 345

346

Growth of catalase gene mutants in presence of extrinsic organic 347

peroxides. The addition of 60 or 90 μM of cumene significantly slowed 348

the growth of the wild-type strain of V. parahaemolyticus at 37oC (Fig. 349

S3A). When 60 μM of cumene was applied to the single and double 350


.asm.org/

Dow

nloaded from

http://aem.asm.org/

20

catalase mutant strains at 37oC, their growth did not differ significantly 351

from that of the wild-type strain (Fig. S3B). 352

Adding 100 or 130 μM of t-BOOH to the wild-type culture slightly 353

reduced the extent of bacterial growth at 37oC and the bacteria reached a 354

lower maximal absorbance than those in the control group without 355

peroxide. Adding 130 μM of t-BOOH did not cause the growth of these 356

catalase mutant strains to differ significantly from that of the wild-type 357

strain (data not shown). These experiments suggest that these 358

katE-homogenous genes may not detoxify organic peroxides. 359

360

Effect of H2O2 on growth of catalase gene mutants at 22 and 12oC. 361

At 22oC, 175μM of H2O2 strongly inhibited the growth of the ΔkatE1, 362

ΔahpC1 and double mutants of ΔkatE1E2 and ΔkatE1-ahpC1, and had no 363

significant effect on the growth of ΔkatE2 (Fig. 3A). Presence of 364

complementary gene of katE1 restored the growth of ΔkatE1 that was 365

inhibited by H2O2 (Fig. 3B). 366

At 12oC, the growth of bacteria was slowed. The corresponding 367

experiment was performed for 56 h. The presence of 70 μM of H2O2 368

inhibited the growth of the double mutant ΔkatE1E2 only for a period of 369


.asm.org/

Dow

nloaded from

http://aem.asm.org/

21

about 40 h, and the growth resumed thereafter. This concentration of 370

H2O2 had no effect on the wild-type and other mutant strains (Fig. 4A). A 371

100 μM concentration of H2O2 completely inhibited the growth of 372

ΔkatE1E2 for a full 56 h (Fig. 4B). A 175 μM concentration of H2O2 373

completely inhibited the growth of ΔkatE1 and ΔkatE1E2 at 12oC, but did 374

not affect the growth of the wild-type strain or ΔkatE2 (Fig. 4C). These 375

experiements showed that the susceptibility of the ΔkatE1 to extrinsic 376

H2O2 was sensitized at incubation temperatures lower than 37oC, and it 377

suggests that behavior of these genes in V. parahaemolyticus is 378

influenced by incubation temperatures. 379

380

Expression of catalase genes. In order to study how these catalase 381

genes are influenced by incubation temperatures, expression of the 382

catalase (katE1, katE2, katG1, katG2), ahpC1 and ahpC2 genes in the 383

exponential phase with and without the challenge of extrinsic H2O2 was 384

determined by RT-qPCR. Under the stress of extrinsic H2O2, the 385

expression of katE1, katE2 and ahpC1 in the wild-type strain was 386

significantly higher at an incubation temperature of 22oC than at an 387

incubation temperature of 37oC, whereas katE1 showed 4.7 and 0.5 fold 388


.asm.org/

Dow

nloaded from

http://aem.asm.org/

22

change at 22oC and 37oC, respectively (Fig. 5A). 389

When the ΔkatE1 strain was cultured under normal conditions 390

without challenge by extrinsic H2O2, the expression of ahpC1 and ahpC2 391

was significantly higher at 37oC than at 22oC (Fig. 5B). Under the 392

challenge of extrinsic H2O2, the expression of ahpC1, ahpC2 and 393

VPA0305 genes was significantly higher at 22oC than at 37oC (Fig. 5C), 394

while no significant difference was observed between the expressions of 395

the two katG-homologous genes (katG1, katG2) (data not shown). 396

397

DISCUSSION 398

399

Vibrio species have one to four catalase genes. V. fischeri has a single 400

katA gene, which is critical in forming symbionts in its squid host (16), 401

whereas V. vulnificus and V. cholerae have two catalase genes that 402

encode catalase and catalase/peroxidase (17). V. parahaemolyticus has 403

four putative catalase genes, which may have different functions and 404

regulatory characteristics than the catalase genes of E. coli and other 405

bacterial species. 406

Among the four putative catalase genes in V. parahaemolyticus, katE1 407


.asm.org/

Dow

nloaded from

http://aem.asm.org/

23

was demonstrated herein to be similar to the monofunctional peroxidase 408

gene (katE1) of E. coli and it is probably the chief functional catalase 409

gene against extrinsic H2O2 in the exponential phase of this bacterium 410

(Fig. 2 and Fig. S3). The other two katG-homologous genes (katG1 and 411

katG2) of V. parahaemolyticus did not exhibit a significant antioxidative 412

role during logarithmic growth (27). The putative amino acid sequence of 413

this KatE1 catalase exhibits high identities of 95.6% and 80.7% with the 414

KatE of V. alginolyticus (accession no. AGV18944) and the KatA of V. 415

fischeri (AF011784), respectively, and a 29.6% identity with the KatE of 416

E. coli. 417

In different bacterial species, different catalase genes play the major 418

role in detoxifying peroxides. In E. coli, KatG is the predominant 419

peroxide scavenger in the exponential phase (28), and the katG gene of V. 420

vulnificus has a similar protective function (29). In V. cholerae, both katG 421

and katB (a katE-like gene) are protective against H2O2 (17). In 422

Rhodobacter species, whether H2O2 induces the expression of katE or 423

katG depends on the species (30). 424

Although katE1 is probably the chief functional catalase gene in the 425

exponential phase, the deletion mutation of this gene did not harm the 426


.asm.org/

Dow

nloaded from

http://aem.asm.org/

24

normal growth of these mutant strains (Fig. S1), the survival thereof at a 427

refrigerating temperature, or its high competitiveness with E. coli (Fig. 1). 428

The endogenous ROS that is generated by aerobic metabolism in these 429

mutants (31) may be detoxified by other antioxidative factors (31). In V. 430

parahaemolyticus, three superoxide dismutases (VP2118, VP2860 and 431

VPA1514), four ahpC/F factors (VPA1683, VP0580, VPA1684 and 432

VPA1681) and two katG-homologous genes (katG1 and katG2) may 433

compensate for the deletion of catalase genes in these mutants (ΔkatE1, 434

ΔkatE2) (32, 33). Catalases and AhpC scavenge endogenous H2O2 that is 435

generated by aerobic metabolism (34, 35), whereas AhpC is the primary 436

detoxifier in Bacillus abortus (33) and E. coli (36). katE2 and ahpC genes 437

may have alternate or compensatory role in the △katE1 (Figs. 2 and 4). 438

Another feature of these catalase genes is the influence of incubation 439

temperature. The sensitivity of the ΔkatE1 to extrinsic H2O2 was 440

increased as the incubation temperature was reduced below 37oC (Figs. 3 441

and 4). A similar effect of incubation temperature on the protective 442

function of the ahpC genes of V. parahaemolyticus and its colony size 443

has been demonstrated elsewhere (23). Low temperature also impairs the 444

growth of the catalase mutant in Listeria monocytogenes (37). In the cited 445


.asm.org/

Dow

nloaded from

http://aem.asm.org/

25

investigations, the more ROS may be produced as the temperature falls, 446

increasing the need for a functional catalase. The accumulation of ROS 447

may be attributed to the expression, stability and activities of catalases 448

and AhpCs. The critical function of katE1 under extrinsic H2O2 stress at 449

22oC was also supported herein by the high expression of this gene in the 450

parent strain (Fig. 5A) and much greater expression of the compensatory 451

genes in △katE1 at 22oC than at 37oC (Fig. 5C). 452

The expression of the aforementioned genes may be regulated by 453

controlling the incubation temperature as has been demonstrated in 454

Yersinia pestis (38). The thermal regulation of the expression and 455

function of these antioxidative factors may involve rpoS, oxyR, toxRS and 456

other regulatory factors. The OxyR (VP2752) regulon is known to 457

regulate the expressions of catalase genes and ahpC genes, which exhibit 458

compensatory patterns in several bacteria (32), whereas the rpoS 459

(VP2553) is a general regulator of stress responses (39). Nevertheless, the 460

regulation of various catalase genes or other antioxidative factors in V. 461

parahaemolyticus has not been investigated. 462

In conclusion, this work demonstrates that the katE-homologous 463

genes, katE1 and katE2, are not critical for the aerobic growth of V. 464


.asm.org/

Dow

nloaded from

http://aem.asm.org/

26

parahaemolyticus in a rich medium, but katE1 was the most important 465

required detoxifier under extrinsic H2O2 stress during logarithmic growth. 466

The sensitivity of the ΔkatE1 to H2O2 increased as the incubation 467

temperature was lowered below 37oC, and katE2 and ahpC genes may 468

have alternate or compensatory roles in this mutant. 469

470

ACKNOWLEDGMENTS 471

472

The authors would like to thank the Ministry of Science and 473

Technology of the Republic of China for financially supporting this 474

research under Contracts Nos. NSC100-2313-B-031-001-MY3 and 475

MOST103-2313-B-031-001-MY3. Ted Knoy is appreciated for his 476

editorial assistance. 477

478

479


.asm.org/

Dow

nloaded from

http://aem.asm.org/

27

480

REFERENCES 481

482

1. Kim JS, Sung MH, Kho DH, Lee JK. 2005. Induction of 483

manganese-containing superoxide dismutase is required for acid 484

tolerance in Vibrio vulnificus. J Bacteriol 187:5984-5995. 485

2. Rosche TM, Smith DJ, Parker EE, Oliver JD. 2005. RpoS 486

involvement and requirement for exogenous nutrient for osmotically 487

induced cross protection in Vibrio vulnificus. FEMS Microbiol Ecol 488

53:455-462. 489

3. Gabbianelli R, Signoretti C, Marta I, Battistoni A, Nicolini L. 490

2004. Vibrio cholerae periplasmic superoxide dismutase: isolation of 491

the gene and overexpression of the protein. J Biotechnol 492

109:123-130. 493

4. Al-Maghrebi MA, Benov LT. 2001. Polyphosphate accumulation 494

and oxidative DNA damage in superoxide dismutase-deficient 495

Escherichia coli. Free Radic Biol Med 31:1352-1359. 496

5. Switala J, Triggs-Raine BL, Loewen PC. 1990. Homology among 497

bacterial catalase genes. Can J Microbiol 36:728-731. 498


.asm.org/

Dow

nloaded from

http://aem.asm.org/

28

6. Jung IL, Kim IG. 2003. Transcription of ahpC, katG, and katE 499

genes in Escherichia coli is regulated by polyamines: 500

polyamine-deficient mutant sensitive to H2O2-induced oxidative 501

damage. Biochem Biophys Res Commun 301:915-922. 502

7. Visick JE, Clarke S. 1997. RpoS- and OxyR-independent induction 503

of HPI catalase at stationary phase in Escherichia coli and 504

identification of rpoS mutations in common laboratory strains. J 505

Bacteriol 179:4158-4163. 506

8. Hofmann B, Hecht HJ, Flohe L. 2002. Peroxiredoxins. Biol Chem 507

383:347-364. 508

9. Imlay JA. 2008. Cellular defenses against superoxide and hydrogen 509

peroxide. Annu Rev Biochem 77:755-776. 510

10. Stead D, Park SF. 2000. Roles of Fe superoxide dismutase and 511

catalase in resistance of Campylobacter coli to freeze-thaw stress. 512

Appl Environ Microbiol 66:3110-3112. 513

11. Lin C, Yu RC, Chou CC. 2004. Susceptibility of Vibrio 514

parahaemolyticus to various environmental stresses after cold shock 515

treatment. Int J Food Microbiol 92:207-215. 516

12. Chiang ML, Chou CC. 2008. Expression of superoxide dismutase, 517


.asm.org/

Dow

nloaded from

http://aem.asm.org/

29

catalase and thermostable direct hemolysin by, and growth in the 518

presence of various nitrogen and carbon sources of heat-shocked and 519

ethanol-shocked Vibrio parahaemolyticus. Int J Food Microbiol 520

121:268-274. 521

13. Lai WB, Wong HC. 2013. Influence of combinations of sublethal 522

stresses on the control of Vibrio parahaemolyticus and its cellular 523

oxidative response. Food Control 33:186-192. 524

14. Diaz JM, Hansel CM, Voelker BM, Mendes CM, Andeer PF, 525

Zhang T. 2013. Widespread production of extracellular superoxide 526

by heterotrophic bacteria. Science 340:1223-1226. 527

15. Hebrard M, Viala JP, Meresse S, Barras F, Aussel L. 2009. 528

Redundant hydrogen peroxide scavengers contribute to Salmonella 529

virulence and oxidative stress resistance. J Bacteriol 191:4605-4614. 530

16. Visick KL, Ruby EG. 1998. The periplasmic, group III catalase of 531

Vibrio fischeri is required for normal symbiotic competence and is 532

induced both by oxidative stress and by approach to stationary phase. 533

J Bacteriol 180:2087-2092. 534

17. Wang H, Chen S, Zhang J, Rothenbacher FP, Jiang T, Kan B, 535

Zhong Z, Zhu J. 2012. Catalases promote resistance of oxidative 536


.asm.org/

Dow

nloaded from

http://aem.asm.org/

30

stress in Vibrio cholerae. PLoS One 7:e53383. 537

18. Wong HC, Ting SH, Shieh WR. 1992. Incidence of toxigenic 538

vibrios in foods available in Taiwan. J Appl Bacteriol 73:197-202. 539

19. Nair GB, Ramamurthy T, Bhattacharya SK, Dutta B, Takeda Y, 540

Sack DA. 2007. Global dissemination of Vibrio parahaemolyticus 541

serotype O3:K6 and its serovariants. Clin Microbiol Rev 20:39-48. 542

20. Makino K, Oshima K, Kurokawa K, Yokoyama K, Uda T, 543

Tagomori K, Iijima Y, Najima M, Nakano M, Yamashita A, 544

Kubota Y, Kimura S, Yasunaga T, Honda T, Shinagawa H, 545

Hattori M, Iida T. 2003. Genome sequence of Vibrio 546

parahaemolyticus: a pathogenic mechanism distinct from that of V 547

cholerae. Lancet 361:743-749. 548

21. Lin LC, Lin GH, Wang ZL, Tseng YH, Yu MS. 2015. Differential 549

expression of catalases in Vibrio parahaemolyticus under various 550

stress conditions. Res Microbiol 166:601-608. 551

22. Chung CH, Ma TY, Fen SY, Wong HC. 2014. Activity of alkyl 552

hydroperoxide reductase subunit C1 and C2 of Vibrio 553

parahaemolyticus against different peroxides. Appl Environ 554

Microbiol 80:7398-7404. 555


.asm.org/

Dow

nloaded from

http://aem.asm.org/

31

23. Wang HW, Chung CH, Ma TY, Wong HC. 2013. Roles of alkyl 556

hydroperoxide reductase subunit C (AhpC) in viable but 557

nonculturable Vibrio parahaemolyticus. Appl Environ Microbiol 558

79:3734-3743. 559

24. Okada N, Iida T, Park KS, Goto N, Yasunaga T, Hiyoshi H, 560

Matsuda S, Kodama T, Honda T. 2009. Identification and 561

characterization of a novel type III secretion system in trh-positive 562

Vibrio parahaemolyticus strain TH3996 reveal genetic lineage and 563

diversity of pathogenic machinery beyond the species level. Infect 564

Immun 77:904-913. 565

25. Huycke MM, Abrams V, Moore DR. 2002. Enterococcus faecalis 566

produces extracellular superoxide and hydrogen peroxide that 567

damages colonic epithelial cell DNA. Carcinogenesis 23:529-536. 568

26. Seaver LC, Imlay JA. 2001. Hydrogen peroxide fluxes and 569

compartmentalization inside growing Escherichia coli. J Bacteriol 570

183:7182-7189. 571

27. Yu, SC. 2014. Characteristics of catalase gene in Vibrio 572

parahaemolyticus. Master thesis, Soochow University. 573

28. Uhlich GA. 2009. KatP contributes to OxyR-regulated hydrogen 574


.asm.org/

Dow

nloaded from

http://aem.asm.org/

32

peroxide resistance in Escherichia coli serotype O157:H7. 575

Microbiology 155:3589-3598. 576

29. Park KJ, Kang MJ, Kim SH, Lee HJ, Lim JK, Choi SH, Park SJ, 577

Lee KH. 2004. Isolation and characterization of rpoS from a 578

pathogenic bacterium, Vibrio vulnificus: role of sigmaS in survival of 579

exponential-phase cells under oxidative stress. J Bacteriol 580

186:3304-3312. 581

30. Zeller T, Klug G. 2004. Detoxification of hydrogen peroxide and 582

expression of catalase genes in Rhodobacter. Microbiology 583

150:3451-3462. 584

31. Dubbs JM, Mongkolsuk S. 2012. Peroxide-sensing transcriptional 585

regulators in bacteria. J Bacteriol 194:5495-5503. 586

32. Charoenlap N, Eiamphungporn W, Chauvatcharin N, 587

Utamapongchai S, Vattanaviboon P, Mongkolsuk S. 2005. OxyR 588

mediated compensatory expression between ahpC and katA and the 589

significance of ahpC in protection from hydrogen peroxide in 590

Xanthomonas campestris. FEMS Microbiol Lett 249:73-78. 591

33. Steele KH, Baumgartner JE, Valderas MW, Roop RM. 2010. 592

Comparative study of the roles of AhpC and KatE as respiratory 593


.asm.org/

Dow

nloaded from

http://aem.asm.org/

33

antioxidants in Brucella abortus 2308. J Bacteriol 192:4912-4922. 594

34. Dubbs JM, Mongkolsuk S. 2007. Peroxiredoxins in bacterial 595

antioxidant defense. Subcell Biochem 44:143-193. 596

35. Cosgrove K, Coutts G, Jonsson IM, Tarkowski A, Kokai-Kun JF, 597

Mond JJ, Foster SJ. 2007. Catalase (KatA) and alkyl 598

hydroperoxide reductase (AhpC) have compensatory roles in 599

peroxide stress resistance and are required for survival, persistence, 600

and nasal colonization in Staphylococcus aureus. J Bacteriol 601

189:1025-1035. 602

36. Seaver LC, Imlay JA. 2001. Alkyl hydroperoxide reductase is the 603

primary scavenger of endogenous hydrogen peroxide in Escherichia 604

coli. J Bacteriol 183:7173-7181. 605

37. Azizoglu RO, Kathariou S. 2010. Temperature-dependent 606

requirement for catalase in aerobic growth of Listeria 607

monocytogenes F2365. Appl Environ Microbiol 76:6998-7003. 608

38. Han Y, Geng J, Qiu Y, Guo Z, Zhou D, Bi Y, Du Z, Song Y, Wang 609

X, Tan Y, Zhu Z, Zhai J, Yang R. 2008. Physiological and 610

regulatory characterization of KatA and KatY in Yersinia pestis. 611

DNA Cell Biol 27:453-462. 612


.asm.org/

Dow

nloaded from

http://aem.asm.org/

34

39. Hulsmann A, Rosche TM, Kong IS, Hassan HM, Beam DM, Oliver 613

JD. 2003. RpoS-dependent stress response and exoenzyme 614

production in Vibrio vulnificus. Appl Environ Microbiol 615

69:6114-6120. 616

40. Simon R, Priefer U, Puhler A. 1983. A broad host range 617

mobilization system for in vivo genetic engineering: transposon 618

mutagenesis in gram negative bacteria. Biotechnology 11:784-791. 619

41. Philippe N, Alcaraz JP, Coursange E, Geiselmann J, Schneider D. 620

2004. Improvement of pCVD442, a suicide plasmid for gene allele 621

exchange in bacteria. Plasmid 51:246-255. 622

623

624


.asm.org/

Dow

nloaded from

http://aem.asm.org/

35

TABLE 1 625

Bacterial strains and plasmids used in this study 626

Strain/

plasmid

Characteristics/sequence Source/

Reference

V. parahaemolyticus

KX-V231 Wild type, serotype O3:K6, KP+,

clinical isolate

This study

ΔkatE1 KX-V231 ΔkatE1 (VPA1418) This study

ΔkatE2 KX-V231 ΔkatE2 (VPA0305) This study

ΔkatE1E2 KX-V231ΔkatE1ΔkatE2 This study

ΔkatE1/katE1 KX-V231 ΔkatE1/ pSCB01-katE1 This study

ΔkatE2/katE2 KX-V231 ΔkatE2/ pSCB01-katE2 This study

ΔahpC1 KX-V231 ΔahpC1 (VPA1683) (23)

ΔkatE1-ahpC1 KX-V231ΔkatE1ΔahpC1 This study

KX-V231V KX-V231 containing pSCB01 This study

E. coli

XL1 blue

recA1 endA1 gyrA96 thi-1 hsdR17

supE44 relA1 lac [F´ proAB lacIq

Z∆M15 Tn10 (Tetr)]

Stratagene


.asm.org/

Dow

nloaded from

http://aem.asm.org/

36

SM10λ-pir thi thr leu tonA lacY supE

recA::RP4-2-Tc::Mu λ pirR6K; Kmr

(40)

Plasmid

pGEM T-easy Cloning vector, Apr Promega

pDS132 R6K ori, mobRP4, sacB, Cm r (41)

pSCB01 Derived from pBR328 and pDS132,

mobRP4, Apr, Cmr, Tcr

(23)

pSCB01- katE1 pSCB01 with katE1 This study

pSCB01- katE2 pSCB01 with katE2 This study

627

628


.asm.org/

Dow

nloaded from

http://aem.asm.org/

37

TABLE 2 629

Primers used in cloning experiments 630

Target Primer Sequence, 5’ 3’

VPA0305

VPA0305-1 CGGCGTTGAAGTGGTGTTGG

VPA0305-2 CCGTATTCTTTGTCTGCACGATTTTG

CGCCTGTAGAGATGTG

VPA0305-3 CACATCTCTACAGGCGCAAAATCGT

GCAGACAAAGAATACGG

VPA0305-4 GCGAACGTCTTCAAGTCGAG

VPA0305-0 GGTCAGATTTATCCTTCGTC

VPA0305-5 GTGATTGTGAATCTAGCTGC

VPA0305-C1 CAGTGTAATCACTCTCGCCA

VPA0305-C2 CAGAGCTGAGCAAGAATACG

VPA1418 VPA1418-1 CATTAAAGAGCCGAACTCGATGC

VPA1418-2 TTGGTAAGCGTGGGTGACGTGGACA

TCTTGTAGGAGTTGAGGG

VPA1418-3 CCCTCAACTCCTACAAGATGTCCACG

TCACCCACGCTTACCAA

VPA1418-4 CAGAACTTGCTGTGGAACTGG


.asm.org/

Dow

nloaded from

http://aem.asm.org/

38

VPA1418-0 CAGGAGCCATGACTGAATACTTG

VPA1418-5 GTTGGTAATGATAACGACGTACG

VPA1418-C1 CATTAAAGAGCCGAACTCGATGC

VPA1418-C2 TTATTTCGCTAAACCTAACGCCAG

631

632


.asm.org/

Dow

nloaded from

http://aem.asm.org/

39

TABLE 3 633

Primers used in RT- qPCR experiment 634

Designation Sequence Target Amplicon,

bp

q16SrRNA-F

q16SrRNA-R

TCCCTAGCTGGTCTGAGA

GGTGCTTCTTCTGTCGCT

16SrDNA 222

VP0580-F

VP0580-R

CGACAACCGTCTAGCTGA

AGCAACACCTGCTTCTGG

ahpC2 202

VPA1683-F

VPA1683-R

CTACCCAGCAGACTTCAC

CTTCACGCATCACACCGA

ahpC1 227

VPA0305-F

VPA0305-R

AGAGTTGTGCACGCTCGT

CCCTACCAGATCCCAGTT

VPA0305

228

VPA1418-F

VPA1418-R

TACGACCGTTGCTGGTGA

TTCTGGCAGCGATGTCCA

VPA1418

235

VPA0453-F

VPA0453-R

TGCATGGCTCCATGACCA

CGCATGCCATGACATACG

VPA0453

257

VPA0768-F

VPA0768-R

GTGGTCATACCGTGGGTA

GGCTCTTCTTCAGTTCCC

VPA0768

237

635

636


.asm.org/

Dow

nloaded from

http://aem.asm.org/

40

Figure Captions 637 638

Fig. 1. Effect of catalase gene mutation on growth of Vibrio 639

parahaemolyticus in competition with Escherichia coli in shaken culture. 640

V. parahaemolyticus wild-type and mutant strains and E. coli that 641

harbored cloning vector pDS132 were cultured separately (control) or 642

co-cultured in TSB-1% NaCl at 37oC and shaking at 160 rpm. A, V. 643

parahaemolyticus wild-type; B, △katE1; C, △katE1E2; D, 644 △katE1/katE1. ●, V. parahaemolyticus strain in co-culture; ○, E. coli in 645

co-culture; ▼, V. parahaemolyticus strain in separate culture; Δ, E. coli in 646

separate culture. 647

648

Fig. 2. Growth of Vibrio parahaemolyticus strains under challenge of 649

extrinsic hydrogen peroxide in a static culture at 37oC. Panel A, Effect of 650

concentration of H2O2 on growth of wild-type strain (KX-V231); ●, 0 μM; 651

○, 175 μM; ▼, 200 μM. Panel B, Effect of 175μM of H2O2 on growth of 652

different strains; ●, wild-type; ○, ΔkatE1; ▼, ΔkatE2; Δ, ΔkatE1E2 653

double mutant. Panel C, Effect of 175μM of H2O2 on growth of wild-type 654

and complementary strains; ●, wild-type; ○, ΔkatE1 with complementary 655

katE1 gene; ▼, ΔkatE2 with complementary katE2 gene; Δ, wild-type 656

with cloning vector. 657


.asm.org/

Dow

nloaded from

http://aem.asm.org/

41


extrinsic 175μM hydrogen peroxide in a static culture at 22oC. Panel A, 659

for mutant strains ; ●, wild-type; ○, ΔkatE1; ▼, ΔkatE2; Δ, ΔkatE1E2 660

double mutant; , ΔahpC1; □, ΔkatE1-ahpC1 double mutant. Panel B, for 661

complementary strain; ●, wild-type with cloning vector; ○, ΔkatE1with 662

complementary katE1 gene. 663

664


different concentration of extrinsic hydrogen peroxide in a static culture 666

at 12oC. Panel A, 70 μM of H2O2; B, 100 μM of H2O2; C, 175μM of H2O2; 667

●, wild-type; ○, ΔkatE1; ▼, ΔkatE2; Δ, ΔkatE1E2 double mutant. 668

669

Fig. 5. Expression of antioxidative genes in wild-type and △ΔkatE1 670

strains of Vibrio parahaemolyticus under H2O2 stress. A, expression of 671

antioxidative genes in wild-type strain incubated at 22 or 37oC under 672

challenge of extrinsic 175μM of H2O2; B, expression of different genes in 673 △ΔkatE1 incubated at 22 or 37oC without extrinsic H2O2 stress; C, 674

expression of different genes in △ΔkatE1 incubated at 22 or 37oC under 675

challenge of extrinsic 175μM of H2O2. Expression of genes in the 676

exponential phase culture with or without the challenge of H2O2 was 677


.asm.org/

Dow

nloaded from

http://aem.asm.org/

42

determined by RT-qPCR; level of expression relative to the 678

corresponding gene of wild-type at each point without H2O2 challenge 679

was calculated, and values at 22 and 37oC were analyzed by t-test. * and 680

** designate significantly different values at p<0.05 or p<0.01, 681

respectively. 682

683 684


.asm.org/

Dow

nloaded from

http://aem.asm.org/

43

685

686

687

Fig. 1. 688

689

690


.asm.org/

Dow

nloaded from

http://aem.asm.org/

44

691

Fig. 2. 692

693


.asm.org/

Dow

nloaded from

http://aem.asm.org/

45

694

Fig. 3. 695

696

697


.asm.org/

Dow

nloaded from

http://aem.asm.org/

46

698

Fig. 4699


.asm.org/

Dow

nloaded from

http://aem.asm.org/

47

700

Fig. 5. 701


.asm.org/

Dow

nloaded from

http://aem.asm.org/


.asm.org/

Dow

nloaded from

http://aem.asm.org/

appl. environ. microbiol. doi:10.1128/aem.02547-15 copyright © … · frpsohphqwdu\ kate2 jhqh lq...

Documents