aversatile set of ligation-independent cloning vectors · breakthrough technologies aversatile set...

Breakthrough Technologies

A Versatile Set of Ligation-Independent Cloning Vectorsfor Functional Studies in Plants1[C][W][OA]

Bert De Rybel2, Willy van den Berg2, Annemarie S. Lokerse, Che-Yang Liao3, Hilda van Mourik,Barbara Möller, Cristina I. Llavata-Peris, and Dolf Weijers*

Wageningen University, Laboratory of Biochemistry, 6703 HA Wageningen, The Netherlands

With plant molecular biology in the omics era, there is a need for simple cloning strategies that allow high throughput tosystematically study the expression and function of large numbers of genes. Such strategies would facilitate the analysis ofgene (sub)families and/or sets of coexpressed genes identified by transcriptomics. Here, we provide a set of 34 ligation-independent cloning (LIC) binary vectors for expression analysis, protein localization studies, and misexpression that will bemade freely available. This set of plant LIC vectors offers a fast alternative to standard cloning strategies involving ligase orrecombination enzyme technology. We demonstrate the use of this strategy and our new vectors by analyzing the expressiondomains of genes belonging to two subclades of the basic helix-loop-helix transcription factor family. We show that neither theclosest homologs of TARGET OF MONOPTEROS7 (TMO7/ATBS1) nor the members of the ATBS1 INTERACTING FACTORsubclade of putative TMO7 interactors are expressed in the embryo and that there is very limited coexpression in the primaryroot meristem. This suggests that these basic helix-loop-helix transcription factors are most likely not involved in TMO7-dependent root meristem initiation.

Whole-genome analysis is becoming a standard anal-ysis tool in reverse genetics plant research. Further-more, there is often the need to study large genefamilies in Arabidopsis (Arabidopsis thaliana) due toredundancy. For these and other reasons, there is anincreasing need in plant research for fast cloning strat-egies. Besides speed, these methods have to be charac-terized by easy handling in order to, for example, verifyprotein localizations with moderately high throughput.Unfortunately, most currently available cloning meth-ods are not able to combine these characteristics. Cur-rent cloning procedures are either laborious and slow(such as classical cloning) or quick but expensive (suchas the Gateway technology; Curtis and Grossniklaus,2003; Karimi et al., 2007). Other, more recent advances,

such as BAC recombineering (Zhou et al., 2011), whileallowing precision cloning, have a clear disadvantagein that they introduce not only a gene of interest, but acomplete genomic region. An emerging single-stepmethod that is very suitable for moderate high-throughput cloning is ligation-independent cloning(LIC; Li and Elledge, 2007; Eschenfeldt et al., 2009).The LIC cloning system is characterized by a fewsimple steps, including linearization of the vector,amplification of the fragment of interest, the creationof sticky ends on the vector and insert by the 3#-5#exonuclease activity of T4 DNA polymerase, andsubsequent annealing of the fragment into the vector(Fig. 1). A related type of LIC cloning has been described,facilitating the assembly of multiple fragments in onereaction, called sequence and ligation-independentcloning, using in vitro homologous recombination andsingle-strand annealing (Li and Elledge, 2007). Formost projects, however, single-purpose LIC cloning issufficient.

Despite its potential to become a good alternative forcurrent cloning strategies, LIC cloning has not beenreadily used in plant research so far, perhaps due tothe absence of a comprehensive set of vectors. Over theyears, only a small number of LIC-based vectors havebeen made available for protein production and puri-fication (Doyle, 2005; Bardóczy et al., 2008), in plantaexpression (Oh et al., 2010), and construction of hair-pin constructs (Hauge et al., 2009; Xu et al., 2010).Although these vectors are very useful for these pur-poses, a comprehensive collection of LIC-based vec-tors in plant research was missing.

Here, we describe the creation of a multipurpose setof 34 LIC-compatible plant LIC vectors (pPLVs; Fig. 3;Table I) for expression analysis, protein localization

1 This work was supported by a long-term FEBS fellowship and aMarie Curie long-term FP7 Intra-European fellowship (IEF–2009–252503 to B.D.R.) and by funding from the Netherlands Organizationfor Scientific Research (grant nos. ALW–816.02.014 and ALW–VIDI–864.06.012) and the European Commission 7th Framework Program(Initial Training Network “SIREN”; contract no. 214788 to D.W.).

2 These authors contributed equally to the article.3 Present address: Institute for Biology III, Freiburg University,

D–79104 Freiburg, Germany.* Corresponding author; e-mail [email protected] author responsible for distribution of materials integral to the

findings presented in this article in accordance with the policydescribed in the Instructions for Authors (www.plantphysiol.org) is:Dolf Weijers ([email protected]).

[C] Some figures in this article are displayed in color online but inblack and white in the print edition.

[W] The online version of this article contains Web-only data.[OA] Open Access articles can be viewed online without a sub-

scription.www.plantphysiol.org/cgi/doi/10.1104/pp.111.177337

1292 Plant Physiology�, July 2011, Vol. 156, pp. 1292–1299, www.plantphysiol.org � 2011 American Society of Plant Biologists

Dow

nloaded from https://academ

ic.oup.com/plphys/article/156/3/1292/6108721 by guest on 30 June 2021

studies, and various misexpression analyses in Arabi-dopsis and other plant species.

RESULTS

Generating a Series of Vectors for LIC

We generated a versatile set of LIC vectors for generaluse in plant molecular biology. These include vectorsfor expression analysis of promoter fragments, proteinlocalization studies, misexpression (using several dif-ferent promoters), as well as standard empty vectors togenerate custom LIC vectors for other purposes (Table I;Fig. 1). A range of fluorescent proteins, triple GFP, superCYAN FLUORESCENT PROTEIN (sCFP), super YEL-LOW FLUORESCENT PROTEIN (sYFP), and tandem-Tomato were selected and used due to their higher

quantum yields compared to the original fluorescentproteins (Shaner et al., 2004; Kremers et al., 2006). Fur-thermore, the pGIIK/B/H-LIC-sYFP-NOSt and pGIIK/B/H-LIC-sCFP-NOSt vectors can be used for Förster re-sonance energy transfer as measured by fluorescencelifetime imaging analyses to detect protein-proteininteractions in plants. Almost all of the vectors areavailable with different antibiotic resistances, increas-ing the versatility of this set of vectors through com-binatorial use of multiple transgenes. All constructedvectors are based on a binary pGreenII (pGII) vectorbackbone with kanamycin (K), phosphinothricin/basta(B), or hygromycin (H) resistance (Hellens et al., 2000),in which a custom LIC site was introduced using EcoRIand BamHI restriction sites (Fig. 1).

The pGIIK/B/H-LIC-NOSt vectors served as thebase for the LIC vectors that were generated, exceptfor the pPLV04 vector, which was modified from apreviously described pGIIB-SV40-3GFP-NOSt vector(Takada and Jürgens, 2007). The custom LIC site thatwas introduced contains a unique HpaI restriction site,which is used for linearizing vectors (Fig. 1). Thevectors used for expression analysis and protein lo-calization were created by introducing the respectivefluorescent protein or GUS fragment in the BamHIrestriction site at the 3# flank of the LIC site. In proteinlocalization vectors, the resulting linker between thegenomic fragment (without stop codon) and the fluo-rescent protein is illustrated in Figure 2. The forwardprimer used to amplify the fluorescent proteins alsocreated a SpeI restriction site, which was used tointroduce the SV40 nuclear localization signal in thevectors used for expression analysis of promoter frag-ments. To allow cloning of the tandemTomato vectors,a remnant 424-bp Lac promoter fragment, whichcaused a reverse reading frame in combination withthe tandem Tomato, was removed. This Lac promoterfragment at the 3# end of the construct was removedby cutting with NotI and StuI restriction enzymesand reintroducing an MluI restriction site. Standardanalyses of protein localization are done using theendogenous promoter by cloning the full genomicfragment in the protein localization vectors. This hasthe advantage of capturing all potential regulatorysequences both in the promoter region and in intronicregions. Nevertheless, these vectors could also beeasily adapted to drive expression from differentpromoters by inserting these into the multiple cloningsite upstream of the LIC site by standard cloningstrategies or by cloning a chimeric construct (createdusing standard overlap extension PCR) into the exist-ing vectors. For the misexpression vectors, the p35Sand pRPS5a promoters (Odell et al., 1985; Weijerset al., 2001) were introduced using KpnI and ApaIrestriction enzymes. The pRPS5a promoter fragmentcontained an HpaI restriction site, which had to bemutated in order to enable linearization of the vector.For this, we mutated the GTTAAC sequence of theHpaI site into GTAAAC using site-directed mutagen-esis (Sawano and Miyawaki, 2000) without affecting

Figure 1. LIC cloning procedure with modified LIC site. Vectors are firstdigested with HpaI restriction enzyme, and fragments are amplified byPCRwith primers containing the LIC adapter sites. Overhangs are madeby the 3#-5# exonuclease activity of T4 DNA polymerase in excess ofdCTP or dGTP for the vector and fragment, respectively. The sticky endoverhangs that are created allow for easy annealing of vector and insert.LB, Left border; ori, origin of replication; RB, right border. [See onlinearticle for color version of this figure.]

A Set of LIC Vectors for Functional Studies in Plants

Plant Physiol. Vol. 156, 2011 1293

Dow



the promoter activity. The pMP promoter (Schlerethet al., 2010) was introduced using KpnI and XhoIrestriction enzymes, and the GAL4-dependent pUAS(upstream activating sequence;West et al., 1984; Weijerset al., 2003) fragment was cloned using PstI and BamHIrestriction sites. An overview of the set of LIC vectorsis given in Figure 3 and Table I.

The overall efficiency of the LIC-based vector cloningdescribed here is very high, although it is important tonote that, in our hands, LIC cloning works best whenhigh concentrations (about 1.5 mg for one T4 treatment)of very pure vector and PCR fragment are used for theT4 treatment. Although there can be a large variabilityin the number of colonies after transformation, the rateof positive colonies is usually high (between 60% and100%). Due to the reduced stability of the triple GFPconstruct in Escherichia coli, cloning with the pPLV04vector as well as cloning larger fragments (.5 kb) into

any of the vectors can be less efficient. Nonetheless, weroutinely clone fragments of up to 5 kb in several ofthese LIC vectors.

Examples of Constructs Generated by LIC

To provide an example of the speed and efficiency ofour LIC-based vectors, we analyzed the promoter

Table I. Overview of LIC-compatible vectors

Respective use, names, antibiotic resistances, remarks, size in base pairs, and required LIC adapter sites for forward and reverse primers used toamplify the required fragment are indicated. ppt, Phosphinothricin; tdTomato, tandemTomato.

Use pPLV VectorAntibiotic

Resistance

Adapter Forward

Primer 5#-3#Adapter Reverse

Primer 5#-3#

Basic vector forcustom use

pPLV01 pGIIB-LIC-NOSt Basta/ppt – –

pPLV02 pGIIK-LIC-NOSt Kanamycin – –pPLV03 pGIIH-LIC-NOSt Hygromycin – –

Promoter analysis pPLV04 pGIIK-LIC-SV40-3xGFP-NOSt Kanamycin TAGTTGGAATGGGTTCGAA TTATGGAGTTGGGTTCGAApPLV05 pGIIB-LIC-SV40-sYFP-NOSt Basta/ppt TAGTTGGAATGGGTTCGAA TTATGGAGTTGGGTTCGAApPLV06 pGIIK-LIC-SV40-sYFP-NOSt Kanamycin TAGTTGGAATGGGTTCGAA TTATGGAGTTGGGTTCGAApPLV07 pGIIB-LIC-SV40-sCFP-NOSt Basta/ppt TAGTTGGAATGGGTTCGAA TTATGGAGTTGGGTTCGAApPLV08 pGIIK-LIC-SV40-sCFP-NOSt Kanamycin TAGTTGGAATGGGTTCGAA TTATGGAGTTGGGTTCGAApPLV09 pGIIH-LIC-SV40-sCFP-NOSt Hygromycin TAGTTGGAATGGGTTCGAA TTATGGAGTTGGGTTCGAApPLV10 pGIIB-LIC-SV40-tdTomato-NOSt Basta/ppt TAGTTGGAATGGGTTCGAA TTATGGAGTTGGGTTCGAApPLV11 pGIIK-LIC-SV40-tdTomato-NOSt Kanamycin TAGTTGGAATGGGTTCGAA TTATGGAGTTGGGTTCGAApPLV12 pGIIH-LIC-SV40-tdTomato-NOSt Hygromycin TAGTTGGAATGGGTTCGAA TTATGGAGTTGGGTTCGAApPLV13 pGIIB-LIC-GUS-NOSt Basta/ppt TAGTTGGAATGGGTTCGAA TTATGGAGTTGGGTTCGAApPLV14 pGIIK-LIC-GUS-NOSt Kanamycin TAGTTGGAATGGGTTCGAA TTATGGAGTTGGGTTCGAApPLV15 pGIIH-LIC-GUS-NOSt Hygromycin TAGTTGGAATGGGTTCGAA TTATGGAGTTGGGTTCGAA

Protein localization pPLV16 pGIIB-LIC-sYFP-NOSt Basta/ppt TAGTTGGAATGGGTTCGAA TTATGGAGTTGGGTTCGAACpPLV17 pGIIK-LIC-sYFP-NOSt Kanamycin TAGTTGGAATGGGTTCGAA TTATGGAGTTGGGTTCGAACpPLV18 pGIIH-LIC-sYFP-NOSt Hygromycin TAGTTGGAATGGGTTCGAA TTATGGAGTTGGGTTCGAACpPLV19 pGIIB-LIC-sCFP-NOSt Basta/ppt TAGTTGGAATGGGTTCGAA TTATGGAGTTGGGTTCGAACpPLV20 pGIIK-LIC-sCFP-NOSt Kanamycin TAGTTGGAATGGGTTCGAA TTATGGAGTTGGGTTCGAACpPLV21 pGIIH-LIC-sCFP-NOSt Hygromycin TAGTTGGAATGGGTTCGAA TTATGGAGTTGGGTTCGAACpPLV22 pGIIB-LIC-tdTomato-NOSt Basta/ppt TAGTTGGAATGGGTTCGAA TTATGGAGTTGGGTTCGAACpPLV23 pGIIK-LIC-tdTomato-NOSt Kanamycin TAGTTGGAATGGGTTCGAA TTATGGAGTTGGGTTCGAACpPLV24 pGIIH-LIC-tdTomato-NOSt Hygromycin TAGTTGGAATGGGTTCGAA TTATGGAGTTGGGTTCGAACpPLV13 pGIIB-LIC-GUS-NOSt Basta/ppt TAGTTGGAATGGGTTCGAA TTATGGAGTTGGGTTCGAACpPLV14 pGIIK-LIC-GUS-NOSt Kanamycin TAGTTGGAATGGGTTCGAA TTATGGAGTTGGGTTCGAACpPLV15 pGIIH-LIC-GUS-NOSt Hygromycin TAGTTGGAATGGGTTCGAA TTATGGAGTTGGGTTCGAAC

Misexpression pPLV25 pGIIB-p35S-LIC-NOSt Basta/ppt TAGTTGGAATAGGTTC AGTATGGAGTTGGGTTCpPLV26 pGIIK-p35S-LIC-NOSt Kanamycin TAGTTGGAATAGGTTC AGTATGGAGTTGGGTTCpPLV27 pGIIH-p35S-LIC-NOSt Hygromycin TAGTTGGAATAGGTTC AGTATGGAGTTGGGTTCpPLV28 pGIIB-pRPS5a-LIC-NOSt Basta/ppt TAGTTGGAATAGGTTC AGTATGGAGTTGGGTTCpPLV29 pGIIB-pMP-LIC-NOSt Basta/ppt TAGTTGGAATAGGTTC AGTATGGAGTTGGGTTCpPLV30 pGIIK-pMP-LIC-NOSt Kanamycin TAGTTGGAATAGGTTC AGTATGGAGTTGGGTTCpPLV31 pGIIH-pMP-LIC-NOSt Hygromycin TAGTTGGAATAGGTTC AGTATGGAGTTGGGTTCpPLV32 pGIIB-UAS-LIC-NOSt Basta/ppt TAGTTGGAATGGGTTCGAA TTATGGAGTTGGGTTCGAACpPLV33 pGIIK-UAS-LIC-NOSt Kanamycin TAGTTGGAATGGGTTCGAA TTATGGAGTTGGGTTCGAACpPLV34 pGIIH-UAS-LIC-NOSt Hygromycin TAGTTGGAATGGGTTCGAA TTATGGAGTTGGGTTCGAAC

Figure 2. The linker introduced by LIC cloning. As an example, thelinker is shown between a genomic fusion without stop codon and afluorescent protein of choice (sYFP) by LIC cloning. AA, Amino acid.[See online article for color version of this figure.]

De Rybel et al.

1294 Plant Physiol. Vol. 156, 2011

Dow



expression domains of TARGET OF MONOPTEROS7(TMO7/ATBS1; Wang et al., 2009; Schlereth et al.,2010) and its three closest homologs, namely, PRE1/BNQ1, PRE2/BNQ2, and PRE4/BNQ3 (Lee et al.,2006; Mara et al., 2010).TMO7was first identified as Activation-Tagged Bri1-

Suppressor1 (ATBS1) in a screen for genes that couldrescue the dwarfed bri1 phenotype when overex-pressed (Wang et al., 2009). More recently, TMO7/ATBS1 (from now on referred to asTMO7) was found tobe a direct target of MP and is required during embryo-genesis (Schlereth et al., 2010). Specifically, TMO7 was

shown to move from the proembryo toward the up-permost suspensor cell to specify this cell as hypophy-sis, which is required for establishing the primary rootmeristem (Schlereth et al., 2010). Although RNA inter-ference suppression of TMO7 led to embryo defects anda low rate of rootless seedlings (Schlereth et al., 2010), itis still possible that other closely related genes actredundantly with TMO7. As a first step in addressingthis issue, we tested the expression of TMO7 and itsfour closest homologs by fusing their promoters toSV40-3xGFP in the pPLV04 vector (Fig. 3). None of theTMO7 homologs showed any expression during em-

Figure 3. Overview of LIC vectors. Indicated areleft and right border (LB and RB), NOS promoterand terminator (pNOS and NOSt), resistancegenes (B/K/H), nuclear localization signal (SV40),the LIC site (LIC), specific promoters for misex-pression (p35S, pRPS5a, pMP, and upstream acti-vating sequence), and respective fluorescentproteins (GFP, sCFP, sYFP, and tandemTomato).[See online article for color version of this figure.]



Dow



bryo development (data not shown); therefore, weanalyzed the expression patterns in the postembryonicroot. Consistent with its role in the establishment of theprimary root meristem, TMO7 was strongly expressedin the quiescent center and surrounding proximal stemcells, but absent from the columella root cap cells (Fig.4). The TMO7 homolog bHLH161/PRE4/BNQ3 wasonly expressed in the lateral root cap, while bHLH166,bHLH136/PRE1/BNQ1, and bHLH134/PRE2/BNQ2were weakly expressed in the root cap and columellacells (Fig. 4). Hence, it appears that none of the TMO7relatives shows a strong coexpression with TMO7 dur-ing embryogenesis or in the primary root meristem. Inthe mature root, however, there is an overlap in expres-sion domains for TMO7, bHLH161, and bHLH166, butnot for bHLH136 or bHLH134 (Supplemental Fig. S1).

In a yeast two-hybrid screen, four closely relatedbasic helix-loop-helix (bHLH) transcription factorswere shown to be able to interact with TMO7 andwere named ATBS1 interacting factors (AIF1-4; Wanget al., 2009). Although TMO7 was shown to interactwith AIF1-4 in vitro and in vivo (in seedlings over-expressing both AIF1 and TMO7), it is not clearwhether these genes are actually expressed in the sametissues and, thus, if their interaction is biologicallymeaningful.

To address this question, we analyzed the expressionof the four AIF1-4 genes as well as that of the relatedbHLH151/UPB (Tsukagoshi et al., 2010), bHLH158,and bHLH159 genes. Again, none of these genes appearsto be expressed during embryo development (datanot shown). In the primary root meristem, bHLH150/AIF1 expression cannot be detected, while bHLH148/AIF2, bHLH147/AIF3, and bHLH149/AIF4 are allexpressed in the root cap and lower columella cells(Fig. 4). A similar expression pattern was observedfor bHLH158, while bHLH159 is expressed in thelateral root cap and vascular tissues. Similar to pub-lished data (Tsukagoshi et al., 2010), bHLH151/UPBis expressed in the lateral root cap and in the vasculartissues (Fig. 4). In the mature root, bHLH149/AIF4,bHLH150/AIF1, bHLH151/UPB, and bHLH159 areexpressed in all cell types, while bHLH148/AIF2 andbHLH147/AIF3 appear to be more specific for vascu-lar tissues (Supplemental Fig. S1).

Additionally, we analyzed the protein localization(pPLV16 or pGIIB-LIC-sYFP-tNOS vector) for some ofthese bHLH transcription factors to support the ex-pression domains found using the pPLV04 (pGIIK-LIC-SV40-3GFP-tNOS) vector (Supplemental Fig. S2).All analyzed protein localization domains fully over-lapped with the promoter expression domains and

Figure 4. Overview of promoter expression patternsof a subclade of TMO7-related bHLH transcriptionfactors using the pGIIK-LIC-VP40-3GFP-NOSt vec-tor. The phylogenetic tree shows a subclade of thebHLH transcription factors based on full-length pro-tein sequences. Branch lengths indicate phylogeneticdistances (see scale bar: fraction of deviations). Con-focal images of primary rootmeristemswere counter-stained using FM4-64 dye (red). [See online articlefor color version of this figure.]

De Rybel et al.


Dow



with available data for bHLH151/UPB (Tsukagoshiet al., 2010), supporting the validity of this set ofvectors.

DISCUSSION

We have created a set of LIC-compatible vectors fordiverse purposes in plant molecular biology research,including expression analysis of promoter fragments,protein localization studies, and misexpression. LICcloning allows for a single-step way to clone in amoderately high-throughput fashion. Despite the ob-vious advantages of LIC cloning, there are somedrawbacks using this system. The most obvious down-side is that every fragment needs to be sequencedwhen used in different vectors, which is not the casefor Gateway cloning. This highlights the need for ahigh-quality proofreading polymerase enzyme foramplification. In our hands, however, we only veryrarely encounter erroneous base pairs (e.g. one mis-take in 10 to 20 kb sequenced; in line with the error rateof the proofreading polymerase used). Another dis-advantage is that cloned fragments cannot be re-combined as with Gateway cloning. However, in ourexperience, this is not a problem for most purposessince the majority of cloning reactions are single-purpose projects.The set of vectors presented here allowed us to

misexpress all members of a gene family of over 20members from four different promoters and to deter-mine/validate transcription patterns for up to 150genes identified in microarray experiments (data willbe published elsewhere). Here, as an example, we showthe use of one of our LIC-compatible vectors to examinethe promoter expression domains of the TMO7 sub-clade of bHLH transcription factors and its putativeAIFinteractors. Interestingly, none of the examined homo-logs showed expression or overlap in expression withTMO7 in the embryo or in the hypophysis descendantsin the primary root meristem, further supporting theproposed single gene function for TMO7 in root mer-istem establishment (Schlereth et al., 2010). Further-more, there is no expression of the putative AIF1-4interactors in the embryo nor is there a coexpressionwith the TMO7 expression domain in the primary rootmeristem. Notably, bHLH150/AIF1 does not appear tobe expressed in the embryo nor the root meristem,precluding the possibility of an interaction with TMO7in these tissues. In conclusion, our analysis has shownthat none of the TMO7 homologs or its putative inter-actors is likely to be involved in the process of TMO7-dependent root meristem initiation.In the primary root, however, several of the analyzed

bHLH transcription factors have overlapping expres-sion domains with TMO7, allowing potential interac-tions in these tissues. Furthermore, as the TMO7 proteinwas shown to move from the proembryo to the futurehypophysis during embryonic root development(Schlereth et al., 2010), we cannot exclude a similar

movement to the columella cells in the primary rootmeristem. Therefore, an overlap in the protein expres-sion domains (and potential for interaction) betweenTMO7 and bHLH148/AIF2, bHLH147/AIF3, andbHLH149/AIF4 in the columella region remains pos-sible. In any case, further research is required toinvestigate the biological significance of these interac-tions. Furthermore, it is important to note that theexpression domains of previously published genes,such as bHLH151/UPB (Tsukagoshi et al., 2010),are identical to what we have found using our LIC-compatible vectors, supporting the quality of our setof vectors.

In conclusion, we believe that this set of LIC-compatible vectors will provide a useful resource forresearchers in plant biology that depend highly oncloning of large numbers of constructs. Therefore, theavailability of this quick and versatile cloning systemmay aid progress in the current omics era.

MATERIALS AND METHODS

The pPLV vectors are all available from the Nottingham Arabidopsis Stock

Centre. The sequences of all vectors have been added to the article as a

supplemental text file (Supplemental Data Set S1) and are accessible at

GenBank (http://www.ncbi.nlm.nih.gov/genbank/). Accession numbers are

provided in Figure 3.

To introduce a fragment of interest into a LIC-based vector, extensions are

added to the fragment during amplification by PCR using primers with LIC

adapter sites (Table I). This LIC-compatible fragment is next treated with T4

DNA polymerase and an excess of dGTP. The 3#-5# exonuclease activity of theT4 DNA polymerase creates 15-bp single-strand overhangs (Fig. 1). LIC

vectors are prepared by linearizing using a unique restriction site in the LIC

site of the vector. Subsequent T4 DNA polymerase treatment with excess of

dCTP then creates 15-bp single-strand overhangs, complementary to those

available on the T4-treated fragment (Fig. 1). Vector and insert are then

combined, allowed to anneal, and transformed into a bacterial host, which will

repair the introduced nicks. The sequence of the LIC site itself ensures correct

orientation of the inserted fragment. A detailed protocol can be found below

and a quick lab protocol in the supplemental data online.

Preparation of Vectors

For a standard preparation, 2 to 4 mg of vector is cut with 1 mLHpaI fast cut

restriction enzyme (Fermentas) in duplicate for 2 h at 37�C. Linearized vectoris next purified from agarose gel using the QIAEXII gel extraction kit (Qiagen),

and duplicates are pooled. Linearized vectors are then precipitated overnight

(or minimum 2 h) using 0.5 volumes ammonium acetate (7.5 M) and 2.5

volumes of 100% ethanol at 220�C. The precipitated vector is pelleted bycentrifugation for 30 min at maximum speed. The supernatant is removed,

and the pellet is washed with 100 mL of 70% ethanol followed by a 100%

ethanol wash. The pellet is next dried and resuspended in 50 mL of water (at

50�C for 5 to 10 min). For T4 treatment (New England Biolabs), 200 to 400 ngof linearized vector, 4 mL 103 T4 buffer, 4 mL 100 mM dCTP, 2 mL 100 mMdithiothreitol, 0.4 mL bovine serum albumin, 0.8 mLT4 DNA polymerase (New

England Biolabs), and water to 40 mL total volume are mixed. The mixture is

centrifuged at maximum speed for 1 min, incubated at 22�C for at least 30 min(up to 2 h), inactivated at 75�C for 20 min, and centrifuged again at maximumspeed for 1 min. T4 treated vectors can be stored at 4�C until further use.

Preparation of Fragments

The DNA fragment of choice is first amplified by PCR using primers with

respective LIC adapter sites (dependent on destination vector; Table I). PCR is

performed in 50-mL volume in duplicate using Phusion Flash polymerase

(Finnzymes; or another high-quality polymerase enzyme with proofreading)



Dow



using the amplification protocol provided by the supplier. Fragments are next

purified from agarose gel using the QIAEXII gel extraction kit, and duplicates

are pooled. For T4 treatment (New England Biolabs), 200 to 400 ng of purified

fragment, 2mL 103 T4 buffer, 2mL 100mMdGTP, 1mL 100mM dithiothreitol, 0.2mL bovine serum albumin, 0.4 mLT4 DNA polymerase (New England Biolabs),

and water to 20 mL total volume are mixed. The mixture is centrifuged at

maximum speed for 1 min, incubated at 22�C for at least 30 min (up to 2 h),inactivated at 75�C for 20 min, and centrifuged again at maximum speed for1 min. T4 treated fragments can be stored at 4�C until further use.

Annealing, Transformation in Escherichia coli, andSequence Verification

To anneal the linearized, T4-treated vector and the T4-treated PCR frag-

ment, 10 to 40 ng vector and insert are combined in a 1:3 molar ratio for 30 min

to 2 h at 22�C (usually about 1 to 3 mL each) or overnight at 4�C. The wholemixture is then transformed into electrocompetent DH5a E. coli cells (trans-

formation efficiency .107 colony forming units/mg), plated on Luria-Bertani(LB)-agar plates with 25 mg/L kanamycin as antibiotic (Table I), and incu-

bated at 37�C overnight. AT4-treated vector without added insert can be usedto analyze the amount of background colonies. The next day, colonies are

verified for inserts using colony PCR and positives grown overnight in 6 mL

LB with 25 mg/L kanamycin. Plasmids are extracted (GeneJET plasmid mini

prep kit from Fermentas) and checked by restriction digest before sequencing.

Because of the proofreading DNA polymerase, point mutations are very

uncommon.

A Simplified Plant Transformation Procedure AllowingModerate Throughput

Plasmids are transformed into electrocompetent Agrobacterium tumefaciens

GV3101 containing the pGreen helper plasmid pSOUP (Hellens et al., 2000)

using standard protocols and plated on LB plates with the appropriate

antibiotics (Table I). Following 2 d of growth at 28�C, a smear of multiplecolonies is inoculated into 20 mL of liquid LB medium with the appropriate

antibiotics and grown overnight at 28�C in a shaker. The next day, the volumeof the culture is increased to 50 mL LB with antibiotics and grown, again at

28�C, to an OD600 of around 0.7 (0.5 to 0.9 is acceptable). If the optical density istoo high, the cultures can be diluted to the correct OD600 using LB. Next, 2.5 g

Suc and 10 to 20 mL Silwet is added to 50 mL of culture and shaken until the

Suc is dissolved. Five to ten plants are then floral dipped in this mixture,

placed in a box, and covered with cling film for 1 d before growing them in the

growth room until seeds can be harvested.

Plant Growth and Selection

Plants (Columbia-0 ecotype) were grown under standard conditions at

23�C in a 16-h-light/8-h-dark cycle. Selection for transgenes was performedon solid Murashige and Skoog medium supplemented with 25 mg/L kana-

mycin (pPLV04) or 15 mg/L phosphinothricin (pPLV16).

Microscopy

Gene expression or protein accumulation was analyzed in roots of homozy-

gous T3 lines carrying a single T-DNA insert as determined by segregation of

kanamycin or phosphinothricin resistance. Four- to five-day-old vertically grown

seedlings were incubated in water containing 1mM FM4-64 (Invitrogen) for 1 min

and subsequently imaged on a Zeiss LSM510 confocal laser scanningmicroscope.

All vector sequences have been deposited at GenBank and can be found using

the following accession numbers: JF909454 (pPLV01), JF909455 (pPLV02), JF909456

(pPLV03), JF909457 (pPLV04), JF909458 (pPLV05), JF909459 (pPLV06),

JF909460 (pPLV07), JF909461 (pPLV08), JF909462 (pPLV09), JF909463







(pPLV31), JF909485 (pPLV32), JF909486 (pPLV33), and JF909487 (pPLV34).

Supplemental Data

The following materials are available in the online version of this article.

Supplemental Figure S1. Overview of promoter expression patterns of a

subclade of TMO7-related bHLH transcription factors using the pGIIK-

LIC-VP40-3GFP-NOSt vector.

Supplemental Figure S2. Comparison between promoter expression

patterns (pGIIK-LIC-VP40-3GFP-NOSt vector) and protein localization

patterns (pGIIB-LIC-sYFP-NOSt vector).

Supplemental Data Set S1. Sequences of pPLV vectors in FASTA format.

Received April 1, 2011; accepted May 5, 2011; published May 11, 2011.

LITERATURE CITED

Bardóczy V, Géczi V, Sawasaki T, Endo Y, Mészáros T (2008) A set of

ligation-independent in vitro translation vectors for eukaryotic protein

production. BMC Biotechnol 8: 32

Curtis MD, Grossniklaus U (2003) A gateway cloning vector set for high-

throughput functional analysis of genes in planta. Plant Physiol 133:

462–469

Doyle SA (2005) High-throughput cloning for proteomics research.

Methods Mol Biol 310: 107–113

Eschenfeldt WH, Lucy S, Millard CS, Joachimiak A, Mark ID (2009) A

family of LIC vectors for high-throughput cloning and purification of

proteins. Methods Mol Biol 498: 105–115

Hauge B, Oggero C, Nguyen N, Fu C, Dong F (2009) Single tube, high

throughput cloning of inverted repeat constructs for double-stranded

RNA expression. PLoS ONE 4: e7205

Hellens RP, Edwards EA, Leyland NR, Bean S, Mullineaux PM (2000)

pGreen: a versatile and flexible binary Ti vector for Agrobacterium-

mediated plant transformation. Plant Mol Biol 42: 819–832

Karimi M, Bleys A, Vanderhaeghen R, Hilson P (2007) Building blocks for

plant gene assembly. Plant Physiol 145: 1183–1191

Kremers GJ, Goedhart J, van Munster EB, Gadella TW Jr (2006) Cyan and

yellow super fluorescent proteins with improved brightness, protein

folding, and FRET Förster radius. Biochemistry 45: 6570–6580

Lee S, Lee S, Yang KY, Kim YM, Park SY, Kim SY, Soh MS (2006)

Overexpression of PRE1 and its homologous genes activates Gibberellin-

dependent responses in Arabidopsis thaliana. Plant Cell Physiol 47:

591–600

Li MZ, Elledge SJ (2007) Harnessing homologous recombination in vitro to

generate recombinant DNA via SLIC. Nat Methods 4: 251–256

Mara CD, Huang T, Irish VF (2010) The Arabidopsis floral homeotic

proteins APETALA3 and PISTILLATA negatively regulate the BAN-

QUO genes implicated in light signaling. Plant Cell 22: 690–702

Odell JT, Nagy F, Chua NH (1985) Identification of DNA sequences

required for activity of the cauliflower mosaic virus 35S promoter.

Nature 313: 810–812

Oh SK, Kim SB, Yeom SI, Lee HA, Choi D (2010) Positive-selection and

ligation-independent cloning vectors for large scale in planta expression

for plant functional genomics. Mol Cells 30: 557–562

Sawano A, Miyawaki A (2000) Directed evolution of green fluorescent

protein by a new versatile PCR strategy for site-directed and semi-

random mutagenesis. Nucleic Acids Res 28: E78

Schlereth A, Möller B, Liu W, Kientz M, Flipse J, Rademacher EH,

Schmid M, Jürgens G, Weijers D (2010) MONOPTEROS controls

embryonic root initiation by regulating a mobile transcription factor.

Nature 464: 913–916

Shaner NC, Campbell RE, Steinbach PA, Giepmans BN, Palmer AE, Tsien

RY (2004) Improved monomeric red, orange and yellow fluorescent

proteins derived from Discosoma sp. red fluorescent protein. Nat

Biotechnol 22: 1567–1572

Takada S, Jürgens G (2007) Transcriptional regulation of epidermal cell

fate in the Arabidopsis embryo. Development 134: 1141–1150

Tsukagoshi H, Busch W, Benfey PN (2010) Transcriptional regulation of

ROS controls transition from proliferation to differentiation in the root.

Cell 143: 606–616

Wang H, Zhu Y, Fujioka S, Asami T, Li J, Li J (2009) Regulation of

De Rybel et al.


Dow



Arabidopsis brassinosteroid signaling by atypical basic helix-loop-helix

proteins. Plant Cell 21: 3781–3791

Weijers D, Franke-van Dijk M, Vencken RJ, Quint A, Hooykaas P,

Offringa R (2001) An Arabidopsis Minute-like phenotype caused by a

semi-dominant mutation in a RIBOSOMAL PROTEIN S5 gene. Devel-

opment 128: 4289–4299

Weijers D, Van Hamburg JP, Van Rijn E, Hooykaas PJ, Offringa R (2003)

Diphtheria toxin-mediated cell ablation reveals interregional communica-

tion during Arabidopsis seed development. Plant Physiol 133: 1882–1892

West RW Jr, Yocum RR, Ptashne M (1984) Saccharomyces cerevisiae GAL1-

GAL10 divergent promoter region: location and function of the up-

stream activating sequence UASG. Mol Cell Biol 4: 2467–2478

Xu G, Sui N, Tang Y, Xie K, Lai Y, Liu Y (2010) One-step, zero-background

ligation-independent cloning intron-containing hairpin RNA constructs

for RNAi in plants. New Phytol 187: 240–250

Zhou R, Benavente LM, Stepanova AN, Alonso JM (2011) A recom-

bineering-based gene tagging system for Arabidopsis. Plant J 66:

712–723



Dow



aversatile set of ligation-independent cloning vectors · breakthrough technologies aversatile set...

Documents