bax 2 promotes apoptosis through caspase-8 activation in ... · bax∆2 promotes apoptosis through...

Bax∆2 Promotes Apoptosis through Caspase-8 Activation

in Microsatellite Unstable Colon Cancer

Honghong Zhang1, Yuting Lin1, Adriana Mañas1, Yu Zhao1, Mitchell F. Denning2,

Li Ma3, and Jialing Xiang1*

1Department of Biological and Chemical Sciences, Illinois Institute of Technology,

Chicago, IL 60616

2Department of Pathology, Loyola University Medical Center, Maywood, IL 60153

3Mumetel, LLC, University Technology Park, Illinois Institute of Technology, Chicago, IL

60616

Running title: BaxΔ2 activates caspase-8 pathway

Keywords: Bax; tumor suppressor; microsatellite instability; alternative splicing; caspase-8

*To whom the correspondence should be addressed: Jialing Xiang, Department of Biological and

Chemical Sciences, Illinois Institute of Technology, 3101 South Dearborn Street, Chicago,

Illinois, USA. Tel.: (312) 567-3491; Fax: (312)-567-3494; E-mail: [email protected]

Note:

This study was supported by a National Institute of Health grant (R01 CA128114).

Conflict of interest: The authors (Xiang and Ma) filed a patent application on the anti-Bax∆2

antibody used in this study. There is no potential conflict of interest.

Word count: 4,462; Figures: 4; Tables: 2

on June 23, 2020. © 2014 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 19, 2014; DOI: 10.1158/1541-7786.MCR-14-0162

http://mcr.aacrjournals.org/

2

Abstract

Loss of apoptotic Bax due to microsatellite mutation contributes to tumor development and

chemoresistance. Recently a Bax microsatellite mutation was uncovered in combination with a

specific alternative splicing event that could generate a unique Bax isoform (Bax∆2) in otherwise

Bax-negative cells. Like the prototype Baxα, Bax∆2 is a potent pro-apoptotic molecule.

However, the pro-apoptotic mechanism and therapeutic implication of Bax2 remain elusive.

Here, the isolation and analysis of isogenic sub-cell lines are described that represent different

Bax microsatellite statuses from colorectal cancer. Colon cancer cells harboring Bax

microsatellite G7/G7 alleles are capable of producing low levels of endogenous Bax∆2

transcripts and proteins. Interestingly, Bax∆2-positive cells are selectively sensitive to a

subgroup of chemotherapeutics compared with Bax∆2-negative cells. Unlike other Bax isoforms,

Bax∆2 recruits caspase-8 into the proximity for activation, and the latter, in turn, activates

caspase-3 and apoptosis independent of the mitochondrial pathway. These data suggest that the

expression of Bax∆2 may provide alternative apoptotic and chemotherapeutic advantages for

Bax-negative tumors.

Implications

“Bax-negative” colorectal tumors expressing a Bax isoform are sensitive to selective

chemotherapeutics.

Introduction

A microsatellite is a short stretch of repeating DNA sequence that is prone to deletion or

insertion due to the slippage of DNA polymerase (1-3). Dysfunction of the DNA mismatch




3

repair (MMR) system often results in microsatellite instability (MSI) (4,5). The classic example

of MSI is Lynch syndrome (6), in which patients have a high risk of developing many types of

cancer, especially hereditary nonpolyposis colorectal cancer (HNPCC) (7,8). Over 90% of Lynch

syndrome patients have a high level of microsatellite instability (MSI-H) (9-11). If a

microsatellite sequence is in the DNA coding region, frameshift mutations can disrupt the

translational reading frame and cause truncation or premature termination. Many genes with

microsatellite frameshift mutations are cancer related, such as Bax, TGF-II, IGFRII, and TCF-4,

which are closely associated with MSI-H colon cancer (12-16). Loss of these key components

significantly contributes to tumor development and chemoresistance (17-19).

Bax is a pro-apoptotic Bcl-2 family member (20-22). Typically, Bax promotes apoptosis

through the activation of the mitochondrial death pathway (23,24). Under a non-stimulated

condition, Bax localizes in the cytosol as monomers. Upon stimulation by a death signal, Bax

translocates to the mitochondrial membrane where it disrupts the mitochondrial membrane,

causes the release of cytochrome C, and sequentially activates caspase-9 and caspase-3 for cell

death (24,25). Bax has several isoforms, mostly generated by alternative splicing between exon 1

and exon 3 or between exon 5 and exon 6 from the prototype Bax pre-mRNA (21,26-30).

These isoforms either universally exist in normal and cancer cells or are only detectable in

certain tissues (29). The pro-apoptotic activity of Bax isoforms can be well preserved as long as

the Bax functional BH domains remain intact (31,32). Some of the Bax isoforms, such as Baxβ,

change the stability of proteins, while others change their potencies of cell death (30,33).

Nevertheless, most Bax isoforms promote apoptosis using the same mechanism as the prototype

Bax, i.e., through the activation of the mitochondrial death pathway (23,30,33,34).




4

Bax is one of the genes that are frequently mutated in MSI tumors (16,35). The inactivation of

Bax by a frameshift mutation is found in 50% of HNPCC (16). The deletion of a single guanine

nucleotide (G) in the Bax exon 3 microsatellite tract (from G8 to G7) results in a reading

frameshift and “Bax-negative” phenotype due to a premature termination codon. The loss of Bax

often promotes tumor growth and increases resistance to chemotherapeutics (17-19). Recently,

we found that the mutation-mediated loss of Bax could be restored by unique alternative splicing

that produces a novel Bax isoform, Bax∆2, which exists only in cells harboring the Bax

microsatellite G7 mutation (36,37). Bax∆2 transcripts can be detected in both MSI cancer cell

lines and primary tumors (36). Bax∆2 is a more potent apoptotic inducer than Bax(36). In this

study, we show that Bax∆2 proteins determine the chemosensitivity of colon cancer cells. Unlike

Baxthe pro-apoptotic activity of Bax∆2 is mediated by the activation of the caspase-8 pathway

rather than the mitochondrial death pathway. Our results uncover a distinct mechanism by which

Bax2 induces apoptosis and suggest that Bax∆2 is a potential target for cancer therapy.

Materials and Methods

Materials

Antibody against Bax (N20, against the Bax N-terminus) was purchased from Santa Cruz

Biotechnology (Santa Cruz, CA). The Bax∆2 monoclonal antibody was generated as described

(36). Antibodies against cleaved human specific caspase-8 and mouse specific caspase-8, and

human specific Bid were from Cell Signaling Technology (Danvers, MA). The antibody against

full-length caspase-8 (LS-C99287) was from Lifespan BioSciences (Seattle, WA). The pan-

Caspase inhibitor (Z-VAD-FMK), Caspase-1 Inhibitor I (Ac-YVAD-CHO), Caspase-8 Inhibitor

II (Z-IETD-FMK), Caspase-3 Inhibitor II (Z-DEVD-FMK) and Caspase-9 Inhibitor (Z-LEHD-




5

FMK) were from Calbiochem (Billerica, MA). Adriamycin, Indomethacin, Cyclophosphamide

(Cytoxan), Cysplatin (CDDP), Fluorouracil (5-FU), Irinotecan (CPT-11), Vinblastine, and

Paclitaxel (Taxol) were from Sigma-Aldrich (St. Louis, MO). Etoposide and MG-132 were from

Calbiochem (Billerica, MA). Hydroxyurea, Daunorubincin and Epirubicin were from Santa Cruz

Biotechnology (Dallas, TX). Bid specific inhibitor (BI-6C9) was from Sigma-Aldrich. The

mitochondrial membrane potential assay kit was from Abcam (Cambridge, MA).

Cell lines and isogenic sublines

Colon cancer cell line HCT116 was obtained from American Type Culture Collection. The cell

line was tested and authenticated by Genetica (Cincinnati. OH) before the experiments. Both

HCT116 and Bax-/- mouse embryonic fibroblasts (MEFs) cells were cultured in DMEM

supplemented with 10% FBS. To isolate single cell population from HCT116 cells, cells were

treated with 500 μM Indomethacin for 72 h to enrich Bax G7 population (17). Single-cell

suspension was plated onto 96-well plates without Indomethacin. Single clones were recovered,

expanded, and validated by both genomic sequencing and RT-PCR analysis.

Bax microsatellite sequencing and RT-PCR

Genomic DNAs were isolated from different HCT116 sublines with DirectPCR lysis reagent

(Viagen Biotech) according to the manufacture’s instruction. Microsatellite region of Bax gene

was amplified by PCR with specific primers surrounding Bax exon 3 microsatellite region, 5’

GAGTGACACCCCGTTCTGAT 3’ (forward) and 5’ ACTCGCTCAGCTTCTTGGTG 3’

(reverse). The PCR products were purified by using MinELute PCR purification kit (QIAGEN)

and subjected to sequence analysis for determination of the Bax microsatellite status. For RT-

PCR, total RNA was isolated using the PureLink RNA Mini kit (Life Technology) according to

the manufacture’s instruction. The cDNAs were reversely transcribed from mRNA using




6

ThermoScript RT-PCR System (Invitrogen). The transcripts were amplified with Bax primers,

5’-GCT CTA GAG AGC GGC GGT GAT GGA CGG GT-3’ (forward), and 5’-GGA ATT CCA

GCT GGG GGC CTC AGC CCA T-3’ (reverse), or Bax∆2 specific primers, 5’-CCA GAG GCG

GGG GGT TTC ATC C-3’ (forward), 5’ –GGT TGT CGC CCT TTT CTA CTT TGC CA-3’

(reverse).

Transient transfection and RNA interference

Cells were allowed grown in 6-well plates to 70-80% confluences before transfection. Caspase-

9 dominant negative construct (LZRS-caspase-9, D/N)(38) and Bid siRNA (5’GGGCAAAAGC

UUACAAAUAUU3’), as well as controls, were transfected using lipofectamine 2000 according

to the manufacturer’s instruction (Life Technology).

Co-immunoprecipitation and immunostaining

Cell pellets were lysed in NP-40 buffer (145 mM NaCl, 5 mM MgCl, 1 mM EGTA, 0.25%

NP-40, 20 mM HEPES, pH 7.4) with a cocktail of protease inhibitors at 4 °C for 30 min. Cell

lysates were incubated with the appropriate antibody-conjugated beads overnight at 4 °C. The

beads were washed with NP-40 buffer for 3 times and the immunocomplexes were separated by

SDS-PAGE and subjected to immunoblotting analysis. For immunostaining, cells were grown

on cover slips coated with 1% gelatin. Cells were fixed and permeabilized with ice-cold

methanol and incubated with primary antibodies diluted in PBS plus 0.3%Triton-X and 3%BSA.

Following PBS washing, cells were incubated with Alexa Fluorescence conjugated secondary

antibodies. Cell nuclei were stained with DAPI. The fluorescence images were collected by

Leica SP5 Laser Scanning Confocal microscope using a 40x objective.

Mitochondrial membrane potential assay




7

Cells (5×106 per well) in 6-well plates were treated with different stimuli for a period of time

as indicated in the figure legends. For the positive control, cells were treated with FCCP

(Carbonyl cyanide 4-(trifluoromethoxy) phenylhydrazone, 100 μM) for 30 min before staining.

Mitochondrial membrane potentials (MMP) were analyzed by using a mitochondrial specific

cationic dye (JC-1) according to the manufacturer’s instruction and the images were collected by

Nikon TE-2000 fluorescence microscope. The quantitation of MMP was performed using ImageJ

program with at least 5 random fields for each sample.

Colony formation and invasive assays

A standard colony formation assay was performed as described (39). Briefly, total 1.5×104

cells were seeded in each well in a 6-well plate. After culturing for 3-4 weeks, the colonies were

visualized by staining with crystal violet and triplicate samples were counted under the

dissecting microscope. The transwell invasion assay was performed by using transwell inserts

with 8.0 μm pore size in 6-well plates. Total 5 × 105 cells were seeded into the upper chamber

and cultured for 24 h. Cells were fixed in the following day with 5% Glutaraldehyde and stained

by Toluidine Blue. The inner surface of the upper chamber was carefully wiped using a cotton

swab. Invasive cells were counted in three randomly selected fields for each well under a

microscope.

Results

The expression of Bax∆2 proteins can be detected in colon cancer cells harboring the Bax

microsatellite G7 mutation allele

Bax∆2 is a functional Bax isoform produced by a unique combination of a microsatellite

mononucleotide deletion (G8 to G7) in Bax exon 3 and alternative splicing of Bax exon 2 (36).




8

HCT116 colon cancer cells contain mixed populations with different Bax microsatellite statuses

as follows: the majority of these cells (94%) have mixed Bax alleles (G8/G7); 4% of these cells

have pure Bax G7/G7; and 2% of these cells have pure Bax G8/G8 (17). It has been shown that

further deletion of the Bax G8 allele in the Bax G8/G7 cells results in a Bax null phenotype and

leads to partial chemoresistance (17). We speculated that the population of HCT116 cells

harboring the Bax G7 mutation is capable of producing Bax∆2, thus remaining sensitive to

chemotherapeutic treatment. To test this scenario, we isolated single-cell populations using a

standard 96-well plating method (Fig. 1A) (17). More than 54 isogenic sub-clones were isolated

and genotyped. The following 20 sub-clones were further analyzed by both genomic sequence

and splicing analyses: 14 clones contained Bax G8/G7; 6 clones contained G7/G7; and none of

the clones contained G8/G8 (Table 1). Interestingly, all 6 Bax G7/G7 clones contained both

detectable transcript products from constitutive splicing and alternative splicing, as determined

by RT-PCR (Table 1). In contrast, all Bax G8/G7 clones contained only constitutive splicing

transcripts, and none of these clones contained a detectable product from alternative splicing

(Table 1). These results suggest that not all alleles containing Bax microsatellite mutations are

capable of alternative splicing.

To study the ability of the isogenic cells to generate Bax2 transcripts, we further analyzed

HCT116 sublines, namely clone #10 (Bax G7/G7) and clone #28 (Bax G8/G7). RT-PCR

analysis with primers in Bax exons 1 and 3 revealed that clone #10 (Bax G7/G7) contained both

constitutive splicing (upper band) and alternative splicing (lower band), although the constitutive

splicing product was predominant (Fig. 1B). In contrast, clone #28 (Bax G8/G7) only contained

constitutive splicing products, albeit the Bax G7 mutated allele. Furthermore, only less than

20% of the total pre-mRNA from the Bax G7/G7 population went through the exon 2 alternative




9

splicing (Fig. 1B). To further confirm that the alternative splicing product (lower band) was a

Bax∆2 transcript, the lower band was excised and subjected to sequence analysis. In addition, the

Bax∆2 specific 5’ primer covering the junction of exons 1 and 3 was used in the PCR analysis.

As expected, the Bax2 transcript was only detected in clone #10 and the Bax∆2 positive

control, but it was not detected in clone #28 and the Baxα negative control (Fig. 1B). Thus,

Bax∆2 transcripts can be easily detected in cells containing the Bax G7/G7 allele.

We then determined the expression of endogenous Bax∆2 proteins in the HCT116 clones #10

and #28 subline cells using a specific anti-Bax2 antibody (36). Immunoblotting analysis

revealed that the endogenous Bax∆2 protein levels were extremely low in clone #10 and

undetectable in clone #28 (Fig. 1C). However, Bax∆2 proteins were easily detected in clone #10

when the cells were treated with MG-132, a proteasomal inhibitor (Fig. 1C). Under the same

conditions, clone #28 had no detectable Bax∆2 proteins. This result was consistent with previous

observations (Fig. 1B) that Bax G8/G7 cannot generate detectable Bax∆2 transcript and protein.

Of note, both clone #10 and clone #28 had no detectable parental Baxα proteins, as analyzed by

immunoblotting using several anti-Baxα antibodies (Fig. 1C and data not shown). Taken

together, these results indicate that cancer cells harboring Bax G7/G7 mutations are capable of

generating Bax∆2 proteins, although the Bax2 proteins appear to be unstable and prone to

proteasomal degradation.

To analyze the physiological characteristics of these two HCT116 isogenic sublines, the

growth rate, invasion ability and colony formation of both clones #10 and #28 cells were

analyzed. We found that clones #10 and #28 were quite similar to each other in terms of growth

rate (Fig. 1D) and invasive ability (Fig. 1E). However, the Bax∆2-positive clone #10 had

significantly less capability in colony formation compared with the Bax∆2-negative clone #28




10

(Fig. 1F). These results indicate that Bax∆2-positive cells may be less tumorigenic in tumor

development.

Bax∆2-positive subline cells are sensitive to a subgroup of chemotherapeutics

We have previously shown that cancer cells with Bax microsatellite mutations, such as prostate

cancer 104-R cells (G7/G7) and colon cancer LoVo cells (G7/G9), are more sensitive to

Adriamycin treatment than cancer cells with wild type Bax (36). However, the heterogeneity of

different cell lines often adds complexity to data interpretation. To address this issue, we

compared HCT116 isogenic subline clone #10 (Bax∆2-positive) and clone #28 (Bax2-negative)

cells for their sensitivities to chemotherapeutic agents. For the initial screening, we selected a

panel of different classes of commonly used chemotherapeutic drugs. Cells were treated with a

series of doses of each drug, and the results of cell death are shown in Table 2. Bax∆2-positive

clone #10 was more sensitive to Adriamycin than Bax2-negative clone #28, which was

consistent with the previous report that Bax∆2-positive cancer cells are more sensitive to

Adriamycin than Bax∆2-negative cancer cells (36). In addition, Bax∆2-positive clone #10 was

also highly sensitive to 5-FU, a pyrimidine analogue compared with the Bax2-negative clone

#28 (Table 2). Interestingly, the sensitivity seems selective, even within the same class of

chemotherapeutic drugs because there was no significant difference when both clones were

treated with Daunorubicin, which is also an anthracycline antibiotic with a similar structure as

Adriamycin (Table 2). These data indicate that Bax∆2-positive cells may have a therapeutic

advantage or preference to a subgroup of chemotherapeutic drugs.

Bax∆2 promotes apoptosis through activation of the caspase-8 pathway

Bax typically targets the mitochondria upon activation and results in the activation of the

caspase-9 and caspase-3 cascade for cell death (40). To determine the underlying mechanism by




11

which Bax∆2 promoted cell death, HCT116 clones #10 and #28 were treated with Adriamycin or

5-FU in the presence of different caspase inhibitors. We found that the chemodrug-induced

apoptosis was significantly augmented in clone #10 and could be effectively inhibited by either a

caspase-8 or caspase-3 inhibitor, but not caspase-1 or caspase-9 inhibitor (Fig. 2A). The caspase-

3 activity was confirmed by the caspase-3 fluorometric assay (Fig. 2B). The activation of

caspase-3 was not surprising, because it is an executioner caspase downstream of many caspase-

mediated cell death events, including the Bax mitochondrial death pathway (24,25). However,

the activation of caspase-8 was unexpected, as the Bax family usually utilizes the mitochondrial

death pathway (24,25). Consistent with this notion, immunoblotting analysis using an anti-active

caspase-8 antibody revealed that caspase-8 was activated, as indicated by the appearance of the

cleaved caspase-8 fragments (43 kDa and 18 kDa), in clone #10 when treated with Adriamycin

or 5-FU but not in clone #28 (Fig. 2C). Thus, Bax∆2 promoted apoptosis through the activation

of caspase-8 and its downstream executioner caspase-3.

Activation of the Bid mitochondrial pathway is not essential for the onset of Bax∆2-induced

apoptosis

Caspase-8 is one of the initiator caspases in the extrinsic death receptor pathway (41). Once

activated, caspase-8 directly activates the executioner caspase-3, or cleaves the BH-3-only

protein Bid into tBid, which in turn targets mitochondria and triggers the release of cytochrome c

for apoptosis (42,43). We next determined if the Bid-dependent mitochondrial death pathway

was required for Bax∆2 to promote apoptosis. We found that Bid was partially degraded in the

Bax∆2-positive clone #10 cells treated with 5-FU or Adriamycin but not in the Bax∆2-negative

clone #28 cells (Fig. 3A). However, inhibition of Bid activity by its specific siRNA or inhibitor

did not significantly affect the chemodrug-induced apoptosis (Fig. 3B). Similar results were




12

obtained using a caspase-9 inhibitor or ectopic expression of the caspase-9 dominant negative

mutant (44) (Fig. 3C). Furthermore, caspase-8 was activated as early as 8 h and reached to its

maximum activity by 16 h, but the mitochondria membrane potential remained reasonable intact

24 h post-treatment, as evidenced by simultaneously monitoring the caspase activity and

mitochondrial membrane potential (Figs. 3D and E). Taken together, these data indicate that the

Bid-dependent mitochondrial death pathway may not be essential for the onset of chemodrug-

induced apoptosis in the Bax∆2-positive cells. Direct activation of caspase-3 by caspase-8 is

likely required for the onset of the apoptosis.

Bax∆2 activates caspase-8 by recruiting it into proximity

Caspase-8 is usually activated by death receptor-mediated self-processing, i.e., the proximity-

induced dimerization, followed by aggregation and self-cleavage/activation (45). We speculated

whether Bax∆2 oligomers or aggregates might serve as a platform to recruit caspase-8 into the

proximity for activation. To test this hypothesis, we first examined whether Bax∆2 and caspase-8

were localized together. Bax null mouse embryonic fibroblast (MEFs) were transfected with

Bax∆2 and the activation of caspase-8 was confirmed by immunoblotting analysis with an anti-

cleaved caspase-8 antibody (Fig. 4A). Immunostaining showed that in the absence of Bax∆2, the

staining of caspase-8 was weak and appeared as diffused fine granules (Fig. 4B, top panel).

Upon the expression of Bax∆2, caspase-8 became aggregated and co-localized with Bax∆2 (Fig.

4B, bottom panel). To determine whether Bax∆2 and caspase-8 physically interacted with each

other, we transfected Bax∆2 into Bax∆2-negative HCT116 clone #28 cells. Co-

immunoprecipitation in combination with immunoblotting analysis revealed that the amount of

the caspase-8 cleaved fragment (p43) was significantly higher in the immunocomplex with the




13

anti-Bax∆2 antibody than that with the IgG control (Fig. 4C). These data suggest that Bax∆2

oligomers may serve as a platform for caspase-8 aggregation and activation.

Discussion

Bax is a pro-apoptotic tumor suppressor and is expressed in almost all types of human cells

(21,46). Exon 3 of Bax contains a microsatellite sequence that is prone to mutation due to

replication slippage if the mismatch repair system is impaired (47,48). A single guanine

nucleotide deletion from G8 to G7 is the most common mutation in colorectal cancer with

microsatellite instability, thus resulting in an apparent Bax null phenotype (47,48). Interestingly,

alternative splicing of Bax exon 2 can rescue the frameshift mutation, generating a unique and

functional Bax∆2 isoform (36). In this report, we demonstrated that cancer cells harboring Bax

G7/G7 alleles were capable of producing Bax∆2 transcripts and proteins, although the levels of

Bax2 transcripts and proteins were extremely low and unstable (Figs. 1B and C). Bax∆2-

positive cells were selectively sensitive to a subgroup of chemotherapeutics, such as 5-FU and

Adriamycin (Table 2 and Fig. 2). Surprisingly, Bax∆2-promoted-apoptosis relied on the

activation of caspase-8 and downstream caspase-3 (Fig. 2). The Bid-mitochondrial pathway

appeared not essential for onset of the apoptosis (Fig. 3). The mechanism underlying caspase-8

activation by Bax2 was most likely through physical interactions between Bax∆2 and caspase-8

resulting in the formation of aggregates thereby triggering the apoptotic process (Fig. 4).

There are two criteria in the generation of BaxΔ2. First, the Bax gene must have the deletion of

a single guanine nucleotide (G8 to G7) in its exon 3 microsatellite tract. Second, the alternative

splicing machinery needs to be able to remove most of exon 2 (36). Previously, we have shown

that the alternative splicing factors for Bax∆2 are universal because cancer or non-cancerous,

human or murine fibroblast cells are all able to process the Bax∆2 alternative splicing in a mini-




14

gene assay (37). Thus, any Bax G7 allele, theoretically, is able to generate Bax∆2. However, our

current results showed that Bax∆2 transcripts and proteins were only detected in cells harboring

the Bax G7/G7 alleles (Fig. 1B). Furthermore, only less than 20% of total pre-mRNA from the

Bax G7/G7 population went through exon 2 alternative splicing (Fig. 1B). Neither alternative

splicing nor the Bax∆2 protein was detected in all Bax G8/G7 subclones tested (Table 1).

However, the underlying mechanism is not known. One possibility is that the amount of Bax∆2

generated by Bax G8/G7 is too low to be detected. Another possibility is that there is a potential

inhibitory mechanism for alternative splicing to occur in Bax G8/G7 cancer cells. Future studies

are needed to test these possibilities.

Bax usually promotes apoptosis through activation of the intrinsic mitochondria death pathway

(49,50). Unlike Bax and other known Bax isoforms, Bax2 lacks exon 2, which is critical for

the mitochondria targeting (33). Although ectopically expressed Bax∆2 is able to activate the

mitochondrial death pathway, it does not mean that Bax∆2 directly targets mitochondria (36).

Our results indicate that caspase-8 via caspase-3 is essential for the onset of Bax∆2-induced

apoptosis, and that mitochondria may act as an amplifier for the death process. Future studies are

needed to explore whether this unique pro-apoptotic feature of Bax2 is related to its ability to

sensitize some “Bax-negative” MSI tumor cells to a subgroup of chemotherapeutic drugs.

Acknowledgement

This study was supported by a National Institute of Health grant (R01 CA128114).




15

References

1. Loeb, L. A. Microsatellite instability: marker of a mutator phenotype in cancer. Cancer

research 1994; 54: 5059-5063.

2. Sia, E. A., Jinks-Robertson, S., and Petes, T. D. Genetic control of microsatellite stability.

Mutat Res 1997; 383: 61-70.

3. Perucho, M. Cancer of the microsatellite mutator phenotype. Biol Chem 1996; 377: 675-

684.

4. Peltomaki, P. Role of DNA mismatch repair defects in the pathogenesis of human cancer.

J Clin Oncol 2003; 21: 1174-1179.

5. Elliott, B., and Jasin, M. Repair of double-strand breaks by homologous recombination in

mismatch repair-defective mammalian cells. Mol Cell Biol 2001; 21: 2671-2682.

6. Lynch, H. T., and Lynch, P. M. The cancer-family syndrome: a pragmatic basis for

syndrome identification. Diseases of the colon and rectum 1979; 22: 106-110.

7. Aarnio, M., Mecklin, J. P., Aaltonen, L. A., Nystrom-Lahti, M., and Jarvinen, H. J. Life-

time risk of different cancers in hereditary non-polyposis colorectal cancer (HNPCC)

syndrome. International journal of cancer. Journal international du cancer 1995; 64: 430-

433.

8. Aarnio, M., Sankila, R., Pukkala, E., Salovaara, R., Aaltonen, L. A., de la Chapelle, A., et

al. Cancer risk in mutation carriers of DNA-mismatch-repair genes. International journal

of cancer. Journal international du cancer 1999; 81: 214-218.

9. Liu, B., Parsons, R., Papadopoulos, N., Nicolaides, N. C., Lynch, H. T., Watson, P., et al.

Analysis of mismatch repair genes in hereditary non-polyposis colorectal cancer patients.

Nature medicine 1996; 2: 169-174.




16

10. Abdel-Rahman, W. M., Ollikainen, M., Kariola, R., Jarvinen, H. J., Mecklin, J. P.,

Nystrom-Lahti, M., et al. Comprehensive characterization of HNPCC-related colorectal

cancers reveals striking molecular features in families with no germline mismatch repair

gene mutations. Oncogene 2005; 24: 1542-1551.

11. Duval, A., and Hamelin, R. Mutations at coding repeat sequences in mismatch repair-

deficient human cancers: toward a new concept of target genes for instability. Cancer

research 2002; 62: 2447-2454.

12. Yamaguchi, T., Iijima, T., Mori, T., Takahashi, K., Matsumoto, H., Miyamoto, H., et al.

Accumulation profile of frameshift mutations during development and progression of

colorectal cancer from patients with hereditary nonpolyposis colorectal cancer. Diseases

of the colon and rectum 2006; 49: 399-406.

13. Ham, M. F., Takakuwa, T., Luo, W. J., Liu, A., Horii, A., and Aozasa, K. Impairment of

double-strand breaks repair and aberrant splicing of ATM and MRE11 in leukemia-

lymphoma cell lines with microsatellite instability. Cancer Sci 2006; 97: 226-234.

14. Miquel, C., Jacob, S., Grandjouan, S., Aime, A., Viguier, J., Sabourin, J. C., et al.

Frequent alteration of DNA damage signalling and repair pathways in human colorectal

cancers with microsatellite instability. Oncogene 2007; 26: 5919-5926.

15. Schwartz, S., Jr., Yamamoto, H., Navarro, M., Maestro, M., Reventos, J., and Perucho,

M. Frameshift mutations at mononucleotide repeats in caspase-5 and other target genes in

endometrial and gastrointestinal cancer of the microsatellite mutator phenotype. Cancer

research 1999; 59: 2995-3002.




17

16. Rampino, N., Yamamoto, H., Ionov, Y., Li, Y., Sawai, H., Reed, J. C., et al. Somatic

frameshift mutations in the BAX gene in colon cancers of the microsatellite mutator

phenotype. Science 1997; 275: 967-969.

17. Zhang, L., Yu, J., Park, B. H., Kinzler, K. W., and Vogelstein, B. Role of BAX in the

apoptotic response to anticancer agents. Science 2000; 290: 989-992.

18. Olejniczak, S. H., Hernandez-Ilizaliturri, F. J., Clements, J. L., and Czuczman, M. S.

Acquired resistance to rituximab is associated with chemotherapy resistance resulting

from decreased Bax and Bak expression. Clin Cancer Res 2008; 14: 1550-1560.

19. Jeong, S. H., Lee, H. W., Han, J. H., Kang, S. Y., Choi, J. H., Jung, Y. M., et al. Low

expression of Bax predicts poor prognosis in resected non-small cell lung cancer patients

with non-squamous histology. Jpn J Clin Oncol 2008; 38: 661-669.

20. Korsmeyer, S. J. BCL-2 gene family and the regulation of programmed cell death.

Cancer research 1999; 59: 1693s-1700s.

21. Oltvai, Z. N., Milliman, C. L., and Korsmeyer, S. J. Bcl-2 heterodimerizes in vivo with a

conserved homolog, Bax, that accelerates programmed cell death. Cell 1993; 74: 609-

619.

22. Chipuk, J. E., Moldoveanu, T., Llambi, F., Parsons, M. J., and Green, D. R. The BCL-2

family reunion. Mol Cell 2010; 37: 299-310.

23. Er, E., Oliver, L., Cartron, P. F., Juin, P., Manon, S., and Vallette, F. M. Mitochondria as

the target of the pro-apoptotic protein Bax. Biochimica et biophysica acta 2006; 1757:

1301-1311.

24. Goping, I. S., Gross, A., Lavoie, J. N., Nguyen, M., Jemmerson, R., Roth, K., et al.

Regulated targeting of BAX to mitochondria. J Cell Biol 1998; 143: 207-215.




18

25. Jurgensmeier, J. M., Xie, Z., Deveraux, Q., Ellerby, L., Bredesen, D., and Reed, J. C. Bax

directly induces release of cytochrome c from isolated mitochondria. Proc Natl Acad Sci

U S A 1998; 95: 4997-5002.

26. Zhou, M., Demo, S. D., McClure, T. N., Crea, R., and Bitler, C. M. A novel splice variant

of the cell death-promoting protein BAX. The Journal of biological chemistry 1998; 273:

11930-11936.

27. Thomas, A. L., Price, C., Martin, S. G., Carmichael, J., and Murray, J. C. Identification of

two novel mRNA splice variants of bax. Cell death and differentiation 1999; 6: 97-98.

28. Schmitt, E., Paquet, C., Beauchemin, M., Dever-Bertrand, J., and Bertrand, R.

Characterization of Bax-sigma, a cell death-inducing isoform of Bax. Biochemical and

biophysical research communications 2000; 270: 868-879.

29. Cartron, P. F., Oliver, L., Martin, S., Moreau, C., LeCabellec, M. T., Jezequel, P., et al.

The expression of a new variant of the pro-apoptotic molecule Bax, Baxpsi, is correlated

with an increased survival of glioblastoma multiforme patients. Human molecular

genetics 2002; 11: 675-687.

30. Fu, N. Y., Sukumaran, S. K., Kerk, S. Y., and Yu, V. C. Baxbeta: a constitutively active

human Bax isoform that is under tight regulatory control by the proteasomal degradation

mechanism. Mol Cell 2009; 33: 15-29.

31. Wang, K., Gross, A., Waksman, G., and Korsmeyer, S. J. Mutagenesis of the BH3

domain of BAX identifies residues critical for dimerization and killing. Mol Cell Biol

1998; 18: 6083-6089.




19

32. Letai, A., Bassik, M. C., Walensky, L. D., Sorcinelli, M. D., Weiler, S., and Korsmeyer,

S. J. Distinct BH3 domains either sensitize or activate mitochondrial apoptosis, serving as

prototype cancer therapeutics. Cancer cell 2002; 2: 183-192.

33. Cartron, P. F., Priault, M., Oliver, L., Meflah, K., Manon, S., and Vallette, F. M. The N-

terminal end of Bax contains a mitochondrial-targeting signal. The Journal of biological

chemistry 2003; 278: 11633-11641.

34. Shi, B., Triebe, D., Kajiji, S., Iwata, K. K., Bruskin, A., and Mahajna, J. Identification

and characterization of baxepsilon, a novel bax variant missing the BH2 and the

transmembrane domains. Biochemical and biophysical research communications 1999;

254: 779-785.

35. Shima, K., Morikawa, T., Yamauchi, M., Kuchiba, A., Imamura, Y., Liao, X., et al.

TGFBR2 and BAX mononucleotide tract mutations, microsatellite instability, and

prognosis in 1072 colorectal cancers. PLoS One 2011; 6: e25062.

36. Haferkamp, B., Zhang, H., Lin, Y., Yeap, X., Bunce, A., Sharpe, J., et al. BaxDelta2 is a

novel bax isoform unique to microsatellite unstable tumors. The Journal of biological

chemistry 2012; 287: 34722-34729.

37. Haferkamp, B., Zhang, H., Kissinger, S., Wang, X., Lin, Y., Schultz, M., et al. BaxDelta2

Family Alternative Splicing Salvages Bax Microsatellite-Frameshift Mutations. Genes &

cancer 2013; 4: 501-512.

38. Sitailo, L. A., Tibudan, S. S., and Denning, M. F. Activation of caspase-9 is required for

UV-induced apoptosis of human keratinocytes. The Journal of biological chemistry 2002;

277: 19346-19352.




20

39. Puck, T. T., and Marcus, P. I. Action of x-rays on mammalian cells. The Journal of

experimental medicine 1956; 103: 653-666.

40. Garrido, C., Galluzzi, L., Brunet, M., Puig, P. E., Didelot, C., and Kroemer, G.

Mechanisms of cytochrome c release from mitochondria. Cell death and differentiation

2006; 13: 1423-1433.

41. Chang, D. W., Xing, Z., Capacio, V. L., Peter, M. E., and Yang, X. Interdimer processing

mechanism of procaspase-8 activation. The EMBO journal 2003; 22: 4132-4142.

42. Gross, A., Yin, X. M., Wang, K., Wei, M. C., Jockel, J., Milliman, C., et al. Caspase

cleaved BID targets mitochondria and is required for cytochrome c release, while BCL-

XL prevents this release but not tumor necrosis factor-R1/Fas death. The Journal of

biological chemistry 1999; 274: 1156-1163.

43. Kantari, C., and Walczak, H. Caspase-8 and bid: caught in the act between death

receptors and mitochondria. Biochimica et biophysica acta 2011; 1813: 558-563.

44. Denning, M. F., Wang, Y., Tibudan, S., Alkan, S., Nickoloff, B. J., and Qin, J. Z.

Caspase activation and disruption of mitochondrial membrane potential during UV

radiation-induced apoptosis of human keratinocytes requires activation of protein kinase

C. Cell death and differentiation 2002; 9: 40-52.

45. Jin, Z., Li, Y., Pitti, R., Lawrence, D., Pham, V. C., Lill, J. R., et al. Cullin3-based

polyubiquitination and p62-dependent aggregation of caspase-8 mediate extrinsic

apoptosis signaling. Cell 2009; 137: 721-735.

46. Knudson, C. M., Tung, K. S., Tourtellotte, W. G., Brown, G. A., and Korsmeyer, S. J.

Bax-deficient mice with lymphoid hyperplasia and male germ cell death. Science 1995;

270: 96-99.




21

47. Miquel, C., Borrini, F., Grandjouan, S., Auperin, A., Viguier, J., Velasco, V., et al. Role

of bax mutations in apoptosis in colorectal cancers with microsatellite instability.

American journal of clinical pathology 2005; 123: 562-570.

48. Molenaar, J. J., Gerard, B., Chambon-Pautas, C., Cave, H., Duval, M., Vilmer, E., et al.

Microsatellite instability and frameshift mutations in BAX and transforming growth

factor-beta RII genes are very uncommon in acute lymphoblastic leukemia in vivo but

not in cell lines. Blood 1998; 92: 230-233.

49. Korsmeyer, S. J., Shutter, J. R., Veis, D. J., Merry, D. E., and Oltvai, Z. N. Bcl-2/Bax: a

rheostat that regulates an anti-oxidant pathway and cell death. Semin Cancer Biol 1993;

4: 327-332.

50. Reed, J. C. Proapoptotic multidomain Bcl-2/Bax-family proteins: mechanisms,

physiological roles, and therapeutic opportunities. Cell death and differentiation 2006;

13: 1378-1386.

Figure legends

Figure 1. Generation and characterization of the isogenic subline cells with the different Bax

microsatellite status. A, Schematic diagram of generating the HCT116 sublines. Cells were

treated with 500 μM Indomethacin for 72 h. A single cell suspension was plated into 96-well

plates without Indomethacin. Bax microsatellite statuses (G8/G8, G8/G7, or G7/G7) of each

sublines were determined by genomic sequencing as described in the methods. B, RT-PCR

analysis of Bax alternative splicing and BaxΔ2 production. The cDNAs were generated from

HCT116 clones #10 (G7/G7 genotype) and clone #28 (G8/G7 genotype) with a set of primers




22

that cover Bax exon 1 through exon 6, or primers specific for Bax∆2 as described in the

methods. The PCR products of Baxα and BaxΔ2 plasmid DNA were used as controls. C,

Immunoblotting of Baxα and BaxΔ2 proteins with an anti-Bax antibody (N20) or an anti-Bax∆2

antibody (2D4), respectively, in clones #10 and #28 after treatment with MG-132 (10 μM) for 8

h. Inputs of transfected BaxΔ2 and Baxα were used as positive controls. D, Cell growth curve

assay of clone #10 and clone #28. Total 1×104 cells were seeded onto 24-well plates and the cell

numbers were counted every 24 h up to 96 h. E, Trans-well invasion assay. F, Colony formation

assay. All experiments were performed independently at least three times.

Figure 2. Bax∆2 promotes apoptosis through activation of caspase-8. A, Cell death assay of

HCT116 clone #10 and clone #28 cells treated with or without 5-FU (500 μM) or Adriamycin

(Adr, 4 μg/ml) for 24 h in the presence of inhibitors (50 μM each) for caspase-3 (DEVD),

caspase-8 (IETD), caspase-1 (YVAD), and caspase-9 (LEHD) as indicated. ** P < 0.01. inh.,

inhibitor. B, Caspase-3 assay of HCT116 clone #10 and #28 cells treated as described in (A).

The activity of caspase-3 was measured using fluorogenic caspase-3 substrate DEVD-AFC (50

μM) with a microplate spectrofluorometer. C, Immunoblotting analysis for the detection of

cleaved casapase-8 in the chemodrug treated clone #10 and #28 cells with an anti-cleaved

caspase-8 antibody.

Figure 3. The Bid-dependent mitochondrial death pathway is not essential for the onset of

chemodrug-induced apoptosis in Bax∆2-positive cells. A, Immunoblotting analysis of cleaved

Bid in HCT116 clone #10 and #28 cells treated with or without 5-FU (500 μM) or Adriamycin (4

μg/ml) as indicated. The intensities of truncated Bid bands were quantitated relevant to the actin




23

control and are presented as arbitrary numbers. B, Cell death assay of HCT116 clone #10 cells

treated with 5-FU (500 μM) in the presence of a Bid specific inhibitor (BI-6C9; 10 μM) or Bid

siRNA. C, Cell death assay of clone #10 cells treated with 5-FU (500 μM) in the presence of a

caspase-9 inhibitor (LEHD; 50 μM) or transfected with a caspase-9 dominant negative (D/N)

mutant construct. D, Quantitative analysis of cleaved caspase-8 and mitochondrial membrane

potential (MMP) in a time course indicated for clone #10 cells treated with 5-FU (500 μM). The

MMP was measured by JC-1 staining (20 μM) and quantitated by Image-J software for the

decrease in the ratio of red (Em 590) versus green (Em 529) fluorescence intensity. Cleaved

caspase-8 was quantitated from the immunoblots by Image-J software from three independent

experiments. E, Representative images of JC-1 staining from (D). Carbonyl cyanide 4-

(trifluoromethoxy) phenylhydrazone (FCCP; 100 μM) was used as a positive control. JC-1

monomer green fluorescence as observed by excitation with 488 nm and emission with 529 nm

(top panel). JC-1 aggregate red fluorescence as observed by excitation at 546 nm and emission at

590 nm (bottom panel).

Figure 4. BaxΔ2 activates caspase-8 through physical interaction. A, Bax-/- MEFs were

transfected with BaxΔ2 for 16 h, and the cleavage of caspase-8 was confirmed by

immunoblotting with anti-cleaved caspase-8 antibody. B, Cells from (a) were immunostained

with an anti-BaxΔ2 (green) and anti-cleaved caspase-8 antibodies (red), and they were imaged

using a confocal microscope. Nuclei were stained with DAPI (blue). C, Cells from clone #28

were transfected with BaxΔ2 for 16 h and subjected to immunoprecipitation (IP) with a BaxΔ2

antibody or control IgG. The immunocomplexes were analyzed by immunoblotting (IB) with

anti-caspase-8 and anti-Bax∆2 antibodies. Actin was used as an input control.




Published OnlineFirst May 19, 2014.Mol Cancer Res Honghong Zhang, Yuting Lin, Adriana Manas, et al. Microsatellite Unstable Colon CancerBaxdelta2 Promotes Apoptosis through Caspase-8 Activation in

Updated version

10.1158/1541-7786.MCR-14-0162doi:

Access the most recent version of this article at:

Manuscript

Authoredited. Author manuscripts have been peer reviewed and accepted for publication but have not yet been

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected] at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://mcr.aacrjournals.org/content/early/2014/05/17/1541-7786.MCR-14-0162To request permission to re-use all or part of this article, use this link



http://mcr.aacrjournals.org/lookup/doi/10.1158/1541-7786.MCR-14-0162

http://mcr.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://mcr.aacrjournals.org/content/early/2014/05/17/1541-7786.MCR-14-0162


bax 2 promotes apoptosis through caspase-8 activation in ... · bax∆2 promotes apoptosis through...

Documents