application of rapd and cytochrome ... - web.macam.ac.ilweb.macam.ac.il/~gad100/aaa cv gad 2010...

Application of RAPD and cytochrome b sequences to

the study of genetic variations in F1 and F2 generations

of two different strains of guppy (Poecilia reticulata,

Peter 1854)

Gad Degani1,2

1AcademicTel-Hai College, School of Science andTechnology, Israel2MIGAL, GalileeTechnological Center, Israel

Correspondence: Dr G Degani, MIGAL, GalileeTechnological Center, PO Box 831, Kiryat Shmona11016, Israel. E-mail: [email protected]

Abstract

The DNA of two laboratory strains of guppy (Poeciliareticulata), Black Yellow (BYS) and Red Flame (RFS),was studied with respect to their colour di¡erences,in two generations (F1 and F2). Their varying mor-phological colours were related to their cloned frag-ments of cytochrome bmitochondrial DNA (mtDNA)and random-ampli¢ed polymorphic DNA-polymer-ase chain reaction (RAPD-PCR). The F1 generationwas characterized by various forms. The male BYScould be divided into 68% having black^yellow tailsand 14% having black^yellow^red tails. The othervariations were found in very low percentages. Thepercentage of black^yellow-tailed males increased to85 in the F2 generation, and the percentages of thevarious other forms consequently decreased. Only63% of BYS males had black^yellow dorsal ¢ns inthe F1 generation, but this percentage increased to84 in F2. Compared with the males, fewer variationswere found in female colour patterns in the F1 gen-eration. A high percentage of BYS females (81%) col-our was found with no signi¢cant increase in the F2generation. However, variations decreased in the F2females. On the other hand, a very high variationwas found in female ¢ns in the F1 generation: only32% were of BYS colour and 25% had no-colour ¢ns.However, a signi¢cant increase in BYS colour wasfound in the F2 generation (61%) and 39% had nocolour. The variation in RFS was lower than BYS inthe F1generation:81% of the F1males had red^yellowtails with colour, 46% of the ¢ns were yellow and36% were red^white. In females, a very high per-centage (84%) had red^yellow tails and 76% had

no-colour dorsal ¢ns. Mitochondria DNA markersand genomic DNAwere studied in various laboratorystrains. In the clone of the fragments of cytochrome b,the bands correlated to the colour phenotype. A frag-ment of the cDNA sequence was determined from a268-bp cloned with fragments of the guppy cyto-chrome b mtDNA gene. The genes varied for thetwo strains inonly two base pairs, startingat the nuc-leotide position171and ending at position174. Threeprimers showed good results in the RAPD-PCR andwere found suitable for the study of DNA variationsin guppy. The high variation detected in BYS, in com-parison with RFS, was re£ected by changes in band-sharing (BS) values ranging from 0.66 to1, versus 0.8to1 in RFS.

Keywords: morphology, DNA, band-sharing, PCR

Introduction

Members of the genus Poecilia exhibit extensive mor-phological, behavioural and life-history variationswithin and between species (Breden, Ptacek, Rashed,Taphorn & Figueiredo1999). In the literature, the se-lection of colour lines is represented as a strain or alaboratory strain that di¡ers from strains in naturalhabitats or their sub-species, however, the di¡erencebetween them is not prominent (Nakajima &Tanigu-chi 2001; Nakadate, Takahito & Taniguchi 2003).However, it is very di⁄cult to identify the di¡erencesin both species and strains due to the overlap inmorphological characteristics, as well as the cross-breeding between some of them (Fryer & Iles1972).

Aquaculture Research, 2004, 35, 807^815 doi:10.1111/j.1365-2109.2004.01071.x

r 2004 Blackwell Publishing Ltd 807

Nevertheless, considerable advances have beenmade in the past 30 years in the ¢eld of evolutionarypopulation genetics and systematics in teleosts,which probably represent the most complex verteb-rate group in terms of both species number and thehuge range of their di¡erentiated origins (Green-wood, Rosen,Weitzman & Meyer1966). In particular,is the development of electrophoretic techniques onstarch (Smithies 1955) and acrylamide (Raymonds &Weintraub 1959). These methods make it possible toseparate proteins, while the use of speci¢c histo-chemical staining enables a demonstration of theactivity of single enzymes on the gel. An analysis ofenzymatic variations in di¡erent species or indi-viduals, representing allelic variations at speci¢cloci, provides information about genetic variabilityamong di¡erent species, sub-species or natural popu-lations.The structure and evolution of ¢sh have been ex-

amined in terms of DNA nucleotide composition(Bowers, Stau¡er & Kocher 1994; Kocher, Conroy,McKaye, Stau¡er & Lockwood 1995; Lee, Conroy,Howell & Kocher 1995; Jackson, Goldberg, Yehuda &Degani 2000; Hamilton 2001). To study variations inintra-speci¢c groups, on populations or related spe-cies, Hutchinson, Newbold, Potter and Edyell (1974),Brown, George andWilson (1979), Gyllensten,Whar-ton and Wilson (1985) and Funkenstein, Carvari,Stadie and Davidovitch (Yache) (1990) performedrestriction DNAanalyses. Fragment patterns of mito-chondrial DNA (mtDNA) sequences, representing ge-netic divergence among populations of di¡erent ¢shspecies, have been analysed extensively (Arise, Reef& Saunders 1987; Bentzen, Leggett & Brown 1988;Billington & Herbert 1988; Grewe & Herbert 1988;Funkenstein et al.1990; Hamilton 2001; Reed, deGra-velle & Carpenter 2001). Random-ampli¢ed poly-morphic DNA (RAPD) ¢ngerprinting o¡ers a rapidand e⁄cient method for generating a new series ofDNA markers in ¢shes (Degani & Levcovitch 1991;Degani, Pitcovski, Dobski & Plotsky 1997; Jacksonet al. 2001).The guppy (Poecilia reticulata) species belongs to

the Poecilia genus, Poeciliidae family, Cyprinodonti-formes order, Actinopterygii class (ray-¢nned ¢shes),and is distributed in South America, Venezuela,Barbados, Trinidad, northern Brazil and Guyana.The guppy is useful as a model ¢sh for studying gen-etics and breeding in aquaculture (for a review, seeNakajima & Taniguchi 2001). More than19 genes re-sponsible for morphological patterns located specif-ically on theYchromosome and16 such genes linked

with XandYchromosomes, have been described (Kir-pichnikov 1981). All over the world, di¡erent strainshave been created based on morphological charac-teristics, such as body colour and ¢n shape, in viewof the fact that guppies are very important in theaquaculture of ornamental ¢sh (Cheong 1996). Mi-crosatellite DNA markers have become the marker ofchoice in many population genetic studies (DeWoody& Avise 2000) and the study of guppy (P. reticulata)variation (Nakadate et al. 2003).The purpose of the present research was to study

genetic variations in two di¡erent laboratory strainsof guppy (P. reticulata): Black Yellow and Red Flume(BYS and RFS respectively) in F1 and F2 generationsfound in aquaculture in northern Israel using theRAPD-polymerase chain reaction (PCR) and clonedcytochrome bmt DNA.

Materials and methods

Fish

The ¢sh used in this study were two laboratorystrains of guppy (P. reticulata), BYS and RFS, importedfrom Srilanka for aquacultural use in Israel. The ¢shwere maintained for 2 years at MIGAL’s laboratoriesprior to carrying out the study.The BYSwere broughtto our laboratory from Kibbutz Samar, and the RFSwere imported from Srilanka to Kibbutz Kfar Sold(Fig. 1). The BYS were developed from two strains,Red Black and Metal Blue. BlackYellow males have ablackandyellow tail ¢n, ayellowdorsal ¢nwith blackspots, and half their body is black; BYS females have afaded black^yellow tail and dorsal ¢n, and a greybody (Fig. 1). Red Flame males have a yellow and redtail, a white body and a yellow dorsal ¢n (Fig. 1). Theproduct strain is based on selectionand creates broodstock. The selection made by the farmers is based onthe phenotype, which is identical to the parents (F1).The F2, made in the same way as the parents selectedfrom the F1, were identical according to phenotype.The phenotype variation in the laboratory strainwas studied by examining three parts of the body inthe strain (tail, ¢n and body). In order to study thegenetic variations of colour phenotype, the mtDNAmarkers and genomic DNAwere studied. In the cloneof the fragments of cytochrome b, the bands were cor-related to the colour phenotype.Fish were maintained individually (males and

females), separated before maturation by sex andmaintained in mono-sex containers measuring40 � 20 � 10 cm,10 ¢sh per container. Twenty-four

DNAvariations in guppy G Degani Aquaculture Research, 2004, 35, 807^815

808 r 2004 Blackwell Publishing Ltd, Aquaculture Research, 35, 807^815

crosses were made to get F1 and another 24 crossesto get F2 for each laboratory strain. Ten ¢sh weresampled for the fragment of cytocrome b sequencefor each laboratory strain of BYS and RFS.The culture system consisted of recirculated water

in closed containers witha constant air supply, a tem-perature of 27 1C and a controllable water £ow.

Dietary formulation

The colour intensity was a¡ected by the growth con-ditions and how the ¢sh were maintained. To deter-mine the phenotype, it is very important to ensure agood diet. Diets were formulated from ingredientscommercially available in Israel. The diets fed weremeal, pellets (commercial) and a paste preparedat MIGAL’s laboratories (63% ¢sh meal, 17% wheatmeal, 7% yolk, 11% soybean meal, 0.5% vitaminsand minerals).Fry were fed for the ¢rst 3 weeks with artemia lar-

vae thrice a day, and then with commercial powder

diets of di¡erent sizes for another 3 weeks before theMIGAL-formulated diets were supplied.

Sampling and DNA extraction

Liver samples were taken from the ¢sh having vari-ous morphological di¡erences (Table 1) as describedby Degani et al. (1997), and stored in tubes for DNAextractionwith K3 EDTAat �70 1C.Genomic DNAwas isolated from 0.01g of liver tis-

sue fromvarious strains of BYS and RFS parents, andF1and F2 generations.Total DNAwas puri¢ed using aQIAmp DNA Mini Kit (QIAGEN, Hilden, Germany).

Cloning

All PCRs were performed in 50 mL of solution con-taining 50mM Tris, pH 8.3, 2.5mM MgCl2, 0.25mMdNTP, 2 mM of each primer and1.3 U of Expand HighFidelity Enzyme (Roche Diagnostics GmbH, Man-nheim, Germany). Primer sequences are shown inTable 2.

Figure 1 Parents of the BlackYellow (BYS) female and male phenotypes and Red Flame (RFS) strains. (a) BYS female,(b) BYS male, (c) RFS female and (d) RFS male.

Aquaculture Research, 2004, 35, 807^815 DNAvariations in guppy G Degani

r 2004 Blackwell Publishing Ltd, Aquaculture Research, 35, 807^815 809

Polymerase chain reaction was performed in aMini Cycler according to the following program:3min at 94 1C, then 30 cycles of 1min at 94 1C,1min at 54 1C and 1min at 72 1C. Ampli¢ed frag-ments were ligated directly to pGEM-T vector(Promega, Madison, WI, USA) and cloned in DH10-competent cells. Sequencing was performed at theUnit for Biological Services, the Hebrew University ofJerusalem.

Cloning of cytochrome b sequences

Genomic DNAwas isolated from 0.01g of liver tissue(Degani et al. 1997), various strains of BYS and RFSparents, and F1 and F2 generations. Total DNA waspuri¢ed using a QIAamp DNA Mini Kit (Qiagen). AllPCRs were performed in 50 mL of solution containing50mM Tris, pH 8.3, 2.5mM MgCl2, 0.25mM dNTP,2 mM of each primer and1.3 U of Expand High Fidel-ity Enzyme (Roche). Primer sequences are shown inTable 2.

Polymerase chain reaction was performed in aMini Cycler according to the following program:3min at 94 1C, then 30 cycles of 1min at 94 1C,1min at 54 1C and 1min at 72 1C. Ampli¢ed frag-ments were ligated directly to pGEM-T vector(Promega) and cloned in DH10-competent cells. Se-quencing was performed at the Unit for BiologicalServices, the Hebrew University of Jerusalem.

Analysis

Sample DNA was prepared from randomly chosen¢sh of various species and hybrids, divided betweenat least two sources (¢sh farms). Only bands largerthan 3 kb were analysed. To assess genetic similaritybetween individuals, band-sharing (BS) was calcu-lated as BS52(Nab)/(Na1Nb), where BS5 the BSlevel in individuals a and b, Nab5number of bandsshared by a and b, Na5 total number of bands for aandNb5 total number of bands for b ( Je¡reys &Mor-ton 1987; Wetton, Carter, Parkin & Walters 1987). Tocalculate the signi¢cance of BS di¡erences, a d-testand w2 for di¡erences between proportions were used(Parker1976).

Table 1 Various colours found in the strains examined andanalysed by RAPD (F1) (BlackYellowand Red Flame CK SP)

Number ColourNumberof fish Colour

Tail Tail

1 Green cobra 30 Gold

2 Black, yellow, blue, red 31 Red, yellow

3 Black, yellow, blue 32 Red, yellow, white

4 No colour 33 Red, white

5 Black, yellow 2 36 Red

6 Black, yellow, red 37 No colour

7 Black, yellow 1

8 Grey

9 Yellow

10 Black

Fin Fin

11 Black, yellow, red 34 Yellow

12 Green cobra 35 Red, yellow

13 Grey 38 No colour

14 Grey, red 35 Yellow

15 Black, blue 36 Yellow, red

16 No colour 48 No colour

17 Black, yellow

18 Black, bright yellow

Body Body

19 No colour 26 Yellow, white

20 Grey 27 Red, white

21 Grey, black 28 Black, yellow, red

22 Blue 29 No colour

23 Green cobra 26 Yellow, white

24 Bright white 27 Red, white

25 Black 28 Black, yellow, red

RAPD, random-ampli¢ed polymorphic DNA.

Table 2 All the primers used in this study

Sequence

Primer for RAPD-PCR

I2 GGAAGGAGAGG

I4 CCGGCCTAGTC

I5 TGTTCCACGG

I6 AAGGCGGCAG

I7 CAGCGACAAG

I8 TTTGCCCGGT

I9 TGGAGAGCAG

I10 ACAACGCGAG

I13 CTGGGGCTGA

G3 GAGCCCTCCA

G4 AGCGTGTCTG

G5 CTGAGACGGA

G6 GTGCCTAACC

G7 GAACCTGCGG

G8 TCACGTCCAC

G15 ACTGGGACTC

G20 TCTCCCTCAG

I03 CAGAAGCCCA

I18 AGGTGACCGT

ZG4 GGAGCTGGC

Primers for cytochrome b

PG1 GCCAACCTACGAAAATCTCAC

PG2 GGTAGAGGCAAATGAAAAACAG

RAPD-PCR, random-ampli¢ed polymorphic DNA-polymerasechain reaction.



Results

The F1 generation was characterized by di¡erentforms. About 50% males and females were found inF1 and F2 generations (Table 3). The average numberof ¢sh per cross that survived was 23 (12.34 femalesand11.12 males).Black Yellow males were distributed as follows:

68% with black^yellow tails and 14% with black^yellow^red tails (Fig. 1). All other variations werefound in very low percentages. In the F2 generation,the percentage of black^yellow-tailed males in-creased to 85% (Fig.2), with a concomitant reductionin the percentages of other forms. Only 63% of BYS

males had black^yellow dorsal ¢ns in the F1 genera-tion; this increased to 84% in F2 (Fig. 3). Relative tomales, less variation was found in female colour pat-terns in the F1generation. A high percentage of typi-cal BYS female tails was found (81%), with nosigni¢cant increase in F2 (Fig. 4). However, this de-creased the variation found in F2 females. On theother hand, averyhighvariationwas found in female¢ns in F1: only 32% were typical to BYS females, and25% had ¢ns with no colour (Fig.5). A signi¢cant in-crease in typical BYS ¢ns was found in F2 (61%), and39% had ¢ns with no colour. Signi¢cant di¡erenceswere found between males of the two generations byd-test in BYS tails, BYS ¢ns and black^grey bodies(Po0.05), as well as female BYS tails, ¢ns and bodies.Variations in RFS were lower than in BYS in the F1

generation. For RFS males,81% had red^yellow tails,46% had yellow ¢ns and 36% red^white bodies(Fig.6). In females, a very high percentage (84%) hadred^yellow tails and 76% had dorsal ¢ns with no col-our (Fig.6). No signi¢cant di¡erences were found be-tween the tail and ¢n colours of F1males and females(by d-test) and their parents.Several sets of degenerate oligonucleotides were

used to clone cDNA encoding the complete cyto-

Table 3 F1and F2 ¢shwith half-black bodies

Males Females All fish

Number of F1 fish 267 284 551

% 48.26 51.27

Number of F2 fish 402 497 899

% 44.72 55.28

Average fish per cross survival (%) 11.2 12.34 23.04

Twenty-four viviparous, 553 ¢sh, w250.46, P40.05.

Figure 2 Percentages of the various tail colours of F1andF2 BlackYellow (BYS) males.

Figure 3 Percentages of the various ¢n colours of F1andF2 BlackYellow (BYS) males.



chrome b sequences of guppy (P. reticulata) from vari-ous strains of BYS and RFS (Fig. 7). The fragment ofthe cDNA sequence was determined from a 268-bp-long clone, representing fragments of the guppycytochrome b mtDNA gene. The genes varied be-tween the two strains only in two base pairs startingat nucleotide (nt) position171and ending at position174 (Fig.7).Seven primers (Table 2) were examined in the

RAPD-PCR: only three (ZG4, I03 and I18) werefound suitable for studying the DNA variations inquestion.The number of bands in the strains elucidated by

the various primers di¡ered among the strains exam-ined. The di¡erences in strain bands and coloursa¡ected by primer I18 are shown in Fig.8. A highvar-iationwas found between the two strains as re£ectedby their BS values, which ranged from 0.63 to 0.92.The highest variation was detected in primer I18and the lowest in ZG4. The highest variation was de-tected in BYS, where BS values ranged between 0.66and 1 (Tables 4^6), compared with RFS, with BSvalues ranging between 0.8 and1 (Table 6).

Figure 4 Percentages of the various tail colours of F1andF2 BlackYellow (BYS) females.

Figure 5 Percentages of the various ¢n colours of F1andF2 BlackYellow (BYS) females.

Figure 6 Percentages of the various tail and ¢n coloursof F1and F2, Red Flame, males and females.



Discussion

In this study, a genetic variation was found betweentwo laboratory strains of guppy used as a model forthe development of strain-related genetic markers.The genetics and breeding of guppy have been stu-died intensively due to the high variations in colourand morphological characteristic of this species,which is used in aquaculture (for a review, see Naka-jima & Taniguchi 2001). Di¡erent laboratory strains

have been created worldwide based on morpholo-gical characteristics, such as body colour and ¢nshape, due to the importance of this species in orna-mental ¢sh aquaculture (Cheong1996). In this study,a correlationwas foundamongcolour phenotypes. Inthe clone of the fragments of cytochrome b, the bandscorrelated to the colour phenotype.Colour variations are well known among the vari-

ous ¢sh species and are used as systematic and gen-etic parameters (Fryer & Iles 1972; Herzberg 1978;

Figure 7 Comparison ofthe cytochrome b clone tothe two strains of guppy(Poecilia reticulata) fromGenBank (No. u06488) ^Black Yellow (BYS) and RedFlame (RFS).

Figure 8 Example of thebands found with primerI18 from the two di¡erentstrains, Black Yellow (BYS)and Red Flame (RFS).



van der Bank, Grant & Ferreira 1989). Degani et al.(1997) studied various di¡erent-coloured strains ofangel¢sh (Pterophyllum scalare). Their ¢ndings show-ed di¡erences among colour strains in DNA ¢nger-printing (RAPD-PCR) patterns in angel¢sh.In this study, we found DNAvariations in various

laboratory strains by comparing their fragments ofthe cytochrome b gene. The cytochrome b gene vari-ed between the two laboratory strains in only twobase pairs. However, although this might be usefulas a genetic marker to di¡erentiate between these la-boratory strains, a more detailed study is needed todetermine whether this marker can be used to dis-tinguish between other laboratory strains of P. reti-culata.Hence, RAPD-PCR is more useful than the meas-

ured fragment of cytochrome b in de¢ning separatelaboratory strains and determining the relationshipsin laboratory strain variations. Breeders in arti¢cialconditions obtain laboratory strains by selecting ac-

cording to colour, but such variations are the resultof newmutations or the manifestation of an existing,but previously unknown, gene. Colour variationsexist in the natural habitats of ¢sh (Greenwood et al.1966); this may be due to variations in laboratorystrains at a genetic level. Here, we examined variouslaboratory strains of guppy (P. reticulata) selected bybreeders. This species has many colour patterns thathave been selected to develop new strains for theornamental ¢sh market. The genetic distance wasfound to be higher between di¡erent strains thanamong various strains that had been developed fromthe same genetic origin. Moreover, higher variationsin colour were found in BYS than in RFS, also de-tected by RAPD-PCR.Another advantage to this method is that it can be

applied to determine a strain’s genotype in order tomaintain its purity, as well to de¢ne di¡erences be-tween new strains created by hybridization and theparent strains.

References

Arise J.C., Reef C.A. & Saunders N.C. (1987) Geographicpopulation structure and species di¡erences in mito-chondrial DNA of mouth brooding marine cat¢sh (Arii-dae) and demersal spawning toad¢shes (Batrachoidiae).Eulalion 41,991^1002.

van der Bank F.H., GrantW.S. & Ferreira J.T. (1989) Electro-phoretically detectable genetic data for ¢fteen South Af-rican cichlids. Journal of Fisheries Biology 34, 465^483.

Bentzen P., LeggettW.C. & Brown G.G. (1988) Length and re-striction site heteropolasmy in the mitochondrial DNA ofAmerican shad (Alosa sapidissima). Genetics118,509^518.

Breden F., Ptacek M.B., Rashed M.,Taphorn D. & FigueiredoC.A. (1999) Molecular phylogeny of the live-bearing ¢sh

Table 4 Comparison at various primers of two di¡erentstrains (BlackYellow (BYS) and Red Flame (RFS)) by band-sharing

Strain Primer RFS tail RFS fin RFS body

BYS – tail I03 0.75 0.86 0.75

BYS – fin I03 0.86 0.92 0.86

BYS – body I03 0.86 0.86 0.86

BYS – tail ZG4 0.63 0.87 0.92

BYS – fin ZG4 0.92 0.92 0.92

BYS – body ZG4 0.80 0.88 0.92

BYS – tail I18 0.86 0.85 0.86

BYS – fin I18 0.86 0.86 0.86

BYS – body I18 0.75 0.86 0.92

Table 5 Comparison of primers within the di¡erent BlackYellow (BYS) colours found in the BYS strain by band-shar-ing (the various colours of tail, ¢n and body in strain F1 areshown inTable 2)

Primer Tail Fin Body

Tail I03 0.88 0.88 0.88

Fin I03 1 1

Body I03 1

Tail ZG4 1 1 1

Fin ZG4 1 1

Body ZG4 1

Tail I18 0.80 0.80 0.66

Fin I18 0.80 0.86

Body I18 0.66

Table 6 Comparison of primers within the di¡erent BlackYellow colours found in the Red Flame (RFS) strain by band-sharing (the various colours of tail, ¢n and body in strain F1are shown inTable 2)

Primer Tail Fin Body

Tail I03 1 1 1

Fin I03 1 1

Body I03 1

Tail ZG4 1 1 1

Fin ZG4 1 1

Body ZG4 1

Tail I18 0.80 1 0.8

Fin I18 0.80 0.8

Body I18 1



genus Poecilia (Cyprinodontiformes: Poeciliidae).Molecu-lar Phylogenetics and Evolution12,95^104.

Billington N. & Herbert P.D. (1988) Mitochondrial DNAvari-ation in Great Lakes walleye (Stizostedion vitreum) popula-tions. CanadianJournal of Fisheries andAquatic Sciences 45,2114^2122.

Bowers N., Stau¡er J.R. & KocherT.D. (1994) Intra- and inter-speci¢c mitochondrial DNA sequence variation withintwo species of rock-dwelling cichlids (Teleostei: Cichlidae)from Lake Malawi, Africa. Molecular Phylogenetics andEvolution 3,75^82.

BrownW.M., George M. & Wilson A.C. (1979) Rapid evolu-tion of animal mitochondrial DNA. Proceedings of theNational Academy of Sciences USA 76,1967^1971.

Cheong L. (1996) Overview of the current internationaltrade in ornamental ¢sh, with special reference to Singa-pore. Revue ScienceTechnology15, 445^481.

Degani G. & LevcovitchY. (1991) Electrophoretic variation insome cichlid species in Israel. Comparative Biochemistryand Physiology 99B, 463^467.

Degani G., Pitcovski J., Dobski T. & PlotskyY. (1997) DNA ¢n-gerprint bands applied to analysis of variation in angel-¢sh (Pterophyllum scalare) (Cichlidae) strains. JournalAquaculture inTropic12, 43^51.

DeWoody J.A. & Avise J.C. (2000) Microsatellite variation inmarine, freshwater and anadromous ¢shes comparedwith other animals. Journal of Fish Biology 56, 461^473.

Fryer G. & Iles T.D. (1972) The Cichlid Fishes of the Great Lakesof Africa. Oliver and Boyd, London, UK.

Funkenstein B., Carvari B., StadieT. & Davidovitch (Yache) E.(1990) Restriction site polymorphism of mitochondrialDNA of the gilthead sea bream (Spaurus aurata) brood-stock in Eilat, Israel. Aquaculture 89, 217^223.

Greenwood P.N., Rosen D.E., Weitzman S.H. & Meyer G.S.(1966) Phyletic studies of Teleostean ¢shes with a provi-sional classi¢cation of living forms. Bulletin of AmericanMuseum Natural History131,339^445.

Grewe P.M. & Herbert P.D.N. (1988) Mitochondrial DNA di-versity among broodstocks of the lake trout Salvelinus na-maycush. Canadian Journal of Fisheries and Aquatic Science45, 2114^2122.

GyllenstenU.,Wharton D. &Wilson A.C. (1985) Maternal in-heritance of mitochondrial DNA during backcrossing oftwo species of mice. Journal of Heredity 76,321^324.

Hamilton A. (2001) Phylogeny of Limia (Teleostei: Poecili-idae) based on NADH dehydrogenase subunit 2 sequenc-es.Molecular Phylogenetics and Evolution19, 277^289.

Herzberg A. (1978) Electrophoretic esterase patterns of thesurface mucus for the identi¢cation of tilapia species.Aquaculture13,81^83.

Hutchinson C.A., Newbold J.E., Potter S.S. & Edyell M.H.(1974) Maternal inheritance of mammalian mitochon-drial DNA. Nature 251,536^538.

Jackson K., Goldberg D., Yehuda Y. & Degani G. (2000)Molecular DNA variation in Koi (Cyprinus carpio) of var-ious color patterns. Israel Journal of Aquaculture 52,151^158.

Je¡reys A.J. & Morton D.B. (1987) DNA ¢ngerprints of dogsand cats. Animal Genetics18,1^15.

KirpichnikovV.S. (1981) The genetics of aquarium ¢sh spe-cies. In: Genetic Bases of Fish Selection. Springer-Verlag,NewYork, USA,77pp.

Kocher T.D., Conroy J.A., McKaye K.R., Stau¡er J.R. & Lock-wood S.F. (1995) Evolution of the ND2 gene in EastAfrican cichlids. Molecular Phylogenetics and Evolution 4,420^432.

LeeW.J., Conroy J., HowellW.H. & Kocher T.D. (1995) Struc-ture and evolution of ¢sh mitochondrial control regions.Molecular Phylogenetics and Evolution 41,54^66.

Maniatis T., Fritsch E.F. & Sambrook J. (1982)Molecular Clon-ing ^ A Laboratory Manual. Cold Spring Harbor Labora-tory, NewYork, USA.

Nakadate M.,Takahito ShikanoT. & Taniguchi N. (2003) In-breeding depression and heterosis in various quantitativetraits of the guppy, Poecilia reticulata. Aquaculture 220,219^226.

Nakajima M. & Taniguchi N. (2001) Genetics of the guppyasa model for experiment in aquaculture. Genetica 111,279^289.

Parker R.E. (1976) Introduction of Statistics for Biology, pp.26^27. Camelot Press, Southampton, UK.

Raymonds S. & Weintraub L.S. (1959) Acrylamide gel asa supporting medium for zone electrophoresis. Science130,711.

Reed D.L., deGravelle M.J. & Carpenter K.E. (2001) Molecularsystematics of Selene (Perciformes: Carangidae) based oncytochrome b sequences. Molecular Phylogenetics andEvolution 21, 486^457.

Smithies D. (1955) Zone electrophoresis in starch gel: groupvariations in the serumproteins of normal humanadults.BiochemistryJournal 61, 241^269.

Wetton J.H., Carter R.E., Parkin D.T. & Walters D. (1987)Demographic study of a wild house sparrow populationby DNA ¢ngerprinting. Nature 327, 2147^2148.



application of rapd and cytochrome ... - web.macam.ac.ilweb.macam.ac.il/~gad100/aaa cv gad 2010...

Documents