avian reovirus: development of elisa and serum neutralization … · margarida mourão por ser sido...
TRANSCRIPT
Avian Reovirus: Development of ELISA and Serum
Neutralization Tests and Preliminary Gene Cloning for the
Development of a Virus-Like Particle Vaccine
Sofia Cristina Vinagre Caeiro
Thesis to obtain the Master Science Degree in
Biological Engineering
Examination Committee
Supervisors: Dr. Ana Margarida Ferreira Henriques Oliveira Mourão and Prof.
Gabriel António Amaro Monteiro
Chairperson: Prof. Jorge Humberto Gomes Leitão
Supervisor: Dr. Ana Margarida Ferreira Henriques Oliveira Mourão
Members of the Committee: Prof. Maria Ângela Cabral Garcia Taipa Meneses de
Oliveira
November 2017
i
ACKNOWLEDGMENTS
Gostaria de começar por mencionar que o desenvolvimento deste trabalho foi uma das experiências
mais desafiantes que já tive quer a nível académico como pessoal. Várias foram as pessoas envolvidas
neste grande desafio, sendo que cada uma me terá dado o seu contributo e as quais gostaria de
reconhecer, neste pequeno discurso.
Tenho que agradecer imenso à Dra. Margarida Mourão por ser sido uma orientadora muito
compreensiva, sempre disposta a esclarecer as minhas inúmeras questões, pela excelente orientação
que me deu quer no laboratório e no desenvolvimento do trabalho escrito, pela sua disponibilidade e,
claro, por tudo aquilo que me ensinou ao longo destes meses!
Gostaria de agradecer ao Dr. Miguel, por partilhar a sua larga experiência comigo, pelos ensinamentos
que me deu e por partilhar todo o seu entusiasmo pela ciência comigo. Fico muito grata pelas
experiências que me proporcionou.
Gostaria de agradecer também à Dra. Sílvia Barros, à Dra. Teresa Fagulha, à Dra. Fernanda Ramos e
ao Dr. Tiago Luís, que me ajudaram sempre que precisei e sempre se sempre mostraram
disponibilidade para o esclarecimento de dúvidas.
A boa disposição e trabalho em equipa é algo que considero muito valioso e sempre pude encontrar no
INIAV, o que tornou esta experiência ainda mais gratificante. Um especial obrigado pelos momentos
de diversão proporcionados pelo Dr. Tiago Luís e ainda, pelas variadas reuniões seguidas ao almoço.
Gostaria também de agradecer à Beatriz Tavares, que considero que foi a minha companheira de curso
no laboratório, que me facilitou a adaptação ao INIAV e sempre me ajudou quando precisei. Obrigada
pelas conversas e pelos vários momentos que passámos.
Gostaria também de agradecer à restante equipa técnica do laboratório de virologia do INIAV, que me
fizeram sentir sempre acolhida, demonstrando sempre disponibilidade para me ajudar.
Gostaria de agradecer ao Prof. Gabriel Monteiro por ter sido meu mentor nos primeiros anos no IST e
que sempre se mostrou totalmente disponível para esclarecer as minhas dúvidas sobre a tese e me
prestar auxílio no que fosse necessário.
Finalmente, gostaria de agradecer à minha família, em particular aos meus pais, ao meu irmão e à
minha cunhada que sempre me apoiaram no meu percurso académico. Ainda, à minha mãe e ao meu
pai, que sempre me tentaram proporcionar os meios para conseguir concretizar os meus objetivos,
tendo sempre acreditado em mim e encorajando-me a aceitar todos os desafios de forma positiva. Ao
meu namorado, agradeço por toda a compreensão, entusiasmo, encorajamento, apoio prestado
sempre que necessário, por acreditar sempre no meu potencial, me encorajar a dar sempre o melhor
de mim e me mostrar que tudo se consegue com esforço e dedicação. Queria também agradecer ao
João Iria por sempre acreditar em mim, me ouvir sempre quando é necessário e por sempre me
conseguir animar, mesmo durante tempos difíceis. Um obrigado ao João Romba, por ser um excelente
ouvinte e um grande companheiro de batalha.
Obrigada a todos vós!
ii
ABSTRACT
Avian reoviruses (ARVs) are pathogens involved in the development of a variety of disease conditions,
among which, the most relevant are viral arthritis-tenosynovitis, runting-stunting and malabsorption
syndromes, causing considerable losses to the poultry industry worldwide. Recently, there was an
increase number of ARV outbreak reports from vaccinated and unvaccinated flocks worldwide, including
Portugal. The recent outbreaks were attributed to the emergence of new viral strains caused by
mutations of the highly variable outer-capsid σC polypeptide and current commercial vaccines fail to
offer cross-protection against these new field strains.
The aims of this work were the preliminary development of virus-like particles (VLPs) for a vaccine
against the ARV 19371-PT12 strain, using the baculovirus-insect-cell expression system for disease
control, which is a safer, cheaper and highly immunogenic vaccine alternative, and the development of
an indirect enzyme-linked immunosorbent assay (ELISA) and serum neutralization tests (SNT), to prove
that protection against ARV can’t be assured by highly positive results measured by ELISA. The σC, σA
and μB proteins were selected for the construction of VLPs, but only the σC and σA encoding genes
were successfully amplified and cloned into the pIEx/Bac-1 transfer vector. A highly specific ELISA, was
developed and validated for the detection of antibodies against ARV. The inter and intra-assay
coefficients of variability were 9.1% and 1.6%, respectively. The SNT demonstrated that highly ELISA-
positive serum samples produced very low virus neutralizing titers. A western immunoblot assay
supported these results, showing that the antibody production was not being directed towards
neutralizing antibodies.
KEYWORDS
Avian reovirus; viral arthritis/tenosynovitis; virus-like particle vaccines; indirect ELISA; serum
neutralization test; western immunoblot
iii
RESUMO
Os reovírus aviários (ARVs) são agentes patogénicos envolvidos no desenvolvimento de várias
doenças, dentre as quais, as mais relevantes são a tenosinovite/artrite viral, a síndrome-de-má-
absorção bem como síndromes associadas a um anormal crescimento da ave, causadores de perdas
económicas na indústria. Recentemente registou-se o aumento do número de casos reportados de
ARV globalmente, incluindo em Portugal, atribuídos à emergência de novas estirpes causadas por
mutações na proteína de superfície σC, altamente variável, para as quais as vacinas comerciais não
conferem proteção.
Os objetivos deste trabalho foram o desenvolvimento preliminar de partículas semelhantes a vírus
(VLPs) contra a estirpe 19371-PT12 de ARV para a produção de vacinas, usando o sistema de
expressão de baculovirus em células de inseto, para controlo da doença, e os desenvolvimentos de um
teste indireto de ELISA e seroneutralização de vírus (SN), para provar que soros fortemente positivos
em ELISA não asseguraram a proteção contra o ARV.
As proteínas σC, σA e μB foram selecionadas para a construção das VLPs, embora só tenha sido
possível a amplificação e clonagem dos genes codificantes de σC e σA no vetor de transferência
pIEx/Bac-1. O método de ELISA foi desenvolvido e validado para a deteção de anticorpos contra o
ARV. Os coeficientes de variação para os inter e intra-ensaios foram 9.1% e 1.6%, respetivamente. Os
testes de SN demonstraram que amostras de soro altamente positivas por ELISA produziram títulos
neutralizantes muito baixos. Um teste de western blot imunológico, demonstrou que a produção de
anticorpos não está direcionada para anticorpos neutralizantes.
PALAVRAS-CHAVE
Reovírus aviário; tenosivovite/artrite viral; vacinas de partículas semelhantes a vírus; VLPs; ELISA
indireta; teste de seroneutralização de vírus; western blot imunológico
iv
LIST OF CONTENTS
Acknowledgments .....................................................................................................................................i
Abstract..................................................................................................................................................... ii
Keywords .............................................................................................................................................. ii
Resumo ................................................................................................................................................... iii
Palavras-chave .................................................................................................................................... iii
List of figures .......................................................................................................................................... vii
List of tables .............................................................................................................................................x
List of Symbols and abbreviations ........................................................................................................... xi
I. Aims of the studies ............................................................................................................................... 1
II. Introduction .......................................................................................................................................... 3
II.1. Genomic organization ................................................................................................................... 3
II.2. The S1 segment ............................................................................................................................ 5
II.3. Genetic variation of ARV .............................................................................................................. 6
II.4. Epidemiology ................................................................................................................................ 7
II.5. pathogenesis ................................................................................................................................. 7
II.6. Clinical symptoms ......................................................................................................................... 9
II.7. Immune response ....................................................................................................................... 10
II.8. Diagnosis and prevention ........................................................................................................... 10
II.8.1. ELISA test ............................................................................................................................ 11
II.8.2. Serum neutralization test ..................................................................................................... 12
II.8.3. Western immunoblot assay .................................................................................................. 12
II.9. Control by vaccination................................................................................................................. 13
II.9.1. Virus-like particles ................................................................................................................ 13
II.9.2. The baculovirus expression vector insect cell system ......................................................... 14
III. Materials and methods ..................................................................................................................... 16
III.1. ARV isolation and identification ................................................................................................. 16
III.2. Preparation of cell cultures ........................................................................................................ 16
III.3. Virus propagation and RNA extraction ...................................................................................... 17
III.4. Phylogenetic analysis of arv strains isolated in Portugal ........................................................... 17
III.4.1. Amplification of the S1 gene by RT-PCR ............................................................................ 17
III.4.2. Sequencing of the amplified S1 gene ................................................................................. 17
III.4.3. Construction of the phylogenetic trees ................................................................................ 18
III.5. Construction of transfer vectors ................................................................................................. 18
III.5.1. Reverse transcription of viral RNA ...................................................................................... 18
III.5.2. Gene amplification of the σC, σA and μB encoding-genes from 19371-PT12 strain ......... 19
III.5.3. Purification of genomic fragments ....................................................................................... 20
III.5.4 Molecular cloning on plasmid PCR®2.1 .............................................................................. 20
v
III.5.5 Plasmid DNA extraction ....................................................................................................... 21
III.5.6 Plasmid DNA restriction ....................................................................................................... 21
III.5.7. Molecular cloning on the pIEx/Bac-1 transfer vector .......................................................... 21
III.5.8. Recombinant pIEx-σC and pIEx-σA clones’ selection ........................................................ 22
III.5.9. Sequencing of the pIEx-Bac-1 recombinants ...................................................................... 22
III.6. Development of an enzyme-linked immunosorbent assay for the detection of antibodies against
avian reovirus in chickens .................................................................................................................. 22
III.6.1 Viral particles purification and concentration for ELISA and Immunoblot assays ................ 22
III.6.2. Chicken and broiler serum samples .................................................................................... 23
III.6.3. Standardization of the indirect ELISA procedure ................................................................ 23
III.6.3.1 Determination of the optimal antigen dilution. ................................................................... 23
III.6.3.2. Simultaneous optimization of HRP-labelled rabbit anti-chicken IgG dilution and ELISA’s
background reduction ..................................................................................................................... 23
III.6.3.3 Indirect ELISA for the detection of antibodies against avian reovirus............................... 23
III.6.4 Validation of the ELISA test ................................................................................................. 24
III.6.4.1. Determination of the detection limit .................................................................................. 24
III.6.4.2. Precision of ELISA results ................................................................................................ 24
III.6.4.3 Assay specificity ................................................................................................................ 24
III.7. Development of a serum neutralization test for the avian reovirus field isolate ........................ 25
III.7.1 Virus preparation for serum neutralization tests .................................................................. 25
III.7.2. Virus titration ....................................................................................................................... 25
III.7.3. Serum neutralization test .................................................................................................... 25
III.7.4. Virus titer confirmation ........................................................................................................ 26
III.8. A western immunoblot assay for detection of antibodies agains ARV viral proteins ................. 26
III.8.1. SDS-PAGE and electrophoretic transfer of proteins to a PVDC membrane ...................... 26
III.8.2. Immunoblot .......................................................................................................................... 27
iV. results ............................................................................................................................................... 28
IV.1 Selection of the ARV strain ........................................................................................................ 28
IV.2. Construction of transfer vectors ................................................................................................ 29
IV.2.1. Amplification of σC, σA and μB encoding genes ................................................................ 29
IV.2.2. Enzymatic restriction with BamHI and NotI ........................................................................ 31
IV.2.3. Molecular cloning on the transfer plasmid pIEx/Bac-1 ....................................................... 31
IV.3. Development of the ELISA reaction ......................................................................................... 33
Iv.3.1. Optimization of the ELISA reaction ..................................................................................... 33
IV.3.2. Determination of the cut-off value ....................................................................................... 34
IV.3.3. Determination of the detection limit using a positve serum ................................................ 34
IV.4 Validation of the developed ELISA reaction for the detection of serum antibodies against the
avian reovirus 19371-PT12 ................................................................................................................ 35
IV.4.1. Precision of ELISA reaction ................................................................................................ 35
vi
IV.4.2. Specificity ............................................................................................................................ 36
IV.5. ELISA results ............................................................................................................................. 37
IV.6. Development of the serum neutralization reaction .................................................................... 38
IV.6.1. Avian reovirus titration ........................................................................................................ 38
IV.6.2. Serum neutralization test results ........................................................................................ 39
IV.7. Western immunoblot.................................................................................................................. 39
V. Discussion ......................................................................................................................................... 42
VI.Future work ....................................................................................................................................... 45
VII. References ...................................................................................................................................... 46
VIII. Annexes .............................................................................................................................................i
VIII.1. Sequence of the 19371-PT12 S1 fragment .................................................................................i
VIII.2. Sequence of the pIEx-σA cloned vector ..................................................................................... ii
VIII.3. Sequence of the μB encoding gene ........................................................................................... ii
VIII.4. Cloning vectors .......................................................................................................................... iv
VIII.4.1. PCR2.1® cloning vector ..................................................................................................... iv
VIII.4.2. pIEx/Bac-1 transfer vector ...................................................................................................v
VIII.5. Molecular weight markers ......................................................................................................... vi
VIII.5.1. NZYDNA ladder VI DNA molecular weight marker............................................................. vi
VIII.5.2. NZYDNA ladder II DNA molecular weight marker .............................................................. vi
VIII.5.3. NZY Colour Protein Marker II protein molecular weight marker ........................................ vii
VIII.6. References ............................................................................................................................... vii
vii
LIST OF FIGURES
Fig.II.1. Diagrammatic representation of the ARV reovirion. Protein λA forms the inner core shell
containing the 10 gene segments of the virus, the viral λB RNA polymerase and its cofactor μA. The
shell is stabilized by protein σA, that establishes the bridge between the inner core and the outer capsid.
The turrets formed by λC extend from the inner core to the outer capsid. Trimers of the σC cell
attachment protein protrude from the top of the turrets. The outer capsid if formed by the μB and σB
proteins. (This figure was kindly provided by Fevereiro.M from
INIAV)……………………………………………………………………………………………………………..4
Fig.II.2. Diagrammatic representation of the avian reovirus S1133 strain S1 mRNA. The S1 transcript is
composed by 1644 nucleotides, and contains three out-of-phase and partially overlapping cistron. The
first cistron (ORF1, nucleotides 25-293) translates into the P10 protein, the second cistron (ORF2,
nucleotides 293-733) expresses the P17 protein and the third cistron (ORF3, nucleotides 630-1610)
expresses σC protein. The nucleotide sequences surrounding the initiation codon of the three cistrons,
indicated by -3 and +4, are shown at the top, while the first nucleotide of each of the termination codons
is indicated with an asterisk (adapted from Bodelon G. et al.
2001)………………………………………………………………………………………………………………5
Fig.II.3. Schematic representation of the result of antigenic drift, where one gene segments (shown in
yellow), suffered genetic modifications that are expressed as the mutation of the σC cell attachment
protein, responsible for the formation of type-specific antibodies in the host cells (this figure was kindly
provided by Fevereiro.M, from
INIAV)……………………………..……………………………………………………………………….………6
Fig.II.4. Schematic representation of the avian reovirus replicative cycle. The attachment of the virus to
the cell receptors is mediated by the σC protein and virus penetration occurs by receptor-mediated
endocytosis. The intraendosomal viral uncoating is followed by the release of transcription-competent
core particles into the cytosol. The dsRNA genome segments translation produces 10 viral mRNAs.
These are either translated into viral proteins at the cell’s ribosomes, or recruited into newly formed core
particles and used as templates for the synthesis of the viral minus strands, resulting in the formation of
progeny genomes. After morphogenesis the mature reovirions exit the infected host cell causing cell
lysis (adapted from Benavente.J and Martínez-Costas
(2007))……………………………………………………………………………………………………………..8
Fig.II.5. Clinical signs and lesions of avian reovirus in broiler chickens. (A). Broiler cases with severe
tenosynovitis at 4 weeks of age; (B). Tenosynovitis associated with the entire leg; (C). Swelling, edema,
and hemorrhages in the tendons; (D). Full-thickness tendon rupture; (figures adapted from Lu, H. et al.
2015). (E). Normal broiler chicken (1050-1090g) and ARV infected broilers (approximately 650 g)
showing severe growth depression, at 23 days of age (figure kindly provided by Fevereiro.M. from
INIAV)……………………………………………………………………………………………….………..……9
Fig.IV.6. Phylogenetic tree constructed with the Bayesian method for genotype classification of the field
strains isolated in INIAV (in bold), based on the variability of the S1 segment encoding σC gene. The
Bayesian analysis was performed using the GTR model (nst = 6) with gamma-shaped rate variation with
a proportion of invariable sites (rates = invgamma). The analysis was run for 106 generations with 4
chains of temperature and each chain was sampled every 10thgenerations. The seven field strains
isolated in Portugal with 37 reference strain sequences retrieved from GenBank, representatives of the
five genotypes, were used in the analysis. The 19371-PT12 isolate is highlighted by the solid box. The
viii
nomenclature for the reference strains consists of the main symptom exhibited by the bird (mal-
absorption syndrome (MAS), runting-stunting syndrome (RSS) and tenosynovitis(TS), sample code and
country of
isolation…………………………………………………………………………………………….…………….28
Fig.IV.7. (A). Agarose gel electrophoresis of the σC encoding gene fragment PCR amplification,
described in section III.5.2. Lane 1 corresponds to the molecular weight marker NZY DNA Ladder VI
(NZYTech). Lanes 2 and 3 contain the nonspecific PCR products obtained after attempting to amplify
the σA and μB encoding genes. The solid in lane 4 represents the σC encoding gene. (B). Amplification
of σA encoding gene by PCR, under 50ºC (lane 2), 55ºC (lane 4) and 60ºC (lane 6). The bands
highlighted by the solid line boxes, of approximately 1200 bp, represent the S2 gene. Lanes 3,5 and 7,
display the result of PCR reactions conducted 50ºC, 55ºC and 60 ºC, respectively, with the addition of
0.5 μl of MgCl2 (50 mM). Lane 1 contains the NZY DNA Ladder II molecular weight marker. (C) Agarose
gel electrophoresis of the M2 gene fragment PCR amplification, desbribed in chapter III.5.2. Lane 1
corresponds to the molecular marker NZY DNA Ladder II (NZYTech). Lane 2 contain the PCR products
of amplification using a mixture of random hexamers, while in lanes 3 and 4, the DNA template was
produced using one of the M2 forward and reverse primers,
respectively…………………………………………………………………………..………………………….30
Fig. IV.8. Diagrammatic representation of the pCR®2.1 cloned vectors. The pCR®2.1 linearized vector
includes restriction sites for BamHI and NotI at 253 bp and 325 bp, respectively. The grey highlighted
area represents the cloned σC encoding gene or σA encoding gene. Both genes contain sequences,
introduced upon PCR amplification, recognized by BamHI and NotI endonucleases. Furthermore, the
σC encoded gene has a single restriction site for EcoRI at 481 bp, while the σA gene has a restriction
sequence for EcoRI at 102 bp. The gene is inserted at position 294. The BamHI and NotI sites of the
cloned vector are separated by approximately 40 bp............................................................................30
Fig. IV.9. (A). Results of gel electrophoresis of the enzymatic restriction of the PCR®2.1/σC vector with
BamHI and NotI (lane2). Lane 1 corresponds to the NZTDNA Lader II molecular weight marker. The
solid line box highlights the restricted σC encoding gene fragment. (B). Results of gel electrophoresis
of the enzymatic restriction of the PCR®2.1/σA plasmid (lane 2) and pIEx/Bac-1 (lane 3) with BamHI
and NotI. The band in lane 4 represents the undigested PCR®2.1/σA plasmid. Lanes 1 and 5 correspond
to the NZYDNA Ladder VI and NZYDNA Ladder II molecular weight markers, respectively. The solid
line box highlights the restricted σA encoding gene fragment, whilst the digested pIEx/Bac-1 plasmid is
identified in the interior of the dashed lined
box………………………………………………………………………………………………………………..31
Fig.IV.10. (A). Results from the enzymatic restriction of 7 pIEx-σC putative clones with EcoRI. Lane 1
represents the NZYDNA Ladder VI weight marker; lanes 2, 4, 5, 6, and 7 represent restriction patterns
from positive clones; lanes 3 and 8 correspond to negative clones. (B). Results from the enzymatic
restriction of 10 pIEx-σA putative clones with EcoRI. Lane 7 represents the restriction pattern of a
positive clone; lane 1 represents NZYDNA Ladder VI weight marker; the remaining lanes represent
restriction patterns from negative clones…………………………………………………………………….32
Fig. IV.11. Comparison of two enzyme-linked immunosorbent assays where a blocking step was
performed for one of the assays, using a BSA blocking solution (0.1%). Both assays were performed
under optimal antigen (ARV) dilution (1:16 000), using 2 replicates of a specific pathogen-free serum
sample (1:400 dilution) and various horse-radish peroxidase rabbit anti-chicken IgG conjugate dilutions.
The dashed line represents the tendency of the results of the ELISA without the saturation step, while
the solid line represents the tendency line for the results for the ELISA performed with the saturation
step. The triangle symbols represent the average absorbance of the 2 replicates, measured at each
conjugate dilution for the assay performed without BSA blocking. The bullet symbols represent the
average absorbance of the 2 replicates, measured at each conjugate dilution for the assay where the
plate was blocked with BSA. The measurement taken when the conjugate was used in the assay at 1:40
ix
000 dilution, and the plate previously saturated with BSA (circled point in the graph) represents a
possible outliar. The table represents the mean value of the measured absorbances for the two
replicates and the S.D for the assays
performed…………………………………………………………….……………………………………….…33
Fig. IV.12. Detection limit assay for the optimally developed ELISA, using the 3 replicates of the positive
chicken control sample (1:400). Samples were 2-fold serially diluted and the absorbance was measured
at each dilution and represented in the graph by the mean of absorbance of the replicates (bullet
symbols). Serum dilution was represented in a decimal logarithmic scale. The dashed horizontal line
represents the absorbance cut-off value of 0.174. The limit of detection was achieved at 1:6400 serum
dilution. The table represents the mean and standard deviation of the three replicates for each serum
dilution……………………………………………………………………….………………………...………...34
Fig. IV.13. Absorbance results for 83 broiler serum samples, from various farms in Portugal, tested by
ELISA. The dashed horizontal line represents the cut-off value of 0.174. The bars above the cut-off
value represent the positive results, while the remaining denote the negative
results…………………………………………………………………………………….………………………37
Fig. IV.14. Absorbance results for 89 breeder chicken serum samples, from various farms in Portugal,
tested by ELISA. The dashed horizontal line represents the cut-off value of 0.174. The bars above the
cut-off value represent the positive results, while the remaining denote the negative
results……………………………………………………………………………………………………………37
Fig.IV.15. Inoculated and non-inoculated cells with isolate 19371-PT12 after 5 days of incubation at 37
ºC in a 5 % CO2 atmosphere. A – LMH cells inoculated with 10 TCID50 (40x magnification).); B –– LMH
cells grown without virus inoculation (40x amplification); The structure highlighted with the dashed line
represents an agglomerate of fused cells (syncytium). C – CHO cells grown without virus inoculation
(40x amplification); D – CHO cells inoculated with 100 TCID50 (40x amplification); E – MDCK cells grown
without virus inoculation (40x amplification); F –MDCK cells inoculated with 100 TCID50 (40x
magnification). No evidence of cytopathic effect can be found in either figures A, C, D, E or
F…………………………………………………………………………………………………………...……..38
Fig.IV.16. Results from the immunoblot assay for the field isolate 19371-PT12. Membrane strips S1 to
S5 were incubated with serum samples positively tested by ELISA. Strips S6 and S7 were incubated
with a pool of positive chicken sera, tested by ELISA, and a negative SPF serum, respectively. The sera
were diluted to 1:25 and incubated with the viral protein-stained membrane for 2.5 h with agitation. The
HRP-labelled rabbit anti-chicken IgG conjugate (dilution 1:1000) was used to detect bound antibodies.
The identifiable viral protein bands are numerated in bold (1-9), with the respective molecular weight
indicated to the left. The band sizes of the protein molecular-weight marker M (NZY Color Protein Marker
II) are identified, respectively to the right. All protein molecular weights are indicated in
kDa……………………………………………………………………………………………………….………40
Fig.VIII.17. Schematic representation of the pCR2.1® cloning vector with the restriction map from the
MCS…………………………………………………………………………………………………….……..….iv
Fig.VIII.18. Diagrammatic representation of the pIEx/Bac-1 transfer expression vector and its MCS. The
table represents the number and position of restriction sites for EcoRI outside the MCS of the
plasmid…………………………………………………………………………………………….………………v
Fig.VIII.19. NZYDNA Ladder VI molecular weight marker (NZYTech)……………………………………vi
Fig.VIII.20. NZYDNA Ladder II molecular weight marker (NZYTech)……………………………………..vi
Fig. VIII.21. NZY Colour Protein Marker II (NZYTech)………..……………………………………………vii
x
LIST OF TABLES
Table 1. Absorbance values obtained in 20 replicates of the pool of positive chicken serum control
samples diluted at 1:1600. The assay was performed as described in section III.8. The mean and
standard deviation values are indicated, as well as the CV obtained for the evaluation of the intra-plate
variability…………………………………………………………………………………………………………35
Table 2. Absorbance values obtained for the pool of positive chicken serum control diluted at 1:1600,
using the developed ELISA reaction in six independent assays. The assay was performed as described
in section III.8. The mean and standard deviation values are indicated, as well as the CV obtained for
the evaluation of inter-plate
variability…………………………………………………………..………………………………….…………35
Table 3. Results for the specificity assay of the developed enzyme-linked immunosorbent assay. Eleven
chicken reference positive serum samples for laryngotracheitis virus, viral encephalomyelitis, New-
Castle disease virus, H5N3, H2N9, H7N1, H3N2, H7N7 and H13N6 avian flu subtype viruses, Marek’s
disease virus and infectious bronchitis virus were tested by ELISA. Positive chicken control serum and
specific pathogen free (SPF) serum samples were used as positive and negative controls, respectively.
All serum samples were diluted to
1:400……………………………………………………………………………………………………………..36
Table 4. Serum neutralizing titers for 30 ELISA positive chicken serum samples and 10 broiler ELISA
negative serum samples. SNT was performed for 2-fold sera dilutions, starting at 1:10, with a constant
viral titer of 100 TCID50 (confirmed by back titration)…………………………………………………….....39
Table 5. Comparison of structural proteins of RAM-1 and S1133 strains of avian reovrus……………41
xi
LIST OF SYMBOLS AND ABBREVIATIONS
Abs Absorbance MDCK
Madin-Darby Canine Kidney epithelial cells
AcMNPV Autographa californica multicapsid nucleopolyhedrovirus MgCl2 Magnesium chloride
APS Ammonium persulfate min Minute
ARV Avian reovirus ml Mililiter
BEV/IC Baculovirus expression vector insect cell system mM Milimolar
BHK21 Baby Hamster Kidney cells mRNA Messenger ribonucleic acid
Bp Base pairs MW Molecular weight
cDNA Complementary desoxyribonucleic acid n number of samples
cm2 Squared centimeters Na2CO3 Sodium carbonate
CO2 Carbon dioxide NaCl Sodium chloride
CPE cytopathic effects NaH2PO4 Monosodium phosphate
CV Coefficient of variation NaHCO3 Sodium bicarbonate
D Distance NCBI National Center for Biotechnology Information
DEPC Diethyl pyrocarbonate nchains Number of chains of temperature
DNA Desoxyribonucleic acid ng Nanograms
dNTPs Deoxynucleotide triphosphates ngen Number of generations
E.coli Escherichia coli NH2 Amino group
EDTA Ethylenediamine tetraacetic acid nm Nanometers
ELISA Enzyme-linked immusorbent assay nst Number of substitution types
G Acceleration due to gravity ºC Degrees Celsium
g/l Grams per liter OD Optical density
GTR General time reversible ORF Open-reading-frame
H Hour PBS Phosphate buffer solution
H2SO4 Sulfuric acid PCR Polymerase chain reation
HCl Hydrochloric acid pmol Picomole
HRP Horse-radish peroxidase PVDF Polyvinylidene fluoride
IgA Immunoglobulin A RFLP Restriction enzyme fragment length polymorphism
IgG Immunoglobulin G RK13 Rabbit Kidney cells
IgM Immunoglobulin M rmp Rotations per minute
INIAV Instituto Nacional de Investigação Agrária e Veterinária RNA Ribonucleic acid
IPTG isopropyl-β-D-thiogalactopyranoside RNAase Ribonuclease
Kb Kilobase RSS Runting-stunting syndrome
L Liter RT-PCR Reverse transcription polymerase chain reaction
LB Luria-Bertani s Second
MAS Malabsorption syndrome SD Standard deviation
MCMC Markov chain Monte Carlo SDS Sodium dodecyl sulfate
MCS multiple cloning site SDS-PAGE
Sodium dodecyl sulfatepolyacrylamide gel electrophoresis
MDBK Madin-Darby Bovine Kidney epithelial cells Sf21 Spodoptera frugiperda cells
Sf9 Spodoptera frugiperda cells
xii
SNT Serum neutralization test
SPF Specific pathogen free
TBE Tris-borate-EDTA
TBS Tris buffered saline
TCID50 Tissue culture infection dose 50
TEMED Tetramethylethylenediamine
TMB 3, 3’, 5, 5’ – tetramethylbenzidine
Tn5 Trichoplusia ni
U Enzyme activity unit
UV Ultraviolet
V Volt
VAT Viral arthritis-tenosynovitis
Vero African monkey kidney cells
1
I. AIMS OF THE STUDIES
Avian orthoreoviruses, also known as avian reoviruses (ARVs) belong to the genus Orthoreovirus of the
Reoviridae family, which encompasses numerous human and animal pathogens, including rotaviruses,
bluetongue viruses and coltiviruses 1. They are commercially significant pathogens involved in the
development of a variety of disease conditions, among which, the most relevant are viral arthritis-
tenosynovitis (VAT), runting-stunting (RSS) and malabsorption syndromes (MAS), that cause
considerable losses to the poultry industry worldwide 2–4. Despite having a low mortality, VAT causes
the development of edema and various lesions of the bird’s hock joints and tendons, responsible for
acute lameness. The first clinical cases of VAT were reported in 1957, although avian reovirus was
proved to be the causing agent of VAT only in 1972 through electronic microscopy 5,6.
The economic losses associated with an ARV infection are related to downgrading of carcasses at
slaughter, due to the unpleasant appearance of affected hock joints, reduced weight and stunted growth
because of nutrient malabsorption or bird’s inability to reach feed, resulting in a small feed conversion.
Some deaths might occur due to trampling by healthy birds 4,7.
Horizontal transmission by the fecal-oral route is considered the primary route of exposure to infection.
The infection is age depend as birds are more susceptible at the hatching period, becoming increasingly
resistant as they get older 8.
Regardless of the widespread distribution of avian reoviruses among poultry flocks, most circulating
strains appear to have low to no pathogenicity causing asymptomatic infections 4,9. Although, when
virulent strains infect unprotected parent stock or their progeny a clinical outbreak may occur. Under
these circumstances, unprotected progeny produced may be harshly affected with the disease.
Therefore, the prevention of a single serious case of ARV infection justifies economically ongoing
vaccine development and vaccination costs. For decades, breeder birds have been successfully
vaccinated with commercial live, live attenuated and inactivated oil emulsion vaccines to reduce or
prevent potential vertical transmission and to provide protection to progeny at an early age from maternal
antibodies 7. Although, during recent years there has been an increase number of outbreak reports in
positive enzyme-linked immunosorbent assays (ELISA) and vaccinated flocks worldwide 3,10–13. In
Portugal a report from Tecnlogia e Nutrição Animal (2013), has revealed a progressive increase in
reported cases of viral arthritis in the poultry industry. The recent outbreaks have been attributed to the
emergence of new viral strains as a consequence of mutations of the highly variable outer capsid σC
polypeptide, that induces the formation of neutralizing antibodies10,12,13. Current commercial vaccines
fail to offer cross-protection against these new field strains, reflecting the demand for the development
of next generation vaccines, such as virus-like particle (VLP) vaccines, which are safer, highly
immunogenic and easier and cheaper to produce 14. One of the most popular system to produce VLPs
is the baculovirus expression vector insect cell system, which has several advantages over the
traditional recombinant bacteria expression systems 14–17.
2
Humoral immune response is one of the most important mechanisms of defense against ARV infection.
The ELISA is a current technique used in explorations to monitor the protection of birds against ARV18.
The objectives of the current work were the partial development of VLP vaccines against the ARV
19371-PT12 strain using the baculovirus expression vector insect cell system (BEV/IC) for disease
control, and the development of both an indirect ELISA and serum neutralization tests, to prove that
highly positive sera measured by indirect ELISA, do not implicate protection of the bird against infection
by ARV.
3
II. INTRODUCTION
II.1. GENOMIC ORGANIZATION
Avian reoviruses, like other members of the genus Orthoreovirus, are non-enveloped viruses
characterized by a double-stranded RNA genome (23.5 kb) partitioned in 10 segments encased within
two icosahedral concentric protein shells of 70-80 nm diameter, that form the outer capsid and the core
of the virion 4,19–21. Avian and mammalian reoviruses are the most important orthoreoviruses and
although they are considered rather similar, some differences have been reported. Unlike mammalian
reoviruses, the ARV induce cells fusion, which determines the formation of syncytia in cell culture and
lack hemagglutination activity 22.
The genomic segments are organized in 3 size classes, determined by electrophoretic mobility,
designated L (large), M (medium) and S (small) 19. The L and M classes contain 3 monocistronic genes,
L1-L3 and M1-M3, respectively, while the S class is composed of 4 genes S1-S4, with a single tricistronic
gene, S1, that encodes 3 different proteins 21,23.
The viral genome can be translated into 12 primary products, 8 of which are structural proteins (λA, λB,
λC, μA, μB, σA, σB and σC) and 4 non-structural proteins (μNS, P10, P17, and σNS) 20,23. Despite both
being expressed by the infected cells, only the first are incorporated into the reovirion structure.
Translated proteins can be grouped in three size classes: large (λ), medium (μ) and small (σ) and are
encoded by the L-class, M-class or S-class genes, respectively 24,. Within each class additional
subscripts are attributed to structural proteins in reverse order of their electrophoretic mobility 25. There
are two additional structural proteins (μBN and μBC), that unlike the others, are originated by post-
translational modifications of the outer-capsid polypeptide μB, which means that virions are composed
of at least 10 polypeptides. The four non-structural proteins of the avian reovirus can be found in the
cytoplasm of infect cells 23. Two of these, defined as μNS and σNS, have been identified has a primary
translation product of M3 and S4 genes, respectively 24, while the remaining, termed P10 and P17 were
discovered as the translated products of the first two cistrons of the polycistronic S1 gene 26.
The μB, μBC and σB proteins are the components of the capsomers that constitute the outer capside
shell, while λA, λB, μA and σA compose the core viral proteins 27. The μBN and σC polypeptides are
exposed at the surface of the viral particle, whereas λC is a component of both layers, extending form
the inner core to the outer capsid, forming 12 pentameric core turrets that enable new mRNA to be
capped and exit the virion 25,28. The viral genome and RNA polymerase are contained within the inner
core shell formed by the λA protein, encoded by the L1 gene, which also provides a scaffold for core
assembly, representing the major component of the viral core 2. The λB polypeptide, a translation
product of the L2 gene, is responsible for RNA polymerase activity 29. The L3 genome segment specifies
the viral guanylyltransferase protein, λC 30. The translation of the M1 gene results in the formation of
μA, a putative cofactor of λB and a minor component of the core structure which is believed to interact
with the μNS protein, expressed by the M3 gene 31. The latter is involved in the formation of viral factories
4
and protein recruitment 32. The M2-encoded protein μB, a major outer capsid component and the
precursor of μBN and μBC structural proteins, is involved in virus entry and transcriptase activation 33.
Protein σA, the primary translation product of S2, possess sequence-independent ds-RNA binding
activity, which is believed to account for ARV resistance to interferon activity 34 and locates on the top
of λA, acting as a bridge between the inner core and outer capsid. The S4 genome segment, encodes
the σNS non-structural ss-RNA binding protein, associated to viral factories, that is suspected to be
enrolled in RNA packaging and replication 27.
The study of ARV proteins associated with neutralization of virus infectivity revealed that λB and S3-
enconded σB polypeptides were determined to induce the formation of broad-specific neutralizing
antibodies, while the small minor component of the outer shell, σC, induces the formation of type
specific-neutralizing antibodies 28.
L genes
M genes
S genes
λB
μA
Transcriptase
complex
μB σB
λC
Turret
Outer shell
σA λA
Inner core
σC
Fig.II.1. Diagrammatic representation of the ARV reovirion. Protein λA forms the inner core shell containing the
10 gene segments of the virus, the viral λB RNA polymerase and its cofactor μA. The shell is stabilized by protein
σA, that establishes the bridge between the inner core and the outer capsid. The turrets formed by λC extend
from the inner core to the outer capsid. Trimers of the σC cell attachment protein protrude from the top of the
turrets. The outer capsid if formed by the μB and σB proteins. (This figure was kindly provided by Fevereiro.M
from INIAV).
5
II .2. THE S1 SEGMENT
The S1 segment, the largest of the S-class segments, is structurally tricistronic, containing three unique
out-of-phase and partially overlapping open-reading-frames (ORFs), conserved in all avian reovirus
strains, suggesting important functional roles for the S1 encoded proteins in the viral cycle 21,23.
Immunoblot analysis of extracts of avian reovirus-infected cells and purified reovirions have revealed
that the segment S1 is functionally tricistronic because each of the three ORFs directs the synthesis of
σC, a structural protein, and P10 and P17, two nonstructural proteins, encoded by ORF3, ORF1 and
ORF2, respectively. The external capsid protein σC is involved in virus infectivity and immunogenic
properties, as is both accountable for the virus attachment to cells and the production of neutralizing
antibodies by host cells. All the while, the extensive syncytium formation phenotype observed in cell
culture, was determined to be caused by the fusogenic NH2 domain of P10 membrane fusion protein,
that mediates cell-cell fusion as a late stage-event in the virus replication cycle but is also responsible
for the increase of membrane permeabilization 26,35. The P17 polypeptide has an important role in the
virus replication cycle as it is a positive regulator of autophagy, an event that facilitates the production
of ARV 36.
The use of overlapping reading frames to encode multiple proteins from a single messenger RNA
(mRNA) might be a way of maximizing the coding capacity of a limited-size genome organism, such as
viruses, since the occurrence of polycistronic mRNAs encoded by higher eukaryotes’ genomes are
scarce, but it might also be a strategy to control the synthesis of viral proteins, like the minor outer capsid
σC protein because of differences exhibited by the ORF initiator codons.23 (fig. II.2.)
Fig.II.2. Diagrammatic representation of the avian reovirus S1133 strain S1 mRNA. The S1 transcript is composed
by 1644 nucleotides, and contains three out-of-phase and partially overlapping cistron. The first cistron (ORF1,
nucleotides 25-293) translates into the P10 protein, the second cistron (ORF2, nucleotides 293-733) expresses the
P17 protein and the third cistron (ORF3, nucleotides 630-1610) expresses σC protein. The nucleotide sequences
surrounding the initiation codon of the three cistrons, indicated by -3 and +4, are shown at the top, while the first
nucleotide of each of the termination codons is indicated with an asterisk (adapted from Bodelon G. et al. 2001).
6
II .3. GENETIC VARIATION OF ARV
During the last decades, the number of avian reovirus infections reports from distinct locations, notably,
China 3, The United States 10, France 12, Taiwan 11 and Canada 13, increased significantly. Studies based
on the phylogenetic construction and sequence analysis of the σC encoding-gene of ARV strains
isolated in recent years showed the existence of many emerging variants which have been classified in
different clusters and seem to differ from the well described strains used in commercial vaccines 12.
When compared with reference strains, ARV isolates from Pennsylvania were grouped into the well-
known genotypes 1 to 5 and some isolates strains were discovered to form a new genotype 6. All the
while, merely 22% of all isolates belonged to genotype 1, that of the vaccine strains 10. The rapid
evolution of these viruses resulted in a wide heterogeneity in pathogenicity and antigen variability, which
might have led to at least 11 serotypes 37.
The great genetic variability, observed in σC protein of the field strain isolates, that justifies the
emergence of new serotypes and epidemic strains, is believed to be ruled by a combination of
mechanisms that take place under strong immunological selection, particularly antigenic drift and gene
reassortment 11,38–40. The first is the product of cumulative mutation in gene portions encoding antibody-
binding sites, resulting in new strains that can’t effectively be neutralized 41. On the other hand, gene
reassortment usually happens when genetic exchange occurs directly between gene segments of two
similar virus, infecting the same cell 42, for instance, two avian reovirus strains, creating new genes
segments contained mixed genetic information.
Fig.II.3. Schematic representation of the result of antigenic drift, where one gene segments (shown in yellow),
suffered genetic modifications that are expressed as the mutation of the σC cell attachment protein, responsible for
the formation of type-specific antibodies in the host cells (this figure was kindly provided by Fevereiro.M, from
INIAV).
7
II .4. EPIDEMIOLOGY
Avian reoviruses can be horizontally and vertically transmitted. Although, egg infection by vertical
transmission happens at a low rate 43. The fecal-oral route is considered the primary route of exposure
to the infection, that typically develops at a very early age at the enteric tract44. As previously mentioned,
the infection by avian reoviruses is age-dependent, as chickens are most susceptible to avian reoviruses
in the post-hatching period and become increasingly more resistant to infection with age 8.
Early infection by the oral route in 1 day-old specific-pathogen-free chickens revealed that the epithelial
cells of the small intestine and the bursa of Fabricius are the main sites of primary infection and virus
replication, which subsequently spreads to other organs through the bloodstream within 1 or 2 days of
infection 44,45. Development of infection via mucosa of the respiratory tract is possible, granting it is not
considered the most significant route of infection. Moreover, the viruses can also enter broken skin of
the feet of chicks and develop in the hock joints 4.
Because ARV is a widespread virus among flocks, with a wide range of pathogenicity, some birds can
be asymptomatic carriers of the infection 27.
The pathogenicity of the virus, the route of exposure, bird’s age, immune condition and the interactions
between ARV and other infectious agents, such as Mycoplasma synoviae 46 and several Staphylococus
species, among other agents, might be detrimental for the nature of the disease that will develop after
onset infection 5.
Avian reoviruses have been isolated from various avian species, such as chickens, pheasants, quail,
turkeys, ducks, pigeons, geese, raptors, psittacine birds, American woodcocks, African green parrots
and other species kept in captivity, reflecting the ability of these viruses to transmit between avian
species 4,10.
II .5. PATHOGENESIS
Avian reoviruses can attach and replicate, not only in avian cells, but also in several mammalian cells,
which suggests that the ARV receptor is a ubiquitous cell surface protein 2. The extracellular attachment
is mediated by specific interactions of the σC polypeptide and the cell surface receptors 47. As it happens
for other non-enveloped viruses, ARV enters the cell by receptor-mediated endocytosis 27. In the
intracellular vacuoles, uncoating takes place under proteolytic processing of the major outer capsid
protein μBC. After uncoating, the viral core is released to the host cell’s cytoplasm, where transcription
of viral genes is initiated by double stranded viral RNA polymerase, using the minus strand of RNA as
template. Viral messenger RNA is released from the core and both used to synthesize the viral proteins,
and to be used as template for the minus strand synthesis of RNA genome after proper encapsidation
into new viral particles. Avian reovirus morphogenesis takes place exclusively within globular viral
factories, which are phase-dense inclusions containing, not only structural and non-structural proteins
8
but also partially and full assembled particles 27. The p10 protein, expressed by the first ORF of the S1
gene was identified as a viral porin, playing a key role in the modification of the late membrane
permeability by ARV. It is likely that the membrane destabilizing activity of p10 causes cell lysis at late
infection times, easing viral particle cell exit and, therefore, the dissemination of the viral infection, but
the mechanisms are not yet known 26. Syncytium formation mechanism in tissues of animals and cell
culture, causing ARV-induced fusion of cells, allows a rapid dissemination of the virus with a significantly
increase the virus-induced cell killing or virus release, allowing the infection of neighboring cells without
exposure to the host’s immune defenses 40. Although this mechanism was demonstrated as non-
essential for the virus replication cycle 48, it can contribute to the pathogenicity of the virus and thus is
believed to attribute a competitive advantage. Virus-induced apoptosis appears to be triggered by
reovirion disassembly inside the endosomes, which represents an early stage of the viral replication
cycle 2.
Fig.II.4. Schematic representation of the avian reovirus replicative cycle. The attachment of the virus to the cell
receptors is mediated by the σC protein and virus penetration occurs by receptor-mediated endocytosis. The
intraendosomal viral uncoating is followed by the release of transcription-competent core particles into the cytosol.
The dsRNA genome segments translation produces 10 viral mRNAs. These are either translated into viral proteins
at the cell’s ribosomes, or recruited into newly formed core particles and used as templates for the synthesis of the
viral minus strands, resulting in the formation of progeny genomes. After morphogenesis the mature reovirions exit
the infected host cell causing cell lysis (adapted from Benavente.J and Martínez-Costas (2007)).
9
II .6. CLINICAL SYMPTOMS
Most infections by ARV are innocuous, although virulent reoviruses exist and have been identified as
the viral agent responsible for the development of numerous important disease conditions, particularly
VAT and malabsorption and runting-stunting syndromes 3,4,9. VAT causes the development of edema
and lesions of the bird’s hock joints, or in more severe stages, erosion of the articulate cartilage, damage
or rupture of the gastrocnemius and digital flexor tendons, accompanied with hemorrhaging and green
discoloration, accountable for acute lameness in individuals not younger than 4 weeks 5. The
malabsorption and runting-stunting syndromes, typically observed from earlier ages, are characterized
by poor growth rate and non-uniform bird’s weight, diarrhea, with undigested food caused by damage
of the intestinal epithelium and/or proventriculitus, retarded feathering and pigment loss 12,49.
Infections by avian reoviruses have also been determined to cause enteric diseases in chickens and
turkeys, as well as myocarditis, pericarditis and hepatitis lesions upon experimental infection with certain
viral strains 5,50,51. Furthermore, it has been established a relationship between the viral infection and
respiratory diseases 2,9,49,52.
A B
C D
E
Fig.II.5. Clinical signs and lesions of avian reovirus in broiler chickens. (A). Broiler cases with severe tenosynovitis
at 4 weeks of age; (B). Tenosynovitis associated with the entire leg; (C). Swelling, edema, and hemorrhages in the
tendons; (D). Full-thickness tendon rupture; (figures adapted from Lu, H. et al. 2015). (E). Normal broiler chicken
(1050-1090g) and ARV infected broilers (approximately 650 g) showing severe growth depression, at 23 days of
age (figure kindly provided by Fevereiro.M. from INIAV).
10
II.7. IMMUNE RESPONSE
One of the most important protection mechanisms against ARV infection is via humoral immune
response 4,53. Reovirus specific antibodies inhibit the attachment of the virus to the cells, but also
facilitate the lysis of viral particles, or virus-infected cells, through interactions with other components of
the immune system 54. The ARV proteins have been shown to induce the formation of antibodies,
although, only two of them, λB and σB, are capable of inducing antibodies with broad specific
neutralizing activity while σC was identified as a higher type-specific neutralizing antibody inducer 28.
There are two types of humoral immunity – local or systemic mediated by different immunoglobulins.
The mucosa of the respiratory and, most importantly, the digestive tracts represent the main initial sites
for virus replication after transmission by fecal-oral route. The latter is also the principal route of excretion
of virus. Local immunity provided by the production of local immunoglobulin A (IgA) antibodies is one of
the first lines of defense against mucosal infections, as increasing levels of IgA are associated with
decreasing virus titers in the gut 55. Systemic immune response to ARV infection is mediated by
immunoglobulin G (IgG) antibodies.
Macrophages are important mononuclear peripheral blood cells enrolled in cell immunity, known to have
multiple effects on lymphocytic activity. They support T-cell-mediated immune responses by antigen
processing and presentation, as well as by secretion of soluble mediators. However, it was determined
that reovirus infection induced immunosuppression by reducing the proliferative ability of lymphocytes
during early stages of infection (from 4 to up 10 days post-infection). This phenomenon is attributed to
viral replication in macrophages, resulting in the induction of suppressive macrophages that inhibit the
T-cell proliferative response to mitogens, enabling viral spread 56,57.
II.8. DIAGNOSIS AND PREVENTION
Clinical signs of reovirus can’t be used in the diagnosis of a reovirus infection because these are not
exclusive of ARV infection and may resemble those of caused by other agents 4,7,.
Therefore, several laboratory techniques have been developed for the accurate detection of an avian
reovirus infection, such as virus isolation, localization of the infected tissue by electron microscopy,
tissue staining methods, like the use of immunofluorescence 58 or the use of monoclonal antibodies for
the immunoperoxidase staining technique, which are laborious and time-consuming. More recently,
faster and more sensitive molecular techniques based on DNA hybridization and polymerase chain
reaction (PCR) methods, like dot-blot hybridization, reverse transcription polymerase chain reaction
11
(RT-PCR) 59 and real-time RT-PCR, which allows the quantification of the target DNA molecule and RT-
PCR combined with restriction enzyme fragment length polymorphism (RFLP) have been developed60–
62. The last enables to type different ARV strains among isolates based on the analysis of the
endonuclease restriction patterns of a specific amplified gene 60.
Several serological tests for detecting antibodies against the avian reovirus have been developed,
including agar gel immunodiffusion, serum virus neutralization tests (SNT) 63, western immunoblot assay
64 and the ELISA test 65.
Despite the wide range of methods available to detect infection against ARV, PCR based techniques
and virus isolation are the preferred methods of diagnosis routinely done at laboratories.
II.8.1. ELISA TEST
Most serological methods, such as SNT, immunoblot assay, and immunodiffusion are very useful for
the detection antibodies against of ARV, although they are laborious and time-consuming. All the while,
the ELISA emerged as a sensitive, low cost, reproducible method, allowing automation, which makes it
the most eligible method for large sample groups 66. Antibody responses of chickens to ARV might
simultaneously provide an important diagnostic’s tool for ARV infection of unvaccinated flocks and
predict the proper time for vaccination 67.
Currently there are indirect ELISA tests using whole virus 65 or recombinant viral proteins coated plates
for the detection of ARV. The later use either a single or a combination of viral proteins, that induces
type-specific or broad specific neutralizing antibodies, and thus have shown to produce better correlation
between ELISA and SNT results 67–69.
There are commercially available ELISAs routinely used to assess levels of immunity induced
vaccination 18. Rapid increases of high ELISA titers observed from serum in breeder flocks can indicate
exposure to field viruses. Moreover, chickens are frequently vaccinated for certain viral strains of ARV,
therefore the detection of antibodies alone cannot be used as a diagnostic tool 70. One limitation of the
ELISA is that it cannot differentiate antibodies generated by the field variant viruses or vaccine viruses
4.
To perform an indirect ELISA test, a 96 well microplate is coated with the purified viral antigen, which
can be the whole virion or specific recombinant proteins, diluted in a coating buffer and typically
incubated at 4ºC, for at least 18h. After washing the coating buffer, the serum samples are properly
diluted in a serum dilution buffer and incubated for 1h at 37ºC with the antigen. A blocking step might
be performed before serum incubation to decrease the background of the absorbance measurements.
After incubation the unbound antibodies are washed. The detection of the bound antibodies is typically
achieved by a reaction with an enzyme-labeled secondary antibody. After 1h incubation at room
temperature, the unbound enzyme-labeled secondary antibody is washed, and the enzyme substrate is
12
added to each of the plate wells. The reaction of the substrate with the enzyme, generates a colored
compound detected by spectrophotometry, which is the reason why this reaction should be conducted
in the dark. Usually the reaction is stopped with the addition of sulfuric acid 68,69,71.
II.8.2. SERUM NEUTRALIZATION TEST
The SNT is a quantitative serological test very important for the diagnosis and control of many avian
viral diseases. Unlike the ELISA test, it can be used to determine ARV serotypes. As it is a method that
relies on cell culture, a single test might take several days, although the use of microplates enables to
perform several SNT tests simultaneously 63,72.
The SNT starts with heat inactivation of serum samples for 30 min at 56ºC in a bath water, before
performing the test. Afterwards, serial two-fold dilutions of the inactivated test sera in serum-free cell
culture medium are made in a 96-well microplate, using duplicate rows of wells for each serum to be
tested. A dilution of stock virus made up to contain from 100 to 300 TCID50 (50% tissue culture infective
dose). Then, the appropriate dilution of stock virus is added to each well containing each serum. The
plates are incubated for 1 h at 37ºC, in a 5% CO2 atmosphere to promote the reaction between the virus
and serum antibodies. A suspension of cells, sensitive to virus, is prepared using a concentration that
will ensure confluent monolayers in the plate wells up to 24h after seeding. Subsequently, the
appropriate volume of cell suspension is added to each well and the plates are incubated at 37ºC in a
humid atmosphere of 5% CO2, for the number of days established for the test (usually 3-5). The
development of cytopathic effects (CPE) should be monitored microscopically. At the end of the test the
serum neutralizing titer is calculated by the Spearman-Kärber method 12,73,74.
II.8.3. WESTERN IMMUNOBLOT ASSAY
A western immunoblot, is a simple way to separate antigens by high resolution techniques, such as
sodium dodecyl sulfatepolyacrylamide gel electrophoresis (SDS-PAGE), followed by the electrophoretic
transference of separated proteins to a membrane. The antigenicity of each protein is tested by
incubation of the blotted membrane with a serum sample. The bound antibodies are typically detected
by reaction with added enzyme-labeled secondary antibodies 75.
For this work, a western immunoblot assay was performed to determine the specificity of chicken sera
antibodies, previously tested by the developed ELISA and SNT, towards the viral proteins.
13
II.9. CONTROL BY VACCINATION
As already mentioned, chickens are most susceptible to infection at day-old and they develop resistance
to infection with age. Protection of chicks via maternal antibody transmission is therefore essential and
represents the control of avian reovirus infections by vaccination of flocks 71.
Worldwide, breeder birds have been vaccinated with commercial live, attenuated or inactivated oil
emulsion vaccines from strains originated from clinical cases of tenosynovitis (S1133) and
malabsorption or enteric diseases (2408 and 2177), that belong to the genotype 1 7. This vaccination
strategy has been effective in minimizing vertical transmission and providing maternal immunity at an
early age, for decades. Although, since 2012 there has been an increase in the number of reported
outbreaks throughout the world in both vaccinated and unvaccinated flocks, associated with the
emergence of new variant strains, related to the variability of the σC viral surface protein, responsible
for inducing the formation of neutralizing antibodies. Maternal antibodies generated by the conventional
reovirus vaccines, developed in the 1970s and 1980s, no longer confer humoral protection to these new
genetic and antigenic variants, leaving the progeny exposed to infection, which is why the development
of new vaccines is crucial to the control of the avian reovirus disease 7.
Recent advances in recombinant vaccine technology include the development of vaccines based on the
recombinant σC proteins expressed in Escherichia coli (E.coli) 76.
II.9.1. VIRUS-LIKE PARTICLES
These days most of the licensed vaccines are either live attenuated or killed, developed using the
conventional technologies. However, new subunit vaccines, such as virus-like particles (VLPs)
represent one of the most appealing approaches in veterinary vaccinology, due to their intrinsic strong
immunogenic properties, a highly safety profile and possible cheaper vaccine candidate. For these
reasons this system was chosen for the production of an alternative new generation vaccine against
avian reovirus 15.
VLPs are multiprotein assemblies, with a well-defined geometry, with typically 22-200 nm of size, that
mimic the structure and conformation of the native virions, that result from the intrinsic ability of many
types of structural viral subunits, like major capsid or envelop proteins, to spontaneously self-assemble
into VLPs when expressed using recombinant expression systems, of which the most popular is the
baculovirus expression system using insect cells 17. VLPs present the antigen in a more authentic
conformation than traditional whole virus vaccines, and their highly ordered structure, composed by
multiple copies of one or more viral proteins elicits a very strong humoral and cellular response from the
immune system. Because they require lower doses of antigen to produce a similar response, when
comparing to the traditional approach, they represent cheaper vaccine candidates, which is very
14
important in veterinary vaccine development, where vaccine cost should be weighed against the cost of
the vaccinated animal 14.
The safety of VLPs derives from the fact that these are devoid of any viral genome, which removes the
risks associated with virus replication, insertion, recombination or reversion 14. The production of VLP-
based vaccines, also eliminates the safety issues associated with whole-virus vaccine production and
administration because it doesn’t require the propagation of pathogenic viruses.
A few examples of commercially available VLP-based vaccines are the GlaxoSmithKline’s Engerix®
(hepatitis B virus) and Cervarix® (human papillomavirus), and Merck and Co., Inc.’s Recombivax HB®
(hepatitis B virus) and Gardasil® (human papillomavirus). In the veterinary field, although there are
several vaccine candidates in study, only the porcine circovirus type 2 VLP-based vaccine Porcilis PVC®
(Intervet International) is commercially available and licensed15.
II.9.2. THE BACULOVIRUS EXPRESSION VECTOR IN SECT CELL SYSTEM
The Baculoviridae is a large family of viruses with large, double-stranded circular DNA genomes, that
infect arthropods, mainly insects. The most extensively studied member of this family is the Autographa
californica multicapsid nucleopolyhedrovirus (AcMNPV). This baculovirus can infect multiple
lepidopteran insects and its genome is used as the backbone to produce most recombinant baculovirus
vectors. The most commonly used lepidopteran insect cell lines are derived from Spodoptera frugiperda
(Sf9 and Sf21) and Trichoplusia ni (Tn5) 16. One of the most important features of these viruses is their
ability to produce large amounts of polyhedrin, that forms a protective paracrystalin structure around
progeny virions – polyhedra – during later stages of infection 15,16. Recombinant baculoviruses are
produced by homologous recombination between the polyhedrin region in the AcMNPV genome and a
transfer plasmid containing a foreign gene placed under control of the polyhedrin strong promotor,
because baculovirus replication in insect cells was found to be independent of the production of
polyhedrin. The recombinant virus can be used to infect cells of larvae in the laboratory, leading to high
levels of transcription of the foreign DNA during the late phase of the infection, without the formation of
inclusion bodies that happens in bacterial systems. The expression of heterologous genes by the
eukaryotic baculovirus expression vector insect cell system allows multiple post-translational protein
modifications like, glycosylation, phosphorylation, acylation, disulfide bond formation, proteolytic
cleavage, amongst others, which represents a major advantage of this system over bacterial
recombinant protein production 16. This system also allows the expression of multiple proteins,
simultaneously, as well as the production of multiprotein subunit complexes, sharing function similarity
with their natural analogs, such as virus-like particles. As baculoviruses are incapable of replicating in
humans, animals or plants, they are highly safe. Human papilloma virus and hepatitis C are some
examples of VLP-based vaccines produced using this system15,16.
The BEV/IC system requires cloning of the desired gene into a smaller transfer vector, easily
transformed into E.coli, that will then suffer homologous recombination with the baculovirus after co-
15
transfection in the exponential phase of insect cells grown to a desired density, allowing the expression
of the heterologous proteins by the recombinant baculovirus 17.
In the present work, the insect-cell expression system BacMagic DNA kit (Invitrogen) was chosen to
express the VLPs composed by three structural proteins of the ARV 19371-PT12 field isolate, of which
μB is one of the major components of the outer capsid, while σA is a major component of the inner
capsid and σC the highly variable and immunogenic protein exposed at the virus surface.
16
III. MATERIALS AND METHODS
III.1. ARV ISOLATION AND IDENTIFICATION
Several flocks of broilers and breeders were screened for ARV by RT-PCR. Those testing positive for
the virus were selected for virus isolation. Seven isolates (19371-PT12, 15965S1-PT12, 28672-PT13,
15544-PT13, 2875G1-PT14, 2925-PT14 and 10076-PT14) from different genotypes were obtained,
after routine diagnosis from chickens with malabsorption syndrome and runting-stunting syndrome,
showing severe emaciation, decreased growth, diarrhea, proventriculitis and enteritis. Cultivation and
observation of the cytopathic effects of ARV were conducted in LMH (ATCC CRL-2117) monolayer cell
cultures.
III.2. PREPARATION OF CELL CULTURES
Leghorn male hepatoma (LMH) (ATCC CRL-2117) is a primary epithelial hepatocellular carcinoma cell
line of dendritic morphology10 highly sensitive to ARV, that was used for virus isolation, virus
multiplication and serum neutralization tests. LMH was developed from chemical transformation of tumor
nodules in the liver of a male leghorn chicken. Cells were routinely grown and maintained in 20 ml of
Gibco® Waymouth's medium, supplemented with L-glutamine, gentamicin sulphate (50 μg/ml) and 10%
fetal bovine serum. A vial of stock (1 ml of at least 1x106 viable cells) of LMH cells stored in liquid
nitrogen was quickly thawed in a 37ºC bath and cells were transferred to a T-25 cm2 flask containing 9
ml of supplemented Waymouth’s medium. The culture was incubated at 37ºC with 5% CO2. Depending
on the density of the seed culture, a confluent monolayer was formed within 24 to 72 hours. When the
cultured cells achieved at least 75% confluency, the medium was discarded and cells were washed,
with sterile phosphate buffer solution (PBS) and then detached from the flask using 2 ml of (0.5%) trypsin
(0.01%) versene solution. After 15 minutes in a 37ºC incubator, the completely detached cells were
centrifuged at 230 g, for 10 min at room temperature. The pellet was subsequently resuspended in the
necessary growth medium volume for experiments and/or to allow the maintenance of the cell line in
liquid culture on other flasks.
Cell cultures using Madin-Darby Bovine Kidney epithelial cells (MDBK), Madin-Darby Canine Kidney
epithelial cells (MDCK), African monkey kidney cells (Vero) and Rabbit Kidney cells (RK13), grown in
supplemented Eagle-MEM culture medium, Baby Hamster Kidney cells (BHK21) cultured in complete
Glasgow medium and Chinese Hamster Ovary cells (CHO) grown in Ham’s F12 Nutrient Mixture
(ThermoFischerScientific) culture medium, were handled following the above described procedures.
17
III.3. VIRUS PROPAGATION AND RNA EXTRACTION
The avian reovirus strains were propagated in LMH cell cultures. Upon development of 70-80% of
cytopathic effect, the cell cultures were frozen at -20ºC. Viral particles were concentrated and partially
purified by centrifugation and filtration. The cultures were treated by freezing and thawing two times and
the liquid was centrifuged at 1500xg, for 30 min at 4ºC. The supernatant was collected and filtered using
a 0.45 µm pore size.
Viral RNA was extracted from the cell culture supernatant using the RNeasy Mini Kit (QIAGEN),
according to manufacturer’s instructions.
III.4. PHYLOGENETIC ANALYSIS OF ARV STRAINS ISOLATED IN PORTUGAL
III.4.1. AMPLIFICATION OF THE S1 GENE BY RT-PCR
The S1 segment of the field strains, isolated at the virology laboratory of Instituto Nacional de
Investigação Agrária e Veterinária (INIAV) were amplified by RT-PCR using the commercial kit One
Step (Qiagen). The appropriate set of primers, ARV-1F (5’ – TTT TTG CTT TTT CAA YCY CTT G – 3’)
and ARV-1643R (5’ – GAT GAA TAA CCA ATC CCA GTA – 3’), where Y represents a degenerate base,
were designed for amplification of the complete segment. Briefly, 25 µl of reaction mixture contained 5
µl of 5x OneStep RT-PCR buffer, 1µl of deoxynucleotide triphosphates (dNTPs) mixture (10 mM each),
1µl of OneStep RT-PCR Enzyme mix and 0.5µl of each primer (50 pmol/μl). Five microliters of the
extracted RNA were used in the reaction. The temperature profile consisted of an initial step of 50ºC for
30 min for reverse transcription and a Taq polymerase activation step of 95ºC for 15 min, followed by
50 cycles for 30 s at 95ºC for denaturation, 30 s at 45ºC for annealing, 2 min at 72ºC for elongation and
a final extension step of 10 min at 72ºC. The RT-PCR products were analyzed by electrophoresis on
1% agarose gel containing 10 000x diluted GelRed (Biotium). The gels were run at 120 V for
approximately 1 h using 1× TBE buffer (89 mM Tris, 89 mM Boric acid, 2 mM ethylenediamine tetraacetic
acid (EDTA)) and examined on an ultra violet (UV)-transilluminator.
III.4.2. SEQUENCING OF THE AMPLIFIED S1 GENE
DNA sequence analysis was done by the dideoxynucleotide chain termination method, described by
Sanger (1977) 77 in an automated laser fluorescent DNA sequence analyzer (3130 Genetic Analyzer -
Applied Biosystems), using the Terminator v1.1® Cycle Sequencing kit (Applied Biosystems). Several
primers, ARV-1F, ARV-695R (5’ – TCG AAG TCA ACG AGA GTA TC – 3’), ARV-1340F (5’ – CTG ACT
GTC ATC GGY AAY TC – 3’), ARV-1643-R and P1F (5’ – AGTATTTGTGAGTACGATTG – 3’) were
used on sequencing reactions of different portions of the gene.
Each sequencing reaction mixture (10 μl) contained 0.5 μl of DNA, 2 μl of sequencing mix, 1 μl of
sequencing buffer and 2 μl of the sequencing primer (4 pmol/μl). The reaction consisted of an initial
denaturation step at 96ºC for 1 min, followed by 25 cycles of 10 s at 96 ºC for denaturation, 5 s at 47ºC
18
to promote primer annealing, 1 min at 60ºC for extension. Afterwards, the sequencing reaction products
were precipitated upon the addition of 2 μl of EDTA (25 mM), 2 μl of sodium acetate (3M, pH 5.2) and
50 μl of 95% (v/v) ethanol, followed by centrifugation for 20 min at 4ºC at 21 000xg.The pellet was
washed with 70 % (v/v) ethanol, for 7 min at the same speed temperature, then blow-dried and finally
resuspended in 15 μl of formamide for denaturation. Samples were applied to a 96 well-plate and
analyzed by fluorescence capillary electrophoresis in the 3130 Genetic Analyzer Sequencer (Applied
Biosystems). The S1 gene assembly was done with the Seqscape v 2.5 software from Applied
Biosystems.
III.4.3. CONSTRUCTION OF THE PHYLOGENETIC TREES
After sequencing of the gene portion of the viral immunogenic σC protein encoding gene, the isolates
were genotypically classified by phylogenetic analysis. To study the phylogenetic origin of the field
reovirus chicken isolates and to define which was the most representative genotype amongst the
isolated filed strains, nucleotide σC encoding gene sequences of different ARV strains were retrieved
from the GenBank and translated to amino acid sequences using Expasy
(http://web.expasy.org/translate/). Some sequences were cut to get all the sequences with the same
length. Multiple alignments of the nucleotide sequences of 498 bp were generated by CLUSTAL W
78 and converted to the NEXUS format using Mesquite software 79. The phylogenetic tree was obtained
with a Bayesian inference of phylogeny through the MrBayes v3.1.2 software that uses a simulation
technique called Markov chain Monte Carlo (or MCMC) to approximate the posterior probabilities of
trees 80,81. MrBayes analysis was performed using the general time reversible (GTR) model (number of
substitution types (nst) = 6) with gamma-shaped rate variation with a proportion of invariable sites (rates
= invgamma). The analysis was run for 106 generations (ngen = 106) with 4 chains of temperature
(nchains = 4) and each chain was sampled every 10th generations (samplefreq = 10).
III.5. CONSTRUCTION OF TRANSFER VECTORS
III.5.1. REVERSE TRANSCRIPTION OF VIRAL RNA
The reverse transcriptase reaction was carried out using the NZY – First Strand kit (NZYTech). A
reaction volume of 20 μl of reverse transcription mixture contained 5 μl of purified viral RNA, 1 μl of
random hexamer solution (50 ng/ml) or a specific primer (50 pmol/ μl), 1 μl of 10x annealing buffer, 1 μl
of diethyl pyrocarbonate (DEPC) treated water, 10 μl of the 2x master mix and 2 μl of enzyme mix. The
reaction program consisted of an initial denaturation at 98ºC for 5 min, followed by a rapid cooling to
4ºC for 1 min. After the addition of the RT polymerase and enzyme Master Mix, the mixture was heated
to 25ºC for 10 min allowing the annealing of the primers, then reheated to 45ºC for 45 min for elongation.
Finally, the temperature was raised to 85ºC for 5 minutes, whilst final extension happened, preceding a
19
chilling to 4ºC. As recommended by the producer, the mixture was incubated for 20 min at 37ºC after 1
μl of ribonuclease H (RNaseH) from E.coli was added.
III.5.2. GENE AMPLIFICATION OF THE σC, σA AND μB ENCODING-GENES FROM 19371-PT12
STRAIN
The σC and σA encoding-genes, from strain 19371-PT12, an isolate of the most representative
genotype group among the isolated field strains, were amplified through PCR using the High Fidelity
PCR Master kit (Roche), with specific primers designed from nucleotide sequences flanking the desired
genes, containing an additional restriction site that generates cohesive ends upon enzymatic restriction.
Primers for σC encoding-gene amplification were designed directly from the nucleotide sequence
already obtained. However, since the σA encoding sequence was unknown at the time, the primer
nucleotide sequence for σA encoding-gene amplification was designed from aligned nucleotide
sequences available at GenBank. For positions in which more than one nucleotide was found, a
degenerate base was used. Restriction sites for BamHI and NotI were incorporated into the structure of
the primers because they were present in the multiple cloning site (MCS) of the pIEx/Bac-1 transfer
plasmid and absent from both the σC encoding-gene sequence and the σA encoding alignment
generated sequence. An additional base, randomly chosen as an A, was added between the BamHI
restriction site and the start codon ATG of the forward primers in order to put the gene in frame with the
start codon of the pIEx/Bac-1 vector. The primers used for the σC encoding-gene amplification were
BamHI-σC-F forward primer (5’- AAAA GGATCC A ATGGCCGGACTAAATCCATC - 3’) and NotI- σC-
R reverse primer (5’ - AAAA GCGGCCGC AGTGTCGATGCCCGTACGC - 3’), respectively1 . The
forward and reverse primers used for the σA encoding-gene amplification were BamHI-σA-F (5’- AAAA
GGATCC A ATGGCGCGTGCCRTRTAC - 3’) and NotI-σA-R reverse (5’ - AAAA GCGGCCGC
GGCGGTAAAKGTGGCTAG - 3’).
A volume of 2.5 μl of synthesized DNA was used as template for the polymerase chain reactions
containing 0.5 μl of each of the reverse and forward primers (50 pmol/ μl), 9.5 μl of PCR grade water
and 12.5 μl of High Fidelity PCR Master Mix. The temperature profile consisted of an initial denaturation
step at 94ºC, for 2 min, followed by 50 cycles for 30 s at 94ºC for denaturation, 30 s at the primers
annealing temperature, 2 min at 72ºC for elongation and a final extension step of 10 min at 72ºC. The
primer annealing temperature set for σC encoding-gene and σA encoding-gene polymerase chain
reactions were, respectively, 55ºC and 52ºC. Since no σA encoding-gene amplification occurred at the
aforementioned hybridization temperature, PCR reactions using a different set of annealing
temperatures (50ºC, 55ºC and 60 ºC) were performed under the same experimental conditions. The
effect of MgCl2 concentration on enzymatic activity was also investigated using the same commercial
kit. For this purpose, 0.5 μl of MgCl2 (50 mM) was added to the reaction mixture.
1 The BamHI and NotI sequences are underlined with solid and dotted lines, respectively.
20
Several attempts were made to amplify the 2031 bp μB encoding gene. Those involved primer
hybridization temperature optimization (47ºC to 60ºC gradients) and changing the amount of template
DNA and MgCl2 concentration in the reaction mixture, using different PCR commercial kits, such as the
High Fidelity (Roche), the GoTaq (Promega), and NZYTaq 2x Colourless Master Mix (NZYTech). The
AgPath-ID One-step RT-PCR commercial kit (Ambion) was used as an attempt to amplify the gene
fragment through a single step reverse transcription reaction.
The primers used for amplification were the BamHI-μB-F forward primer (5’- AAAA GGATCC A
ATGGGHAACGCRACGTCTG - 3’) and the NotI-μB-R reverse primer (5’ - AAAA GCGGCCGC
CGATGGYTTRAACAACRTCTG - 3’)1. These were designed following the same design strategy for σA
encoding-gene primers.
The μB encoding gene amplification was achieved using the NZYTaq 2x Colourless Master Mix
commercial kit with the following PCR reaction mixture: 2.5 μl of synthesized DNA was used as template
for the polymerase chain reactions containing 0.5 μl of each of the reverse and forward primers (50
pmol/ μl), 9.5 μl of PCR grade water and 12.5 μl of (NZYTaq II 2x Colourless Master Mix). The
temperature profile consisted of an initial denaturation step at 94ºC, for 2 min, followed by 50 cycles for
30 s at 94ºC for denaturation, 30 s at 47ºC to promote primer hybridization, 2 min at 72ºC for elongation
and a final extension step of 10 min at 72ºC.
III.5.3. PURIFICATION OF GENOMIC FRAGMENTS
PCR products were separated and analyzed by electrophoresis on 1% agarose gel (Sigma), containing
10 000x diluted GelRed (Biotium). The gels were run at 120 V for approximately 1h using 1× TBE buffer
(89 mM Tris, 89 mM Boric acid, 2 mM EDTA) and examined in an UV-transilluminator. The amplified
fragments were excised and purified using the NZY Gel Pure kit (NZYTech), following the
manufacturer’s instructions.
III.5.4 MOLECULAR CLONING ON PLASMID PCR®2.1
The purified DNA fragments encoding the σC, σA and μB proteins were cloned into the PCR®2.1 cloning
vector from The Original TA Cloning Kit (Invitrogen) and subsequently transformed into competent XL-
Gold E.coli cells. The ligation reaction was conducted over night, at 14ºC, with the following reaction
mixture: 1 μl of linearized cloning vector (25 ng/μl); 1 μl of T4 DNA ligase; 2 μl of ligase buffer and 1 μl
of the purified amplified DNA. The total volume of the ligation mixture was then used on XL Gold
transformation starting with a 20 minutes period of incubation on ice. Afterwards, the mixture was placed
in a 42ºC water bath for 30 s and then rapidly placed on ice for 2 min, resulting in thermal chock. A
volume of 250 μl of Luria-Bertani (LB) bacterial growth medium was added to the cell suspension, which
was then incubated at 37ºC for 1 h at a constant stirring velocity of 160 rotations per minute (rpm). After
this period, the mixture was plated on LB solid agar medium supplemented with the selection antibiotic
kanamycin (50 μg/ml), the lactose analogue 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-
Gal) (40 μl from a stock of 40 mg/ml) and the isopropyl-β-D-thiogalactopyranoside (IPTG) inductor (40
21
μl from a stock of 100 mM) to promote the selection of recombinant bacteria, based on the blue-white
screening method, and finally incubated over night at 37ºC.
III.5.5 PLASMID DNA EXTRACTION
The recombinant plasmid DNA was extracted by the boiling method, described by Holmes and Quingley
(1981) 82 from 2 ml of recombinant clones, incubated overnight at 37ºC in liquid LB growth medium. The
cultures were centrifuged for 2 minutes at 8 000xg and the pellet was resuspended in 750 μl of STET
solution (50 mM Tris/HCl, pH 8; 50 mM EDTA; 5% (v/v) Triton X-100; 8% (w/v) sucrose), to which had
previously been added lysozyme (10 μl:1ml of cell culture) and RNAase (5 μl:1ml of cell culture). Then,
the cells resuspended in the lysis buffer were boiled for 5 minutes at 100ºC and pelleted by centrifugation
at 21 000xg for 10 min at 4ºC. Plasmid DNA was isopropanol – precipitated (750 μl) and centrifuged at
the same temperature and speed for 15 minutes. The plasmid DNA pellet was air dried and solubilized
in 50 μl of nuclease free water, after the supernatant was discarded. Before proceeding to molecular
cloning of the σC and σA enconding-genes in the pIEx/Bac-1 transfer vector, the extracted recombinant
plasmid DNA was enzymatically restricted with EcoRI and the resulting fragments were separated by
electrophoresis, which allowed to confirm that the desired σA and σC encoding genes were properly
cloned into the PCR®2.1 cloning vector. In addition, gene cloning in this intermediate vector renders the
production of the desired genes simply dependent on bacterial growth in liquid medium, representing
an easier and more convenient alternative to PCR. The clones that provided the correct restriction
pattern in the gel were later sequenced, allowing to determine the σA encoding-gene sequence (see
annexes VIII.2).
III.5.6 PLASMID DNA RESTRICTION
Before proceeding with the cloning of the BamHI-σA-NotI and BamHI-σC-NotI fragments on the transfer
vector pIEx/Bac-1, the cloned plasmids, PCR®2.1-σC and PCR®2.1-σA were enzymatically cleaved
with the BamHI and NotI restriction enzymes. The reaction was achieved in 20 μl total volume,
containing 10 μl of the cloned plasmid, 2 μl of 10x enzyme buffer (NEBuffer3 10x concentrate, Biolabs),
0.2 μl of 100x purified BSA solution (Biolabs) and 0.5 μl of BamHI (20000 U/ml, Biolabs) and 1 μl of NotI
(10000 U/ml, Biolabs) restriction enzymes. The same restriction enzymes were used to digest the
pIEx/Bac-1 allowing the further ligation of the genes. All the components of the restriction reaction were
used in the same proportions, except the amount of the purified pIEx vector (6 μl). All reaction mixtures
were incubated at 37ºC of 1 hour. The reaction products were separated by gel electrophoresis and
purified using the NZY Gel Pure (NZYTech), as already described.
III.5.7. MOLECULAR CLONING ON THE PIEX/BAC-1 TRANSFER VECTOR
After purification, the restricted genomic fragments were ligated by the T4-DNA ligase (1 U/μl, Invitrogen)
into the pIEx/Bac-1 vector by their compatible sticky ends. An insert-to-vector ratio of 3 was used for
both ligation reaction mixtures. The ligation reactions occurred within a mixture containing 2.5 μl of DNA
fragment (BamHI-σC-NotI or BamHI-σA-NotI), 5 μl of digested pIEx/Bac-1 vector, 2 μl of buffer and 1 μl
of T4 DNA ligase. Both reaction mixtures were incubated overnight at 14ºC.
22
The ligation mixture was used to transform 50 μl XL-Gold competent E.coli bacteria following the
transformation protocol described in section III.5.4. The suspension was platted on LB agar medium,
supplemented with the transfer vector selective antibiotic – ampicillin (100 μg/ml) – and incubated
overnight at 37ºC.
III.5.8. RECOMBINANT PIEX-σC AND PIEX-σA CLONES’ SELECTION
After plasmid DNA extraction by the boiling method of Holmes and Quingley (1981) 82, described in
section III.5.5., recombinant pIEx/Bac-1 clones containing the desired genes, BamHI-σC-NotI and
BamHI-σA-NotI, were selected by cleavage with the EcoRI restriction enzyme. Five microliters of the
extracted plasmid DNA were enzymatically digested for 1 h at 37ºC, in a reaction mixture containing 0.5
μl of EcoRI restriction enzyme (5000 U, NZYTech), 1.5 μl of 10x enzyme buffer NZYBuffer A and 8 μl
of nuclease-free water. The mixture was then separated by gel electrophoresis (1% agarose) and the
nucleic acid restriction patterns were examined.
III.5.9. SEQUENCING OF THE PIEX-BAC-1 RECOMBINANTS
After investigation of the gel restriction patters, the clones exhibiting the expected restriction profile were
targeted for sequencing. Sequencing reactions were carried out in a thermocycler using the Terminator
v1.1® Cycle Sequencing kit (Applied Biosystems by the dideoxynucleotide chain termination method,
described by Sanger (1977) 77 and the reaction products were analyzed in a fluorescent DNA analyzer
(3130 Genetic Analyzer - Applied Biosystems). To determine if the BamHI-σC-NotI and BamHI-σA-NotI
gene inserts were correctly ligated to the pIEx-Bac-1 transfer vectors, two sequencing reactions were
performed for the same sequencing project, each one using a different primer for the insert flanking
region. The primers used were the sense IE1 Promotor (5’ – TGGATATTGTTTCAGTTGCAAG – 3’) and
the antisense IE1 terminator (5’ – CAACAACGGCCCCTCGATA – 3’) primers. The reaction was
performed as explained in section III.4.2. The analysis and assembly of the sequences was done with
the Seqscape v2.5 software provided by the sequencer manufacturer.
III.6. DEVELOPMENT OF AN ENZYME-LINKED IMMUNOSORBENT ASSAY FOR THE DETECTION OF
ANTIBODIES AGAINST AVIAN REOVIRUS IN CHICKENS
III.6.1 VIRAL PARTICLES PURIFICATION AND CONCENTRATION FOR ELISA AND IMMUNOBLOT
ASSAYS
The avian reovirus strain 19371-PT12 was propagated in LMH cell cultures. Upon development of 70-
80% of cytopathic effect, the cell cultures were frozen at -20ºC. Viral particles were concentrated and
partially purified by centrifugation, filtration and ultracentrifugation procedures. The cultures were treated
by freezing and thawing two times, following centrifugation at 30 000 xg, for 15 min at 4ºC. The
supernatant was collected and filtered using a 0.45 µm pore size. The filtrate containing the virions was
centrifuged at 92 000 xg, for 2 h and 4 ºC, through a 20% sucrose cushion. The viral pellet was washed
with 5 ml of sterile phosphate buffered saline (PBS) and recentrifuged in the same conditions. Purified
23
viral particles were resuspended in 1 ml of TNE buffer (0.01 M Tris-HCl, pH 7.6; 0.1 M NaCl and 0.001
M EDTA).
III.6.2. CHICKEN AND BROILER SERUM SAMPLES
Serum samples were obtained from 89 breeder chickens and 83 broilers, from several farms from
continental Portugal. No information was available whereas sampled birds’ vaccination against ARV
was concerned. Several chicken serum samples with elevated absorbance values (>1.00) were pooled
and used as a positive control, since no reference serum samples for ARV were available. A specific
pathogen free (SPF) chicken serum was used as a negative control.
III.6.3. STANDARDIZATION OF THE INDIRECT ELISA PROCEDURE
III.6.3.1 DETERMINATION OF THE OPTIMAL ANTIGEN DILUTION.
To determine the optimal concentration of the viral antigen to use in the ELISA reaction, titrations of the
antigen (ARV 19371-PT12) were carried out in a polystyrene microplate (Nunc). An amount of 100 μl of
the purified viral particles at several dilutions (1:100, 1:500, 1:1 000, 1:2 000, 1:4 000, 1:8 000 and 1:16
000), prepared in carbonate/bicarbonate buffer (15 mM Na2CO3 and 35 mM NaHCO3) pH 9.6, was used
to coat the wells’ surface of the ELISA microplates. The coated plates were incubated overnight at 4ºC.
Four replicates of positive and negative SPF serum samples diluted at 1:400 in dilution buffer (2.5 mM
NaH2PO4, 7.5 mM Na2HPO4, 500 mM NaCl, 0,05 % Tween 80), were used for each antigen dilution.
Horseradish peroxidase (HRP)-labelled rabbit anti-chicken IgG conjugate (Jackson Immunoresearch
Laboratories) was diluted at 1:10 000 in dilution buffer.
III.6.3.2. SIMULTANEOUS OPTIMIZATION OF HRP-LABELLED RABBIT ANTI-CHICKEN IgG
DILUTION AND ELISA’S BACKGROUND REDUCTION
To reduce the background associated with the absorbance measurements, the coated plates,
previously incubated overnight at 4 ºC, were washed and blocked for 1h at 37 ºC, using a 0.1% (w/v)
bovine serum albumin (BSA) carbonate/bicarbonate solution (blocking buffer). For the study of optimal
dilution of chicken anti-species conjugate, the ELISA reaction was performed as explained bellow, but
the conjugate was added at various dilutions (1:10 000, 1:20 000, 1:40 000 and 1:80 000). Each assay
was performed with four replicates of the negative and positive controls.
III.6.3.3 INDIRECT ELISA FOR THE DETECTION OF ANTIBODIES AGAINST AVIAN REOVIRUS
An enzyme-linked immunosorbent assay was developed, with the investigated optimal experimental
conditions, to detect the presence of antibodies against avian reovirus in serum samples of chickens
and broilers. To coat the ELISA plate, purified ARV 19371-PT12 viral particles were incubated for
30 min at 4ºC, with an equal volume of a 2% octyl solution in PBS (n-octyl β-D-gluco-pyranoside) and
then diluted at optimum concentration (1:16 000) in the carbonate/bicarbonate buffer, followed by the
addition of 100 µl of diluted antigen to each well of the ELISA plate, and incubation over night at 4ºC.
24
Following three washes with PBS/Tween washing buffer (PBS, 0.05 % Tween-20, pH 7.4), 100 µl of a
0.1% (w/v) bovine serum albumin (BSA) carbonate/bicarbonate solution were added to each well and
the plate was incubated for 1 h at 37 ºC to promote saturation of the unbound sites. After rewashing the
plate three times, serum samples diluted at 1:400 in diluent buffer were added at 100 µl /well and
incubated for 1 h at 37ºC, following a three-time wash. After dilution at the ideal concentration (1:40 000),
100 µl of the HRP-labelled rabbit anti-chicken IgG were added for the detection of bound antibodies,
following a 1 h incubation at room temperature. After washing, 100 µl of TMB solution (3, 3’, 5, 5’ –
tetramethylbenzidine) was added per well. The reaction was carried out for 10 min, in the dark, at room
temperature, followed by the addition of 100 µl of the stop solution (0.5 M sulfuric acid) to terminate the
reaction. The absorbance measurements for each well were taken at 450 nm using the Dynatech ELISA
reader (Dynatech). A pool of positive chicken serum samples and an SPF chicken serum were used as
positive and negative controls, respectively.
III.6.4 VALIDATION OF THE ELISA TEST
To validate the ELISA test, limit of detection, inter- and intra-assay precisions and specificity were
investigated.
III.6.4.1. DETERMINATION OF THE DETECTION LIMIT
To determine the detection limit for the developed ELISA, 100 µl of a two-fold serially diluted positive
chicken pool sample (starting at 1:400 dilution), were added to each well of the coated plate, followed
by incubation for 1 h at 37 ºC. Three replicates were performed for each tested serum dilution. This
assay followed the protocol described for the ELISA reaction (section III.6.3.3).
III.6.4.2. PRECISION OF ELISA RESULTS
To evaluate the precision of the ELISA test, the inter-assay and the intra-assay variabilities were
measured in terms of the coefficient of variability (CV). This is a dimensionless number calculated by
the standard deviation (SD) of a set of optical density measurements (OD) divided by the mean of the
set. Plate variability or reproducibility was evaluated by the inter-assay CV and it was calculated by the
mean values of the chicken serum positive control (1:1600) obtained in each of the five assayed plates.
To study intra-plate variability, positive chicken serum (1:1600) was tested in a single plate with 20
replicates. Positive control samples were diluted to 1:1600 for both variability assays, because
reasonable absorbance values, of approximately 1.5 were obtained at this dilution, but also because it
is 2-fold dilutions lower than that of the detection limit.
III.6.4.3 ASSAY SPECIFICITY
Reference sera positive for laryngotracheitis virus, encephalomyelitis virus, New-Castle disease virus,
six avian influenza virus subtypes (H5N3, H2N9, H7N1, H3N2, H7N7 and H13N6), Marek’s disease
virus and infectious bronchitis virus and negative for ARV were tested, according to the developed
protocol, to study the enzyme-linked immunosorbent assay’s specificity towards the detection of
25
antibodies against ARV. All sera were diluted at 1:400 and both positive and negative controls were
used.
II I.7. DEVELOPMENT OF A SERUM NEUTRALIZATION TEST FOR THE AVIAN REOVIRUS FIELD ISOLATE
III.7.1 VIRUS PREPARATION FOR SERUM NEUTRALIZATION TESTS
A culture of LMH cells was used to produce the virus stock for serum neutralization tests. The cells were
grown in 50 ml of growth medium in two separate T-flasks (175 cm2 of surface area) with 1 ml of virus
inoculum of the ARV field isolate 19371-PT12. The cells were grown at 37ºC in a 5% CO2 atmosphere
until the cytopathic effect was at least 80%, resulting in 4 days of incubation. The flasks were frozen and
thawed 2 times, to increase virus yield. Finally, the cell culture was clarified by centrifugation at 1500xg
for 30 min and supernatant was stored at -80ºC, until the virus stock was titrated and used in serum
neutralization tests. Virus titration was done by 10-fold serial dilutions.
III.7.2. VIRUS TITRATION
For the development of a seroneutralization test (SNT) several cellular lines, MDCK, MDBK, BHK21,
CHO, Vero, RK13 and LMH, were tested for sensitivity to avian reovirus 19371-PT12 isolate through
several virus titration assays. Ten-fold virus dilutions, starting at 1:10, using 8 replicates were tested in
a 96 well microplate. Each well contained 50 µl of complete culture medium, the same volume of the
virus dilution and 100 µl of a cellular suspension (preparation described in section III.2.). After five days
of incubation at 37ºC in a 5% CO2 atmosphere, the cells were investigated for cytopathic effects and the
tissue culture infection dose 50 (TCID50) was calculated by the Spearman Kärber method 73,74. Cell
rounding and shrinkage, apoptosis, low density cultures accompanied by cell detachment and the
formation of syncytia constitute typical manifestations of cytopathic effect caused by avian reovirus
infections 26. The TCID50 is defined as the dilution of a virus required to infect 50% of a given batch of
inoculated cell cultures and thus can be used to evaluate a cellular line sensitivity to a certain virus 83.
III.7.3. SERUM NEUTRALIZATION TEST
Six serum samples were tested, in duplicate, per microplate after being diluted at 1:5 in serum free
Waymouth’s complete culture medium, heat-inactivated for 30 min at 56ºC and subsequently
centrifuged at 13000xg for 2 min. Each tested serum sample was sequentially diluted by a factor of 2.
Eight dilutions per serum sample were tested: 1:10; 1:20; 1:40; 1:80; 1:160; 1:320; 1:640; 1:1280. A
constant virus concentration of 100 TCID50/50 µl of avian reovirus 19371-PT12 isolate was incubated
with serum samples for 1h at 37ºC. The SNT was performed in 96-well microplates containing LMH cells
(preparation described in section III.2.). After incubation for five days at 37ºC in a 5% CO2 atmosphere,
the cells were investigated for cytopathic effects. The serum neutralization titers, defined as the highest
possible dilution to produce a neutralizing effect, were also calculated by the Spearman Kärben method.
26
III.7.4. VIRUS TITER CONFIRMATION
To ensure that virus titer of 100 TCID50 was, in fact, used in the SNT, a back-titration test was performed.
Ten-fold dilutions of the 100 TCID50 viral stock solution used in the SNT were prepared in a 96-well
microplate, which contained 50 µl of LMH complete culture medium. Ten replicates were done for each
virus dilution (100 TCID50, 10 TCID50, 1 TCID50, 0.1 TCID50 and 0.01 TCID50). After the addition of 100
µl of LMH cell suspension, the plates were incubated for five days at 37ºC in a 5% CO2 atmosphere.
The number of infected wells were accounted for each dilution upon observation of CPE. Virus titer was
confirmed, once again, using the Spearman Kärben method of calculation.
II I.8. A WESTERN IMMUNOBLOT ASSAY FOR DETECTION OF ANTIBODIES AGAINS ARV VIRAL
PROTEINS
III.8.1. SDS-PAGE AND ELECTROPHORETIC TRANSFER OF PROTEINS TO A PVDC MEMBRANE
The viral antigen particles of the ARV 19371-PT12 strain were concentrated and partially purified by
filtration and ultracentrifugation, as previously explained, and used as the antigen for Western blot.
Viral protein separation was carried out using sodium dodecyl sulfate polyacrylamide gel electrophoresis
(SDS-PAGE) in a BioRad MiniProtein II electrophoresis unit. Proteins were separated using a 12%
acrylamide separating gel, prepared with 4.35 ml of deionized water, 2.5 ml of Tris-HCl (1.5 M pH 8.8
buffer), 100 µl of sodium dodecyl sulfate (SDS) (10%), 3 ml of acrylamide Bis (40%), 50 µl ammonium
persulfate (APS) (10%) and 5 µl of tetramethylethylenediamine (TEMED). Four milliliters of the gel
mixture were loaded into the assembled gel apparatus and topped with SDS (0.1%) to promote air
isolation. After polymerization, the 4% acrylamide stacking gel mixture was prepared using 3.2 ml of
deionized water, 1.25 ml of Tris-HCl (0.5 M, pH 6.8), 50 µl of SDS (10%), 488 µl of acrylamide Bis (40%),
40 µl of APS (10%) and 10 µl of TEMED. Once polymerization had been completed, the viral samples
were mixed, in equal proportions, with the Laemmli sample buffer (Bio Rad), containing 5% of 2-
mercaptoethanol, boiled for 5 min, to promote protein denaturation and applied to the stacking gel. After
the gels were mounted onto the electrophoresis apparatus, the running buffer 1X (5X stock solution: 45
g Tris Base (15 g/l); 216 g glycine (72 g/l); 15 g SDS (5 g/l) to 3 liters of deionized water) was added
and the protein samples were run at 200 V for 60 min.
After electrophoresis, the gel was soaked in the transfer buffer (Tris base (2.53 g/l); glycine (12 g/l); 16.7
% (v/v) methanol), for 15 min. Simultaneously, the polyvinylidene fluoride (PVDF) (Bio-Rad) transfer
membrane was placed in methanol and then soaked in transfer buffer. The electrophoresed proteins
were transferred to the PVDF membrane for 30 min at 15 V, using the Trans-Blot semi-dry transfer cell
system (Bio-Rad).
27
III.8.2. IMMUNOBLOT
After being air dried, the PVDF strips containing the separated viral proteins were cut from the
membrane and serially soaked in methanol and TBS (Tris buffered saline)-Tween buffer (2.42g/l Tris
base, 29.2 g/l NaCl, and 0.01% Tween20, pH 7.5). Five positive chicken sera, a pool of positive chicken
sera and SPF chicken serum were diluted at 1:25 in TBS-Tween buffer and incubated with the
membrane strips overnight, with agitation at room temperature. One milliliter of HRP-conjugated anti
chicken IgG (1:1000) was incubated for 2.5 h after the strips had been washed three times with TBS-
Tween buffer. The antibodies were detected using 1 ml of 4-chloro-1-naphtol (3 mg/ml in methanol) after
three successive washes with TBS-Tween and TBS buffers.
28
Fig.IV.6. Phylogenetic tree constructed with the Bayesian method for genotype classification of the field strains isolated
in INIAV (in bold), based on the variability of the S1 segment encoding σC gene. The Bayesian analysis was performed
using the GTR model (nst = 6) with gamma-shaped rate variation with a proportion of invariable sites (rates = invgamma).
The analysis was run for 106 generations with 4 chains of temperature and each chain was sampled every
10thgenerations. The seven field strains isolated in Portugal with 37 reference strain sequences retrieved from GenBank,
representatives of the five genotypes, were used in the analysis. The 19371-PT12 isolate is highlighted by the solid box.
The nomenclature for the reference strains consists of the main symptom exhibited by the bird (mal-absorption
syndrome (MAS), runting-stunting syndrome (RSS) and tenosynovitis(TS), sample code and country of isolation.
IV. RESULTS
IV.1 SELECTION OF THE ARV STRAIN
Since seven isolated ARV field strains were available at the laboratory, it was necessary to select the
appropriate strain for the construction of the VLPs, as well as for the development of the ELISA and
serum neutralization tests. The selected isolate should represent the majority of the strains and therefore
a phylogenetic analysis was performed to determine the genotype of each isolate.
Genotype classification of the seven field isolates based on the gene portion of S1, encoding the highly
variable σC protein, was achieved through phylogenetic analysis, using the Bayesian method. Also
neighbor-joining and Maximum likelihood phylogenetic trees were constructed, giving rise to similar
results. The obtained phylogenetic tree (fig.IV.6) revealed the five genotype groups already described
for ARV 10 and demonstrated that the field-strains were classified in genotypes 2 (n=5), 3 (n=1) and 4
(n=1). Most of field-isolated strains belong to genotype 2, which was clearly the most representative
amongst the isolated strains. For this reason, the 19371-PT12 was selected for VLPs production, and
the development of serum neutralization tests. Nonetheless, either one of the five isolates belonging to
genotype 2 could have been chosen.
29
IV.2. CONSTRUCTION OF TRANSFER VECTORS
IV.2.1. AMPLIFICATION OF σC, σA AND μB ENCODING GENES
RT-PCR reactions were performed as described in Materials and methods, to amplify the portion of the
S1 segment encoding for σC and the S2 and M2 genes, encoding the σA and μB proteins, respectively,
of the ARV 19371-PT12 field isolate, for the construction of the virus like particles. As observed in fig.
IV.7A, the first attempt only allowed the amplification of the 981 bp fragment corresponding to the σC
encoding gene (lane 4). The absence of a band of approximately 1200 bp and the presence of numerous
bands at lower molecular weights in lane 2, reveal that not only the S2 gene amplification was
unsuccessful but also that there was unspecific amplification. No distinctive bands were revealed in lane
3, indicating that M2 amplification was also unaccomplished in this first attempt.
Fig. IV.7B, shows the results of PCR reactions conducted under different primer annealing temperatures
(50ºC, 55ºC and 60ºC) and/or with higher MgCl2 concentrations for S2 amplification. A single band of
similar intensity of about 1200 bp was observed at each of the three different temperatures (lanes 2, 4
and 6). The increase of the MgCl2 concentration in the reaction mixture was detrimental to the S2 gene
amplification as no bands corresponding to the gene’s molecular weight were observed (lanes 3, 5 and
7).
Several optimizations regarding the PCR mixture’s composition and the temperature profiles were
performed to amplify the M2 gene that encodes μB, a major structural protein of the virion. FigIV.7C
present the M2 amplicons. The cDNA used as template for each of the three amplification reactions was
produced with different reverse transcription reaction mixtures. The template DNA was either
synthesized by RT-reaction using a mixture of random hexamers (lane 1), as described in section III.5.1,
or using one of the M2 forward or reverse primers (lanes 3 and 4). All PCR reactions produced the
expected fragment of approximately 2031 bp, regardless of how template DNA was synthesized. The
amplicons in lanes 2, 3 and 4 were excised, purified and sequenced. The sequence of the amplified
product revealed high homology with other M2 sequences deposited at GenBank. However, a BamHI
restriction sequence was found within the amplified M2 gene, which hampered the molecular gene
cloning into the pIEx-Bac-1 transfer plasmid, using BamHI and NotI endonucleases as initially planned.
For that reason, a new forward primer for M2 was designed, containing a restriction site for KpnI (5’–
AAAAGGTACCAATGGGHAACGCRACGTCTG – 3’)2, also found in the MCS of the pIEx/Bac-1 and
absent from the 19371-PT12 M2 nucleotide sequence already known. Although, all attempts to amplify
the M2 fragment with the KpnI and NotI, forward and reverse primers, following the optimization
strategies described in the chapter III.5.2, were proved unsuccessful.
2 KpnI restriction sequence is underlined.
30
An intermediate cloning step was performed in PCR®2.1 to increase the number of copies of the BamHI-
σC-NotI gene portion, and BamHI-σA-NotI gene, in order to facilitate further gene cloning in the
pIEx/Bac-1 transfer plasmid. After blue-white clone screening, the cloned PCR®2.1/σC and
PCR®2.1/σA plasmids were extracted and digested with EcoRI endonuclease to confirm cloning. The
restriction patterns were analyzed by gel electrophoresis and the properly cloned plasmids were
identified and selected.
2000
gene
Fig. IV.8. Diagrammatic representation of the pCR®2.1 cloned vectors. The pCR®2.1 linearized vector includes
restriction sites for BamHI and NotI at 253 bp and 325 bp, respectively. The grey highlighted area represents the
cloned σC encoding gene or σA encoding gene. Both genes contain sequences, introduced upon PCR amplification,
recognized by BamHI and NotI endonucleases. Furthermore, the σC encoded gene has a single restriction site for
EcoRI at 481 bp, while the σA gene has a restriction sequence for EcoRI at 102 bp. The gene is inserted at position
294. The BamHI and NotI sites of the cloned vector are separated by approximately 40 bp,
(B) (A) (C)
Fig.IV.7. (A). Agarose gel electrophoresis of the σC encoding gene fragment PCR amplification, described in section
III.5.2. Lane 1 corresponds to the molecular weight marker NZY DNA Ladder VI (NZYTech). Lanes 2 and 3 contain
the nonspecific PCR products obtained after attempting to amplify the σA and μB encoding genes. The solid in lane
4 represents the σC encoding gene. (B). Amplification of σA encoding gene by PCR, under 50ºC (lane 2), 55ºC
(lane 4) and 60ºC (lane 6). The bands highlighted by the solid line boxes, of approximately 1200 bp, represent the
S2 gene. Lanes 3,5 and 7, display the result of PCR reactions conducted 50ºC, 55ºC and 60 ºC, respectively, with
the addition of 0.5 μl of MgCl2 (50 mM). Lane 1 contains the NZY DNA Ladder II molecular weight marker. (C)
Agarose gel electrophoresis of the M2 gene fragment PCR amplification, desbribed in chapter III.5.2. Lane 1
corresponds to the molecular marker NZY DNA Ladder II (NZYTech). Lane 2 contain the PCR products of
amplification using a mixture of random hexamers, while in lanes 3 and 4, the DNA template was produced using
one of the M2 forward and reverse primers, respectively.
31
IV.2.2. ENZYMATIC RESTRICTION WITH BamHI AND NotI
The selected PCR®2.1/σC and PCR®2.1/σA, as well as the pIEx/Bac-1 transfer vectors were
enzymatically digested with the BamHI and NotI restriction enzymes and separated by agarose gel
electrophoresis. The results obtained are shown in fig.IV.9. It is possible to observe three different
products that result from the restriction reactions of both PCR®2.1/σC and PCR®2.1/σA (lanes 2 from
fig.IV.9 A and B). The heaviest band represents the linearized PCR®2.1 vector, while the σC encoding
gene (fig.IV.9 A) or σA encoding gene (fig.IV.9 B) with their respective BamHI/NotI sticky ends
correspond to the intermediate band. The presence of additional BamHI and NotI restriction sites within
the MCS of the PCR®2.1 vector justifies the appearance of a low molecular weight fragment of about
40 bp, that corresponds to the superposition of BamHI/BamHI and NotI/NotI fragments (see fig IV.8.).
The restriction sequences for the BamHI and NotI enzymes in pIEx/Bac-1 vector (6796 bp) are
separated by a 26 bp segment, which is too small to be detected after gel electrophoresis. The absence
of bands at lower molecular weights shows that no coiled or supercoiled forms of the transfer plasmid
were present in the mixture, suggesting that the vector was properly linearized, and originated a band
of 6770 bp that can be seen in lane 3 (fig.IV.9 B).
IV.2.3. MOLECULAR CLONING ON THE TRANSFER PLASMID PIEX/BAC-1
The restricted pIEx/Bac-1 transfer vector, as well as the BamHI-σC-NotI and BamHI-σA-NotI gene
fragments were purified from the gel bands, highlighted in figure IV.9. A and B. The gene fragments
were subsequently cloned into the transfer plasmid at the nucleotide position 2454. The selection of the
cloned plasmids was achieved through the analysis of the restriction patterns of the selected clones with
(B) (A)
Fig. IV.9. (A). Results of gel electrophoresis of the enzymatic restriction of the PCR®2.1/σC vector with BamHI and
NotI (lane2). Lane 1 corresponds to the NZTDNA Lader II molecular weight marker. The solid line box highlights the
restricted σC encoding gene fragment. (B). Results of gel electrophoresis of the enzymatic restriction of the
PCR®2.1/σA plasmid (lane 2) and pIEx/Bac-1 (lane 3) with BamHI and NotI. The band in lane 4 represents the
undigested PCR®2.1/σA plasmid. Lanes 1 and 5 correspond to the NZYDNA Ladder VI and NZYDNA Ladder II
molecular weight markers, respectively. The solid line box highlights the restricted σA encoding gene fragment, whilst
the digested pIEx/Bac-1 plasmid is identified in the interior of the dashed lined box.
32
EcoRI. The pIEx/Bac-1 vector nucleotide sequence includes five restriction sites for the EcoRI
endonuclease, outside its MCS, at positions 1279, 1381 1488, 1561 and 1668 (see appendix VIII.4.2).
Both σC and σA encoded genes have a restriction site sequence for EcoRI at nucleotide positions 481
and 102, respectively. Therefore, the enzymatic restriction of the cloned transfer vectors should originate
six fragments: four fragments of 102 bp, 107 bp, 107 bp, and 73 bp, one representing the vector’s
backbone (6112 bp or 6776 bp, for pIEx-σC and pIEx-σA) and another obtained from the gene’s
cleavage (1267 bp and 888 bp, for σC and σA, respectively). The results obtained are shown in figure
IV.10. In lanes 2, 4, 5, 6 and 7 (fig.IV.10 A) it is possible to observe positive pIEx-σC clones, identified
by the appearance of a distinctive restriction product of approximately 1200 bp and two smaller products
of sizes of approximately 70 bp (73 bp fragment) and 100 bp (including the fragment of 102 bp and the
two fragments of 107 bp). In lanes 2, 4, 5 and 7, other small products resulted from restriction, which
seems to suggest that the pIEx-σC vector restriction was incomplete. The fragment corresponding to
the gene in lane 3 exhibits a molecular weight lower than 1200, and probably does not correspond to a
positive clone. The clone selected for further experiments was the one that is observed in lane 6. The
molecular cloning of the σA encoded gene into the pIEx/Bac-1 transfer vector generated one positive
clone (fig. IV.10 B), as it is possible to observe a distinct band at approximately 900 bp, and two bands
of sizes about 100 and 70 bp, besides a much heavier product, representing the vector backbone. The
remaining clones probably correspond to self-ligated transfer vector, as no products are observed
around 900 bp. The positive selected clones were sequenced to assure the right orientation and integrity
of the cloned genes.
Fig.IV.10. (A). Results from the enzymatic restriction of 7 pIEx-σC putative clones with EcoRI. Lane 1 represents the
NZYDNA Ladder VI weight marker; lanes 2, 4, 5, 6, and 7 represent restriction patterns from positive clones; lanes 3
and 8 correspond to negative clones. (B). Results from the enzymatic restriction of 10 pIEx-σA putative clones with
EcoRI. Lane 7 represents the restriction pattern of a positive clone; lane 1 represents NZYDNA Ladder VI weight
marker; the remaining lanes represent restriction patterns from negative clones.
33
0,00
0,10
0,20
0,30
0,40
0,50
10 30 50 70
Absorb
ance
Conjugate dilution (x1000)
Fig. IV.11. Comparison of two enzyme-linked immunosorbent assays where a blocking step was performed for one of
the assays, using a BSA blocking solution (0.1%). Both assays were performed under optimal antigen (ARV) dilution
(1:16 000), using 2 replicates of a specific pathogen-free serum sample (1:400 dilution) and various horse-radish
peroxidase rabbit anti-chicken IgG conjugate dilutions. The dashed line represents the tendency of the results of the
ELISA without the saturation step, while the solid line represents the tendency line for the results for the ELISA
performed with the saturation step. The triangle symbols represent the average absorbance of the 2 replicates,
measured at each conjugate dilution for the assay performed without BSA blocking. The bullet symbols represent the
average absorbance of the 2 replicates, measured at each conjugate dilution for the assay where the plate was
blocked with BSA. The table represents the mean value of the measured absorbances for the two replicates and the
S.D for the assays performed.
IV.3. DEVELOPMENT OF THE ELISA REACTION
IV.3.1. OPTIMIZATION OF THE ELISA REACTION
The optimization of the ELISA test involved the determination of the optimal antigen dilution of the coated
antigen, the background reduction of absorbance measurements and the determination of the optimal
dilution of HRP-labelled rabbit anti chicken IgG conjugate. The optimal antigen dilution was achieved at
1:16 000. Before the serum was incubated with the coated antigen, a blocking step using a BSA solution
(0.1%) was performed. SPF serum samples were tested at 1:400, using different concentrations of HRP-
labelled rabbit anti-chicken IgG. The results (fig IV.11.) clearly show a significant reduction of the
average absorbance values for the SPF serum, upon saturation with BSA, and a decrease of the
measured absorbance accompanied by the increase of HRP-labelled rabbit anti-chicken IgG dilution. A
positive control serum (1:400) incubation with several HRP-labelled rabbit anti-chicken IgG dilutions
revealed that optimal dilution was achieved at 1: 40 000. As expected, the increase in the dilution of
HRP-labelled rabbit anti-chicken IgG was accompanied by a reduction of the measured absorbances
values, because a lower amount of enzyme is available to react with the H2O2, thus decreasing the
amount of oxidized chromogenic substrate, resulting in lower intensity of color development.
Without BSA blocking
Conjugate dilution (x1000)
10 20 40 80
Mean 0,5250 0,3405 0,2395 0,1440
S.D 0.0863 0.00354 0.0106 0.0113
With BSA blocking
Conjugate dilution (x1000)
10 20 40 80
Mean 0,1080 0,0865 0,1010 0,0375 S.D 0.00424 0.00212 0.0622 0.00212
34
IV.3.2. DETERMINATION OF THE CUT-OFF VALUE
To investigate the existence of antibodies against avian reovirus 19371-PT12 field isolate, serum
samples from 89 breeder chickens and 83 broilers were analyzed.
Eighty-three ARV negative samples from broilers and chickens, tested by ELISA at 450 nm (abs <0.150),
were used to calculate the average (X) and standard deviation (SD) of the optical density (OD) values.
The cut-off value was established as the sum of the average OD value of the negative samples (X) with
three times the SD value, according to the formula: cut-off value= X+3SD 66. Since the average OD
value was calculated in 0.064, with a standard deviation of 0.0365, the cut-off value was estimated as
0.174. Therefore, serum samples with OD values above 0.174 were considered positive by ELISA.
IV.3.3. DETERMINATION OF THE DETECTION LIMIT USING A POSITVE SERUM
The detection limit is considered the highest dilution of a serum sample to produce a positive result. To
find out the limit dilution value, the pool of positive chicken serum samples, used as positive control,
was two-fold serially diluted (starting with serum at 1:400 dilution) and tested by ELISA under the
optimally investigated experimental conditions. For each dilution, the absorbance value was calculated
as the mean absorbance of the three sample replicates assayed. The results, represented in fig.IV.12,
demonstrate that the highest serum dilution to produce an OD value higher than the cut-off value was
achieved at 1:6400, thus considered the highest serum dilution to be detected by this assay.
Serum diluition
Mean S.D
1:400 2,60 0,245 1:800 1,74 0,181 1:1600 1,27 0,191 1:3200 0,420 0,0675 1:6400 0,223 0,0402 1:12800 0,132 0,0220 1:25600 0,0570 0,00200
0,00
0,50
1,00
1,50
2,00
2,50
300 3000 30000
Absorb
ance
Serum dilution (log scale)
Fig. IV.12. Detection limit assay for the optimally developed ELISA, using the 3 replicates of the positive chicken
control sample (1:400). Samples were 2-fold serially diluted and the absorbance was measured at each dilution
and represented in the graph by the mean of absorbance of the replicates (bullet symbols). Serum dilution was
represented in a decimal logarithmic scale. The dashed horizontal line represents the absorbance cut-off value of
0.174. The limit of detection was achieved at 1:6400 serum dilution. The table represents the mean and standard
deviation of the three replicates for each serum dilution.
35
IV.4 VALIDATION OF THE DEVELOPED ELISA REACTION FOR THE DETECTION OF SERUM
ANTIBODIES AGAINST THE AVIAN REOVIRUS 19371-PT12
The ELISA provides a high analytical sensitivity method for antibody detection against the avian
reovirus. However, to get reliable and reproducible results, rigorous control of assay performance is
essential.
IV.4.1. PRECISION OF ELISA REACTION
To assess sample variation within a plate for the developed ELISA, 20 replicates of the positive control
chicken serum, diluted at 1:1600, were tested. The assay results are presented in table 1. Plate
reproducibility was evaluated by the inter-assay CV. The absorbance value of positive control samples
(diluted to 1:1600) was measured for 6 assayed plates (see table 2). The CV obtained within a plate
was 1.6%, while the inter-assay coefficient of variation was 9.1%.
Table 1. Absorbance values obtained in 20 replicates of the pool of positive chicken serum control samples diluted
at 1:1600. The assay was performed as described in section III.8. The mean and standard deviation values are
indicated, as well as the CV obtained for the evaluation of the intra-plate variability.
Absorbance
1.165 1.170 1.151 1.153 1.124 1.135 1.127
1.118 1.138 1.111 1.115 1.119 1.142 1.127
1.126 1.133 1.136 1.133 1.158 1.165
Mean 1.137 S.D 0.0177 CV (%) 1.6
Table 2. Absorbance values obtained for the pool of positive chicken serum control diluted at 1:1600, using the
developed ELISA reaction in six independent assays. The assay was performed as described in section III.8. The
mean and standard deviation values are indicated, as well as the CV obtained for the evaluation of inter-plate
variability.
Absorbance/assay 1.408 1.260 1.270 1.181 1.131 1.104
Mean 1.225 S.D 0.112 CV (%) 9.1
36
IV.4.2. SPECIFICITY
A specificity test for the developed ELISA was performed using 11 chicken reference serum samples
positive for other avian diseases viruses and negative for reovirus, including six avian flu viruses of
different subtypes (H5N3, H2N9, H7N1, H3N2, H7N7 and H13N6), laryngotracheitis virus,
encephalomyelitis virus, New-Castle disease virus, Marek’s disease virus, and infectious bronchitis
virus, at 1:400 dilution. The assay results (table 3) demonstrate that, most serum samples didn’t react
with the coated antigen, as denoted by the low absorbance values that were in most cases within the
same order of magnitude of the absorbance value for the specific pathogen free serum. The absorbance
measured for the New-Castle disease reference serum was slightly higher than the cut-off value.
However, the results obtained reflect the elevated specificity of the ligation between the antigen and
ARV induced antibodies, revealing that the ELISA reaction developed is highly specific.
Table 3. Results for the specificity assay of the developed enzyme-linked immunosorbent assay. Eleven chicken
reference positive serum samples for laryngotracheitis virus, viral encephalomyelitis, New-Castle disease virus,
H5N3, H2N9, H7N1, H3N2, H7N7 and H13N6 avian flu subtype viruses, Marek’s disease virus and infectious
bronchitis virus were tested by ELISA. Positive chicken control serum and specific pathogen free (SPF) serum
samples were used as positive and negative controls, respectively. All serum samples were diluted to 1:400. The
antigen and HRP-labelled rabbit anti-chicken IgG conjugate were used at the determined optimal dilutions of 1:16
000 and 1:40 000, respectively.
Reference serum Absorbance
Laryngotracheitis 0.0780
Encephalomyelitis 0.156
New Castle 0.193
H5N3 0.0660
H2N9 0.0540
H7N1 0.0380
H3N2 0.0510
H7N7 0.102
H13N6 0.0290
Marek 0.156
Infectious bronchitis 0.0520
SPF
Positive control
0.0210
2.485
Positive control 2,485
37
IV.5. ELISA RESULTS
Breeder chicken and boiler serum samples, 89 and 83 respectively, from several explorations in Portugal
were tested to investigate the presence of antibodies against avian reovirus. The results (fig. V.13)
exposed that only 10.8% (9/83) of the broiler samples tested positive in the ELISA, which reflects that
89.2% of broilers did not develop any humoral response against ARV. All the while, the breeder chicken
samples revealed almost the opposite tendency (fig.V.14) with 84.3% (75/89) testing positive because
of the development of a humoral response.
0,000
0,050
0,100
0,150
0,200
0,250
0,300
0,350
0,400
Absorb
ance
Broiler serum samples
Fig. IV.13. Absorbance results for 83 broiler serum samples, from various farms in Portugal, tested by ELISA. The
dashed horizontal line represents the cut-off value of 0.174. The bars above the cut-off value represent the positive
results, while the remaining denote the negative results.
0,000
0,500
1,000
1,500
2,000
2,500
Absorb
ance
Chicken serum samples
Fig. IV.14. Absorbance results for 89 breeder chicken serum samples, from various farms in Portugal, tested by
ELISA. The dashed horizontal line represents the cut-off value of 0.174. The bars above the cut-off value represent
the positive results, while the remaining denote the negative results.
38
IV.6. DEVELOPMENT OF THE SERUM NEUTRALIZATION REACTION
IV.6.1. AVIAN REOVIRUS TITRATION
Cells from the CHO MDCK, Vero, BHK21, MDBK, RK13 and LMH cellular lines, were inoculated with
several dilutions of the isolate 19371-PT12. Except for LMH cells, no cytopathic effect was detected
(fig.IV.15) at microscopic observation, since cells maintained their usual shape and density,
demonstrating that no infection had been developed post inoculation. By opposition, LMH cell
morphology and density was greatly affected in the presence of the virus, where the formation of
syncytia, rounding of the cells, decreased occupation of the growth surface, cell detachment and
apoptosis were observed. The virus titer equivalent to 1 TCID50, was determined to be 104/50 µl of viral
solution, calculated by the Spearman Kärben method. Figure IV.15. presents LMH (A and B), CHO (C
and D) and MDCK (E and F) cells inoculated and non-inoculated with the ARV 19371-PT12 strain. Since
LMH cells were proven to be the only susceptible to ARV infection among the cellular lines tested, these
were chosen for serum neutralization test development.
A
C D
A B
E F
Fig.IV.15. Inoculated and non-inoculated cells with isolate 19371-PT12 after 5 days of incubation at 37ºC in a 5 %
CO2 atmosphere. A – LMH cells inoculated with 10 TCID50 (40x magnification).); B –– LMH cells grown without virus
inoculation (40x amplification); The structure highlighted with the dashed line represents an agglomerate of fused
cells (syncytium). C – CHO cells grown without virus inoculation (40x amplification); D – CHO cells inoculated with
100 TCID50 (40x amplification); E – MDCK cells grown without virus inoculation (40x amplification); F –MDCK cells
inoculated with 100 TCID50 (40x magnification). No evidence of cytopathic effect can be found in either figures C, D,
E or F.
39
IV.6.2. SERUM NEUTRALIZATION TEST RESULTS
Serum neutralization tests were performed to provide additional information about the serum samples
tested by the developed ELISA, namely if the antibodies against ARV present in the positive serum
samples could effectively neutralize the virus. For this purpose, 30 chicken serum samples, with the
highest positive absorbance values in the ELISA reaction, and 10 ELISA negative broiler’s serum
samples were tested. Despite the highly positive results in the ELISA, most of the neutralizing serum
titers were low (<40.5/50 μl of viral solution containing 100 TCID50), with 36,7% (11 out of 30) of all
chicken sera exhibiting neutralizing titers inferior to 10/ 50 μl of viral solution containing 100 TCID50,
which were considered negative. Although, one chicken serum sample revealed a much higher
neutralizing titer in comparison with the remaining tested samples, with a virus neutralizing titer of 161.2
/ 50 μl of viral solution containing 100 TCID50. As expected, the antibody-negative broiler sera did not
produce any viral neutralizing effect, as all samples were negative in SNT.
Table 4. Serum neutralizing titers for 30 ELISA positive chicken serum samples and 10 broiler ELISA negative
serum samples. SNT was performed for 2-fold sera dilutions, starting at 1:10, with a constant viral titer of 100 TCID50
(confirmed by back titration).
Serum neutralizing titer/ 50 μl of
viral solution containing 100
TCID50
<10 10.2 14.4 20.3 28.7 40.5 161.2
Breeder chicken samples 11 5 6 3 3 1 1
Broiler samples 10
IV.7. WESTERN IMMUNOBLOT
To identify the specificity of antibodies in chicken sera towards the viral proteins of the 19371-PT12
isolate, a western immunoblot assay was developed using purified reovirus particles. The viral proteins,
separated by SDS-PAGE, were transferred onto a PVDC membrane and incubated with five chicken
serum antibody-positive samples (strips 1 to 5), a positive control (strip 6) and a negative SPF serum
sample (strip 7). All sera, except serum tested in strip 2, had been previously tested by SNT, which
revealed that virus neutralizing titers for these samples were all inferior to 20.3/ 50 μl of viral solution
containing 100 TCID50. The results (fig.IV.16) denote the formation of similar patterns of band-sets for
the tested sera, except for the negative control. A model correlating the polypeptide molecular weight
(𝑀𝑊 ) and migrating distance (𝑑 ) on the polyacrylamide gel was developed (equation 1), using a
reference marker (NZYColour Protein Marker II), and used for protein assignment of the bands, together
with the information in table 5. The correlation coefficient for the model was 0.992. It is possible to find
small variations in the MWs of the viral proteins belonging to different avian reovirus strains. These
40
might arise from differences in biomolecules inherent to each strain or experimental work. The
estimated MWs of proteins corresponding to bands 3 to 9, shown in fig IV.16, were close to those
described for other avian reovirus strains, S1133 and RAM-1 (table 5), which suggests that the outer
capsid proteins, μB, μBC, σB and σC probably correspond to bands 5, 6, 8 and 9, while the λC protein,
found in both the viral core and external capsid, is probably represented by band 3. For the same
reasons, core proteins μA and σA are likely to be characterized by bands 4 and 7. The remaining core
components λA and λB, the heaviest within the viral particle structure (table 5), are likely to correspond
to bands 1 and 2, even though the estimated sizes for these were 146 kDa and 205 kDa, respectively,
which are higher than those reported for other strains. It’s noteworthy to mention that the model used
to predict protein size was developed for a 25-135 kDa size range. Since bands 1 and 2 are outside this
size window, the estimated weights have a higher uncertainty.
𝑀𝑊(𝑘𝐷𝑎) = −0.2152 𝑑(𝑐𝑚)3 + 8.6706 𝑑(𝑐𝑚)2 − 118.29 𝑑(𝑐𝑚) + 586.4 (1)
S1 S2 S3 S4 S5 S6 S7 M
(kDa)
146
104
77
62
58
45
42
39
1
2
3
4
5 6
7
8
135
100
75
9
63
48
35
25
Fig.IV.16. Results from the immunoblot assay for the field isolate 19371-PT12. Membrane strips S1 to S5 were
incubated with serum samples positively tested by ELISA. Strips S6 and S7 were incubated with a pool of positive
chicken sera, tested by ELISA, and a negative SPF serum, respectively. The sera were diluted to 1:25 and
incubated with the viral protein-stained membrane for 2.5 h with agitation. The HRP-labelled rabbit anti-chicken
IgG conjugate (dilution 1:1000) was used to detect bound antibodies. The identifiable viral protein bands are
numerated in bold (1-9), with the respective molecular weight indicated to the left. The band sizes of the protein
molecular-weight marker M (NZY Color Protein Marker II) are identified, respectively to the right. All protein
molecular weights are indicated in kDa.
(kDa)
205
41
Table 5. Comparison of structural proteins of RAM-1 and S1133 strains of avian reovrus.
Virus strain RAM-1 28 Virus strain S1133 25
Protein MW (kDa) MW (kDa)
λA 130 147
λB 124 130
λC 105 120
μA 74 79
μB 68 72
μBC - 68
μBN - 5.5
σA 45 43
σB 43 42
σC 39 34
42
V. DISCUSSION
After phylogenetic analysis of the ARV strains isolated, genotype 2 was identified as the most frequent
amongst the isolates. The 19371-PT12 strain, belonging to this genotype was chosen for the
development of a VLP-based vaccine. The construction of VLPs using the baculovirus expression vector
insect cell system, involves the cloning of the desired genes into the pIEx/Bac-1 transfer plasmid in
E.coli, followed by homologous recombination with the baculovirus after co-transfection of insect cells.
One of the aims of this work was to clone the σC, σA and μB encoding-genes into the pIEx/Bac-1 transfer
vector. The highly variable and type specific neutralizing antibodies inducing σC structural protein, the
inner core component σA and a major component of the outer capsid μB were chosen to produce the
VLPs because of their immunogenic properties and self-assembly capabilities. The portion of the S1
gene encoding σC and the σA-S2 encoding gene were successfully amplified and cloned into the
pIEx/Bac-1 transfer vectors.
An indirect ELISA reaction was developed, optimized and validated, using the whole virus 19371-PT12
strain as coating antigen, for the detection of antibodies against avian reovirus. Various ELISA reactions
were performed to find the optimal coating antigen dilution and ideal HRP-labeled rabbit anti-chicken
IgG conjugate dilution, which were determined to be 1:16 000 and 1:40 000, respectively. The
optimization process, also entailed the background reduction of the absorbance measurements, caused
by the often occurrence of non-specific binding reactions in ELISA tests using avian sera. Factors such
as the nature of the antigen coating to the well, the amount of IgM in the serum, as well as age and
serum dilution have been attributed to non-specific binding 67. To increase the specificity of antibodies
to the antigen, the plate wells were saturated with a BSA blocking solution after they were coated with
optimally diluted viral particles, which led to a significant background reduction (fig.IV.11), because of
the decrease of unspecific binding to the antigen or the surface of the wells, occupied by BSA molecules.
The indirect ELISA was used to assess the humoral response of breeder chickens and broilers to ARV.
Based on the cut-off value, 84.3% of breeder chickens (n=89) and just 10.8% of broilers (n=83) tested
positive, reflecting the development of a humoral response, either attributed to vaccination or infection
of the birds with ARV. The ELISA negative results reflect the lack of humoral response, which might
indicate that the bird is free from infection or that it was at seroconversion at the time the serum was
collected. The control of the disease by vaccination mostly relies on the vaccination of parent flocks,
with the aim of conferring immunity to the progeny via maternal antibodies 71. Although, since the
occurrence of new viral strains, commercial vaccines have shown to be ineffective in protecting progeny
against reovirus, which is likely to justify the great discrepancy between the percentage of positive
results between breeder chickens and broilers. Another possible explanation is related to the
ubiquitousness of ARV among poultry flocks. Because breeder chickens live longer than broiler
chickens, they are more likely to have been infected by pathogenic or non-pathogenic forms of ARV
thus justifying the development of humoral responses detected by the developed ELISA reaction 7.
43
The validation of the ELISA reaction involved the determination of the precision and specificity. To
evaluate the precision of the ELISA reaction, the inter-assay and the intra-assay variabilities were
measured in terms of the coefficient of variation (CV). Sample variation within a plate was evaluated by
testing 20 replicates of a positive control in a single plate. The inter-assay variability was determined
using a positive control sample in the developed ELISA reaction in six independent assays. Both assays
showed CV values well under the acceptance threshold value of <15% 16,84, indicating that the test has
good repeatability and reproducibility. The reaction also revealed great specificity, as it was capable of
generate negative results for reference serum samples containing antibodies against other avian viral
diseases, (n=10). The limit of detection, defined as the highest serum dilution of the positive control
serum, was determined to be 1:6400 for the tested positive serum.
Virus titration using several cellular lines demonstrated that the LMH cells were the only sensitive to the
ARV 19371-PT12 isolated strain, which were selected to perform serum neutralization tests.
Highly ELISA-positive chicken serum samples were used in serum neutralization tests. The results
demonstrated that 36.7% of tested samples failed to provide any virus neutralization, and that, all but
one, of the remaining serum samples exhibited very low virus neutralizing titers. These results prove
that, contrary to common practice, the ELISA alone should not be used to access the bird’s immunity to
viral infection, as most tested subjects revealed elevated antibody titers by ELISA, but a low titer of
antibodies capable of effectively neutralizing the antigen, which is probably attributed to the failure of
current vaccination programs, or related to the emergence of new variants of avian reovirus. Instead,
the ELISA should be used as a monitoring tool that should be complemented by SNT, having in mind
that immunity is not merely mediated by humoral response but also by cellular response, which is not
factored by any of the tests.
To identify the specificity of antibodies in chicken sera towards the viral proteins of the 19371-PT12
strain, a western immunoblot was developed. The molecular weight corresponding to each band was
determined using a model that correlates the protein migrating distance in the gel, with its respective
weight, using a reference weight marker. Comparing the band sizes with those from other reported
proteins allowed protein assignment of the bands, it was possible to observe that the intensity and band
profile differs between samples, although for each sample, the bands identified with outer capsid
proteins μB and σB, and in some cases (strips 1-4) σA, a viral core protein, were the most intense,
reflecting the specificity of the tested sera towards these viral proteins. Polypeptides λB, σB have been
reported to have broad specific neutralizing activity, while σC is known for its type specific neutralizing
activity. All sera reacted with the λB, as a distinctive band is seen (fig.IV.16), although very faint bands
for the small σC fusion protein, which might be explained by the high variability of this protein. This
analysis agrees with the ELISA and SNT results for the tested sera, where highly positive results were
obtained by ELISA, but generally low neutralizing antibodies were observed in SNT, revealing that the
production of antibodies is not being directed towards neutralizing antibodies.
Besides its 10 structural proteins, the avian reovirus has 4 non-structural proteins, composed by μNS,
μNSC, σNS, p10 and p17, which are expressed in infected cells but do not incorporate the viral particle
44
2,24. Therefore, chicken serum reactivity towards non-structural proteins could not be studied in this
assay. A western immunoblot assay using infected cells lysate should be considered instead.
45
VI.FUTURE WORK
The next step for the VLPs production is the co-transfection of the cloned pIEx-σC and pIEx-σA and the
genetically modified baculovirus, derived from the AcNPV genome (BacMagic DNA (Invitrogen)), of
insect Sf9 insect cells, where homologous recombination between the two compatible vectors will occur,
allowing the expression of the recombinant proteins. For the amplification of the μB encoding gene, new
amplification conditions, regarding PCR mixture and temperature profiles should be tested.
The ELISA results should be validated with a commercial ELISA, and the specificity and sensitivity of
the reaction should be determined. To assess the specificity of the ELISA reaction, samples testing
negative by the commercial ELISA, should be tested by the developed ELISA to ensure that the same
negative results can be generated. On the other hand, sensitivity can be evaluated by measuring the
proportion of positive samples correctly identified by the ELISA test, when comparing with the results of
the commercial ELISA.
After expression of the recombinant type-specific neutralizing σC protein by the insect cell system, the
indirect ELISA reaction could be improved, using this protein as a coating antigen, instead of the whole
virus particle, which has it has been shown, has the disadvantage of detecting both neutralizing and
non-neutralizing antibodies, leading to difficulties to assess the immune protection of the bird. Using the
σC external capsid protein as an antigen can be a way to avert this difficulty because only neutralizing
antibodies would be detected by the ELISA reaction, thus possibly eliminating the need to perform time-
consuming and laborious serum neutralization tests to confirm the protection status of the birds against
ARV infection. In fact, indirect ELISA reactions, using bacterial and yeast recombinant immunogenic
viral proteins as coating antigens, such as σC and σB proteins, have already been reported to have
great correlation with the SNT results 67–69.
46
VII. REFERENCES
1. King AMQ, Division. IU of MSV. Virus Taxonomy : Classification and Nomenclature of Viruses : Ninth Report of the International Committee on Taxonomy of Viruses. Elsevier; 2012. https://books.google.pt/books?hl=pt-PT&lr=&id=aFYaE9KXEXUC&oi=fnd&pg=PP1&dq=International+Committee+on+Taxonomy+of+Viruses,+9th+report+(2011)&ots=uLeqNy4hXS&sig=LkDvJIKqwoH3xWt_bqDV71gOXlQ&redir_esc=y#v=onepage&q=International Committee on Taxonomy of Vir. Accessed November 1, 2017.
2. Benavente J, Martínez-Costas J. Avian reovirus: Structure and biology. Virus Res. 2007;123(2):105-119. doi:10.1016/j.virusres.2006.09.005.
3. Zhong L, Gao L, Liu Y, et al. Genetic and pathogenic characterisation of 11 avian reovirus isolates from northern China suggests continued evolution of virulence. Sci Rep. 2016;6(1):35271. doi:10.1038/srep35271.
4. Jones RC. Avian reovirus infections. Rev Sci Tech. 2000;19(2):614-625. http://www.ncbi.nlm.nih.gov/pubmed/10935283. Accessed November 1, 2017.
5. Van Der Heide L. Viral arthritis/tenosynovitis: A review. Avian Pathol. 1977;6(4):271-284. doi:10.1080/03079457708418237.
6. van der Heide L. The history of avian reovirus. Avian Dis. 2000;44(3):638-641. http://www.ncbi.nlm.nih.gov/pubmed/11007012. Accessed November 1, 2017.
7. S.Sellers H. Current limitations in control of viral arthritis and tenosynovitis caused by avian reoviruses in commercial poultry. Vet Microbiol. 2017;206:152-156. doi:10.1016/J.VETMIC.2016.12.014.
8. Rosenberger JK, Sterner FJ, Botts S, Lee KP, Margolin A. In vitro and in vivo characterization of avian reoviruses. I. Pathogenicity and antigenic relatedness of several avian reovirus isolates. Avian Dis. 1989;33(3):535-544. http://www.ncbi.nlm.nih.gov/pubmed/2549941. Accessed November 1, 2017.
9. van Loon AAWM, Koopman HC, Kosman W, et al. Virology: Isolation of a new serotype of avian reovirus associated with malabsorption syndrome in chickens. Vet Q. 2001;23(3):129-133. doi:10.1080/01652176.2001.9695099.
10. Lu H, Tang Y, Dunn PA, Wallner-Pendleton EA, Lin L, Knoll EA. Isolation and molecular characterization of newly emerging avian reovirus variants and novel strains in Pennsylvania, USA, 2011–2014. Sci Rep. 2015;5:14727. doi:10.1038/srep14727.
11. Liu HJ, Lee LH, Hsu HW, Kuo LC, Liao MH. Molecular evolution of avian reovirus: evidence for genetic diversity and reassortment of the S-class genome segments and multiple cocirculating lineages. Virology. 2003;314(1):336-349. doi:10.1016/S0042-6822(03)00415-X.
12. Troxler S, Rigomier P, Bilic I, et al. Identification of a new reovirus causing substantial losses in broiler production in France, despite routine vaccination of breeders. Vet Rec. 2013;172(21):556-556. doi:10.1136/vr.101262.
13. Ayalew LE, Gupta A, Fricke J, et al. Phenotypic, genotypic and antigenic characterization of emerging avian reoviruses isolated from clinical cases of arthritis in broilers in Saskatchewan, Canada. Sci Rep. 2017;7(1):3565. doi:10.1038/s41598-017-02743-8.
14. Roldão A, Mellado MCM, Castilho LR, Carrondo MJ, Alves PM. Virus-like particles in vaccine development. Expert Rev Vaccines. 2010;9(10):1149-1176. doi:10.1586/erv.10.115.
15. Crisci E, Bárcena J, Montoya M. Virus-like particles: The new frontier of vaccines for animal viral infections. Vet Immunol Immunopathol. 2012;148(3-4):211-225. doi:10.1016/j.vetimm.2012.04.026.
47
16. Liu F, Wu X, Li L, Liu Z, Wang Z. Use of baculovirus expression system for generation of virus-like particles: Successes and challenges. Protein Expr Purif. 2013;90(2):104-116. doi:10.1016/j.pep.2013.05.009.
17. Vicente T, Roldão A, Peixoto C, Carrondo MJT, Alves PM. Large-scale production and purification of VLP-based vaccines. J Invertebr Pathol. 2011;107:S42-S48. doi:10.1016/j.jip.2011.05.004.
18. Thayer SG, Villegas P, Fletcher OJ. Comparison of two commercial enzyme-linked immunosorbent assays and conventional methods for avian serology. Avian Dis. 1987;31(1):120-124. http://www.ncbi.nlm.nih.gov/pubmed/3034226. Accessed November 2, 2017.
19. Spandidos DA, Graham AF. Physical and chemical characterization of an avian reovirus. J Virol. 1976;19(3):968-976. http://www.ncbi.nlm.nih.gov/pubmed/987252. Accessed November 1, 2017.
20. Borodavka A, Ault J, Stockley PG, Tuma R. Evidence that avian reovirus σNS is an RNA chaperone: implications for genome segment assortment. Nucleic Acids Res. 2015;43(14):7044-7057. doi:10.1093/nar/gkv639.
21. Shapouri MRS, Kane M, Letarte M, Bergeron J, Arella M, Silim A. Cloning, sequencing and expression of the S1 gene of avian reovirus. J Gen Virol. 1995;76(6):1515-1520. doi:10.1099/0022-1317-76-6-1515.
22. Glass SE, Naqi SA, Hall CF, Kerr KM. Isolation and characterization of a virus associated with arthritis of chickens. Avian Dis. 17(2):415-424. http://www.ncbi.nlm.nih.gov/pubmed/4351420. Accessed November 2, 2017.
23. Bodelón G, Labrada L, Martı́nez-Costas J, Benavente J. The Avian Reovirus Genome Segment S1 Is a Functionally Tricistronic Gene That Expresses One Structural and Two Nonstructural Proteins in Infected Cells. Virology. 2001;290(2):181-191. doi:10.1006/viro.2001.1159.
24. Varela R, Benavente J. Protein coding assignment of avian reovirus strain S1133. J Virol. 1994;68(10):6775-6777. http://www.ncbi.nlm.nih.gov/pubmed/8084013. Accessed November 1, 2017.
25. Martínez-Costas J, Grande A, Varela R, García-Martínez C, Benavente J. Protein architecture of avian reovirus S1133 and identification of the cell attachment protein. J Virol. 1997;71(1):59-64. http://www.ncbi.nlm.nih.gov/pubmed/8985323. Accessed November 1, 2017.
26. Bodelón G, Labrada L, Martínez-Costas J, Benavente J. Modification of late membrane permeability in avian reovirus-infected cells: viroporin activity of the S1-encoded nonstructural p10 protein. J Biol Chem. 2002;277(20):17789-17796. doi:10.1074/jbc.M202018200.
27. Ide PR, Dewitt W. Serological incidence of avian reovirus infection in broiler-breeders and progeny in Nova Scotia. Can Vet J = La Rev Vet Can. 1979;20(12):348-353. http://www.ncbi.nlm.nih.gov/pubmed/231481. Accessed November 2, 2017.
28. Wickramasinghe R, Meanger J, Enriquez CE, Wilcox GE. Avian Reovirus Proteins Associated with Neutralization of Virus Infectivity. Virology. 1993;194(2):688-696. doi:10.1006/viro.1993.1309.
29. Xu W, Coombs KM. Conserved structure/function of the orthoreovirus major core proteins. Virus Res. 2009;144(1-2):44-57. doi:10.1016/j.virusres.2009.03.020.
30. Hsiao, J., Martınez-Costas, J., Benavente, J., Vakharia VN. Cloning, Expression, and Characterization of Avian Reovirus Guanylyltransferase. Virology. 2002;296(2):288-299. doi:10.1006/VIRO.2002.1427.
31. Noad L, Shou J, Coombs KM, Duncan R. Sequences of avian reovirus M1, M2 and M3 genes and predicted structure/function of the encoded μ proteins. Virus Res. 2006;116(1-2):45-57.
48
doi:10.1016/j.virusres.2005.08.014.
32. Tourı́s-Otero F, Cortez-San Martı́n M, Martı́nez-Costas J, Benavente J. Avian Reovirus Morphogenesis Occurs Within Viral Factories and Begins with the Selective Recruitment of σNS and λA to μNS Inclusions. J Mol Biol. 2004;341(2):361-374. doi:10.1016/j.jmb.2004.06.026.
33. O’Hara D, Patrick M, Cepica D, Coombs KM, Duncan R. Avian reovirus major mu-class outer capsid protein influences efficiency of productive macrophage infection in a virus strain-specific manner. J Virol. 2001;75(11):5027-5035. doi:10.1128/JVI.75.11.5027-5035.2001.
34. Gonzalez-Lopez C, Martínez-Costas J, Esteban M, Benavente J. Evidence that avian reovirus sigmaA protein is an inhibitor of the double-stranded RNA-dependent protein kinase. J Gen Virol. 2003;84(6):1629-1639. doi:10.1099/vir.0.19004-0.
35. Shmulevitz M, Corcoran J, Salsman J, Duncan R. Cell-cell fusion induced by the avian reovirus membrane fusion protein is regulated by protein degradation. J Virol. 2004;78(11):5996-6004. doi:10.1128/JVI.78.11.5996-6004.2004.
36. Chi PI, Huang WR, Lai IH, Cheng CY, Liu HJ. The p17 nonstructural protein of avian reovirus triggers autophagy enhancing virus replication via activation of phosphatase and tensin deleted on chromosome 10 (PTEN) and AMP-activated protein kinase (AMPK), as well as dsRNA-dependent protein kinase (PKR)/eIF2α signaling pathways. J Biol Chem. 2013;288(5):3571-3584. doi:10.1074/jbc.M112.390245.
37. Wood, G. W., Nicholas, R. A. J., Hebert, C. A., Thornton DH. Serological comparisons of avian reoviruses. J Comp Pathol. 1980;90(1):29-38. doi:10.1016/0021-9975(80)90025-0.
38. Shen, P. C., Chiou, Y. F., Liu, H. J., Song, C. H., Su, Y. P., & Lee LH. Genetic variation of the λA and λC protein encoding genes of avian reoviruses. Res Vet Sci. 2007;83(3):394-402. doi:10.1016/J.RVSC.2007.01.002.
39. Su, Y. P., Su, B. S., Shien, J. H., Liu, H. J., & Lee LH. The sequence and phylogenetic analysis of avian reovirus genome segments M1, M2, and M3 encoding the minor core protein μA, the major outer capsid protein μB, and the nonstructural protein μNS. J Virol Methods. 2006;133(2):146-157. doi:10.1016/J.JVIROMET.2005.10.031.
40. Duncan, R., & Sullivan K. Characterization of Two Avian Reoviruses That Exhibit Strain-Specific Quantitative Differences in Their Syncytium-Inducing and Pathogenic Capabilities. Virology. 1998;250(2):263-272. doi:10.1006/VIRO.1998.9371.
41. Donnelly JJ, Friedman A, Martinez D, et al. Preclinical efficacy of a prototype DNA vaccine: enhanced protection against antigenic drift in influenza virus. Nat Med. 1995;1(6):583-587. http://www.ncbi.nlm.nih.gov/pubmed/7585127. Accessed November 2, 2017.
42. Zhou NN, Senne DA, Landgraf JS, et al. Genetic reassortment of avian, swine, and human influenza A viruses in American pigs. J Virol. 1999;73(10):8851-8856. http://www.ncbi.nlm.nih.gov/pubmed/10482643. Accessed November 2, 2017.
43. Al‐Muffarej SI, Savage CE, Jones RC. Egg transmission of avian reoviruses in chickens:
Comparison of a trypsin‐sensitive and a trypsin‐resistant strain. Avian Pathol. 1996;25(3):469-480. doi:10.1080/03079459608419156.
44. Jones RC, Islam MR, Kelly DF. EARLY PATHOGENESIS OF EXPERIMENTAL REOVIRUS INFECTION IN CHICKENS. Avian Pathol. 1989;18:239-253. http://www.tandfonline.com/doi/pdf/10.1080/03079458908418599. Accessed November 2, 2017.
45. Kibenge FSB, Gwaze GE, Jones RC, Chapman AF, Savage CE. Experimental reovirus infection in chickens: Observations on early viraemia and virus distribution in bone marrow, liver and enteric tissues. Avian Pathol. 1985;14(1):87-98. doi:10.1080/03079458508436210.
46. Bradbury JM, Garuti A. Dual infection with Mycoplasma synoviae and a tenosynovitis‐inducing
49
reovirus in chickens. Avian Pathol. 1978;7(3):407-419. doi:10.1080/03079457808418294.
47. Shapouri MRS, Arella M, Silim A. Evidence for the multimeric nature and cell binding ability of avian reovirus a3 protein. J Gen Virol. 1996;77:1203-1210. http://www.microbiologyresearch.org/docserver/fulltext/jgv/77/6/JV0770061203.pdf?expires=1509585621&id=id&accname=guest&checksum=08604AB9B41B80362D02DE1AAF79308C. Accessed November 2, 2017.
48. Duncan R, Chen Z, Walsh S, Wu S. Avian Reovirus-Induced Syncytium Formation Is Independent of Infectious Progeny Virus Production and Enhances the Rate, but Is Not Essential, for Virus-Induced Cytopathology and Virus Egress. Virology. 1996;224(2):453-464. doi:10.1006/viro.1996.0552.
49. Songserm T, Pol JM, van Roozelaar D, Kok GL, Wagenaar F, ter Huurne AA. A comparative study of the pathogenesis of malabsorption syndrome in broilers. Avian Dis. 2000;44(3):556-567. http://www.ncbi.nlm.nih.gov/pubmed/11007003. Accessed November 1, 2017.
50. Mandelli G, Rampin T, Finazzi M. Experimental Reovirus Hepatitis in Newborn Chicks. Vet Pathol. 1978;15(4):531-543. doi:10.1177/030098587801500411.
51. Tang KN, Fletcher OJ, Villegas P. The effect on newborn chicks of oral inoculation of reovirus isolated from chickens with tenosynovitis. Avian Dis. 1987;31(3):584-590. http://www.ncbi.nlm.nih.gov/pubmed/2823775. Accessed November 1, 2017.
52. Saif YM, Fadly AM, Glisson JR, McDougald LR, Nolan LK, Swayne DE. Diseases of Poultry. Wiley-Blackwell; 2011. https://books.google.pt/books/about/Diseases_of_Poultry.html?id=XWleGIZcZakC&redir_esc=y. Accessed November 1, 2017.
53. Shapouri MRS, Arella M, Silim A. Immunogenicity of E. coli-expressed CT3 protein of avian reovirus in chickens. Avian Pathol. 1997;26:419-425. http://www.tandfonline.com/doi/pdf/10.1080/03079459708419223. Accessed November 2, 2017.
54. van Loon AAWM, Kosman W, van Zuilekom HI, van Riet S, Frenken M, Schijns VEJC. The contribution of humoral immunity to the control of avian reoviral infection in chickens after vaccination with live reovirus vaccine (strain 2177) at an early age. Avian Pathol. 2003;32(1):15-23. doi:10.1080/0307945021000070679.
55. Mukiibi-Muka G, Jones RC. Local and systemic IgA and IgG responses of chicks to avian reoviruses: Effects of age of chick, route of infection and virus strain. Avian Pathol. 1999;28(1):54-60. doi:10.1080/03079459995046.
56. Pertile TL, Karaca K, Walser MM, Sharma JM. Suppressor macrophages mediate depressed lymphoproliferation in chickens infected with avian reovirus. Vet Immunol Immunopathol. 1996;53(1-2):129-145. doi:10.1016/0165-2427(96)05555-9.
57. Neelima S, Ram GC, Kataria JM, Goswami TK. Avian Reovirus Induces an Inhibitory Effect on Lymphoproliferation in Chickens. Vet Res Commun. 2003;27(1):73-85. doi:10.1023/A:1022014825451.
58. Jones RC, Onunkwo O. STUDIES ON EXPERIMENTAL TENOSYNOVITIS IN LIGHT HYBRID CHICKENS. Avian Pathol. 1978;7:171-181. http://www.tandfonline.com/doi/pdf/10.1080/03079457808418268. Accessed November 2, 2017.
59. Xie Z, Fadl AA, Girshick T, Khan MI. Amplification of avian reovirus RNA using the reverse transcriptase-polymerase chain reaction. Avian Dis. 1997;41(3):654-660. http://www.ncbi.nlm.nih.gov/pubmed/9356712. Accessed November 2, 2017.
60. Lee LH, Shien JH, Shieh HK. Detection of avian reovirus RNA and comparison of a portion of genome segment S3 by polymerase chain reaction and restriction enzyme fragment length
50
polymorphism. Res Vet Sci. 1998;65(1):11-15. doi:10.1016/S0034-5288(98)90020-0.
61. Liu HJ, Chen JH, Liao MH, Lin MY, Chang GN. Identification of the sigma C-encoded gene of avian reovirus by nested PCR and restriction endonuclease analysis. J Virol Methods. 1999;81(1-2):83-90. doi:10.1016/S0166-0934(99)00063-4.
62. Liu HJ, Lee LH, Shih WL, Li YJ, Su HY. Rapid characterization of avian reoviruses using phylogenetic analysis, reverse transcription-polymerase chain reaction and restriction enzyme fragment length polymorphism. Avian Pathol. 2004;33(2):171-180. doi:10.1080/03079450310001652130.
63. Giambrone JJ. Microculture Neutralization Test for Serodiagnosis of Three Avian Viral Infections. Avian Dis. 1980;24(1):284. doi:10.2307/1589788.
64. Endo‐Munoz LB. A western blot to detect antibody to avian reovirus. Avian Pathol. 1990;19(3):477-487. doi:10.1080/03079459008418701.
65. Slaght SS, Yang TJ, Van der Heide L, Fredrickson TN. An enzyme-linked immunosorbent assay (ELISA) for detecting chicken anti-reovirus antibody at high sensitivity. Avian Dis. 1978. http://agris.fao.org/agris-search/search.do?recordID=US19790404791. Accessed November 2, 2017.
66. Xie Z, Qin C, Xie L, et al. Recombinant protein-based ELISA for detection and differentiation of antibodies against avian reovirus in vaccinated and non-vaccinated chickens. J Virol Methods. 2010;165(1):108-111. doi:10.1016/j.jviromet.2009.12.008.
67. Shien J. H., Yin HS, Lee LH. An enzyme-linked immunosorbent assay for the detection of antibody to avian reovirus by using protein σ B as the coating antigen. Res Vet Sci. 2000;69(2):107-112. https://www.cabdirect.org/cabdirect/abstract/20003008502. Accessed November 2, 2017.
68. Yang Z-J, Wang C-Y, Lee L-H, et al. Development of ELISA kits for antibodies against avian reovirus using the σC and σB proteins expressed in the methyltropic yeast Pichia pastoris. J Virol Methods. 2010;163(2):169-174. doi:10.1016/j.jviromet.2009.07.009.
69. Liu HJ, Kuo LC, Hu YC, Liao MH, Lien YY. Development of an ELISA for detection of antibodies to avian reovirus in chickens. J Virol Methods. 2002;102(1-2):129-138. doi:10.1016/S0166-0934(02)00010-1.
70. Guo K, Dormitorio T V., Ou S-C, Giambrone JJ. Development of TaqMan real-time RT-PCR for detection of avian reoviruses. J Virol Methods. 2011;177(1):75-79. doi:10.1016/j.jviromet.2011.06.022.
71. Islam MR, Jones RC. An enzyme-linked immunosorbent assay for measuring antibody titre against avian reovirus using a single dilution of serum. Avian Pathol. 1988;17(2):411-425. doi:10.1080/03079458808436459.
72. Giambrone JJ, Solano W. Serologic Comparison of Avian Reovirus Isolates Using Virus Neutralization and an Enzyme-Linked Immunosorbent Assay. Avian Dis. 1988;32(4):678. doi:10.2307/1590984.
73. Kärber G. Beitrag zur kollektiven Behandlung pharmakologischer Reihenversuche. Naunyn Schmiedebergs Arch Exp Pathol Pharmakol. 1931;162(4):480-483. doi:10.1007/BF01863914.
74. Spearman C. The method of right and wrong cases (constant stimuli) without Gauss’s formula. 1908;(2):227–242. https://www.scienceopen.com/document?vid=c4853d5a-53d2-412c-a6d5-bee97b4f8e83. Accessed November 2, 2017.
75. Blake MS, Johnston KH, Russell-Jones GJ, Gotschlich EC. A rapid, sensitive method for detection of alkaline phosphatase-conjugated anti-antibody on Western blots. Anal Biochem. 1984;136(1):175-179. http://www.ncbi.nlm.nih.gov/pubmed/6424501. Accessed November 2, 2017.
51
76. Goldenberg D, Lublin A, Rosenbluth E, Heller ED, Pitcovski J. Optimized polypeptide for a subunit vaccine against avian reovirus. Vaccine. 2016;34(27):3178-3183. doi:10.1016/j.vaccine.2016.04.036.
77. Sanger F, Nicklen S, Coulson AR. DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci U S A. 1977;74(12):5463-5467. http://www.ncbi.nlm.nih.gov/pubmed/271968. Accessed November 2, 2017.
78. Thompson JD, Higgins DG, Gibson TJ. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 1994;22(22):4673-4680. http://www.ncbi.nlm.nih.gov/pubmed/7984417. Accessed November 2, 2017.
79. Maddison WP, Maddison DR. Mesquite: a modular system for evolutionary analysis. 2009. http://mesquiteproject.org.
80. Huelsenbeck JP, Ronquist F. MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics. 2001;17(8):754-755. http://www.ncbi.nlm.nih.gov/pubmed/11524383. Accessed November 2, 2017.
81. Ronquist F, Huelsenbeck JP. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics. 2003;19(12):1572-1574. doi:10.1093/bioinformatics/btg180.
82. Holmes DS, Quigley M. A rapid boiling method for the preparation of bacterial plasmids. Anal Biochem. 1981;114(1):193-197. http://www.ncbi.nlm.nih.gov/pubmed/6269464. Accessed November 2, 2017.
83. Kangro BWJ, Mahy HO. Virology Methods Manual. Elsevier Science; 1996. https://loagireles.files.wordpress.com/2015/07/virology-methods-manual-mahy.pdf. Accessed November 2, 2017.
84. Henriques AM, Fagulha T, Barros SC, et al. Development and validation of a blocking ELISA test for the detection of avian influenza antibodies in poultry species. J Virol Methods. 2016;236:47-53. doi:10.1016/j.jviromet.2016.07.006.
i
VIII. ANNEXES
VIII .1. SEQUENCE OF THE 19371-PT12 S1 FRAGMENT
Sequencing of the S1 fragment, encodes three gene sequences. P10 encoding sequence is the first
highlighted in grey, while the σC encoding sequence is the second highlighted in grey. P17 encoding
sequence is underlined.
TGTGCCGATGTTCCGTATGTCGTCCGGTTCTTGTAACGGTGCTACTTCTATCTTTGGTAACGTACATTGTCAGGC
TGCTCAGAACTCAGCTGGTGGTGACTTGCAGGCGACTTCTTCTTTAATAGCTTACTGGCCCTATCTAGCTGCAGG
TGGCGGACTCCTCCTGATCCTTATTGTTCTTGTTGCAATTATATATTGCTGTAAGGCTAGGATTAAATCGGACGC
TGCTAGAAACGTGTTCTATCGTGAGTTAGCTGCTCTGAATACAGTGAGGTGTGATGCAGTCCCTCCGTCATACAG
TGTTTAACGTTAACAGATTTGAGTTTTCGCCAATCATCTTTAGTGAATGCGCTAGTCCATCGTTTACTGCCATCA
CTGCTTCTGATCCGGCTAAGTATTTTAATATCGAGCTACAGTCTAACCATCCACTGTACCATAACATCTGCGACA
TCCTAGCGCGCCCTTGTGAGGTACACGTTTCATTGACGCGTCGATTTGCTTTGTTTTCAACTTTGTCCAGCATCT
GCGAGTACGATTGCGCGCTCCTTAATTCGTGTGACGCTATTTACTCTCTGCCTTCATCATTCGGAACTTCACGAT
TGGTGATTCACTGGGATGGCCGGACTAAATCCATCACAACGAAGAGAAGTCGTGGGATTGATACTCTCGTTGACT
TCGAGCGCGACTACAAACTGTGGAGATTTGACTGCGATTCATGAACGATTACTTAAGTTAGACTCATCAGTGGAG
TCGTTAACGGCATCTGTTGGCGATTTATCTCATAGGTTTTCGGAATTAGAGGTTGACTTGCAGAATGTTGATTCT
TCGATACGTCAGGTGACCTCCTCGTTGACTGCTTTGTCTAAAGAAGTACGTCAATTACGCTCTGCTGTAAGCGAC
AACACAGCCTCCATTTCGAGTCTCTCAGCGACGGTGGCTGATCATCAGCAATCATTGACTGATCTACGAACCTCT
GTAAGTGTTAATGTTACAGACATCACAAATCTGAAGGGCAGTGTGACCACATTAAGTCTAACTGTCACCGATCTT
GAGAGGCGACTGAAAGTGGTTGAGTCTGGTTCGAGCTCCTCGTTGGAATTCACGTCACCTCTAAGCTTAACTAAT
GGTGTTGTATCTTTAAACATGGACCCATATTTCTGCTCTGACAACCACGCGCTAACTTCATACTCGTCGGACGCT
CAGCTAATGCAATTTCAATGGCTGGCTCGTGGTGACGATGGCTCTTCGGGGTCAGTGGAGATGCTTGTTAACGCA
CACTGCCACGGACGTCGTACTGACTACATGATGTCTACTACGGAGAACCTGACTGTCACTGGTAATTCCACTTCT
CTCGTCTTCAGTCTGGATTACATTACTAAGCCGCCGTCTGACATGTCACGATTGGTGCCTCGGGCCGGGTTTCAG
GCTGCTTCTTTCCCCGTGGACGTATCTTTCACCAGAGATACTACGACACATGCGTACCAAGTCTATGGCGCGTTC
ACTTCTCCACGCAGTTTTAAGATCACATTTCTTACGGGGGGGACTGGCACAGCGAATCTTCGTTTCTTGACCGTG
CGTACGGGCATCGACACTTAAGGTGTGGCGCCG
P10
P17
C
ii
VIII .2. SEQUENCE OF THE PIEX-σA CLONED VECTOR
Sequencing of the pIEx-σA cloned vector allow to determine the sequence of the σA enconding gene
highlighted in grey. The gene sequence was found to have high homology with other σA enconding
genes sequences of other reoviruses deposited at GenBank. The restriction sequences of BamHI and
NotI are underlined by a solid and a dotted line, respectively.
ATGGCAAGCTGGAGCCACCCGCAGTTCGAAAAGGGTGCAGATGACGACGACAAGGTACCGGATCCAATGGCGCGTGCCG
TGTACGACTTCTTTTCTACGCCTTTCGGGAATCGTGGTCTAGCTACAAATAGAACTCAACTTTCGTCACTGCTATCAAGTTCG
AATTCCCCATGGCAACGCTTTCTATCATCAATGACTCCATTGACTGCGCCTGGCATTGTCTCCACACCTGAAGCACCTTATCC
GGGTTCGTTGCTGTATCAGGAATCAATGCTTCACAGTGCGACCGTCCCTGGGGTACTAGGCAACCGTGATGCTTGGCGAA
CTTTCAACGTCTTAGGATTCTCCTGGACTGATGAGGGTTTATCGGGGTTAGTGGCTGCTCAAGATCCTCCCCCTGCCGCTCC
CTATCAACCAGCGTCTGCGCAATGGTCTGATTTGCTTAACTACCCACGATGGGCGAACAGACGCCGAGAATTACAATCTAA
GTACCCTCTTTTGCTTAGATCTACACTGCTCTCCGCCATGCGAGCTGGTCCCGTCCTGTATGTTGAAACGTGGCCTAACATG
ATATCAGGTCGACTAGCTGATTGGTTCATGTCTCAaTACGGCAACAACTTTGTTGATATGTGTGCCcGACTGACGCAATCCT
GCGCGAATATGCCCGTTGAGCCTGATGGAAATTATGATCAACAGATGCGTGCCTTGATTAGTCTTTGGCTTTTGTCGTACA
TTGGAGTAGTAAATCAAACTAACACTATCAGTGGTTTCTACTTCTCCTCGAAAACTCGGGGTCAGGCTCTGGATAGTTGGA
CTCTGTTCTATGCTACGAACACTACCCGTGTTCCCATCACACAGAGACATTTCGCTTATGTGTGCGCGCGATCTCCTGATTG
GAATGTTGATAAGTCCTGGATTGCTGCAGCTAACCTGACCGCTATCGTCATGGCGTGTCGTCAACCTCCAATGTTTGCGAA
CCAGGGTGTGATTAATCAGGCTCAGAATCGACCAGGTTTTTCTATGAATGGGGGTACACCTGTTCATGAGCTTAATCTGCT
CACTACTGCGCAGGAGTGCATTCGACAGTGGGTGGTGGCTGGTTTGGTCTCAGCAGCAAAGGGCCAAGCTCTGACGCAG
GAAGCTAACGATTTTTCGAATCTGATTCAGGCGGACCTGGGGCAGATCAAGGCACAGGATGACGCGTTATACAATCAACA
ACCAGGTTATGCGAGAAGGATCAAGCCATTTGTTAATGGTGACTGGACACCAGGTATGACCGCGCAAGCTCTAGCTGTTC
TAGCCACCTTTACCGCCGCGGCCGCAGGAGCTCCGGGCTTCTCCTCAATTTCCGCTCaTcACCACCATCaTcaccaTCACCACC
ACTAA
VIII .3. SEQUENCE OF THE μB ENCODING GENE
After PCR amplification of the μB encoding gene the gene was sequenced. Because the size of the
gene was to large (2031 bp), it was not possible to sequence the entire gene. The unsequenced
positions are presented with a question mark. A restriction site for BamHI, underlined with a solid line,
was found within the gene sequence, which hampered the subsequent cloning of the gene intro the pIEx
transfer vector.
ATGGGCAACGCAACGTCTGTTGTTCAGCACTTTAATATCCAGGGTGATGGTAATCACTTCGCTCC
CTCCGCTGAAACCACATCATCTGCTGTCCCATCTCTATCATTAAATCCTGGGTTGCTCAATCCTGG
CGGTAAGGCATGGACTTTAATTGATCCAACATTGGACGCTTCTGACCCGTCTTCCCTGCGTCTGA
TGACGTCGGCCGATTTGTCCGTATTGTCAAACGCAGCTACAAGAAACGCGACTGGTTTCCTTCCT
ACGTCTGGCATGTACATTGTCCCTTCCAAAGAGACTCTGAGTGTGGTAACTGGTCATGCTCTTTCT
CAGTTTGAAAAGCTCCAGATGGCTTGCGAATTGGATCGCGATTATCTAGATGCCCGAGGTGTTTC
ACCCGAGTCAGTTGACATATCTAACTACATAGTGTACATCGATTGCTATGTTGGTGTGTCTGCTCG
CCAAGCCGCTTCCAATTTCCAAACGCACGTACCCGTCATTACAAAGTCCCGAATGACCCAGTTTA
TGACATCTGCTCAGAATGTGCTTCAAGTACTGGGGCCTTGGGAGCGGGATGTTCGTGAGCTGCT
AACAATCCTTCCAACCTCTACCACCGCTGGCAAGCTCTCCTGTGACATGAAGTCTGTTGTGCGGT
TCATTGATGATCAACTTTCTGACACCAGCTTATGTCGATTGTATCCTGAGTGTGCTGCCTCGGGCT
GTTGCGAAGCGAAATGGTGGTATACGATGGAAGCAGCCCGGATTCCGATGATGCCCCTTCCCTT
GCAACGAATGACGTTGCCGCATCTACCATGGGTGCTTTAGCGAA??????????????????????????
?????????????????????????????????????????????????????????????????????????????????
iii
?????????????????????????????????????????????????????????????????????????????????
???????????????????????????????????????????????????????????????????TCAAAAAGGTT
CAACTGTAATTAACCTTGAACAGACTGGCAGCATGATGTTGAGGTGAATGTATCTGGTAAGGATTA
TAAGAAGGGTTCGTTCGATCCAAACAATAAGAAATTGGTTCTGTTGGTTATGCAATCCAAAATCCC
ATTTGAAATGTGGACTACCGCTTCCCAAATATCAGGCATTGCGCAAGTGGCTGAAGTGACTGTTC
ATGCTGCGGACAGTTCCACTCCCGATCGTAAGATCATTGGTGAGACATCTCTATCATATTTATTTG
AACGTGAGACCGTCACAACTGCCAACACGGAAGTTAATACTTATCTACTCTGTACTTGGCAACTA
GACGCTCAACAGAGTGACGGGACTAATGCATGGCAAGACGCCTGGGACGCGGTAAACCACGCT
GACCCCCCTTACATCAGGCACTGTAACCGTTAAAGGAACTTCAGTCGATTCCATTGTTCCCGCTG
ATCTAGTTGGTTCTTACACTCCTGAGTCACTATCTGCAGCCTTGCCAAACGATGCGGGTCGGATC
CTCGCTGAAAAGGCTATAAGATTGGCAGATGCGATCAAGAAAGAAGATGATTCGGTAATCGACGA
ATCTTCACCTTTTAGTACTCCGATACAGGGCGTACTGGCAGTCAAACAACTGGACACTGATGGTA
CTCGTGGAATTAGAACACTACAACCTCCTGCGTTCTTGAAGAGAGTGGCATCACGTGCCCTGCAC
ATGTTCTTGGGTGACCCTCAGTCCATCTTGAAAATGACAACCCCTGTGCTTAAAGATCCAGACGT
ATGGACGGGGTTCATACAAGGCGTTCGTGACGGTATAAGGACGAAGTCGCTGTCTGCGGGTGTT
CGATCAGTATATAACAATGTCGCCGCTACCCAGTCCGTCCAGTCATGGAAGCAGGGTTTTCTGAC
GAAGATTCAG
iv
VIII .4. CLONING VECTORS
VIII .4.1. PCR2.1® CLONING VECTOR
Cloning PCR2.1® vector from the Original TA Cloning kit (Invitrogen) schematic representation and
MCS restriction map.
Fig. VIII.17. Schematic representation of the pCR2.1® cloning vector with the restriction map from the MCS 1.
v
VIII .4.2. PIEX/BAC-1 TRANSFER VECTOR
Schematic representation of the pIEx-Bac-1 transfer vector from the BacMagic DNA transfection kit
(Invitrogen) and identification of the restriction map of tis MCS. The table represents the number and
location of the EcoRI restriction enzyme outside the MCS of the vector.
Fig.VIII.18. Diagrammatic representation of the pIEx/Bac-1 transfer expression vector and its MCS. The table
represents the number and position of restriction sites for EcoRI outside the MCS of the plasmid 2.
vi
Fig.VIII.20. NZYDNA Ladder II molecular weight marker (NZYTech)4.
VIII .5. MOLECULAR WEIGHT MARKERS
Two DNA molecular weight markers were used for electrophoresis: NZYDNA ladder VI and NZYDNA
Ladder II (from NZYTech). A colored protein molecular weight marker (NZY Color Protein Marker II) was
used for viral protein SDS-PAGE.
VIII .5.1. NZYDNA LADDER VI DNA MOLECULAR WEIGHT MARKER
Fig.VIII.19. NZYDNA Ladder VI molecular weight marker (NZYTech)3.
VIII .5.2. NZYDNA LADDER II DNA MOLECULAR WEIGHT MARKER
vii
VIII .5.3. NZY COLOUR PROTEIN MARKER II PROTEIN MOLECULAR WE IGHT MARKER
Fig. VIII.21. NZY Colour Protein Marker II (NZYTech) 5
VIII .6. REFERENCES
1. Invitrogen by Life Technologies. TA Cloning® Kit, Invitrogen User Guide MAN0000008
2. Merck Chemicals. pIEx/Bac-1 Expression Vector. Novagen User Protocol TB4680107
3. nzytech, genes & enzymes. NZYDNA Ladder VI. Retrieved from: https://www.nzytech.com/products-
services/dna-ladders/mb089/ (accessed for the last time at November 2nd of 2017 at 2:59 pm)
4. nzytech, genes & enzymes. NZYDNA Ladder II. Retrieved from: https://www.nzytech.com/products-
services/dna-ladders/mb043/ (accessed for the last time at November 2nd of 2017 at 3:00 pm)
5. nzytech, genes & enzymes. NZY Colour Protein Marker II. Retrieved from:
https://www.nzytech.com/products-services/protein-markers/mb090/ (accessed for the last time at
November 2nd of 2017 at 3:02 pm)