biochemical basis for malate over production in actinomycete spp

Biochemical Basis for Malate Overproduction in

Actinomycete spp. Isolated from Cotton Rhizosphere

Presented by:Anjali Joshi (11MMB005)

Nikul Parsana (11MMB011) Sakhmeet Patel (11MMB018)

Guided by:Dr. Shalini Rajkumar

Introduction

Actinobacteria

Fig.1. A typical Actinomycetes colony growing on agar•Gram positive, aerobic, filamentous, high G+C content (Williams et al.1989; Manfio et al. 1995).

Habitat of Actinomycetes

Habitat Actinomycetes Reference

Salt lake Streptomonospor amylolytica,Streptomonospora flavalba

Cai et al., 2009

Marine(pacific ocean)

Micromonospora, Rhodococcus, Streptomyces Maldonado et al.,2004

Tropical rain forest Streptosporangium, Nocardia, Micromonospora,Streptomyces, Actinomadura,

Wang et al., 1999

Stream Streptomyces,Micromonospora, Actinomadura, Pseudonocardia

Das et al., 2006

Marine sediment Salinispora tropica,Salinispora arenicola Jensen et al.,2006

Antarctica soil Streptomyces, Actinomycetales Moncheva et al.,2002

Mangrove soil Micromonospora, Streptomyces. Hong et al., 2009

Forest soil Micromonospora,Microbisporium,Actinosporium,Streptosporangium

Seong et al.,2001

Habitat for Actinomycetes

Habitat Actinomycetes Reference

Volcanic soil Streptomyces,Streptosporangium,Actinomadura Zenova et al.,2009

Fresh water Saccharopolyspora,Actinosynnema Sibanda et al.,2010

Agricultural soil Actinoallomurus,Actinopolyspora,Micromonospora Khanna et al.,2011

Mangrove ecosystem Actinomycetes Fredimose et al.,2011

Theobroma cacao Streptomyces Barreto et al., 2008

Lycopersicon esculentum(tomato)

Streptomyces species,Streptoverticillium,Nocardia

Cao et al.,2004

Pea (Pisum sativum) Streptomyces lydicus Tokala et al.,2002

Wheat Streptomyces Juhnke et al., 1987

Cotton S. purpureus, S. aurantiacus, S. microflavus. Hassanin et al., 2007

Actinomycetes in Plant Rhizosphere

Plant Rhizosphere Actinomycetes Reference

Medicinal plant Streptomyces,Actinomadura sp.,Microbispora sp., Micromonospora sp.,Nocardia sp,Nonomurea sp

Khamna et al., 2009

Mahuva (Madhuca induca),Karaj(Pongamia globra)

Streptomyces sp. Thangapandian et al., 2007

Maize (Zea mays) Actinomycetes Miller et al., 1989

Rice (Oryza sativa L.) Mycobacterium,Streptomyces,Micromonospora,Actinoplanes,Frankia,

Tian et al.,2007

Theobroma cacao Streptomyces Barreto et al., 2008

Lycopersicon esculentum (tomato)

Streptomyces species,Streptoverticillium,Nocardia

Cao et al.,2004

Wheat Streptomyces Juhnke et al., 1987

Cotton S. purpureus, S. aurantiacus, S. microflavus. Hassanin et al., 2007

PGP activity of Actinomycetes

Rhizospheric Actinomycetes

IAA Siderophore Phosphate Solubilization

Reference

Streptomyces viridis + + + Khamna et al., 2010, Gangwar et al., 2012.

Nocardia + + + Gangwar et al., 2012

Micromonospora + + + Gangwar et al., 2012

Saccharopolyspora + + + Gangwar et al., 2012

Actinopolyspora + + + Gangwar et al., 2012

Streptomyces rochei IDWR19, Streptomycescarpinensis IDWR53, Streptomyces thermolilacinus IDWR81

+ + + Jog et al., 2012

Fig.2. Mechanisms of P solubilization (Khan et al., 2010)

Mechanisms of P solubilization

Mineral Phosphate Solubilization by microorganisms in soil

Organic acid productionSOIL

Organic acid production by soil microbes

Soil Microbes Organic acid production Reference

Peniciilium bilaii Citric acid, oxalic acid Cunningham et al, 1992

Aspergillus candidus Oxalic acid, tartaric acid Banik et al, 1982

Bacillus firmus Oxalic acid, tartaric acid Banik et al, 1982

Streptomyces spp. Oxalic acid, tartaric acid Banik et al, 1982

Pseudomonas fluorescens 2-ketogluconic acid Duff et al, 1963

Enterobacter intermedium 2-ketogluconic acid Hwangdbo et al, 2003

Aspergillus niger Gluconic acid, fumaric acid, succinic acid, acetic acid, oxalic acid

Rashid et al, 2004

Rhizobium meliloti 2-ketogluconic acid Halder et al, 1993

Azospirillum Gluconic acid Hilda et al, 2004

Organic acid production by Actinomycetes

Actinomycetes Organic acid production Reference

Streptomyces spp.U121 Hydrocitric acid Hilda et al., 2006

Streptomyces lividans Pyruvic acid, 2-oxoglutaric acd

Madden et al., 1996

Acinetobacter rhizosphaere Gluconic acid, oxalic acid, lactic acid,malic acid, formic acid

Gulati et al., 2009

Micromonospora endolithica Unidentified organic acid Khaled et al., 2009

Actinomadura Unidentified organic acid Abdulla, 2009

Kitasatospora Unidentified organic acid Abdulla, 2009

Nocardioses Unidentified organic acid Abdulla, 2009

Origin of Study

• In previous studies, significantly high P-solubilizing actinomycete isolates from cotton rhizosphere were obtained. • The isolate (CR-16) over produced malate (as confirmed on TLC using malate standard) in minimal medium supplemented with 100 mM glucose. However, when grown on lower glucose concentration (50 mM), acid production was not observed.

• Literature lacks determined pathway for malate over production in actinomycetes

• Majority of actinomycetes are reported to follow glycolytic pathway for glucose metabolism . Glyoxylate shunt has also been reported in Streptomyces spp. (Han and Reynolds,1997).

TCP solubilization profile of CR-16

Fig.3. Phosphate solubilization on Tris buffered (50 mM) (pH- 8.0)Tricalcium Phosphate (TCP) Agar supplemented with 100 mM glucose by CR-16 isolate

Metabolic Pathway

Glucose(50 mM)

Pyruvateglycolysis

Fig.4. Metabolism of glucose

Metabolic Pathway at high concentration of glucose

Fig.5. Putative Pathway for production of malic acid

Glucose(100 mM)

Pyruvateglycolysis

Objectives

Confirmation of MPS phenotype of CR-16 and EC-11 in presence of rhizospheric carbon sources.

Elucidation of hypothesized pathway for malate over production in phosphate solubilising CR-16 isolate. Enzyme assays (Isocitrate lyase, Isocitrate dehydrogenase and Malate synthase). Gene expression (Isocitrate lyase, Isocitrate dehydrogenase and Malate synthase)

study by reverse transcriptase PCR (RT-PCR) Confirmation of gene expression by Real-time PCR (q-PCR)

In vivo studies for beneficial effect of isolates on chick pea plants. Pot experiment Hydroponic studies

▪ Rock phosphate containing MS medium▪ Coinoculation with commercially available biofertilizer (V Green)

▪ Biocontrol trait (chitinase production)▪ Organic phosphorous utilization (phytase production)▪ Potassium solubilization (Mica sol.)▪ Halotolerance of isolates

Materials and Methods

Selection of cultures to determine malate production pathway

• Test culture: Phosphate solubilizing actinomycete isolate (CR-16) showing over production of malic acid.

• Control: Phosphate solubilizing actinomycete isolate (EC-11) lacking malic acid over production served as a control.

Revival of cultures:

Organic acid production:

Minimal medium supplemented with 2% glucose was inoculated with CR-16 and incubated at 30o

C for 7 days.

Cells were centrifuged at 10,000 rpm for 10 min

Qualitative and quantitative organic acid profile of cell free supernatant by HPLC analysis (CSMCRI, Bhavnagar) using Supelcogel organic acid specific column (Sigma Aldirch)

CR-16 and EC-11 obtained in

previous studies were maintained

on ISP-3 and preserved as 20% glycerol

stock

Minimal medium

(Vellore, 2001) with glucose

unless mentioned otherwise

Incubated at 30 ◦C for 7 days

under static/shaking

condition

Sugar utilization profile and MPS phenotype of CR-16 and EC-11

Objective 1:

Sugar utilization profile and MPS phenotype of CR-16 and EC-11

CR-16 and EC-11 inoculated

in minimal medium

containing 1% sugar and

incubated at 30 oC for 10 days

pH of cell free supernatant

was measured and growth was visually

observed

Phosphate estimation by

phosphomolybdate method (Ames, 1964)

Gene Expression studies and Enzyme Assays of enzymes involved in malate over production

Isocitrate dehydrogenase Isocitrate lyase Malate synthase

Objective 2:

Enzyme Production

Cells grown in minimal medium with 50 mM and 100 mM glucose

seperately.

Incubated at 30 oC under shaking for

7 days

Cells were subjected to

freeze thaw and lysozyme

treatment for 1 h at 37 oC

Cells were then resuspended in

0.1 M phosphate buffer (pH- 6.8)

(Ball and McCarthy, 1988)

Cells were lysed by ultra

sonication for 10 sec five times with 1.5 min

interval at 700 WClear cell lysate obtained after

centrifugation at 8000 rpm for 10 min was used as enzyme source

Enzyme Assays: Isocitrate Dehydrogenase:

•Isocitrate dehydrogenase (IDH) was determined by continuous spectrophotometric rate determination depending on reduction of β-NADP ( Nicotinamide Adenine Dinuleotide Phosphate ) at 340 nm.

•The IDH activity was measured by decrease in the absorption of β-NADP at 340 nm. One unit IDH converts 1µmole of isocitrate to α-ketoglutarate per minute at pH 7.4 at 370 C (Bergmeyer, 1974).

Enzyme Assays: Isocitrate Lyase:

• Isocitrate lyase (ICL) was determined by continuous spectrophotometric rate determination depending on formation of phenylhydrazine glyoxylate and measuring absorption at 324 nm.

•The ICL activity was measured by decrease in absorption of phenylhydrazine glyoxylate at 324 nm. One unit ICL forms 1µmole of glyoxylate per minute at pH 6.8 at 300 C( Chell et al,1978).

Enzyme Assays: Malate Synthase:

•Malate synthase (MS) was determined by continuous spectrophotometric rate determination depending on reduction of 5,5’- Dithio bis 2- Nitrobenzoic acid (DTNB) to 5- Thio, 2- Nitrobenzoic acid (TNB) at 412 nm.

•The MS activity was measured by decrease in absorption of DTNB at 412 nm. One unit MS cleaves 1 µmole of acetyl CoA per minute at pH 8.0 at 300C in presence of glyoxylate (Silverstein, 1975).

Gene Expression (RT-PCR)

Primer designing RNA isolation Reverse Transcriptase PCR (RT-PCR) Data analysis

Primer Designing

Primer synthesis using Integrated DNA Technology (IDT)

Primer pairs fulfilling all criteria for primer selection were selected The primers were confirmed by Insilico PCR

Primers were reconfirmed by primer BLAST

Gene sequence of enzymes: Isocitrate dehydrogenase, Isocitrate lyase, Malate synthase of Streptomyces spp. from NCBI

Contig sequence from sequences of the same gene using codon aligner

Coding sequence of the gene using ORF Finder

RNA isolation Growth

Actinomycetes in minimal medium,

30 oC, 4-5 days

Cell LysisGTE solution, freeze thaw

bead beating, lysozyme

SDS-EDTA prolonged

incubation at 65 oC

Cell lysateProceeded

with High pure RNA isolation

kit (Roche)Steps

Silica Binding,DNase

treatment,Washing,Elution

RNA yield confirmed on 1.5% agarose

gel and quantified at

260 nm

Equal concentration of RNA (4 μg) was used for

gene amplification

of IDH, ICL and MS genes. DNA

gyrase gene was used as an internal control

Amplification of genes using Reverse Transcriptase-PCR reaction Kit (PrimeScript one tube reaction, Takara)

Reagents Volume

2x 1 step buffer (Reaction buffer, dNTP mixture, One step enhancer solution)

12.5 μl

Prime Script 1 step enzyme mix (PrimeScript RTase, DNA Polymerase- Ex Taq HS, RNase Inhibitor)

1 μl

Forward Primer 100 mmole

Reverse Primer 100 mmole

Template RNA 4 μg

Sterile Milli Q Make up volume upto 25 μl

Total Volume 25 μl

Specific for genes

PCR programme (IDH, ICL and MS)

c-DNA synthesis PCR

PCR programme (DNA gyrase)

c-DNA synthesis PCR

Data Analysis

RT-PCR products were resolved on 1.5 % and 1.2 % agarose gel respectively and viewed under gel documentation system.

The data was analyzed TotalLab quant (Ver. 10) as follows:

Detection of lanes, annotation of wells, band detection, removal of background signals

Different parameters of the bands were analyzed including area of band in pixels(for DNA concentration) and peak height (for purity)

Graph for area (in pixels) of each band was plotted

Confirmation of Gene Expression by Real Time PCR (q-PCR)

RNA isolation

c-DNA synthesis

q-PCR and data analysis

PCR conditions

Reagents Volume

SYBR Premix Ex Taq II (2X) 25 µl

Forward Primer (10 µM) 2 µl

Reverse Primer (10 µM) 2 µl

ROX Reference Dye (50X) 1 µl

c-DNA template 100 ng

sterile milliQ water Make upto 50 µl

Final Volume 50 µl

specific for genes

PCR Programme

Process Temperature Time

Initial denaturation 95 oC 30 sec

PCR (40 CYCLES) 95 oC 5 sec

60 oC 30 sec

Dissociation stage As recommended for ABI Real-time StepOnePLus PCR system

Prefixed

Data Analysis

Data were analysed in StepOne software (ver. 2.2.2), Applied BioSystems Life Technologies.

DNA gyrase was used as an internal control.

ΔCT values were calculated for each sample. Accordingly, RQ values were determined.

Graphs were plotted with RQ values for each samples.

In vivo study for beneficial effects of CR-16 and EC-11 inoculation on Cicer

arietinum (chick pea) growth and development

Objective 3:

Pot Experiment for in vivo study of PGP effects of CR-16 and EC-11 inoculation

Chick pea seeds surface sterilized by 0.1% HgCl2 and 70%

ethanol

Washed many times with sterile distilled

water and rolled over N-agar plate for

validation

Seeds germinated on 1% water agar plate were bacterized in

dense spore suspension of each isolate separately

(107-108/ml) for 1 h

Seeds were sown in sterile soil in equal

sized pits and grown at room temperature

using standard light-dark cycle

After Incubation for 40 days, different plant

parameters were measured.

Uninoculated plants served as control

Hydroponics for in vivo study of PGP effects of CR-16 and EC-11


ethanol


water and rolled over N-agar plate for confirmation of

sterilization

Seeds germinated on 1% water agar plate

Germinated seeds were placed in sterile partial MS medium

inoculated with CR-16 and EC-11

Plants were incubated in Plant

Growth Chamber at 28oC and 35%

relative humidity (Rh)

After 14 days of incubation different

plant parameters were measured

Hydroponics assay to study growth of inoculated plants in free phosphate deprived MS medium


ethanol



sterilization


Germinated seeds were placed in

sterile free phosphate deprived

MS medium containing rock phosphate and

inoculated with CR-16 and EC-11

Plants were incubated in Plant Growth

Chamber at 28oC and 35% relative humidity

(Rh)



Hydroponics - Coinoculation of commercial biofertilizer with CR-16 and EC-11


ethanol



sterilization


Germinated seeds were placed in

sterile partial MS medium

containing V-Green biofertilizer with and without CR-16 and EC-11

Plants were incubated in Plant Growth

Chamber at 28oC and 35% relative humidity

(Rh)



Chitinase production (Biocontrol)Phytase production (Organic P solubilization)

Potassium solubilizationHalotolerance of isolates

Objective 4:

Chitinase test

Cultures spotted on 2% colloidal chitin agar (Renwick et al.,1991)

Amount of NAG liberated was estimated by DNSA method (Miller, 1959)

Phytase test

Cultures spotted on 1% sodium phytate agar (Harland and Harland, 1980)

Amount of free soluble phosphate liberated was estimated (Ames, 1969)

Potassium solubilizationCultures spotted on 1% mica agar Amount of potassium solubilized was

estimated by flame photometry (Sugumaran and Janarthanam,2007)

Halotolerance of isolates

Cultures grown in minimal medium containing 2,4,6,8 and 10% NaCl and incubated and growth was visually observed

Results and Discussion

Revival of CR-16 and EC-11

Morphological and colonial characteristics of CR-16 and EC-11

Isolate Vegetative mycelium

Aerial mycelium

Pigmentation

Spore Size and Shape

Appearance

Substrate secretion

Additional feature

Microscopic arrangement

CR-16 Lightbrown

Cream Light brown

Light Grey (++)

Small, Even margin

Dry,Raised

None Nucleated colony

Point shapedSpores

EC-11 Lightbrown

White Black Light Grey(++)

Small,Evenmargin

Dry,Flat

Greenish None RegularSpores withHyphae

CR- 16 EC-11

Gram’s Staining

CR - 16ISP- 1 ISP - 4

ISP -3 ISP - 7

Colony morphology on ISP media

EC -11ISP-1 ISP -3

ISP - 4 ISP -7

Colony morphology on ISP media

MPS phenotype of CR-16 and EC-11 in presence of

different sugars

Acid production by CR-16 and EC-11 in presence of different carbon sources

Sugar

Suc

cina

te

Ace

tate

Glu

cona

te

Citr

ate

Oxa

late

Ara

bino

se

Rib

ose

Man

nito

l

Xyl

ose

Glu

cose

Lact

ose

Fruc

tose

Suc

rose

pH V

alue

0

2

4

6

8

10EC-11CR-16

(P ≤ 0.05, n=3)

• pH drop in glucose and fructose from 7.2 to 5.0 in both isolates

• In presence of organic acids succinate, acetate and oxalate CR-16 showed no significant change in pH; whereas increase in pH for same tubes was observed in EC-11

• CR-16 showed pH drop from 7.2 to 5.0 in sugars viz ribose, xylose , arabinose, sucrose, mannitol and lactose, indicating organic acid production

• Organic acid over production results in pH drop (Hilda et al 2006)

Growth in different rhizospheric sugars

Sugars

Suc

cina

te

Ace

tate

Ara

bino

se

Rib

ose

Oxa

late

Man

nito

l

Citr

ate

Fruc

tose

Xyl

ose

Suc

rose

Glu

cose

Lact

ose

Glu

cona

te

Gro

wth

0.0

0.2

0.4

0.6

0.8

EC-11 CR-16

• All 13 different rhizospheric sugars were utilized by both the isolates• Growth of EC-11 was faster compared to CR-16• However, CR-16 showed more pH drop compared to EC-11

Sugar utilization growth profile of CR-16 and EC-11

Qualitative assay of Phosphate Solubilization

Red halo zone surrounding EC-11

Fig.7. P solubilization by EC-11 on Tris (25 mM) (pH-8.0) buffered TCP agar

Phosphate Solubilization in different rhizospheric sugars

Sugar

Succ

inat

e

Ace

tate

Glu

cont

e

Oxa

late

Ara

bino

se

Rib

ose

Man

nito

l

Xyl

ose

Glu

cose

Lact

ose

Fruc

tose

Sucr

ose

Con

cent

ratio

n of

Pi (

mg

ml- )

0.0

0.2

0.4

0.6

0.8

1.0 EC-11CR-16

(P ≤ 0.05, n=3)

• Range of free phosphate liberated: 96.79 μg/ml to 267.14 μg/ml

• CR-16 solubilized maximum phosphate in presence of ribose followed by xylose and lactose

• EC-11 solubilized maximum phosphate in presence of fructose followed by succinate and glucose

• Phosphate solubilization is found in those sugars which showed organic acid production

• P solubilization by organic acid production is reported in actinomycetes( Gangwar et al., 2012)

Rock Phosphate Solubilization

1 2 3 4 5 6 7 8 9 10 110

0.1

0.2

0.3

0.4

0.5

0.6

f(x) = 0.0503727272727273 xR² = 0.99992219525961

Concentration of KH2PO4 (μg/ml)

O.D

. at 8

20 n

mStandard curve

Isolate Free phosphate concentration (μg/ml)

CR-16 95.24±0.034

EC-11 91.27±0.012

(P ≤ 0.05, n=3)

Biocontrol trait (chitinase production)Organic P utilization (phytase production)

Potassium solubilizationHalotolerance of isolates

Chitinase Production by EC-11

Clear zone of hydrolysis surrounding colonies indicate chitinase production

Fig.8.Chitinase production by EC-11 on 2% colloidal chitin agar

Quantitative assay for chitinase

0 0.2 0.4 0.6 0.8 1 1.20

0.1

0.2

0.3

0.4

0.5

0.6

0.7

0.8

f(x) = 0.677590909090911 xR² = 0.996071781343927

NAG conc. (mg ml-1)

O.D

. at 5

40 n

m

Isolate Chitinase production (units/ml)

EC-11 1.27±0.007

CR-16 -

(P ≤ 0.05, n=3)

Chitin is the major polymer present in fungal cell wall. Hence chitinase producing cultures are known to have antifungal activity. Chitinase production is common in actinomycetes (Gupta et al., 1995)

Actinomycete isolates producing chitinase serve as a natural plant protecting agent against phytopathogenic fungus (Shirokikh et al., 2007).

EC-11 produced 1.27 units/ml chitinase in 2% colloidal chitin medium which is within the known range reported for actinomycetes.

Quantitative assay for phytase

0 0.1 0.2 0.3 0.4 0.5 0.6 0.70

0.20.40.60.8

11.21.41.61.8

2f(x) = 3.29722222222222 xR² = 0.997507781354895

KH2PO4 conc. (mM ml-1)

O.D

. at 6

60 n

m

Isolates Phytase production (units/ml)

CR-16 0.68±0.007

EC-11 0.52±0.011

O.D. at 660 nm

(P ≤ 0.05, n=3)

Phytic acid, myo-inositolhexaphosphate, is a major storage form of phosphorus in cereals and legumes, representing 18–88% of total phosphorus. Phytic acid is also abundantly available in soil. However, plants cannot utilize it as phosphate is present in a bound form.

Phytate degrading enzymes (phytases) breakdown phytic acid and release inorganic phosphate (Pi) which can be taken up by plants (Reddy et al., 1982). The phenomena is called as organic phosphate solubilization.

The isolates under study (CR-16 and EC-11) produced 0.68 and 0.52 units/ml enzyme respectively. The values are higher than reported in Thermomonospora spp.RC7 (0.233 units/ml ) (Wittanalai et al., 2003).

Halotolerance of CR-16 and EC -11

Salinity (%) Growth of CR-16 Growth of EC-112 +++ +++4 +++ +++6 +++ +++8 +++ +++

10 +++ +++

• For the survival of cultures in saline conditions, salt tolerance is required. Saline soils usually have high NaCl concentration. Similarly, saline condition is created in fertile non-saline soils due to improper irrigation.

• Hence for a bio-inoculant, salt tolerance is a desirable trait. The cultures obtained showed tolerance to as high as 10% NaCl. In literature, halotolerant actinobacteria Haloactinospora alba (7-23% NaCl tolerance) are reported (Tang et al., 2008).

• Results indicate NaCl tolerant cultures, however tolerance to higher NaCl range needs to be examined.

Mica utilization

Isolate Free potassium concentration

CR-16 300 μg/ml

EC-11 400 μg/ml

• Crude powder of mica rocks was obtained. Mica contains potassium ions in bound form, thus making it unavailable. Mica solubilizing cultures liberate K+ ions from mica rocks which can be further utilized by plants.

• In the present study, CR-16 and EC-11 solubilized mica releasing K+ ions. The solubilization is relatively higher as compared to other mica solubilizing bacteria (MSc dissertation thesis, Archana D.S., 2007, University of Agricultural sciences, Dharwad) • To the best of our knowledge, there are no reports for mica solubilization for actinomycetes.

Enzyme Assays

HPLC Profile of culture supernatant

Fig.6.HPLC profile of isolate CR 16: Peak with RT 13.12 min corresponds to malate (RT 13.1 min)

Enzyme Assays: 1. Isocitrate dehydrogenase EC-11

• Significantly high activity of IDH in 50 mM glucose and low activity of IDH in 100 mM glucose.

Isocitrate dehydrogenase EC-11

Glucose concentration

0 1 2

Enz

yme

U m

l-1

0.00

0.01

0.02

0.03

0.04

0.05

0.06

EC-11 50 mM pH -2.7 EC-11 100 mM pH- 2.5EC-11 50 mM pH -7.0 EC-11 100 mM pH -7.0

(P ≤ 0.05, n=3)

• Significantly low activity of ICL in 50 mM glucose and high activity of ICL in 100 mM glucose

2. Isocitrate lyase EC-11

Isocitrate lyase EC-11


0 1 2

Enz

yme

U m

l-1

0.000

0.005

0.010

0.015

0.020

0.025

0.030

EC-11 50 mM pH -2.7 EC-11 100 mM pH -2.5 EC-11 50 mM pH -7.0 EC-11 100 mM pH -7.0

(P ≤ 0.05, n=3)

• Similar amount of malate synthase produced in 50 mM and 100 mM glucose.• We can conclude that EC-11 produces some unidentified organic acid other than malic acid.

3. Malate Synthase EC-11

Malate synthase EC-11


0 1 2

Enz

yme

U m

l-1

0.000

0.005

0.010

0.015

0.020

0.025

EC-11 50 mM pH -2.7 EC-11 100 mM pH -2.5EC-11 50 mM pH -7.0 EC-11 100 mM pH -7.0

4. Isocitrate dehydrogenase CR-16

Isocitrate dehyrogenase CR-16


0 1 2

Enz

yme

U m

l-1

0.00

0.01

0.02

0.03

0.04

0.05

0.06

CR-16 50 mM pH -2.8 CR-16 100 mM pH -2.1 CR-16 50 mM pH -7.0 CR-16 100 mM pH -7.0

• Significant low activity of IDH in 50 mM and high activity in 100 mM glucose

(P ≤ 0.05, n=3)

• Significant low activity of ICL in 50 mM and high activity in 100 mM glucose.

5. Isocitrate lyase CR-16

Isocitrate lyase CR-16


0 1 2

Enz

yme

U m

l-1

0.00

0.01

0.02

0.03

0.04

0.05

0.06

0.07

CR-16 50 mM pH -2.8 CR-16 100 mM pH -2.1 CR-16 50 mM pH -7.0CR-16 100 mM pH -7.0

(P ≤ 0.05, n=3)

• Significant low activity in 50 mM and high activity in 100 mM glucose

6. Malate synthase CR-16

Malate Synthase CR-16


0 1 2

Enz

yme

U m

l-1

0.00

0.02

0.04

0.06

0.08

0.10

CR-16 50 mM pH -2.8 CR-16 100 mM pH -2.1 CR-16 50 mM pH -7.0CR-16 100 mM pH -7.0

(P ≤ 0.05, n=3)

Summary of enzyme assays

Isolate IDH (U ml-1) ICL (U ml-1) MS (U ml-1)

After pH drop- 10 daysBefore pH drop- 3 days

After pH drop

Before pH drop

After pH drop

Before pH drop

After pH drop

Before pH drop

CR-16 (50 mM) 0.070 0.040 0.050 0.022 0.080 0.030

CR-16 (100 mM) 0.090 0.049 0.090 0.020 0.140 0.030

EC-11 (50 mM) 0.070 0.032 0.030 0.015 0.060 0.014

EC-11 (100 mM) 0.095 0.037 0.045 0.017 0.060 0.015

• CR-16 shows significant high activity of ICL and MS at high concentration of glucose • EC-11 shows similar malate synthase activity, no over production of malate in EC-11, organic acid produced by EC-11 is unidentified• Enzyme activity of all three enzymes almost similar in medium before pH drop• High activity of ICL and MS in CR-16 shows presence of glyoxylate shunt pathway

Gene Expression

Primers:

Enzymes Primer Sequence

Forward Primer Tm(◦c) Reverse Primer Tm(◦c)

Isocitrate dehyrogenase CCAACATCATCAAGCTGCCGAACA 60.1 AGACCTTCATCATCGTGGCCTTCA 60.2

Isocitrate lyase

TTCGAGCTGACCAAGGCGATGAT 60.7 CCAGGGTGATGAACTGGAACTTGT 59.1

Malate synthase

ACTTCGGCCTGTACTTCTTCCACA 60.0 TCGTAGAGGATCTCCTCCATCTCGAA 59.8

DNA gyrase

GAAGTCATCATGACCGTTCTGCA 59.2 AGCAGGGTACGGATGTGCGAGCC 65.6

RNA Isolation:

1 2 3 4

• Bands of RNA resolved on 1.5% agarose gel.• RNA concentration quantified at 260 nm • Same concentration of RNA template used for RT-PCR.

Isolate and glucose

concentrationO.D. at 260 nm Concentration (μg/μl)

CR-16 (50 mM) 0.270 4.32

CR-16 (100 mM) 0.266 4.26

EC-11 (50 mM) 0.284 4.54

EC-11( 100 mM) 0.282 4.51

• Lane 1: CR-16 (50 mM)• Lane 2: CR-16 (100 mM)• Lane 3: EC-11 (50 mM)• Lane 4: EC-11 (100

1. DNA gyrase:

• DNA gyrase, internal control• Band intensity not affected by glucose concentration

1.2 kb amplicon

2. Isocitrate dehydrogenase

200 bp amplicon

Isolate Band intensity

EC-11 (50 mM) high

EC-11 (100 mM) low

1 2

• Lane 1: EC-11 (50 mM)• Lane 2: EC-11 (100 mM)

3. Isocitrate lyase:

200 bp amplicon


CR-16 (50 mM) Low

CR-16 (100 mM) High

EC-11 (50 mM) Low

EC-11 (100 mM) High

1 2 3 4

• Lane 1: CR-16 (50 mM)• Lane 2: CR-16 (100 mM)• Lane 3: EC-11 (50 mM)• Lane 4: EC-11 (100 mM)

4. Malate synthase:

1 2 3 4

200 bp amplicon


CR-16 (50 mM) Low

CR-16 (100 mM) High

EC-11 (50 mM) Moderate

EC-11 (100 mM) Moderate

• Lane 1: CR-16 (100 mM)• Lane 2: CR-16 (50 mM)• Lane 3: EC-11 (100 mM)• Lane 4: EC-11 (50 mM)

TotalLab AnalysisIsocitrate dehydrogenase

EC-11 50 mM EC-11 100 mM0

500

1000

1500

2000

2500

3000

3500

4000

Area

(pixe

ls)

• Area covered under 50 mM is higher compared to 100 mM glucose concentration indicating higher IDH activity in 50 mM glucose for EC-11

Isocitrate lyase

CR-16 50 mM CR-16 100 mM EC-11 50 mM EC-11 100 mM0

1000

2000

3000

4000

5000

6000

7000

8000

Area

(pix

els)

•Area of band was higher for 100 mM glucose as compared to 50 mM glucose for both CR-16 and EC-11 indicating higher ICL activity at 100 mM glucose

Malate synthase

CR-16 50 mM CR-16 100 mM EC-11 50 mM EC-11 100 mM0

500

1000

1500

2000

2500

3000

3500

4000

4500

Are

a (p

ixel

s)

• Area covered under 50 mM is lesser compared to 100 mM glucose concentration in CR-16• EC-11 shows almost equal area covered under 50 mM and 100 mM glucose concentration

Real time PCR

EC11_100EC11_50

0

0.5

1

1.5

2

2.5

3

3.5

Isocitrate Dehydrogenase

Samples

RQ

• Expression in 50 mM is higher compared to 100 mM glucose concentration indicating higher IDH activity in 50 mM glucose for EC-11

EC11_100EC11_50

CR16_50CR16_100

012345678

Isocitrate Lyase

Samples

RQ

• Expression was higher for 100 mM glucose as compared to 50 mM glucose for both CR-16 and EC-11 indicating higher ICL activity at 100 mM glucose

CR16_100CR-16_50

EC-11_100EC-11_50

0

0.2

0.4

0.6

0.8

1

Malate Synthase

Samples

RQ

• Expression in 50 mM is lesser compared to 100 mM glucose concentration in CR-16• EC-11 shows almost equal expression in 50 mM and 100 mM glucose concentration

Summary of Gene Expression

Isolate IDH intensity ICL intensity MS intensity

CR-16 (50 mM) - Low Low

CR-16 (100 mM) - High High

EC-11 (50 mM) High Low Moderate

EC-11 (100 mM) Low High Moderate

• High intensity ICL and MS bands obtained in 100 mM glucose medium shows the presence of glyoxylate shunt in CR-16• Low intensity IDH band at 100 mM glucose concentration compared to 50 mM glucose concentration • EC-11 MS bands are of almost equal intensity indicating lack of malate over production• IDH gene amplification for CR-16 was not obtained due to inadequate initial m-RNA concentration

In vivo studies for effects of PGP activity of CR-16 and

EC-11 on chick pea growth

Plant growth experiment

CR-16 Control EC-11

Plant growth parameters

• Gopalkrishna et al., (2012) reported 39-65% increase in root length, shoot length and total dry weight by Streptomyces inoculation•Micromonospora endolithica promoted the growth of roots and shoots of bean plants (El-Tarabily et al.,2008)• Actinomycetes isolates CR-16 and EC-11 showed beneficial effects on chick pea development• Higher root length, shoot length, lateral roots, branches and plant biomass observed as compared to control

Plants Root length (cm) Shoot length (cm)

Shoot length increase (fold)

No. of lateral roots

No. of branches

Dry weight (mg)

Dry weight increase

(fold)

Control 1±0 2.5±0.70 - 1±0 4±0 265±0.04 -

CR-16 3.83±1.72 10.17±5.56 3 5±1.75 6±1.47 580±0.16 2.2

EC-11 5.00±1.41 16.00±1.41 5.4 10±0.70 10±0 550±0.01 2.0

Hydroponics- plant growth parameters

• The mechanisms by which PGPR promote plant growth are not fully understood but include : 1) ability to produce plant hormones (Mordukhova et al., 1991) 2) asymbiotic N2 fixation (Boddey and Dobereiner, 1995) 3) solubilization of mineral phosphate and other nutrients (De Freitas et al., 1997) •The production of hormones by PGPR in numerous reports indicate the importance of indolacetic acid (IAA) in the roots and shoots development (Aloni et al. 2006)• El tarabily (2008) reported PGP with S. filipinensis due to ability to produce IAA• CR-16 and EC-11 showed beneficial effects on chick pea growth in partial MS medium

Plants Root length (cm)

Shoot length (cm)

% increase with respect to

control


No. of branches

Dry weight (mg)

% increase with respect

to control

Control 7.5±2.36 11.33±0.82 -- 10±1.18 7±1.89 120±0.001 --

CR-16 8.53±0.54 16.37±2.95 44% 15±1.93 11±0.61 120±0.024 --

EC-11 10.22±1.22 19.59±3.46 72% 15±2.25 10±0.92 130±0.006 8%

Hydroponics with rock phosphate


• Saber et al., (2009) reported inoculation of mung bean with phosphate solubilizing fungi in presence of rock phosphate or calcium superphosphate increased significantly growth, seed yield and P-uptake • Plant promotion relies on the ability of the Actinomycetes to solubilize phosphate (El-Tarabily et al., 2008; Hamdali et al.,2008) •Root development in rock phosphate containing M.S. medium was low as compared to normal M.S. medium• EC-11 showed its beneficial effects on chick pea shoot development and CR-16 showed its beneficial effect on plant biomass

Root length (cm) Shoot length (cm)

Shoot length

% increase


No. of branches

Dry weight (mg)

Dry weight % increase

Control 5.76±3.06 9.60±3.28 - 2±0.20 14±1.21 146±0.003 -

CR-16 4.08±0.26 8.57±0.28 - 1±0.80 13±0.91 169±0.018 15.75 %

EC-11 5.65±0.49 13.95±0.35 45 % 2±0.14 13±0.42 134±0.019 -

Hydroponics with commercial biofertilizer


•Vessey (2003) defines biofertilizers as a substance which contains living microorganisms which, when applied to seed, plant surfaces, or soil colonizes the rhizosphere or the interior of the plant and promotes growth by increasing the supply or availability of primary nutrients the host plant.• Rhizobacteria, associated with rhizosphere, can fix nitrogen, and solubilizing phosphorus has been used as inoculum in nonleguminous species such as maize, rice, wheat, and sugar cane (Dobereiner 1997).• However, beneficial effects of isolates seen on shoot development and lateral roots development• Plant biomass in EC-11 inoculated plants was more as compared to control

Plants Root length (cm) Shoot length (cm)

Shoot length% increase


No. of branches

Dry weight (mg)

Dry weight% increase/

decrease

Control 16.06±1.13 12.20±1.09 - 19±1.76 16±2.16 135±0.02 -

CR-16 15.10±1.33 14.33±1.21 17.3 % 26±2.23 12±3.78 117±0.06 -

EC-11 15.45±1.05 14.73±0.32 20.7 % 25±3.74 10±0.65 146±0.003 8.1 %

SUMMARY

CR-16 EC-11

MPS Ribose > Xylose > Lactose Fructose > Succinate > Glucose

Chitinase --- 1.27 units/ml

Phytase 0.68±0.007 units/ml 0.52±0.011 units/ml

Halotolerance Upto 10% NaCl Upto 10% NaCl

Mica 300 μg/ml 400 μg/ml

Pathway for malic acid Present: glyoxalate shunt present; malate synthase high

Absent: glyoxalate shunt present; malate synthase low

IAA + +

P Solubilization + +

Siderophore production + +

References

Williams, S.T. , Sharples, G.P., Bradshaw, R.M. The fine structure of Actinomycetes. In actinomyctales, Characteristics and practical importance , Edited by G.sykes and F.A Skinner . London : Acedemic press. Pp. 113-130 (1973)

Locci, R., Williams, S.T., M.E. Sharpe and J.G. Holt (Eds.). Willians and Wilkins. Baltimore, 1989. Streptomyces and Related Genera. In: Bergeys Manual of Systematic Bacteriology, 2452-2492.

Manfio, G.P., Zakrzewska-Czerwinska, J., Atalan, E. Goodfellow, M. Towards minimal standards for the description of Streptomycesspecies. Biotechnologia. 7-8: 242–253 (1995).

Vanloon baker 2003 Bais et al 2004, Gray and Smith 2005, kiely et al 2006 Hasegawa, S., Shimazu, M ., Meguro, A., Ohmura, y., Nishimura, T., Kunoh, H. An endophytic Actinomycetes,

Streptomyces sp. MBR-52, that accelerates emergence and elongation of plant adventitious root. Actinomycetologicia. 20: 1-9 (2006)

Okazaki, T.: K. Takahashi, M. Kizuka & R. Enokital,1995, Annu. Rep.Sankyo Res. Lab Studies on Actinomycete isolated from plant leaves, Vol. 47, 97–106.

Matsukuma, S.; T. Okuda & J.Watanabe,1994,Actinomycetologica Isolation of Actinomycetes from pine litter layers, Vol.8, 57–65.

Matsumoto, A.; Y. Takahashi, M. Mochizuki, A. Seino, Y. Iwai & S. Omura,1998, Actinomycetologica, Characterization of actinomycetes isolated from fallen leaves, Vol. 12, 46–48.

Fuhrer, T., Fischer, E., and Sauer, U. (2005). Experimental identification and quantification of glucose metabolism in seven bacterial species. Journal of bacteriology.187, 1581-1590.

Marschner H 1995 Mineral Nutrition of Higher Plants. Academic Press, London. Hoffland E 1992 Quantitative evaluation of the role of organic-acid exudation in the mobilization of rock phosphate by

rape. Plant Soil 140, 279–289. Johnson J F, Allan D L, Vance C P and Weiblen G 1996a Root carbon dioxide fixation by phosphorus-deficient Lupinus

albus: Contribution to organic-acid exudation by proteoid roots. Plant Physiol. 112, 19–30.

Ryan P R, Delhaize E and Randall P J 1995a Malate efflux from root apices and tolerance to aluminum are highly correlated in wheat. Aust. J. Plant Physiol. 122, 531–536.

Ismail I, DeBellis L, Alpi A and Smith S M 1997 Expression of glyoxylate cycle genes in cucumber roots responds to sugar supply and can be activated by shading or defoliation of the shoot. Plant Mol. Biol. 35, 633–640.

Earl K D, Syers J K and McLaughlin J R 1979 Origin of citrate, tartrate, and acetate on phosphate sorption by soils and synthetic gels. Soil Sci. Soc. Am. J. 43, 674–678.

Fox T R and Comerford N B 1992 Influence of oxalate loading on phosphorus and aluminum solubility in spodosols. Soil Sci. Soc. Am. J. 56, 290–294.

Fox T R, Comerford N B and McFee W W 1990a Phosphorus and aluminum release from a spodic horizon mediated by organic acids. Soil Sci. Soc. Am. J. 54, 1763–1767.

Fox T R, Comerford NB and McFee W W 1990b Kinetics of phosphorus release from spodosols – effects of oxalate and formate. Soil Sci. Soc. Am. J. 54, 1441–1447.

Gerke J 1994 Kinetics of soil phosphate desorption as affected by citric acid. Z. Pflanzenernähr. Bodenk. 157, 17–22.

Jones D L and Darrah P R 1994b Role of root derived organic-acids in the mobilization of nutrients from the rhizosphere. Plant Soil 166, 247–257.

Bolan N S, Naidu R, Mahimairaja S and Baskaran S 1994 Influence of low-molecular-weight organic-acids on the solubilization of phosphates. Biol. Fert. Soils 18, 311–319.

Fox T R, Comerford NB and McFee W W 1990b Kinetics of phosphorus release from spodosols – effects of oxalate and formate. Soil Sci. Soc. Am. J. 54, 1441–1447.

Lan M, Comerford N B and Fox T R 1995 Organic anions effect on phosphorus release from spodic horizons. Soil Sci. Soc. Am. J. 59, 1745–1749.

Stone et al.,2000, Nature Genetics , Mutation of a gene encoding a putative chaperonin causes McKusick-Kaufman syndrome, Mutation of a gene encoding a putative chaperonin causes McKusick-Kaufman syndrome, Vol. 25, 79–82.

Baker, P. N., Morser, J. & Burke, D. C. ,1980, Journal of lnterferon Research, Effects of sodium butyrate on a human lymphoblastoid cell line (Namalwa) and its interferon production, Vol. 1, 71-77.

Hiltner, L. Uber neure Erfahrungen und problem auf dem dem Gebiet der Bodenbakteriologie und unter besonder Berucksichtigung der Grundungung und branche. [German].- Arb Dtsch Landwirtsch Ges. 98: 59-78 (1904)

Maldonado, L.A., James, E.M., Stach, Wasu Pathom-aree1, Alan, C., Ward Alan, T., Bull, Goodfellow, M. Diversity of cultivable Actinobacteria in geographically widespread marine sediments. Antonie van Leeuwenhoek. 87: 11–18 (2005).

Wang, Y., Zhang, Z.S., Ruan, J.S., Wang, Y.M., Ali S.M.S.D. Investigation of actinomycetes diversity in the tropical rainforest of Singapore. Journal of Industrial Microbiology and biotechnology. 23: 178-187 (1999).

Das, M., Royer, T.V., Leff, L.G. Diversity of Fungi, Bacteria, and Actinomycetes on Leaves Decomposing in a Stream. Applied Environmental Microbiology. 73(3): 756–767 (2007).

Castillo, U., Harper, J. K., Strobel, G. A., Sears, J., Alesi, K., Ford, E., Lin, J., Hunter, M., Maranta, M., Ge, H., Yaver, D., Jensen, J. B., Proter, H., Robinson, R., Millar, D., Hess, W.M., Condron, M., Teplow D. Kakadumycins, novel antibiotics from Streptomyces sp. NRRL 305, an endophyte of Grevillea pteridifolia. FEMS (Federation of European Material Societies) Microbiology Letter. 224: 183–190 (2003).

Moncheva, P., Tishkov, S., Dimitrova, N.V., Chipeva, S. Antonova-Nikolova and N. Bogatzevska. characteristics of soil actinomycetes from antarctica. Journal of culture collections. 3: 3-14 (2002).

Hong, K., Gao, A.H., Xie, Q.Y., Gao, H., Zhuang, L., Lin, H.P., Yu, H.P. Li, J., Yao, X.S., Goodfellow, M., Ruan, J.S. Actinomycetes for Marine Drug Discovery Isolated from Mangrove Soils and Plants in China. Marine Drugs. 7: 24-44 (2009).

Seong, C. N., Ji Heok Choi, Keun-Shik Baik. An Improved Selective Isolation of Rare Actinomycetes from Forest Soil. The Journal of Microbiology. 39(1): 17-23 (2001).

Zenova, G.M., Kurapova, A.I., Lysenko, A.M., Zvyagintsev, D. G. The structural-functional organization of thermo tolerant complexes of actinomycetes in desert and volcanic soils Earth and Environmental Science . 42(5): 531-535 (2009).

Sibanda, T., Mabinya, L.V., Mazomba, N., David, A., Akinpelu, K., Bernard, Ademola, O., Olaniran , Anthony, I., Okoh. Antibiotic Producing Potentials of Three Freshwater Actinomycetes Isolated from the Eastern Cape Province of South Africa. International Journal of Molecular Science. 11: 2612-2623 (2010).

http://www.springerlink.com/content/?Author=G.+M.+Zenova

http://www.springerlink.com/content/?Author=G.+M.+Zenova

http://www.springerlink.com/content/?Author=A.+I.+Kurapova

http://www.springerlink.com/content/?Author=A.+M.+Lysenko

http://www.springerlink.com/earth-and-environmental-science/

Ravikumar. S., Fredimoses, M., Gokulakrishnan, R., Biodiversity of actinomycetes in Manakkudi mangrove ecosystem, Southwest coast of India. Annals of Biological Research. 2(1): 76-82 (2011).

Barreto, T.R., augusto, c.m., Da silva, ana cristina, f., Soares, jorge, t., De souza. Population densities and genetic diversity of actinomycetes associated to the rhizosphere of theobroma cacao. Brazilian journal of microbiology. 39: 464-470(2008).

Cao, L., Z., You, J., Tan, H., Zhou, S. Isolation an dcharecterization of endophytic Streptomyces strains from surface-sterilized tomato (Lycopersicon esculentum) roots. Letters in Applied Microbiology. 39:425-430 (2004)

Ranjeet, K., Tokala Janice, L., Strap Carina, M. Jung Don, L., Crawford, Michelle Hamby Salove, Lee A., Deobald, J., Franklin Bailey, Morra, M.J. Novel Plant-Microbe Rhizosphere Interaction Involving Streptomyces lydicus WYEC108 and the Pea Plant (Pisum sativum), Applied and Environmental Microbiology. 68(5): 2161–2171 (2002).

Ehrlich, H. L. Mikrobiologische und biochemische Verfahrenstechnik. In: Einsele, A., Finn, R. K., Samhaber, W., editors. (1990). Geomicrobiology, 2nd ed. Weinheim: VCH Verlagsgesellschaft.

Fernandez, C. and Novo R. (1988). Vida Microbiana en el Suelo, II. La Habana: Editorial Pueblo y Educación. MOLLA MAZ AND CHOWDHURY AA.1984. Microbial mineralization of organic phosphate in soil. Plant Soil 78: 393–399. CHIEN SH AND MENON RG. 1995. Factors affecting the agronomic effectiveness of phosphate rock for direct application.

Fert Res 41: 227–234. SALE PWG AND MOKWUNYE AU. 1993. Use of phosphate rocks in the tropics. Fert Res 35: 33–45. SANCHEZ PA, SHEPHERD KD, SOULE MJ, PLACE FM, BURESH RJ AND IZAC AN. 1997. Soil fertility replenishment in Africa: an

investment in natural resource capital. In: Replenishing soil fertility in Africa, Indianapolis. Proceedings, SSSA Special PublicationNo. 51, Madison, WI:AmericanSociety of Agronomy, 1997, p. 1–46.

Begon, M., Harper, J. L., Townsend, C. R. (1990). Ecology: Individuals, Populations and Communities, 2nd ed. Blackwell Scientific Publications USA.

Goldstein, A. H. (1994). Involvement of the quinoprotein glucose dehydrogenase in the solubilization of exogenous phosphates by gram-negative bacteria. In: Torriani-Gorini, A., Yagil, E., Silver, S., editors. Phosphate in Microorganisms: Cellular and Molecular Biology. Washington, DC: ASM Press. pp. 197-203.

OBERSON A, BESSON JM, MAIRE N AND STICHER H. 1996. Microbiological processes in soil organic transformations in conventional and biological crop- ping systems. Biol Fertil Soils 21: 138–148.

STEWART JWB AND TIESSEN H. 1987. Dynamics of soil organic phosphorus. Biogeochem 4: 41–60. BEEVER RE AND BURNS DJW. 1980. Phosphorus uptake storage and utilization by fungi Adv Bot Res 8:

127–219. Fernandez, C. and Novo R. (1988). Vida Microbiana en el Suelo, II. La Habana: Editorial Pueblo y

Educación. Odum, E. P. (1986). Fundamentos de Ecologìa. Mexico: Interamericana. ENGELSTAD OP, JUGSUJINDA A AND DE DATTA SK. 1974. Response by flooded rice to phosphate rocks of

varying citrate solubility. Soil Sci Soc Amer Proc 38: 524–529. RICHARDSON AE. 2001. Prospects for using soil microorganisms to improve the acquisition of phospho-

rus by plants. Aust J Plant Physiol 28: 897–906. Dey, B. K. (1988). Phosphate solubilizing organisms in improving fertility status of soil. In: Sen, S.P., Palit, P.

(Eds.). Biofertilizers Potentialities and Problems. Plant Physiology Forum, Naya Prokash, Calcutta, pp.237±248.

Goldstein, A. H. (1986). Bacterial solubilization of mineral phosphates: historical perspective and future prospects.American Journal of Alternative Agriculture. 1, 51-7. 50.

Goldstein, A. H. (1994). Involvement of the quinoprotein glucose dehydrogenase in the solubilization of exogenous phosphates by gram-negative bacteria. In: Torriani-Gorini, A., Yagil, E., Silver, S., editors. Phosphate in Microorganisms: Cellular and Molecular Biology. Washington, DC: ASM Press. pp. 197-203.

Shirokikh IG, Zenova GM, Merzaeva OV et al. Actinomycetes in prokaryotic complex of the rhizosphere of

oats in a soddy-podzolic soil. Eurasian soil Sci 40: 158-162, 2007. Jones, D. A., Smith, B. F. L., Wilson, M. J., Goodman, B. A. (1991). Solubilizator fungi of phosphate in rise

soil. Mycol Res. 95, 1090-3. Dalal, R. C. (1977). Soil organic phosphorus. Advances in Agronomy. 29, 83-117

Anderson, G. Assessing organic phosphorus in soils. In: Khasawneh, F. E., Sample, E. C., Kamprath, E. J., editors. (1980). The Role of Phosphorus in Agriculture. Madison, Wis: American Society of Agronomy. pp. 411–32.

Harley, J. L., Smith, S. E. (1983). Mycorrhizal symbiosis. London, New York: Academic Press. Paul, E. A., Clark, F. E. (1988). Soil Microbiology and Biochemistry. San Diego, CA: Academic Press Ohtake, H., Wu, H., Imazu, K., Ambe, Y., Kato, J., Kuroda, A. (1996). Bacterial phosphonate degradation,

phosphite oxidation and polyphosphate accumulation. Resources, Conservation and Recycling. 18, 125-34.

McGrath, J. W., Wisdom, G. B., McMullan, G., Lrakin, M. J., Quinn, J. P. (1995). The purification and properties of phosphonoacetate hydrolase, a novel carbon-phosphorus bond- cleaving enzyme from Pseudomonas by Rhizobium huakuii PMY1. Applied and Environmental Microbiology. 64, 356-58.

McGrath, J. W., Hammerschmidt, F. and Quinn, J. P. (1998). Biodegradation of phosphonomycin by Rhizobium huakuii PMY1. Applied and Environmental Microbiology. 64, 356-58.

Boddey, R. M., Dobereiner,J.(1995). Nitrogen fixation associated with grasses and cereals: recent progress and perspectives for the future. Plant and Soil, 108 (Suppl1). 53-65.

Scher, F. M., Baker, R. (1982). Effect of Pseudomonas putida and a synthetic iron chealator on induction of soil suppressiveness to Fusarium wilt pathogens. Phytopathology. 72, 1567– 1573.

Arshad, M., Frankenberger Jr., W. T. (1993). Microbial production of plant growth regulators. In: Blaine, F. Metting, Jr. (Eds.), Soil Microbial Ecology. Marcel and Dekker, Inc., New York. pp. 307-347.

Glick, B. R. (1995). The enhancement of plant growth by free living bacteria. Canadian Journal of Microbiology. 41 (Suppl 2), 109-114.

Khan, A. G. (2005). Role of soil microbes in the rhizosphere of plants growing on trace metal contaminated soils in phtoremediation. Journal of Trace Element in Medicine and Biology. 18, 355-364.

Bais HP, Park SW, Weir TL, Callaway RM, Vivanco JM. How plants communicate using the underground information superhighway. Trends Plant Sci 2004; 9:26-32

Badri DV, Vivanco JM. Regulation and function of root exudates. Plant Cell Environ 2009; 32:666-81. 20. Aulakh MS, Wassmann R, Bueno C, Kreuzwieser J, Rennenberg H. Characteriaztion of root exudates at different

growth stages of ten rice (Oryza sativa L.) cultivars. Plant Biol 2001; 3:139-48. 21. Badri DV, Loyola-Vargas VM, Broeckling CD, De-la-Peña C, Jasinski M, Santelia D, et al. Altered profile of secondary

metabolites in the root exudates of Arabidopsis ATP- binding cassette transporter mutants. Plant Physiol 2008; 146:762-71.

Neumann G, Römheld V. Root excretion of carboxylic acids and protons in phosphorus- deficient plants. Plant Soil 1999; 211:121-30.

Piñeros MA, Magalhaes JV, Carvalho-Alves VM, Kochian LV. The physiology and bio- physics of an aluminum tolerance mechanism based on root citrate exudation in maize. Plant Physiol 2002; 129:1194-206. 25.

Campbell R, Greaves MP. Anatomy and community structure of the rhizosphere. In: Lynch JM, ed. The Rhizosphere. England: John Wiley and Sons Ltd 1990; 11-34.

Valencia-Cantero E, Hernández-Calderón E, Velázquez-Becerra C, López-Meza JE, Alfaro-Cuevas R, López-Bucio J. Role of dissimilatory fermentative iron-reducing bacteria in Fe uptake by common bean (Phaseolus vulgaris L.) plants grown in alkaline soil. Plant Soil 2007; 291:263-73.

Sperberg, J. I. (1958). The incidence of apatite-solubilizing organisms in the rhizosphere and soil. Austalian Journal of Agricultural Research. 9, 778.

Katznelson, H, Peterson, E.A., Rovatt, J. W. (1962). Phosphate dissolving microoganisms on seed and in the root zone of plants. Canadian Journal of Botany. 40, 1181-6.

Raghu, K., MacRae, I. C. (1966). Occurrence of phosphate-dissolving microorganisms in the rhizosphere of rice plants and in submerged soils. Journal of Applied Bacteriology. 29, 582-6.

Alexander, M. (1977). Introduction to Soil Microbiology. New York: Wiley and Sons. Hoon, H., Park, R. D., Kim, Y. W., Rim, Y. S., Park, K. H., Kim, T. H., Such, J. S., Kim, K. Y. (2003). 2-ketogluconic acid

production and phosphate solubilization by Enterobacter intermedium. Current Microbiology. 47, 87-92.

Vazquez, P., Holguin, G., Puente, M. E., Lopez-Cortez, A., Bashan, Y. (2000). Phosphatesolubilizing microorganisms associated with the rhizosphere of mangroves in a semiarid coastal lagoon. Biology and Fertility of Soils. 30, 460-468.

Bar-Yosef B., Rogers, R. D., Wolfram, J. H., Richman, E. (1999). Pseudomonas cepacia mediated rock phosphate solubilization in kaolinite and montmorillonite suspensions. Soil Science Society of American Journal. 63, 1703-1708.

Gupta, R. R., Singal, R., Shanker, A., Kuhad, R. C., Saxena, R. K. (1994). A modified plate assay for secreening phosphate solubilizing microorganisms, The Journal of General and Applied Microbiology. 40, 255-260.

Gaur, A.C. (1990). Physiological functions of phosphate solubilizing micro-organisms. In: Gaur, A.C. (Ed.), Phosphate Solubilizing Micro-organisms as Biofertilizers. Omega Scientific Publishers, New Delhi. pp. 16-72. 47.

Gaur A.C. (1990). Phosphate solubilizing microorganisms as biofertilizers. Omega Scientific Publisher, New Delhi, pp. 176 Banik, S. and Dey, B. K. (1982). Available phosphate content of an alluvial soil as influenced by inoculation of some isolated

phosphate-solubilizing microorganisms. Plant and Soil. 69, 353- 364.9. Banik, S. and Dey B. K. (1983). Phosphate solubilizing potentiality of the microorganisms capable of utilizing aluminium

phosphate as a sole phosphate source. Zentralblatt Fur Mikrobiologie.138, 17-23. Khamna, S., Yokota, A., Lumyong, S. Actinomycetes isolated from medicinal plant rhizosphere soils: diversity and

screening of antifungal compounds, indole-3-acetic acid and siderophore production.World Journal of Microbiology and Biotechnology. 25: 649–655 (2009).

Thangapandian, V. Actinomycetes diversity in the Rhizosphere soil of different medicinal plants in Kolly Hills Termilnadu, India, for secondary metabolite production. Asian Journal of Plant Science. 6: 66-70 (2007).

Thangapandian, V., Ponmurugan, P., Ponmurugan, K. actinomycetes diversity in the Rhizosphere soils of different medicinal plants in Kolly hills tamilnadu, in India for secoundary metabolite production. Asian journal of plant science. 6(1): 66-77 (2007).

Miller, H.J., Henken, G., Van Veen, J.A. Variation and composition of bacterial populations in the rhizospheres of maize, wheat, and grass cultivars. Canadian Journal of Microbiology. 35: 656–660 (1989).

Tian, X., Cao, L., Tan, H., Han, W., Chen, M., Liu, Y., Zhou, S. Diversity of Cultivated and Uncultivated Actinobacterial Endophytes in the Stems and Roots of Rice. Microbial ecology. 53: 700–707 (2007).

Barreto, T.R., augusto, c.m., Da silva, ana cristina, f., Soares, jorge, t., De souza. Population densities and genetic diversity of actinomycetes associated to the rhizosphere of theobroma cacao. Brazilian journal of microbiology. 39: 464-470(2008).

Tian, X., Cao, L., Tan, H., Han, W., Chen, M., Liu, Y., Zhou, S. Diversity of Cultivated and Uncultivated Actinobacterial Endophytes in the Stems and Roots of Rice. Microbial ecology. 53: 700–707 (2007).

Juhnke, M. E., Mathre, D. E., Sands, D. C. Identification and Characterization of Rhizosphere-Competent Bacteria of Wheat, Journal of Applied and Environmental. Microbiology. 53(12): 2793-2799(1987).

Madhurama Gangwar, Sheela Rani and Neerja Sharma. Investigating endophytic actinomycetes diversity from Rice for plant growth promoting and antifungal activity.International journal of advanced life sciences,Vol.1:10-21(2012).

Beever, R. E and Burns, D. J. W. (1980). Phosphorus uptake storage and utilization by fungi. Advances in Botanical Research. 8, 127– 219.

Illmer, P. and Schinner, F. (1992). Solubilization of inorganic phosphates bymicroorganisms isolated from forest soils. Soil Biology and Biochemistry. 24, 389± 395. 67.

Illmer, P., Barbato, A. and Schinner, F. (1995). Solubilization of hardly-soluble AlPO4 with P-solubilizing microorganisms. Soil Biology and Biochemistry. 27, 265±270.

Halder, A. K. and Chakrabartty, P. K. (1993). Solubilization of inorganic phosphate by Rhizobium. Folia Microbiologica. 38, 325-30. Kucey, R. M. N. (1983). Phosphate solubilizing bacteria and fungi in various cultivated and virgin Alberta soils. Canadian Journal of

Soil Science. 63, 671-8. Gugi, B., Orange, N., Hellio, F., Burini, J. F., Guillou, C., Leriche, F., Guespin-Michel, J. F. (1991). Effect of growth temperature on

several exported enzyme activities in the psychrotropic bacterium Pseudomonas fluorescens. Journal of Bacteriology. 173, 3814-20.

Fraga, R. and Rodríguez, H. (1999). Phosphate solubilizing bacteria and their role in plant growth promotion. Biotechnology Advances. 319-339.

Richardson, A. E. and Hadobas, P. A. (1997). Soil isolates of Pseudomonas spp. that utilize inositol phosphates. Canadian Journal of Microbiology. 43, 509-16.

Ohtake, H., Wu, H., Imazu, K., Ambe, Y., Kato, J., Kuroda, A. (1996). Bacterial phosphonate degradation, phosphite oxidation and polyphosphate accumulation. Resources, Conservation and Recycling. 18, 125-34.

McGrath, J. W., Hammerschmidt, F. and Quinn, J. P. (1998). Biodegradation of phosphonomycin by Rhizobium huakuii PMY1. Applied and Environmental Microbiology. 64, 356-58.

Omar, S. A. (1998). The role of rock phosphate solubilizing fungi and vesicular arbuscular mycorrhiza (VAM) in growth of wheat plants fertilized with rock phosphate. World Journal of Microbiology and Biotechnology. 14, 211-219.

Gyaneshwar P., Naresh Kumar, G. and. Parekh, L. J. (1998). Effect of buffering on the phosphate-solubilizing ability of microorganisms. World Journal of Microbiology & Biotechnology. 14, 669±673. 56.

Gyaneshwar, P., Parekh, L. J., Archana, G., Poole, P. S., Collins, M. D., Hutson, R. A., Naresh Kumar, G. (1999). Involvement of a phosphate starvation inducible glucose dehydrogenase in soil phosphate solubilization by Enterobacter asburiae. FEMS Microbiology Letters. 171, 223-229.

Kucey, R. M. N., Jenzen, H. H., Leggett, M. E. (1989). Microbially mediated increases in plant available phosphorus. Advances in Agronomy. 42, 199-228.

Bolan, N. S., Mahimairaja, S., Baskaran, S. (1994). Influence of lowmolecular- weight organic acids on the solubilization of phosphates. Biology and Fertility of Soils. 18, 311-319.

Jones, D.L., nggguyen, C., Finlay, R.D Carbonflow in the rhizosphere: carbon trading at the soil-root interface. Plant soil.321:5-33(2009)

Nahas, E. (1996). Factors determining rock phosphate solubilization by microorganism isolated from soil, World Journal of Microbiology and Biotechnology. 12, 18-23.

Halder, A. K., Mishra, A. K., Bhattacharyya, P., Chakrabartty, P. K. (1990). Solubilization of rock phosphate by Rhizobium and Bradyrhizobium. Journal of General and Applied Microbiology. 36, 81-92. 58.

Halder, A. K. and Chakrabartty, P. K. (1993). Solubilization of inorganic phosphate by Rhizobium. Folia Microbiologica. 38, 325-30. Banik, S. and Dey, B. K. (1982). Available phosphate content of an alluvial soil as influenced by inoculation of some isolated

phosphate-solubilizing microorganisms. Plant and Soil. 69, 353- 364. 9.

Banik, S. and Dey B. K. (1983). Phosphate solubilizing potentiality of the microorganisms capable of utilizing aluminium phosphate as a sole phosphate source. Zentralblatt Fur Mikrobiologie.138, 17-23.

Duff, R. B. and Webley, D. M. (1959). 2-Ketogluconic acid as a natural chelator produced by soil bacteria. Chemistry and Industry. 1376-77.

Chen, Y. P., Rekha, P. D. Arun, A. B. Shen, F. T. Lai, W. A. Young C. C. (2006). Phosphate solubilizing bacteria from subtropical soil and their tricalcium phosphate solubilizing abilities. Applied Soil Ecology. 34, 33-41.

Duine, J.A. (1991). Quinoproteins: enzymes containing the quinonoid cofactor pyrroloquinoline quinone, topaquinone or tryptophan-tryptophan quinone. European Journal of Biochemistry. 200, 271-284.

Kim, K. Y., Mcdonald, G. A, Jordan, D. (1997). Solubilization of hydroxypatite by Enterobacter agglomerans and cloned Escherichia coli in culture medium. Biology and Fertility of Soils. 24, 347-35.

Krishnaraj, P. U. and Goldstein, A. H. (2001). Cloning of a Serratia marcescens DNA fragment that induces quinoprotein glucose dehydrogenase-mediated gluconic acid production in Escherichia coli in the presence of stationary phase Serratia marcescens. FEMS Microbiology Letters. 205, 215–220.

Subba Rao, N. S. (1982).Advances in agricultural microbiology. In: Subba Rao, N. S., editor. Studies in the Agricultura and Food Sciences. London: Butterworth Scientific. pp. 295-303.

Hiraga, K.L, Sheeu M., Kitazawa, S., Takahashi, M., Shimada, R. Sato and K. Oda. (1997). Isolation and characterization of chitinase from a flake- chitin degrading marine bacterium, Aeromonas hydrophila H-2330. Biosci. Biotechnol. Biochem., 61: 174-176.

Shin-Hye, P. and L. Jung- Hyun. (2000). Purification and characterization of chitinase from a marine bacterium, Vibrio sp. 98CJ11027. J. Microbiol., 38: 224-229.

Majewski, R.A. and Domach, M.M. (1990). Simple constrained optimization view of acetate overflow in E. coli. Biotecnology and Bioengineering, 35(7): 732-738.

el-Mansi EM, Holms WH. (1989) Control of carbon flux to acetate excretion during growth of Escherichia coli in batch and continuous cultures. J Gen Microbiol. ;135(11):2875–2883.

Kornberg, H.L. (1966). The role and control of Glyoxylate cycle in E. coli. Biochem. J. 99(1): 1-11. Je-Nie, P. and Joseph, S. (2003) Transcription levels of key metabolic genes are the cause for different glucose utilization pathways in

E. coli B (BL21) and E. coli K (JM109). Journal of Biotechnology, 109(1): 21-30

THANKYOU

biochemical basis for malate over production in actinomycete spp

Documents