ATGACTGCGTGTCATGCCAGGCTAACTGCATGCTGATCGTACTCGATCATGTGGTTAAGTACTCGTCAATCGCTTGCATATGTCTAGTCGCTAGCTGTACTCGATCGATGCACTGATCATTTCCCGAGCGTATACTGCGTCCAA

Dup Chr7

N Chr7

Microscopically-visible abnormalities~0.4-0.6% of population-disease risk depends on type of alteration

SNP variants-100% of population-percent associated with disease?

Sub-microscopic structural variants~1kb to 3 Mb deletions, duplications, copynumber variants -100% of populations-de novo frequency?-meiotic and mitotic stability?-how do they affect gene expression?-disease risk?

What is content of structural variation in the human genome?What component of that is involved in disease susceptibility?

Technologies are good for finding >50kb changesTechnologies are good for finding >50kb changesComparative Genome Hybridisation:Whole Genome TilePath (WGTP array)

Comparative Intensity Analysis:Affymetrix 500K Early Access SNP chip

TestDNA

Reference DNA

•26,973 large insert clones •94.4% of euchromatin

TestDNA 1

TestDNA 2

Constructing a CNV map of the human genome

Matt Hurles/Nigel Carter (Sanger), Charles Lee (Harvard), Keith Jones (Affymetrix), Hiro Aburatani (Univ. of Tokyo), Xavier Estivill (Spain), Steve Scherer (Toronto)

-269 Hapmap samples examined using tiling BAC + Affy 500k

-1448 CNVs

-360 Mb of CNVs in 269 HapMap samples covering 12%Of genome

-avg. size 254 kb

-avg. of 111 CNVs per genome

~10-20 Mb CNV per genome

-overlap 2,909 genes

-overlap 286 OMIM genes

Consortium unpublished

The next frontier…

-robust identification of variants in 1-50 kb size-optical mapping (D. Schwarz)-paired-end clone mapping (E. Eichler)-other techniques

-technologies that capture all variation? -complete sequencing and comparison