by vanessa noemi raileanu - university of toronto t-space · vanessa noemi raileanu master of...
TRANSCRIPT
Characterization of Mesenchymal Stromal Cells Derived from
Human Umbilical Cord Tissue
By
Vanessa Noemi Raileanu
A thesis submitted in conformity with the requirements
for the degree of Master of Science
Graduate Department of Physiology
University of Toronto
© Copyright by Vanessa Noemi Raileanu 2015
II
Characterization of mesenchymal stromal cells derived from human
umbilical cord tissue
Vanessa Noemi Raileanu
Master of Science
Department of Physiology
University of Toronto
2015
Abstract
Mesenchymal stromal cells (MSCs) have emerged as candidates with therapeutic
potential to treat different pathologies. MSCs isolated from the bone marrow are most
commonly used, however, umbilical cord (UC) tissue presents a source that has not been
as extensively studied, yet can be obtained with more ease. Here, we characterize UC-
MSCs obtained from 40 patient samples and conclude that different cell populations have
the same phenotypic profile. TSG-6 has recently been suggested as a biomarker that can
be used in order to predict the in vivo efficacy of different MSC populations, and we
show that within a subset of UC-MSC samples, there are variations in the expression
levels of TSG-6, however this does not correlate with the cytokine secretion profiles or
the wound healing capacity of the cells in a db/db male mouse excisional wound splinting
model.
III
Acknowledgements
I would like to express my gratitude to my supervisor, Dr. Ian Rogers, for giving
me the opportunity to work on this project, for his constant support, knowledge and for
being my mentor. This was an amazing learning experience and it developed and
moulded my scientific mind in many ways. I would like to thank my committee members,
Dr. Armand Keating and Dr. Robert Casper for their support and ideas, helping to shape
my project and encouraging my work. Thank you to Annie and Michael for training me
and answering my numerous flow cytometry related questions and to Jenn and Theresa
for helping with the animal studies. I am grateful to Dr. Brown’s lab, specifically Alex
and Prem, for teaching and guiding me through real-time RT-PCR. Thank you to
Insception LifeBank for providing the umbilical cord samples and to Dr. Sue Mueller for
allocating your time and effort to this task. Everyone at Insception has been incredibly
welcoming, friendly and I am grateful for having had the opportunity to be exposed to the
industry aspect of science. Finally, thank you to my friends who have many times been
the source of laughter throughout the years.
To Eddie, you have always stood by my side and made this experience memorable, I
couldn’t have imagined it without you.
My family has been the roots and source of love, support, understanding, and guidance.
Dad, your worldly advice has been invaluable. Mom, your love of science and vast
amount of knowledge that you garner has been my fuel for learning.
IV
Table of Contents
ACKNOWLEDGEMENTS ....................................................................................................................... III
TABLE OF CONTENTS ........................................................................................................................... IV
LIST OF ABBREVIATIONS .................................................................................................................... VI
LIST OF TABLES ................................................................................................................................... VIII
LIST OF FIGURES .................................................................................................................................... IX
CHAPTER ONE: INTRODUCTION ......................................................................................................... 1
1. INTRODUCTION .................................................................................................................................... 2
1.1 MSCS: STEM OR STROMAL? .................................................................................................................. 2 1.1.1 Pluripotent Stem Cells ................................................................................................................. 2 1.1.2 Stem Cell Nomenclature ............................................................................................................... 8 1.1.3 Tissue Specific Stem Cells ............................................................................................................ 9 1.1.4 Mesenchymal Stem Cells .............................................................................................................10 1.1.5 MSC Immunophenotype ..............................................................................................................12
1.2 IN VIVO IDENTITY................................................................................................................................13 1.2.1 Pericytes ......................................................................................................................................13 1.2.2 Neural Crest Cells .......................................................................................................................15
1.3 SOURCES OF HUMAN MESENCHYMAL STROMAL CELLS ......................................................................16 1.3.1 Embryonic Tissue ........................................................................................................................16 1.3.2 Adult Tissue .................................................................................................................................17 1.3.3 Birth Associated Tissues .............................................................................................................20
1.4 IMMUNOMODULATION .........................................................................................................................25 1.4.1 Innate Immunity ..........................................................................................................................25 1.4.2 Adaptive Immunity ......................................................................................................................28
1.5 WOUND HEALING ................................................................................................................................30 1.5.1 Tissue Repair ..............................................................................................................................30 1.5.2 Diabetic Wound Healing .............................................................................................................32 1.5.3 TSG-6 ..........................................................................................................................................39 1.5.4 Animal Models ............................................................................................................................44 1.5.5 Diabetic Mouse Models of Wound Healing ................................................................................45
1.6 RATIONALE, HYPOTHESIS AND OBJECTIVES .........................................................................50
1.6.1 Rationale .....................................................................................................................................50 1.6.2 Hypothesis and Objectives ..........................................................................................................50
CHAPTER TWO: EXPERIMENTAL METHODS AND MATERIALS ..............................................52
2. EXPERIMENTAL METHODS AND MATERIALS...........................................................................53
2.1 UMBILICAL CORD COLLECTION AND PREPARATION ............................................................................53 2.2 MSC ISOLATION ..................................................................................................................................53 2.3 CELL CULTURE ....................................................................................................................................56 2.4 CRYOPRESERVATION ...........................................................................................................................56 2.5 FLOW CYTOMETRY ANALYSIS .............................................................................................................56 2.6 RNA EXTRACTION AND REAL-TIME PCR ...........................................................................................59 2.7 CYTOKINE ARRAY ...............................................................................................................................61
2.7.1 Array Procedure .........................................................................................................................61 2.7.2 Data Analysis ..............................................................................................................................65
2.8 EXCISIONAL MURINE MODEL ..............................................................................................................65 2.8.1 Surgical Procedure .....................................................................................................................65 2.8.2 Wound Analysis ...........................................................................................................................66 2.8.3 Tissue Collection and Fixation ...................................................................................................68
V
2.8.4 Immunohistochemistry ................................................................................................................68 2.9 STATISTICAL ANALYSIS .......................................................................................................................69
CHAPTER THREE: RESULTS ................................................................................................................70
3. RESULTS .................................................................................................................................................71
3.1 MSC ISOLATION EFFICIENCY AND EXPLANT CULTURE .......................................................................71 3.2 MSC IMMUNOPHENOTYPE ...................................................................................................................75 3.3 MSC WOUND HEALING EFFICIENCY ...................................................................................................83
3.4 TSG-6 Expression ..........................................................................................................................85 3.5 Cytokine Secretion Analysis ...........................................................................................................88
3.6 MURINE EXCISIONAL WOUND HEALING ..............................................................................................91
CHAPTER FOUR: DISCUSSION ...........................................................................................................104
4. DISCUSSION .........................................................................................................................................105
4.1 CHANGES IN MSC PROFILE WITH CULTURE .......................................................................................105 4.2 PARACRINE SIGNALLING ...................................................................................................................107 4.3 DIABETES COMPLICATIONS ...............................................................................................................111 4.4 TSG-6 AND WOUND HEALING ...........................................................................................................112
5. CONCLUSION AND FUTURE STUDIES .........................................................................................121
6. REFERENCES ......................................................................................................................................123
VI
List of Abbreviations
Alpha-MEM Alpha minimum essential medium
AP-1 Activator protein 1
APC Antigen presenting cells
APC Allophycoerythrin
BM-MSC Bone marrow mesenchymal stromal cells
CCL5 Chemokine (C-C motif) ligand 5
CD Cluster of differentiation
CFU-F Colony forming until-fibroblastoid
CT Cord tissue
CXCL Chemokine (C-X-C motif) ligand
DC Dendritic cells
DMEM Dulbecco's modified eagle's medium
EGF Epidermal growth factor
ES cell Embryonic stem cell
FGF-basic Fibroblast growth factor-basic
FGF-4 Fibroblast growth factor-4
FITC Fluorescein isothiocyanate
FS Forward scatter
FS TOF Forward scatter time of flight
GAGs Glycosylaminoglycans
GM-CSF Granulocyte-macrophage colony-stimulating factor
GvHD Graft-versus-host
HA Hyaluronic acid
HGF Hepatocyte growth factor
HSCs Hematopoietic stem cell
HUCPVCs Human umbilical cord perivascular cells
ICAM-1 Intercellular adhesion molecule 1
ICM Inner cell mass
IDO Indolemine 2,3-dioxygenase
IFN-γ Interferon gamma
IGF-1 Insulin-like growth factor 1
IL Interleukin
ISCT International Society for Cellular Therapy
LIF Leukemia inhibitory factor
LPA Lipoaspirate
MHC Major histocompatibility complex
MIF Migration inhibitory factor
MIP Macrophage inflammatory protein
MMPs Matrix metalloproteinases
MPSC Multi-potential stem cell
MSCs Mesenchymal stromal cells
NF-IL6 Nuclear factor IL-6
NF-κB Nuclear factor-κB
NK Natural killer
VII
PE Phycoerythrin
PerCP-Cy5.5 Peridin chlorophyll protein-cyanine 5.5
PGE-2 Prostaglandin E2
PBLs Peripheral blood leukocytes
PBS Phosphate buffered saline
RIN RNA integrity number
SCF Stem cell factor
SS Side scatter
SSEA-3 Stage specific embryonic antigen-3
SSEA-4 Stage specific embryonic antigen-4
SS TOF Side scatter time of flight
STZ Streptozoicin
TGF-β Transforming growth factor-β
TLR Toll-like receptor
TNF-α Tumour necrosis factor alpha
TSG-6 Tumor necrosis factor-stimulated gene 6
UCT Umbilical cord tissue
UCB Umbilical cord blood
VCAM-1 Vascular cell adhesion molecule 1
VEGF Vascular endothelial growth factor
vWF von Willebrand factor
VIII
List of Tables
Table 1: Antibodies and fluorochromes used to analyze UCT-MSCs. ............................. 58
Table 2: Real time RT-PCR Primer Sequences. ............................................................... 60
Table 3: Cytokines detected in the array kit. .................................................................... 63
Table 4: Personal data collected for each cord sample. .................................................... 73
Table 5: Growth characteristics of individual cord samples. ............................................ 74
Table 6: RNA integrity analysis for a subset of UCT-MSCs analyzed for TSG-6 mRNA
expression levels. .............................................................................................................. 86
IX
List of Figures
Figure 1: Developmental Potential. .................................................................................... 7
Figure 2: Stages of wound healing.................................................................................... 37
Figure 3: MSC anti-inflammatory effects are mediated through TSG-6. ......................... 43
Figure 4: Explant culture of human umbilical cord samples. ........................................... 55
Figure 5: Wound healing calculations. ............................................................................. 67
Figure 6. Time to cell outgrowth for 40 UCT-MSC samples. .......................................... 75
Figure 7. Cell number obtained at first passage for 9 UCT-MSC samples. ..................... 76
Figure 8. Cell number obtained at each passage for three MSC populations. .................. 77
Figure 9: Colour density plots of CT16, CT24, and CT15 at early, mid and late analysis.
........................................................................................................................................... 80
Figure 10: Percent of cells illustrating expression of hematopoietic and stromal markers
at early, mid, and late analysis for 20 samples analyzed at each passage. ........................ 82
Figure 11: Percent of cells illustrating expression of hematopoietic and stromal markers
at early, mid, and late analysis for 40 samples analyzed at early passage and 20 cord
tissues analyzed at mid and late passages. ........................................................................ 83
Figure 12: Variable TSG-6 mRNA expression among a subset of UCT-MSC samples. . 86
Figure 13: TSG-6 mRNA correlation with maternal age and newborn weight. ............... 87
Figure 14: Cytokine secretion profiles of CT15 expressing low TSG-6 mRNA, CT16
expressing high TSG-6 mRNA, and CT24 illustrating no TSG-6 mRNA expression. .... 89
Figure 15: Wound closure analysis. .................................................................................. 94
Figure 16: Wound bed histology for CT16-treated mice. ................................................. 96
Figure 17: Wound bed histology for CT15-treated mice. ................................................. 98
Figure 18: Wound bed histology for control mice. ......................................................... 100
Figure 19: Wound bed immunohistochemistry for CT-16 treated mice. ........................ 102
Figure 20: Wound bed immunohistochemistry for CT-15 treated mice. ........................ 103
X
Figure 21: Wound closure analysis illustrating different interpretations........................ 119
Figure 22: CT15-treated mouse wound healing calculations excluded for days 7, 10, and
14..................................................................................................................................... 120
Chapter One: Introduction
2
1. Introduction
1.1 MSCs: stem or stromal?
1.1.1 Pluripotent Stem Cells
The defining characteristics of pluripotent stem cells include the ability to differentiate
into any cell type after unlimited cell renewal in the stem cell state. This is best illustrated
by their ability to contribute to all tissues of the mouse when pluripotent stem cells are
incorporated into aggregation chimeras (Puri & Nagy, 2012). Some of the first studies
done on pluripotent stem cells were on cells derived from mouse teratocarcinomas in
which the tumour was seen to contain stem cells, known as embryonal carcinoma cells (G.
R. Martin & Evans, 1975). These cells were observed to exhibit pluripotency,
differentiating to form the endoderm, mesoderm, as well as the ectoderm (G. R. Martin &
Evans, 1975). After in vitro culturing under a defined set of medium conditions, the
embryonal carcinoma cells were seen to form keratinizing epithelium, endodermal cysts,
fibroblasts, cartilage, adipose tissue, beating muscles, pigmented cells, and neural cells
(G. R. Martin & Evans, 1975). As such, pluripotent cells can be stimulated under
different culture conditions to differentiate into various cell types. Since that time,
pluripotent stem cells have classically been obtained from the foetus. Mammalian
development begins when an oocyte is fertilized by a sperm, forming a single cell embryo,
the zygote. The zygote is totipotent, as it can give rise to an embryo with all the cells
needed to form an organism, as well as the placenta which is vital for fetal development
(Mitalipov & Wolf, 2009). As a result, each cell that is considered totipotent can give rise
to a whole organism, and this is said to be true until the four cell stage embryo in humans
(Figure 1) (Mitalipov & Wolf, 2009). Mammalian embryogenesis begins with a set of
3
cleavage divisions to generate a population of blastomeres, which eventually undergo
cellular differentiation followed by the segregation of the different developmental
lineages, compaction and formation of the blastocyst (Nichols et al., 1998). The
trophectoderm, the outer layer of cells of the blastocyst, forms the trophoblast and
components of the placenta, whereas the inner cell mass (ICM) of the blastocyst gives
rise to non-trophoblast extraembryonic tissues and of all fetal cell types, including germ
cells (Nichols et al., 1998). The ICM becomes more differentiated eventually giving rise
to all three germ layers (endoderm, mesoderm, and ectoderm). This cell population is
considered to be pluripotent, because it can form cells of the three germ layers, having the
capacity to give rise to any fetal and adult cell type (Mitalipov & Wolf, 2009). The
pluripotent cell state of the ICM does not exist for a prolonged period of time, however,
the pluripotent cells found in the ICM can be isolated as embryonic stem cells (ES) from
the blastocyst, obtained from the pre-implantation embryo (Boroviak, Loos, Bertone,
Smith, & Nichols, 2014; Takahashi & Yamanaka, 2006). As a result, human pluripotent
stem cells include human embryonic stem cells and induced pluripotent stem cells. ES
cells were first isolated from the ICM of the 129 SvE strain mouse by Evans and
Kaufman in 1981, and also by Martin in that same year from early blastocysts obtained
by mating random bred ICR female mice with SWR/J males (Evans & Kaufman, 1981; G.
R. Martin, 1981). The derived ES cell lines exhibited the ability to proliferate, divide
indefinitely, differentiate into cells of the three germ layers (Mitalipov & Wolf, 2009). In
the mouse, ES cells are obtained from ICM of the late blastocyst at 4 days post coitum,
and are often maintained in media with the addition of leukemia inhibitory factor (LIF),
fetal calf serum, and feeder layers, and hence can be passaged indefinitely without
4
differentiation (Tang et al., 2010). However, different mouse strains have a different
efficiency in establishing ES cell lines. The 129/Sv strain is most often used. ES cell lines
that have been used in the past include CCE, D3, and E14, which have been derived from
the 129/Sv strain (Kawase et al., 1994). The 129/Sv strain exhibits a high incidence of
spontaneous testicular teratomas as well as teratocarcinomas, and as a result, this strain
has been used as a source of embryonic carcinoma cell lines as well (Kawase et al., 1994).
Many ES cell lines have also been obtatined from the C57BL/6 strain as well as the
BALB/c strain, however BALB/c strain shows a lower efficiency in establishing ES cell
lines (Kawase et al., 1994). It has been shown that live offspring can be obtained from
mice derived completely from ES cells. Nagy et al. (1993) established ES cell lines from
crossing chinchilla 129 Sv females with agouti 129/Sv-CP males. One cell line, called R1,
was used to create an ES cell tetrapolid aggregate and was able to produce offspring that
were entirely ES cell derived (Nagy, Rossant, Nagy, Abramow-Newerly, & Roder, 1993).
This was validated by coat colour, which showed only agouti contribution and no
tetroploid cells, from albino mice, were found in the blood of the mice derived entirely
from ES cells (Nagy et al., 1993). Earlier passages of the R1 cell line (up to passage 14)
yielded more robust results. Even with permissive strains, only about 30% of the embryos
gave rise to stable mouse ES cell lines (Czechanski et al., 2014). Strains that are known to
be non-permissive include CBA, NOD, and DBA, however, protocols have started to
become available describing the derivation of mouse ES cell lines even from non-
permissive strains (Czechanski et al., 2014).
Human embryonic stem cells are obtained from the ICM by removing the outer
trophectoderm layer (Reubinoff, Pera, Fong, Trounson, & Bongso, 2000). Human
5
embryonic stem cell lines were first obtained in 1998 by Thomson et al. from human
embryos, produced by in vitro fertilization, from the ICM of the embryos cultured until
the blastocyst stage (Thomson et al., 1998). The cells were able to differentiate in vitro
without the addition of mouse embryonic fibroblast feeder layers, both in the presence
and absence of human leukemia inhibitory factor (Thomson et al., 1998). The established
cell lines expressed surface markers stage-specific embryonic antigen (SSEA)-3 and
SSEA-4, which are not present on mouse ES cells, which express SSEA-1 (Thomson et
al., 1998). Other markers found on human ES cell lines include TRA-1-60, TRA-1-81,
and alkaline phosphatase (Thomson et al., 1998). The ES cell lines derived by Thomson
et al. were maintained in culture for 4 to 5 months (passages 14 to 16) and injected into
severe combined immunodeficient (SCID)-beige mice. Teratoma formation was noted in
these mice and differentiated cells from all three embryonic germ layers (endoderm,
mesoderm, and ectoderm) could be identified within the tumors (Thomson et al., 1998).
Differentiated tissues in the teratomas included cartilage, squamous epithelium, primitive
neuroectoderm, anaglionic structures, muscle, bone, and glandular epithelium (Reubinoff
et al., 2000). Stem cell lines from human blastocysts have been shown to be similar to
mouse ES cells derived from post-implantation mouse epiblast cells, referred to as EpiSC.
These mouse epiblast cells have been shown to be propagated using conditions used for
human ES cell culture (Tesar et al., 2007). Human ES cells are larger in size and grow as
a monolayer, and EpiSCs grow in a similar fashion, rather than exhibiting growth typical
of mouse ES cells; small, compact, and form domed colonies (Tesar et al., 2007).
Additionally, human ES cells lack a response to leukemia inhibitory factor and
differentiation of human ES cells is seen to occur rapidly, regardless if the cells are
6
deprived of a feeder layer, even in the presence of LIF (Reubinoff et al., 2000). On the
other hand, for mouse ES cells, it has been shown that LIF is required for maintenance of
the cells in an undifferentiated state.
7
Figure 1. Developmental potential of cells within an organism. The zygote, 2-cell stage,
and 4-cell stage are considered totipotent, whereas the blastocyst is considered
pluripotent and the embryo, fetus, infant, adult and elderly contain multipotent and
unipotent cells. (Mitalipov, S., & Wolf, D. (2009)).
Figure 1: Developmental Potential.
8
1.1.2 Stem Cell Nomenclature
The use of the term stem cell dates back to the 19th century, where it was used
specifically in the context of the embryo (Maehle, 2011). Although the term stem cell is
widely applied in the literature today, there is a disparity in the scientific community as to
the definition and cell type used to characterize a true stem cell. Classically, the term is
used to define a cell which can divide and proliferate indefinitely without differentiation,
can form all three embryonic germ layers under appropriate stimulation and can also
repopulate a tissue in vivo. However, this nomenclature has not been vigorously applied.
For example, the term stem cell has been used for many decades when describing the
process of hematopoiesis, referring to a cell that can sustain the development of blood
cells, namely hematopoietic stem cells (HSCs) (Dykstra et al., 2007; Ramalho-Santos &
Willenbring, 2007). However, even though this small subpopulation of cells are termed
'stem cells', they are multi-potent, having the ability to differentiate into cells of the blood
system, rather than being pluripotent (Seita & Weissman, 2010). HSCs hence possess the
potential for both multi-potency as well as self-renewal. Consequently, they may also be
termed non-pluripotent stem cells, or progenitor cells, as the term progenitor cells is
assigned to blood stem cells which have started to differentiate into a lymphoid and
myeloid progenitor cell (Young et al., 2001). As a result, there is a difference between
lineage-committed progenitor stem cells and lineage-uncommitted pluripotent stem cells
(Young et al., 2001). Animals that have been lethally irradiated suffer from bone marrow
failure, however, injections of non-irradiated bone marrow cells are capable of
reconstituting the whole immune system, hence saving the lives of these mice (Spangrude,
Heimfeld, & Weissman, 1988). Overall, the term 'stem cell' has evolved and expanded
9
from its original rigid definition, and now encompasses different stem cell populations,
such as totipotent stem cells termed "zygote", pluripotent stem cells such as induced
pluripotent stem cells and ES cells, and unipotent macrophage progenitors (Seita &
Weissman, 2010).
1.1.3 Tissue Specific Stem Cells
Most tissues are mainly composed of mature cell types which are terminally
differentiated, however also present is a small subpopulation of stem cells specific to
each tissue, such as haematopoietic, neural, gastrointestinal, epidermal, hepatic, and
mesenchymal stem cells (Jiang et al., 2002). The role of these tissue specific stem cells is
to act as a reservoir of replenishing cells that maintain the tissue. When compared with
ES cells, tissue specific stem cells have less self-renewal ability and pluripotency is not
exhibited, even though they differentiate into multiple lineages (Jiang et al., 2002). The
prototypical tissue specific stem cell, and also the best studied due to its early isolation, is
the hematopoietic stem cell mentioned earlier (Bryder, Rossi, & Weissman, 2006). Other
examples include mesenchymal stem cells, however, very few studies have shown that
isolated mesenchymal stem cell populations are true stem cells. Some have reported that
purification of cell populations from the bone marrow (BM) yields mesenchymal stem
cells as well as a subset of more immature cell types, exhibiting the capacity to
differentiate into cells of mesenchymal origin, visceral mesoderm, neuroectoderm and
endoderm (Jiang et al., 2002). Some have shown that there are clonal populations of stem
cells in the connective tissues of post-natal animals, where the clones consist of
pluripotent mesenchymal stem cells (Young et al., 2001). Moreover, others have reported
that when mice have been bone marrow ablated, donor mesenchymal stem cells first
10
replace a portion of the mesenchymal stem cells in the bone marrow of the recipient mice
(Prockop, 1997). The results from this study suggest that the progeny of mesenchymal
stem cells acquire the phenotypes of different target tissues before they leave the marrow
or after they have entered the microenvironment of specific tissues. Overall, there seems
to be only a very limited number of studies that have been done to date which have
shown and proven the fact that there are stem cells present within isolated mesenchymal
stem cell populations. The method that is used for this task is limiting dilution techniques
for clonal analysis.
1.1.4 Mesenchymal Stem Cells
The concept of mesenchymal stem cells dates back to the 19th century, where it was
shown that ectopic bone, marrow, and fibrous tissue formed when bone marrow was
placed in mice, in a different tissue from that of origin (Bianco, Robey, & Simmons,
2008). The population of cells had osteogenic potential and hence were termed
osteogenic stem cells. In the 1960's and 1970's, Freidenstein and coworkers conducted a
set of experiments, which identified these BM stromal and osteogenic stem cells by
isolating fibroblast colonies from the BM and spleen of guinea pigs. When these cells
were placed in diffusion chambers in vitro, at the right density, bone formation was
observed (Friedenstein, Chailakhjan, & Lalykina, 1970). The fibroblasts were seen to
form discrete colonies derived from a single cell, and hence were called colony forming
unit-fibroblastoid cells, or CFU-F (Friedenstein et al., 1970). These experiments
established and solidified that there existed a non-hematopoietic cell population in the
BM, which supported the process of hematopoiesis, were able to differentiate to bone and
also form colonies derived from single cells in tissue culture (Friedenstein et al., 1970). In
11
the 1990's, Arnold Caplan derived the term mesenchymal stem cells, and this
nomenclature is frequently used and engrained in the scientific literature today.
Nevertheless, data to support the identity of mesenchymal cells as true stem cells are
sparse and controversial. Clonal self-renewal and multi-lineage differential potential are
two classifications that encompass the definition of a "stem cell." In tissues, there are a
limited number of mesenchymal cells that are specifically stem cells, as a result, clonal
self-renewal has been difficult to prove with robust and reproducible experiments
(Sarugaser, Hanoun, Keating, Stanford, & Davies, 2009). Moreover, clonal populations
of cells have not been shown to be derived from a single cell. Another criterion
encompassing the term stem cell is the ability to differentiate to multiple lineages.
Mesenchymal stem cells have been shown to differentiate into the classical tri-lineage
pathway, however, differentiation into other cell types, such as skeletal muscle,
myocardium, and tendon has not yet been proven with robust evidence (Bianco et al.,
2008). Although some studies have illustrated the ability of mesenchymal stem cells to
differentiate into cells other than osteoblasts, chondrocytes and adipocytes, the capacity
of the cells to do this are not widely accepted by everyone in the scientific community
and are cited to be merely artefacts of culture conditions not exhibiting any functional
capacity. Lastly, due to the fact that bone and muscle are derived from different
progenitors in the developing foetus, there is uncertainty as to whether there is a common
post-natal mesenchymal progenitor cell (Nombela-Arrieta, Ritz, & Silberstein, 2011). As
a result, caution should be taken in regards to the nomenclature of these cells, more
specifically, when using the term stem cell to describe an isolated mesenchymal cell
population, as this may lead to misconceptions about their "stemness." The International
12
Society for Cellular Therapy (ISCT) has suggested that even though the acronym MSCs
is used, the term stromal, rather than stem, should be applied (Keating, 2012). As a result,
the term "stromal" rather than "stem", will be used for this project, as a
heterogeneous population of cells were isolated and the true stem cell identity of this
population was not a focus of the study, and hence was not proven.
1.1.5 MSC Immunophenotype
Amongst confusion in the scientific community about which cells constitute
mesenchymal stromal cells (MSCs) and a lack of standardized criteria to define MSCs in
vitro, the ISCT has proposed a set of minimal criteria by which to phenotypically identify
mesenchymal stromal cells: (1) cells must adhere to plastic under standard culture
conditions, (2) must express CD105, CD73, and CD90, and lack expression of CD45,
CD34, CD14 or CD11b, CD79a or CD19, and HLA-DR, and (3) differentiate into
osteocytes, adipocytes and chondrocytes in vitro (Karp & Leng Teo, 2009; Lv, Tuan,
Cheung, & Leung, 2014). Unfortunately there is no single antigen which is MSC specific,
and which can be used to select for MSCs. The markers provided by the ISCT are
expressed on a variety of other cell types, especially blood cells. Surface antigen
characterization of expanded MSC cultures has shown the expression of CD44, CD71,
CD51, CD106, and STRO-1 (Chamberlain, Fox, Ashton, & Middleton, 2007; Phinney &
Prockop, 2007). However, different groups use various isolation methods and culture
conditions for MSCs, and as a result, the cells usually represent a heterogeneous
population, expressing different variations as well as levels of these markers. MSCs
isolated from different tissues and species do not all express the same molecules and may
have slightly different properties (Chamberlain et al., 2007). This may cause some
13
variation in the immunophenotype stated by the ISCT. For example, MSCs isolated from
human adipose tissue initially express CD34, and this marker is also expressed on murine
MSCs (Meirelles Lda, Fontes, Covas, & Caplan, 2009). Discrepancies in marker
expression have also been shown in MSCs isolated from different compartments of the
bone marrow; MSCs isolated from endosteal or stromal niche in the bone marrow have
been shown to express Oct-4 and Nanog, which are both nuclear markers, and SSEA-4,
which is a surface marker widely used to identify embryonic stem cells (Bara, Richards,
Alini, & Stoddart, 2014). However, these markers have not been shown to be expressed
on MSCs obtained from perivascular locations (Bara et al., 2014). Overall, even though
there is a consensus regarding the cell surface identity of MSCs, cells have been shown to
be phenotypically heterogeneous and marker profiles of each isolated MSC population
should be studied individually.
1.2 In Vivo Identity
1.2.1 Pericytes
The in vivo identity of MSCs has not yet been fully elucidated and is still an area of
question and debate. In tissues, MSCs are a rare cell population present in low numbers,
thus making their study and identification difficult (Nombela-Arrieta et al., 2011). The
exact numbers and frequencies of MSCs in tissues are difficult to determine due to
various isolation methods and culture techniques, however, in the bone marrow it has
been estimated that MSCs are found at a frequency of 0.001%-0.01% of the total
nucleated cells, and hence are found 10-fold less than HSCs (Bernardo, Locatelli, &
Fibbe, 2009). It has also been shown that especially for the BM, the frequency of MSCs
declines with age, from 1/10,000 nucleated marrow cells in a newborn to about
14
1/1,000,000 nucleated marrow cells in an 80-year-old-person (Bernardo et al., 2009).
This has also been shown for adipose tissue derived mesenchymal stem cells (Alt et al.,
2012). However, there have been several hypotheses as to the presumed in vivo identity
of MSCs. One of these theories postulates that MSCs in vivo may be derived from
pericytes (Lv et al., 2014). There are many reports describing a perivascular niche for
MSCs, where the cells have been proposed to lie on the basement membrane opposed to
endothelial cells (da Silva Meirelles, Caplan, & Nardi, 2008; Lv et al., 2014). This
observation is supported by the fact that MSCs are usually isolated from arterial or
venous walls (da Silva Meirelles et al., 2008). However, MSCs have also been obtained
from capillaries, post-capillary venules, arteries, and veins, whereas "pericyte" refers only
to cells in capillaries or post-capillary venules (Nombela-Arrieta et al., 2011).
Nevertheless, pericytes have been shown to display features similar to those exhibited by
MSCs, expressing the same surface antigens and having multi-lineage differentiation
potential into cells of mesenchymal origin, specifically osteocytes, chondrocytes and
adipocytes. Other hypotheses that have arisen are that pericytes represent an ancestor cell
of MSCs or that they represent a distinct MSC cell subset (Bara et al., 2014). It should be
noted that even though several cell characteristics can be obtained from in vitro cultures,
the results obtained should not be extrapolated to the in vivo identity of the cells, as the
properties of MSCs may be altered by various culture conditions. Isolation of cells from
the same source has yielded varying results in regards to phenotype, proliferation, and
differentiation capabilities. Hence in vitro characteristics of MSCs may only be induced
by specific culture conditions rather than being a direct reflection of their true in vivo
identity.
15
1.2.2 Neural Crest Cells
Another developmental origin of MSCs has been suggested to be the neural crest. In the
embryonic lineage, neural crest derived from the ectoderm gives rise to an astonishing
array of cells and tissues, including vascular smooth muscle cells in the central nervous
system as well as the thymus, whereas mural cells found in the coleomic organs,
specifically the gut, lung, and liver, are all derived from the mesoderm and mesothelium
(Armulik, Genove, & Betsholtz, 2011). This indicates a process whereby mesothelial
cells undergo an epithelial-to-mesenchymal-transition, delaminate, and migrate into the
organs to produce mesenchymal components, including fibroblasts, vascular smooth
muscle cells, and pericytes (Armulik et al., 2011). The hypothesis that MSCs arise from
the neural crest originates from the observation that MSCs have been shown to
differentiate to neuronal and glial cells. In the developing embryo, the neural crest arises
as a multipotent stem cell population, which forms at the interface between the
neuroepithelium and the future epidermis of the developing embryo (Mayor & Theveneau,
2013). Neural crest cells are derived from the ectoderm, and it has been shown that the
cells are able to form and contribute to many different cell types, which can be sub-
divided into four main categories (Gilbert, 2000). The cranial neural crest cells
differentiate into cartilage, bone, glia, and connective tissue of the face, the trunk neural
crest cells differentiate into either pigment synthesizing melanocytes, or sympathetic
ganglia, the adrenal medulla, and the nerves of the aorta (Gilbert, 2000). The vagal and
sacral neural crest cells form the parasympathetic ganglia of the gut, and finally, the
cardiac neural crest gives rise to the melanocytes, neurons, cartilage, and connective
tissues, as well as the entire musculoconnective tissue wall of the heart (Gilbert, 2000).
Markers that are used to uniquely identify neural crest cells, such as Twist, p75NTR,
16
Snail1, Snail2, Sox9, and Mpz, were also found on isolated murine MSCs (Morikawa et
al., 2009). This suggests that MSCs may have a neural crest origin. Another marker,
called nestin, has been used to group MSCs into two cell populations, each exhibiting
different developmental fates. MSCs lacking nestin expression, found within the
developing bone marrow of long bones, contribute to the developing bones of the fetus,
and soon after lose MSC identity (Isern et al., 2014). Nestin positive MSCs, identified by
GFP expression under the control of the nestin promoter, help maintain the hematopoietic
niche of the perinatal bone marrow and do not participate in osteochondral development
in the fetus. These cells have also been shown to originate from the neural crest (Isern et
al., 2014).
1.3 Sources of Human Mesenchymal Stromal Cells
1.3.1 Embryonic Tissue
It has been proposed that MSCs can be isolated from fetal and most postnatal tissues.
MSCs have classically been obtained from the BM, however, this procedure is invasive,
can lead to infections and incur pain, hence alternative sources of MSCs have been
investigated, such as fetal tissues or the umbilical cord (UC). Embryonic MSCs have
been shown to originate mainly from the neuroepithelium as well as the neural crest,
appearing by mid-gestation (Hu et al., 2003; Uccelli, Moretta, & Pistoia, 2008). First
trimester fetal MSCs have been derived from liver, blood, as well as the bone marrow and
it has been shown that these cells exhibit similar characteristics to adult MSCs
(Campagnoli et al., 2001). The morphologic, immunophenotypic, and functional
characteristics of fetal derived MSCs are similar to those found in adult tissues
(Campagnoli et al., 2001). However, others have suggested that the differentiation
17
capacity of fetal derived MSCs differs based on the tissue source. MSCs isolated from 20
week foetuses showed that while bone marrow, liver, lung, and spleen derived MSCs
were able to differentiate into adipocytes, MSCs isolated from the spleen had a lower
potential of differentiation into this cell type, while the bone marrow, lung and liver
showed a significantly higher osteogenic differentiation (in 't Anker et al., 2003). Second
trimester fetal MSCs have also been obtained from the fetal lung (in 't Anker et al., 2003).
In addition, MSCs have been cultured from fetal pancreas, which have been shown to be
able form CFU-F (Hu et al., 2003). MSCs isolated from fetal pancreatic tissue mainly
express CD44, CD29, and CD13, but not HLA-DR or von Willebrand factor (vWF) (Hu
et al., 2003). These cells are able to differentiate into the tri-lineage pathway (Hu et al.,
2003). Single cell suspensions of MSCs derived from the lung, liver, spleen and bone
marrow from week 20 foetuses express CD90, CD105, CD166, and CD73, and are
negative for hematopoietic markers CD45, CD14, and CD31 (in 't Anker et al., 2003).
Overall, fetal derived MSCs have been proven to express the classical MSC marker
profile and show tri-lineage differentiation. Varying results among some studies in
regards to differentiation potential suggests differences in isolation or culturing methods
from these sources.
1.3.2 Adult Tissue
Bone Marrow
Adult sources of MSCs are mostly commonly isolated from the bone marrow, which
were initially identified by Freidenstein and are the most common studied cell source. In
the bone marrow, MSCs are found in the stromal compartment, where they support
haematopoiesis. Another function of BM-MSCs has been suggested to be related to the
18
development, stabilization, and maintenance of the sinusoidal network in the BM (Bianco
et al., 2008). BM-MSCs have also been shown to be committed, but not differentiated,
osteogenic progenitors (Bianco et al., 2008). MSCs are isolated usually by density
gradient centrifugation, to remove unwanted cell types such as hematopoietic cells, from
bone marrow aspirates obtained from the iliac crest. MSCs have been shown to have a
characteristic fibroblast morphology when cultured, expressing alpha-smooth actin,
CD105 (SH2), CD73 (SH3), and SH4, CD106, CD120a, VCAM-1, vWF, cytokeratins,
and extracellular matrix proteins such as fibronectin, vimentin, collegen I and collagen IV,
and are negative for CD1a, CD14, CD31, CD45, and CD56 (Conget & Minguell, 1999;
Pittenger et al., 1999). BM-MSCs are able to differentiate into chondrogenic, adipogenic
and osteogenic lineages under specific culture conditions (Pittenger et al., 1999).
However, cells isolated from the bone marrow have a low cell yield, and the older age of
volunteers are not ideal (Choudhery et al., 2012). Although the effects of advanced age
on MSCs have been controversial, previous work suggests that cell populations undergo
changes when obtained from donors of advanced age, as the expression of surface makers,
CD44, CD90, CD105, and Stro-1 were found to undergo age-related changes (Stolzing,
Jones, McGonagle, & Scutt, 2008). Overall it has been shown that there are various age
related changes to MSCs when obtained from the bone marrow. Furthermore, there is
only a small frequency of MSCs present within the bone marrow, with reports suggesting
that only about 0.001 to 0.01% of cells isolated are MSCs (Pittenger et al., 1999).
Adipose Tissue
Another source of MSCs has been adipose tissue, which has been suggested to be
superior to bone marrow, due to the fact that it is a more convenient source of cells, as the
19
tissue can be harvested in large amounts, with a less invasive procedure (Choudhery et al.,
2012; Fraser, Wulur, Alfonso, & Hedrick, 2006). More specifically, three types of
surgical procedures are used for adipose tissue harvesting; surgical resection, tumescent,
or conventional liposuction and ultrasound assisted liposuction (Oedayrajsingh-Varma et
al., 2006). Cells are usually obtained from the tissue by enzymatic digestion with
collagenase (Hass, Kasper, Bohm, & Jacobs, 2011). It has been reported that all
procedures result in little patient discomfort and low donor site morbidity
(Oedayrajsingh-Varma et al., 2006). The most common source for adipose tissue is the
abdomen or thigh regions, due to the abundance of subcutaneous adipose tissue and high
yield of cells (Schreml et al., 2009). Some studies have suggested that there is a higher
yield of MSCs from the abdomen than from the hip and thigh regions, whereas others
have stated approximately equal cell yield from the lower abdomen and inner thigh
(Schreml et al., 2009). Another harvesting site which can be used, although not as
common, is the infrapatellor Hoffa's fat pad (Schreml et al., 2009). The MSCs isolated
from adipose tissue, most often referred to as processed lipoaspirate (LPA) cells or
adipose derived stem cells, are similar to those obtained from bone marrow, however
some differences exist between the two cell populations. BM-MSCs as well as those
obtained from adipose tissue both exhibit homogeneity in cell morphology, size, as well
as granularity (Choudhery et al., 2012; De Ugarte et al., 2003). It has been shown that
LPA cells express surface markers CD13, CD29, CD44, CD58, CD90, CD105, and
CD166, and do not demonstrate expression of the epitopes CD14, CD19, CD31, and
CD45 (De Ugarte et al., 2003). Several studies have suggested that CD106 (VCAM-1) is
found to be expressed on BM-MSCs but not on LPA cells (De Ugarte et al., 2003; Hass et
20
al., 2011). Differences in expression of other markers, such as CD49d have also been
noted (De Ugarte et al., 2003). Several studies have demonstrated the ability of the cells
to undergo adipogenic, chondrogenic, osteogenic, as well as myogenic differentiation
(Choudhery et al., 2012; Fraser et al., 2006; Rodriguez, Elabd, Amri, Ailhaud, & Dani,
2005). In comparison to other cell sources, MSCs obtained from adipose tissue have been
shown to differentiate into more mature and larger adipocytes (Choudhery et al., 2012).
LPA cells have been shown to have a higher population doubling time as well as exhibit a
lower percentage of cells undergoing senescence during earlier passages when compared
with BM-MSCs (Kern, Eichler, Stoeve, Kluter, & Bieback, 2006). Many studies indicate
that adipose tissue can be used as an alternative and valuable source of MSCs.
Other sources
Other sources of adult derived MSCs include peripheral blood, dental pulp, synovium,
skin and skeletal muscle.
1.3.3 Birth Associated Tissues
Umbilical Cord Blood
Umbilical cord blood (UCB) is a proven source of hematopoietic stem cells, and has been
shown to be a possible source of MSCs; however data regarding the isolation of MSCs
has been controversial. This is mainly due to difficulties in isolating MSCs from UCB
due to their low frequency. Nevertheless, UCB is an attractive source of MSCs due to the
fact that the isolation procedure is painless and there is no harm to the mother or infant.
UCB-MSCs are also a more immature cell type than those obtained from the bone
marrow. Cells are usually obtained by venous puncture of the umbilical vein. UCB-MSCs
21
show a similar surface phenotype to BM-MSCs, being positive for CD29, CD49b, CD44,
CD58, and CD105 and negative for cell surface epitopes of the hematopoietic lineage
CD31, CD45, CD19, CD34, and HLA-DR (O. K. Lee et al., 2004). However, a study
done by Lee et al. (2004) found that the cells were negative for CD90, which has been
shown to be expressed by cells from the BM as well as adipose tissue. Consistent with
bone marrow and adipose tissue derived MSCs, some studies have shown UCB-MSCs to
be able to differentiate into osteoblasts, adipocytes and chondrocytes (W. Wagner et al.,
2005). However, others have proven UCB-MSCs to differentiate into osteoblasts,
adipocytes, and cells of the neural lineage, but not chondrocytes (Goodwin et al., 2001).
Others have suggested differentiation only into cells of the chondrogenic and neurogenic
lineages (Bieback, Kern, Kluter, & Eichler, 2004) Nevertheless, MSC isolation from
UCB is a laborious process, time consuming, and results in low cell yield. In comparison
to bone marrow and adipose tissue, which illustrate an isolation efficiency of 100%, UCB
has an isolation efficiency around 30%, as well as slower growth rate (Rebelatto et al.,
2008). Several studies have examined procedures that can be used to obtain a greater cell
yield, such as ensuring a storage time of less than 15 hours, a net volume of more than 33
ml of blood, and a mononuclear cell count greater than 1 x 108 of mononuclear cells, and
no signs of coagulation or hemolysis (Bieback et al., 2004).
Another cell type that has been isolated from umbilical cord blood and exhibits
similarities to MSCs are multi-potential stem cells (MPSCs). Rogers et al. has shown that
upon isolation, these cells are able to adhere to plastic, are CD45 and CD34-positive, and
are a distinct cell type from mesenchymal cells as well as hematopoietic cells (Rogers et
al., 2007). Additionally, unlike other cell types, MPSCs can be derived from 100% of
22
cord blood samples (Rogers et al., 2007). These cells possess mesenchymal properties,
expressing CD90, CD105, and CD73 on the cell surface (Rogers et al., 2007). MPSCs are
induced to form after 8 days in culture in media supplemented with fibroblast growth
factor 4 (FGF-4), stem cell factor (SCF) and Flt3 ligand (Rogers et al., 2007). Positive
therapeutic potential of MPSCs have been illustrated in a mouse hind limb ischemia
model, whereby the cells were documented to release many paracrine factors and
differentiate in vivo into endothelial cells, smooth muscle cells, as well as striated muscle
cells (Whiteley et al., 2014). Other models, such as a rat spinal cord injury model, has
demonstrated that the therapeutic properties of the cells can be attributed to the secretion
of cytokines and chemokines that possess anti-inflammatory, neuroprotective and
angiogeneic properties, hence facilitating the endogenous repair processes (Chua et al.,
2010). The cells were also seen to be present one week after transplantation (Chua et al.,
2010). Overall, it has been shown that MPSCs are a stable and reproducible cell
population that has shown to have therapeutic potential and seem to resemble MSCs,
however, unlike MSCs are a result of cell culture (Whiteley et al., 2014).
Umbilical Cord Tissue
The umbilical cord is a vehicle for the transport of blood from the placenta to the foetus
and vice versa. It consists of two arteries and one vein that are all surrounded by the
Wharton's jelly and a layer of amnion. Umbilical cord tissue is another source that
harbours MSCs. This source is attractive due to the fact that its collection is non-invasive
and the tissue is usually discarded as medical waste. UC-MSCs have a low
immunogenicity and do not have as many bioethical concerns encompassing their use
(Han et al., 2013). This is due to the fact that MSCs express low levels of major
histocompatibility complex (MHC) class I, and are negative for MHC class II (Ankrum,
23
Ong, & Karp, 2014). However, some studies have also shown that under certain culture
conditions, MSCs are immunogenic and can stimulate the humoral and cellular immune
response. These MSCs demonstrate increased expression of MHC class I and MHC class
II when exposed to interferon gamma (IFN-γ) (Ankrum et al., 2014). The umbilical cord
stroma, known as the Wharton's jelly, is a connective tissue composed of mainly
glycosylaminoglycans (GAGs), and it is most often the source used to isolate cells (Secco
et al., 2008). Additionally, MSCs can also be isolated from the perivascular region of the
umbilical cord. For this isolation method, the epithelium is removed to expose the matrix
underneath, after which the vessels, with the intact extracellular matrix, are removed and
the cells are harvested using enzymatic digestion with collagenase (Sarugaser et al.,
2009). These cells as referred to as human umbilical cord perivascular cells (HUCPVCs).
MSCs can be extracted using the explant or enzymatic digestion techniques, although the
latter is the conventional method. Vessels are stripped out of the cord and cut into small
pieces (around 2 cm). The ends are tied together to form a circle with the outside of the
vessel exposed. Everything is digested with 0.1% collagenase IV or collagenase II, at
37 °C for 16–18 h (Han et al., 2013). The cells are then harvested at 37°C at 5 % CO2.
This method prevents the endothelial cells from being released during the digestion
process.
In comparison to the enzymatic digestion method, the explant isolation method does not
involve the use of collagenase and hence is more cost effective. This method also allows
for easier clinical approval. This is due to the fact that collagenase, used in the enzymatic
digestion protocol, must be made for clinical use and must also undergo extensive testing.
The explant method involves draining the cord of blood, washing it and cutting the cord
24
into 4-6 mm thick sections. These are further divided into 3-4 smaller pieces and plated
onto culture dishes after which medium, such as Dulbecco's modified eagle's medium
(DMEM) or alpha-MEM (alpha minimum essential medium), supplemented with 10%
fetal bovine or calf serum and antibiotics, is added and cultured under 5 % CO2 at 37 °C
(Han et al., 2013). After a varying period of time, cells become attached to the culture
dish. Viable cells have been obtained using both methods, however some differences
between the two isolation techniques have been noticed. When compared with enzymatic
digestion, explant culture has shown to have a lower MSC yield per tissue gram and has
shown to require more days in primary culture until the first cell harvest (Gittel et al.,
2013). For example, equine UC-MSCs have illustrated 10 days in primary culture by
digestion method as compared to 18 days in explant culture (Gittel et al., 2013). However,
the results from our study has shown that cells can be seen in as little as five days after
explant. The tissue explant method also has been cited to have a longer culture cycle and
yield a lower number of primary cells per centimetre of umbilical cord (Han et al., 2013).
However, the explant culture method has several advantages over enzymatic digestion, as
it prevents cellular damage, it is more economical, and cells isolated using this method
have been suggested to release higher amounts of certain growth factors, such as basic
fibroblast growth factor (FGF basic) (Yoon et al., 2013). Additionally, adherence and
proliferation of cells after sub-culturing has also been shown to be more efficient (Han et
al., 2013).
MSCs are present in higher frequencies in the umbilical cord tissue when compared with
other sources such as the bone marrow or peripheral blood. Additionally, UC-MSCs have
a higher proliferation as well as expansion potential when compared with MSCs derived
25
from adult tissues, perhaps due to the fact that they are a more immature cell type
(Trivanovic et al., 2013; H. S. Wang et al., 2004). MSCs obtained from the umbilical
cord express CD44, CD105, CD105 (SH2), CD73 (SH3), but not markers indicative of
blood cells, such as CD45, CD34, CD19, CD11b, and CD14. When cultured with specific
induction medium, they have the potential to differentiate into adipocytes, chondrocytes,
as well as osteoblasts (Huang et al., 2013). It has been suggested that MSCs from donors
of various ages differ in regards to their proliferation as well as clonogenicity,
specifically that cells from younger mothers have a higher proliferative potential as well
as a greater osteogenic differentiation (Huang et al., 2013).
Other Sources
MSC isolation has also been reported from various other birth associated tissues, such as
the placenta and amniotic fluid, however these sources are not as common as the
umbilical cord blood or the umbilical cord tissue itself.
1.4 Immunomodulation
1.4.1 Innate Immunity
The innate immunity is a first-line of defence response against microorganisms and
infections. MSCs are able to modulate the immune system, and the nature of this
modulation is dependent on the cellular and inflammatory environment (Le Blanc &
Davies, 2015). During the early phases of infection, MSCs exhibit predominantly pro-
inflammatory effects due to exposure to Toll-like receptor (TLR) 2 and TLR4. Activated
MSCs migrate to the site of injury and secret various chemokines, such as the chemokine
(C-X-C motif) ligand (CXCL) 9, CXCL10, macrophage inflammatory protein (MIP)-1α
26
and MIP-1β (Le Blanc & Davies, 2015). The expression of Toll-like receptors can prime
MSCs; TLR4 has been shown to cause secretion of pro-inflammatory cytokines by MSCs
and TLR3 primed MSCs are able to exert immune suppressive functions (Waterman,
Tomchuck, Henkle, & Betancourt, 2010). MSCs can also suppress immune activation.
This occurs when the cells are exposed to pro-inflammatory cytokines such as IFN-γ and
tumour necrosis factor alpha (TNF-α) (Le Blanc & Davies, 2015). They do not express
MHC class II on their surface and have low or intermediate expression of MHC class I,
hence they are considered to be immune privileged cells and can be infused into
autologous or allogeneic hosts. The mechanism of action has been cited to be
multifactorial, dependent on both soluble factor secretion, as well as cell-to-cell contact
(Waterman et al., 2010). In vitro, MSCs can suppress lymphocyte alloreactivity in mixed
lymphocyte cultures (Le Blanc & Ringden, 2007). MSCs are able to inhibit the growth of
monocytes towards dendritic cells (DC), which are known to accumulate in inflamed
tissues and are considered antigen presenting cells (APCs) (Moretta, 2002). When DCs
are cultured with BM-MSCs, the immune cells are not able to stimulate CD4+ T cell
proliferation, and MSCs can also alter the cytokine secretion profile of DCs (English,
French, & Wood, 2010). MSCs are able to suppress TNF-α secretion by DCs, hence
attenuating immune responses (Aggarwal & Pittenger, 2005). Additionally, the
expression of several DC surface receptors, which are responsible for natural killer (NK)
cell activation and cell killing, can be down regulated by MSCs, such as NKp30 and
natural-killer group 2, member D (Uccelli et al., 2008). MSCs have also been shown to
impact other effector cells of the innate immune system, such as NK cells. These cells
play a role in controlling the spread of some tumours and also microbial infections by the
27
production of various pro-inflammatory cytokines (Vivier, Tomasello, Baratin, Walzer, &
Ugolini, 2008). Similar to their action on DCs, MSCs can abolish the secretion of IFN-γ
by NK cells that have been stimulated by IL-2 (Le Blanc & Ringden, 2007). MSCs can
prevent the proliferation of resting NK cells, however only a partial inhibition of
proliferation was seen when MSCs were cultured with activated NK cells (which have
been incubated with IL-2 for more than 7 days). This may be due to MSC surface
expression of ligands recognized by different activating NK cell receptors, such as
DNAM-1, NKG2D, and well as low levels of HLA class I (Le Blanc & Ringden, 2007).
Under normal conditions, the expression of HLA class I molecules on the surface of
autologous cells prevents NK cell activation due to interaction with a specific set of
inhibitory receptors present on the surface of NK cells (Spaggiari, Capobianco, Becchetti,
Mingari, & Moretta, 2006). Low levels of MHC class I on MSCs can induce autologous
and allogenic NK cell mediated cytotoxicity lysis of MSCs, under inflammatory
conditions where NK cells are exposed to IL-2 (Spaggiari et al., 2006). Hence, this
suggests that inhibitory interactions as a result of HLA class I on MSCs are not sufficient
to protect MSCs from lysis (Spaggiari et al., 2006). However, this is countered by IFN-γ,
a cytokine released by NK cells, which has been shown to be able to up-regulate HLA
class I molecules on MSCs, thus rendering the cells resistant to NK-mediated lysis
(Spaggiari et al., 2006). The up-regulation of HLA class I molecules was also seen to
decrease cytokine production by NK cells. Since this study illustrated that NK cells are
able to lyse MSCs, this raised the question of why MSCs are not killed by NK cells in
vivo. It has been suggested that in vivo, there may be MSCs localized in specific tissue
niches, expressing higher levels of MHC class I, or that NK cells might not reach an
28
activation state sufficient for MSC lysis (Spaggiari et al., 2006). This data could be useful
for therapies using MSCs, such as suppression of graft-versus-host (GvHD) in BM
transplants.
1.4.2 Adaptive Immunity
The adaptive immunity is a second line of defence against pathogens and is activated
once the innate immunity has already taken effect. MSCs are able to regulate the adaptive
immune system through direct cell-to-cell interaction as well as through soluble factor
secretion, however, it is not know which method is more prevalent. MSCs are able to
attenuate the activation of the immune system by inhibiting T lymphocyte cell
proliferation. In vitro, the addition of autologous BM-MSCs are able to inhibit T-cell
proliferation, even after stimulation with IL-2 (Di Nicola et al., 2002). This reaction was
dose dependent; T lymphocytes and irradiated allogenic dendritic cells were cultured at a
ratio of 1:1, and increasing amounts of irradiated BM-MSCs were added. T lymphocyte
proliferation was seen to be optimal at a ratio of 1:5 (Di Nicola et al., 2002). This
inhibition of T lymphocyte proliferation by BM-MSCs was reversible. Stimulated T cells
cultured with irradiated BM-MSCs for 7 days resulted in a reduced T lymphocyte
proliferation, however when the T lymphocytes were re-timulated (by at addition of
dendritic cells or IL-2) for two days after this time period of inhibition, this restimulation
lead to a proliferation of the T lymphocytes that was comparable with control cultures
without BM-MSCs (Di Nicola et al., 2002). MSCs can also decrease the amount of
cytokines produced by T-cells, namely IFN-γ, IL-2, IL-4 and TNF-α, which are
associated with inflammatory processes (Ghannam, Bouffi, Djouad, Jorgensen, & Noel,
2010). Proliferation of CD4+ and CD8+ T-cells stimulated by peripheral blood
29
leukocytes (PBLs) or DCs is inhibited by MSCs (Di Nicola et al., 2002). It has been
suggested that MSCs are able to inhibit T-cell receptor dependent and independent
proliferation, along with suppression of IFN-γ and TNF-α production, thus inducing
peripheral T-cell tolerance (Zappia et al., 2005). This is hypothesized to occur through
the regulation of the NF-kB signalling pathway and also by stopping the T-cell cycle in
the G0/G1 phase (Keating, 2012). Many factors have been suggested to be involved in T-
cell suppression by MSCs, namely transforming growth factor-β (TGF-β), hepatocyte
growth factor (HGF), indoleamine 2,3-dioxygenase (IDO), and prostaglandin E2 (PGE-2)
(Sato et al., 2007). However, there are species differences in the immune modulation
activity of MSCs, as IDO, a tryptophan catabolizing enzyme, acts in humans as well as
Rhesus monkeys, whereas nitric oxide is mainly involved in mice (Keating, 2012).
For humans, the immune suppression activity of MSCs has been compared to the
mechanism used by professional antigen-presenting cells in inhibiting T-cell responses to
autoantigens and fetal alloantigens (such as preventing the rejection of the fetus during
pregnancy) in vivo (Terness et al., 2002). IDO is strongly induced at the level of
transcription by IFN-γ along with other proinflammtory cytokines, thus causing the
conversion of tryptophan to kynurenine by the enzyme (Meisel et al., 2004). Tryptophan
is an essential amino acid, needed for the biosynthesis of important proteins (Terness et
al., 2002). T-cells are known to be sensitive to tryptophan depletion, and at low
tryptophan concentrations, cell cycle is arrested at the G1 cell cycle point, as T cells
possess a specific cell cycle regulatory checkpoint that has been shown to be sensitive to
tryptophan concentrations in tissue microenvironments (Mellor & Munn, 1999; Terness
et al., 2002). MSCs do not constitutively express IDO, however, the protein can be
30
detected by Western blot analysis after stimulation with INF-γ (Meisel et al., 2004).
MSCs and mixed lymphocyte reaction co-cultures suggest that MSCs are the primary
source of IDO activity. This is further supported by the fact the addition of tryptophan is
able to restore T cell proliferation (Meisel et al., 2004).
1.5 Wound Healing
1.5.1 Tissue Repair
MSCs hold great promise for clinical applications and in regenerative medicine due to
their therapeutic abilities. In vivo, MSCs are involved in many processes, such as cellular
homeostasis, aging, tissue damage as well as inflammatory diseases (Ma et al., 2014).
There have been clinical trials done to assess the ability of MSCs in various pathological
conditions mostly using BM-MSCs. The first clinical trial in which the cells were tested
for their therapeutic effects was for children who had undergone allogenic BM
transplantation for severe osteogenesis imperfecta, characterized by defective type I
collagen production affecting tissues such as bone and ligament, where a significant
improvement in bone structure and function was seen in these patients after the
administration of MSCs (Horwitz et al., 1999). Since this time, there have been more than
300 patients that have received systemically infused MSCs for various indications
(Horwitz & Dominici, 2008). Moreover, many clinical trials are currently being done to
investigate the efficacy of MSC therapy for hematological pathologies such as aplastic
anemia, cardiovascular diseases such as heart disease and vascular disease, and
neurological and inherited disorders such as Hurler syndrome (Giordano, Galderisi, &
Marino, 2007). MSCs have also been used for cutaneous wound healing. The main
mechanisms by which MSCs exert their therapeutic properties is by the secretion of
31
various growth factors and cytokines, such as IL-6, IL-7, and granulocyte-macrophage
colony-stimulating factor (GM-CSF) (Deans & Moseley, 2000). There are four published
clinical studies which use MSCs in cutaneous wound healing (Isakson, de Blacam,
Whelan, McArdle, & Clover, 2015). Both autologous as well as allogenic cells have been
used in these studies (Isakson et al., 2015). For example, Badiavas et al. used BM cells
obtained from the iliac crest and applied the aspirate directly to the wound as well as
injected a small amount into the edges of the wound. Among the three patients studied, a
reduction in wound size was noticed, with improved thickness, vascularity, and integrity
of the dermis, greater generation of granulation tissue and epithelization, and after two
years, complete wound closure (Badiavas & Falanga, 2003). Falanga et al. used a fibrin
spray to deliver BM-MSCs to acute surgical wounds. Histological analysis of the wounds
suggested that some MSCs were able to migrate into the upper layers of the wound bed
and differentiate into fibroblastic cells (Falanga et al., 2007). This same study
administered BM-MSCs to diabetic wounds and noticed a decrease in the size of the
wound at 16 weeks after three topical applications of MSCs (Isakson et al., 2015). Others
have applied autologous BM-MSCs to diabetic foot ulcer patients. Dash et al.
administered one million MSCs per cm of wound area with a syringe into the ischemic
limb and along the edges of the wound (Dash, Dash, Routray, Mohapatra, & Mohapatra,
2009). When compared with controls, which received only standard wound care regimens,
patients who also concurrently received the cells had a reduced ulcer size (71% when
compared to only 23% in the control group), experienced an increase in pain-free walking
distance (7.5 fold increase when compared to 2.2 fold increase during the 12 week follow
up) and an increase in the cellularity of the wound (Dash et al., 2009). Biopsy analysis
32
revealed reticulin fibers, indicating that BM-MSCs were able to contribute to dermal
rebuilding and closure of the non-healing chronic wound (Dash et al., 2009). Overall,
these clinical trials have shown that MSCs are able to accelerate wound closure for
chronic non-healing wounds where conventional treatments have failed.
1.5.2 Diabetic Wound Healing
Epidermal wound healing is classically subdivided into four steps which usually follow a
sequential progression of overlapping events in healthy individuals; hemostasis,
inflammation, proliferation and migration, and resolution and remodelling (Figure 2)
(Sonnemann & Bement, 2011). Various types of immune cells are recruited and
implicated in the wound healing process, namely platelets, which are responsible for the
formation of a platelet plug, neutrophils followed by macrophages, which both contribute
to scar formation, keratinocytes, which migrate over the injured dermis, fibroblasts and
finally myofibroblasts, which interact and produce extracellular matrix, mainly in the
form of collagen, which helps form the mature scar (Gurtner, Werner, Barrandon, &
Longaker, 2008). Hemostasis is the process where further blood loss is prevented due to
constriction of the damaged blood vessels and platelet clot formation (Sonnemann &
Bement, 2011). Also, the formation of a network of fibrin fibrils is initiated as fibrinogen
cleaves thrombin (Sonnemann & Bement, 2011). This allows growth factors to bind and
promote the inflammatory stage of wound healing (Sonnemann & Bement, 2011).
Inflammation is characterized by the recruitment of leukocytes to the wound. The first
leukocytes that arrive are neutrophils, which engulf bacteria, and then monocytes, which
differentiate into macrophages and remove debris as well as neutrophils which have died
(Sonnemann & Bement, 2011). This stage is also characterized by angiogenesis, whereby
33
new vessels are formed, thus supplying oxygen and nutrients to the wound lesion
(Sonnemann & Bement, 2011). The next stage, proliferation and migration, is
characterized by epidermal cells and fibroblasts (Sonnemann & Bement, 2011).
Epidermal cells migrate over the wound site by assuming a more flattened, elongated
morphology, and also recruit fibroblasts, which form granulation tissue (Sonnemann &
Bement, 2011). The new epidermis moves over the wound area as a coherent sheet, due
to cell to cell contact that is maintained between the epidermal cells (Sonnemann &
Bement, 2011). Fibroblast cells are able to differentiate into myofibroblasts, due to
growth factors in the wound environment. These cells help bring the edges of the wound
closer together. Both fibroblasts and myofibroblasts secrete a large amount of collagen
along with other extracellular matrix proteins, hence forming the basis of new granulation
tissue (Sonnemann & Bement, 2011). Myofibroblasts also align the collagen fibrils that
make up the extracellular matrix by bringing the edges of the wound closer together
(Sonnemann & Bement, 2011). Lastly, the final phase of wound healing is resolution and
remodeling, whereby the following events take place: the edges of the migrating sheet of
new skin make contact with each other and epidermal proliferation as well as migration
stops, leukocytes in the wound leave or undergo programmed cell death, the extracellular
matrix is remodelled, and granulation tissue is removed (Sonnemann & Bement, 2011).
At the end of this phase, only the scar tissue remains, which is composed of the aligned
extracellular matrix filaments (Sonnemann & Bement, 2011). However, there can be
interruptions of this orderly sequence of events, thus leading to delayed wound healing or
even wounds that do not heal at all. Chronic wounds do not follow this orderly sequence
of events, and are often characterized by a prolonged state of inflammation (Guo &
34
Dipietro, 2010). Most chronic wounds are ulcers that are associated with ischemia,
diabetes mellitus, or pressure (Guo & Dipietro, 2010). Diabetes associated wounds
represent a serious problem as they are a major cause of hospitalizations and may lead to
amputations. There are 150 million people with diabetes world-wide, and 15% of those
suffer from foot ulcerations, which often become non-healing chronic wounds (Wu,
Driver, Wrobel, & Armstrong, 2007). The mechanisms of wound healing are altered in
those with diabetes and such impairments are further magnified by insults such as
bacterial infections, tissue ischemia, trauma and poor management, all which can
aggravate the wound and cause diabetic foot ulcers to heal slowly, hence transforming
into chronic wounds (Jeffcoate & Harding, 2003). Epidermis from chronic ulcers have
shown to be very thick, hyperproliferative, and containing mitotically active cells in
suprabasal layers, whereas mitosis occurs only in the basal layers of the skin from normal
volunteers (Stojadinovic et al., 2005). The pathogenic triad are the three main factors
responsible for chronic wound formation in those with diabetes; namely neuropathy,
ischemia, and trauma (Falanga, 2005). Cells and cytokines that are essential for wound
healing to take place are altered in people with diabetes, for example it has been shown
that there is a diminished response of keratinocytes. At the non-healing edge of diabetic
foot ulcers, keratinocytes show very little migration, hyperproliferation, as well as
incomplete differentiation (Brem & Tomic-Canic, 2007). There is also a reduced capacity
of the endothelial cells to form new blood vessels, alterations in macrophage function,
collagen accumulation, bone healing, angiogenic response, and the quantity as well as
quantity of granulation tissue is also affected in this pathology (Brem & Tomic-Canic,
2007; Prosdocimi & Bevilacqua, 2012). Chronic diabetic ulcers persist due to a disrupted
35
formation of granulation tissue and deep tissue necrosis (Galkowska, Wojewodzka, &
Olszewski, 2006). Fibroblasts obtained from diabetic ulcers have shown to differ in their
proliferative capacity when compared to non-diabetic ulcer fibroblasts and age-matched
fibroblasts (Loot et al., 2002). Macrovascular disease, such as a reduction in capillary size
and thickening of the basement membrane, are responsible for circulatory problems
associated with diabetes, which also contributes to the pathogenesis of impaired wound
healing (Falanga, 2005). There is also impaired growth factor production; previous
studies have shown that in diabetic foot ulcers, there is a lack of up-regulation of bFGF
and insulin-like growth factor 1 (IGF-1) expression and reduced expression of TGF-β1
and IL-15 in the vascular endothelium (Galkowska et al., 2006). These growth factors
play roles in angiogenesis, hence this may be responsible for the delayed granulation
tissue formation and retarded healing in those with diabetes (Galkowska et al., 2006).
Although there are various treatment options available, the primary and most important
prevention strategy is maintaining normal blood glucose levels, followed by appropriate
management of the affected wound area, including proper debridement, protective
footwear, systemic antibiotics, pressure off-loading, and moist dressings (Vuorisalo,
Venermo, & Lepantalo, 2009). Specifically, debridement refers to the removal of all
necrotic tissue, callus present around the wound and also foreign material (Wu et al.,
2007). This is important in order to decrease the risk of infection, which can prevent
wound contraction and healing. After debridement, the wound is washed and cleansed
and a moist wound environment should be maintained (Wu et al., 2007). Proper
offloading, one of the biggest challenges in those with diabetic foot ulcers but the primary
mode of healing, includes having patients use a wheel chair, crutches, or even bed rest to
36
prevent pressure on the affected area (Wu et al., 2007). Total contact casts or removable
cast walkers have also been used (Wu et al., 2007). Current treatment options focus on
modifying controllable causative factors, such as treatment of the wound by oral
antibiotics, such as cephalexin (Isakson et al., 2015). Antimicrobial creams, applied
directly on the ulcer, have also been used. Other interventions include surgical
debridement and negative pressure wound therapy, however these are associated with
long healing times (Isakson et al., 2015). Current treatment options can be ineffective and
limited in their reparative capacities, and there is a need for more innovative therapeutic
alternatives. As a result, MSCs have been studied for their wound healing properties in
many animal models and have shown promise in accelerating healing in diabetic wounds.
Due to the many aberrations present in those with diabetes, such as growth factor
abnormalities, the application of cells may be able to correct and help improve some of
these deficiencies. Particularly, MSCs have shown to enhance wound healing mainly
through the release of cytokines and growth factors that have shown to be absent in the
diabetic wound healing process. The application of cells as therapeutic agents ultimately
results in increased angiogenesis, reepithelialisation, and granulation tissue formation
(Isakson et al., 2015).
37
Figure 2: Stages of wound healing.
38
Figure 2. (a) Image depicts intact skin, prior to wound. (b) Immediately after a wound
occurs, a platelet plug forms in order to attain hemostasis. Platelets also have a role in
releasing various cytokines that attract inflammatory cells, such as neutrophils and
macrophages, to the wound site. (c) Neutrophils are amongst the first cells to be recruited,
within an hour after the wound has occurred, in order to clear debris. They also have a
role in releasing additional cytokines. Monocytes are recruited to the wound after 24-48
hours, mature into macrophages, and continue the process of cleaning the wound.
Macrophages secret cytokines in order to stimulate angiogenesis and attract fibroblasts
(d) Proliferation and migration occurs when fibroblasts arrive at the wound and secrete a
collagen matrix, thus forming the bulk of scar tissue. Fibroblasts also differentiate into
myofibroblasts, which help bring the edges of the wound closer together. Epidermal cells
at the wound margin proliferate and migrate into the wound, thus forming a new
epithelial layer. (e) Remodelling occurs when fibroblasts and other inflammatory cells
secrete matrix metalloproteinases (MMPs) to assist in the cross-linking of the collagen
matrix. (Sonnemann, K. J., & Bement, W. M. (2011)).
39
1.5.3 TSG-6
The gene TSG-6, tumor necrosis factor-stimulated gene 6, was originally identified by
screening a cDNA library from foreskin fibroblasts treated with TNF-α (Milner & Day,
2003). It is a 35 KDa protein, which is not normally expressed in healthy tissues and
cells, but rather secreted in response to inflammation. Hence, it is associated with
inflammatory diseases and its expression is induced by various inflammatory cytokines,
such as TNF-α and IL-10 (Milner & Day, 2003). More specifically, the sera of patients
with arthritis have TSG-6 protein expression, whereas it is not detected in the sera
collected from patients with no history of articular joint disease (Wisniewski et al., 1993).
It has been shown that the expression of the secretory protein TSG-6 is tightly regulated
at the level of transcription by the pro-inflammatory cytokines IL-1, TNF-α, and bacterial
lipopolysaccharide (Klampfer, Chen-Kiang, & Vilcek, 1995). However, studies have
shown that the regulation of the TSG-6 promoter by cytokines is complex (Klampfer et
al., 1995). The region between -163 and -58 in the TSG-6 promoter allows for gene
induction by TNF-α and IL-1. This region contains a CCAAT box as well as binding sites
for the transcription factor activator protein 1 (AP-1) and for the nuclear factor IL-6 (NF-
IL6) family of transcription factors (Klampfer, Lee, Hsu, Vilcek, & Chen-Kiang, 1994).
The NF-IL6 transcription factor (-106 to -114) is needed for the activation of TSG-6 by
the cytokines TNF-α and IL-1, which are likely to be found in an inflammatory region
(Klampfer et al., 1995). Two binding sites for NF-IL6 are needed within the TSG-6 5′
promoter and enhancer region. NF-IL6 can function as an activator or inhibitor of TSG-6
transcription, depending on the activator to inhibitor ratio. Stimulation by cytokines leads
to an increased level of the activator forms of NF-IL6 (Klampfer et al., 1994).
40
Additionally, the AP-1 regions within the TSG-6 promoter have also been found to be
important for TSG-6 expression by TNF-α and IL-1 (Klampfer et al., 1994). Specifically,
the AP-1 site has been shown to cooperate with the NF-IL6 site in the activation of the
TSG-6 promoter (Klampfer et al., 1994).
TSG-6 has a high degree of sequence homology to the NH2-terminal of the CD44
protein, part of the hyaluronan family of binding proteins (T. H. Lee, Wisniewski, &
Vilcek, 1992). CD44 is a major cell surface receptor for HA found to be expressed on the
surface of a variety of cell types, such as hematopoietic cells, B and T cells (Lesley et al.,
2004). As a result, this indicates that it may also function as a regulator of cell-cell and
cell-matrix interactions during inflammation and tumorigenesis (T. H. Lee et al., 1992).
TSG-6 has also been shown to be able to interact with hyaluronic acid (HA), a
glycosylaminoglycan found in the extracellular component of most tissues, and
abundantly in cartilage as well as synovial fluid (T. H. Lee et al., 1992). Binding of CD44
to HA has been implicated in the adhesion of lymphocytes to endothelium at
inflammatory lesions. HA can form a complex with TSG-6 in an inflammatory milieu,
exhibiting the ability to bind to cells expressing the CD44 receptor (Lesley et al., 2004).
This has been suggested to be a mechanism by which leukocytes exhibit enhanced
adhesion during inflammation, as it has been shown that HA and TSG-6 are upregulated
during an inflammatory response (Lesley et al., 2004).
Recently, TSG-6 protein has been suggested as a biomarker that may be used to predict
the in vivo efficacy of MSCs at reducing sterile inflammation in various animal models.
A study done by Lee et al., showed that there was a wide variation in the efficacy of
human MSCs obtained from bone marrow aspirates of healthy individuals at reducing
41
inflammation in a chemical injury of the cornea mouse model. To find a possible
biomarker that predicated the efficacy of various cell populations, different characteristics
that have previously been associated with MSC anti-inflammation and immune
suppressive effects were looked at. These included the differential potential of the cells,
as well as the mRNA expression levels of different genes (R. H. Lee et al., 2014). Genes
that were studied included TSG-6, heme-oxygenase 1, cyclooxygenase 2, PGE-2, IL-1
receptor antagonist, TGF-β1, and IDO1, however, only TSG-6 was shown to have a
significant positive correlation with the ability of the cells to suppress inflammation in
vivo (R. H. Lee et al., 2014). In this study, the role of TSG-6 was confirmed by
overexpressing the gene in cells, which initially showed very little mRNA expression.
TSG-6 overexpression resulted in an increased efficacy of the cells in the cornea model
(R. H. Lee et al., 2014). TSG-6 was also seen to be higher in MSCs obtained from female
donors, and a negative correlation was noted with height, weight, osteogenic
differentiation, as well as date of collection, but no correlation with age of the donors was
seen. Many studies to date have shown the correlation of TSG-6 with the therapeutic
potential of the cells. A rat model of intra-cerebral hemorrhage illustrated that MSCs had
a protective effective on the blood brain barrier, and this was thought to be due to the
secretion of TSG-6 by MSCs, which has been shown to inhibit the NF-κB pathway in
macrophages (Figure 3) (Choi, Lee, Bazhanov, Oh, & Prockop, 2011). TSG-6 expression
and secretion has been suggested to be a major factor responsible for MSC induced
inhibition of maturation and function of bone marrow-derived dendritic cells (Liu et al.,
2014), improvement of myocardial infarctions in mice (R. H. Lee et al., 2009),
42
accelerated wound healing in murine full-thickness skin wounds (Qi et al., 2014), as well
as reduced renal tubular inflammation and fibrosis (Wu et al., 2014).
43
Figure 3: MSC anti-inflammatory effects are mediated through TSG-6.
Figure 3. The anti-inflammatory effects of MSCs have been proposed to be due to TSG-6,
a secreted protein, acting on macrophage cells present near a wound site. When
inflammation is induced by the administration of zymosan, activated NF-κB signalling
increases the production of pro-inflammatory cytokines, such as TNF-α, which in turn
prime MSCs to secrete TSG-6. TSG-6 deceases the production of pro-inflammatory
cytokines through interaction with CD44 alone or in a complex with hyaluronin. Overall,
this reduces the recruitment of neutrophils to the wound site, hence reducing excessive
inflammation. (Choi, H., Lee, R. H., Bazhanov, N., Oh, J. Y., & Prockop, D. J. (2011)).
44
1.5.4 Animal Models
MSCs have been used and tested in numerous animal models for their wound healing
capabilities. In vivo, MSCs have an ability to migrate to injured areas, release trophic
factors that aid in tissue repair and regeneration, enhance angiogenesis, act as
chemoattractants for other cell types and inhibit fibrosis and apoptosis (Joyce et al., 2010).
They have been investigated in different preclinical studies for various genetic diseases,
such as Duchenne muscular dystrophy. In such studies, UC-MSCs showed positive
effects, reaching the musculature, however, the cells did not differentiate in skeletal and
muscle cells (Zucconi et al., 2011). MSCs have also been used as therapeutic strategies
for models of lung injury. Using a bleomycin induced lung injury mouse model, MSCs
have shown to hasten repair, decrease fibrosis, and attenuate inflammation in injured
lungs (Rojas et al., 2005). Other studies have illustrated that infused MSCs are able to
home to the lung and adopt an epithelium-like phenotype, reducing collagen deposition in
the lung tissue of mice, thus making these cells candidates for the treatment of lung
disease (Ortiz et al., 2003). Moreover, MSCs have also been shown to be effective in
animal models of myocardial infarction, such as swine and murine myocardial infarction
models, where beneficial effects were seen due to a decreased inflammatory response,
reduced infarct size, and improved cardiac function. Although studies have shown that IV
infused MSCs become entrapped in the lung, others have reported that the cells are able
to implant in the injured myocardium, where they maintain wall thickness and improve
contractile dysfunction (Iso et al., 2007; Kraitchman et al., 2003; R. H. Lee et al., 2009;
Shake et al., 2002). In all the cases, the majority of the cells lodge in the lung, but some
are also able to make it through to the injured tissue. It is possible that the cells trapped in
45
the lung are secreting factors into the blood stream (Iso et al., 2007). MSCs are also
effective treatments for limb ischemia, diabetic wound healing mouse models, as well as
neurodegenerative diseases, mainly by the secretion of cytokines and chemotactic factors
(Rosova, Dao, Capoccia, Link, & Nolta, 2008).
1.5.5 Diabetic Mouse Models of Wound Healing
Since wound healing is impaired in patients with diabetes, the most accurate wound
healing murine models will incorporate the diabetes phenotype. There are two main type
of diabetes, type I and type II diabetes, each having different root causes. Type I diabetes
is due to autoimmune destruction of the beta cells in the pancreas, which produce the
hormone insulin, and type II diabetes is caused by insulin resistance coupled with beta
cell dysfunction, where there is a lack of beta cell compensation (King, 2012). There are
a plethora of animal models that have been developed to study both type I as well as type
II diabetes, however, the db/db, Akita, and streptozoicin (STZ)-induced C57BL/6J are the
most commonly used in research (Michaels et al., 2007). The db/db mice, representing a
model of type II diabetes, are homozygous for a mutation in the leptin receptor, a major
mediator of satiety, which exerts effects within the arcuate nucleus of the hypothalamus.
This model represents the clinical features of type II diabetes, as the mice become obese
at approximately three to four weeks of age and show an elevation in blood glucose levels
at four to eight weeks (The Jackson Laboratory, 2014). The Akita mice have a
heterozygous mutation in the insulin II gene, while STZ injection causes toxicity and
destruction of the pancreatic islet beta cells, with both these models representing type I
diabetes (Michaels et al., 2007).
46
The genetic background of the mouse model being used must also be considered. Most
animal models on wound healing use the C57BL/6 db/db mice to study impairments in
wound healing due to type II diabetes (Harris, Mitchell, Yan, Simpson, & Redmann,
2001). Furthermore, strain differences in mice dictate the severity of the diabetes
phenotype and the effect of high-fat diets on the overall health of the mice (Harris et al.,
2001). The db/db genotype in C57BL/6 mice behaves in a similar fashion to the ob/ob
mutation on the same strain. In comparison to the C57BL/KsJ background, C57BL/6
mice merely become insulin resistant, while the C57BL/KsJ develop overt diabetes
(Hummel, Coleman, & Lane, 1972). Although the two strains are alike in the early stages
of disease, illustrating hyperglycemia, rapid weight gain, and hyperinsulinemia, disease
progression differs at later stages. Specifically, C57BL/KsJ strain illustrates severe
diabetes, as seen by hyperphagia, obesity, permanent hyperglycemia starting at 2-3
months, temporarily elevated plasma insulin concentrations (which seem to be halted
prematurely) and degenerative changes in the islets of Langerhans (Hummel et al., 1972).
Diabetes is less severe on the C57BL/6 background. Like C57BL/KsJ mice, hyperphagia
and obesity are present, however, these mice display mild diabetes characterized by
transitory hyperglycemia and markedly elevated plasma insulin concentrations, as well as
hypertrophy of the islet cells and increased proliferative capacity of the beta cells
(Hummel et al., 1972). Other mice with the db/db phenotype include BALB/c mice.
When compared with BALB/c mice, C57BL/6 mice have a higher susceptibility to diet-
induced obesity, type 2 diabetes, and atherosclerosis (The Jackson Laboratory, 2014).
Type II diabetes is a pathology which represents a major health concern worldwide, due
to the prevalence of a sedentary lifestyle and diets rich in calories (Wild, Roglic, Green,
47
Sicree, & King, 2004). There are many different models of rodent wound healing that
have been described and used, including incisional, excisional, burn, as well as
granulation tissue models (Galiano, Michaels, Dobryansky, Levine, & Gurtner, 2004).
While excisional wounds are most commonly used in the literature, there are numerous
variations in the size of the wound generated, the number of wounds, how the wound is
generated, as well as occlusive dressings, splints, or non-occlusive bandages that have
been used (Ansell, Campbell, Thomason, Brass, & Hardman, 2014). Incisional wounds
usually exhibit more similarity among studies; 10-15 mm in length, full thickness, and
scalpel induced, where most commonly a suture is used to close the wound margins
(Ansell et al., 2014). Wound healing in both models (incisional and excisional) fill with a
matrix composed of fibrin, fibronectin and plasma-derived components (Davidson, 2001).
Burn models can also be used, induced chemically, thermally, or by radiation. Thermal
burns have been shown to create a zone of coagulative necrosis, in which the denaturation
of plasma and cellular protein leads to the obstruction of blood vessels (Davidson, 2001).
Hence, tissue is devoid of many essential nutrients (Davidson, 2001). The epithelial layer
of the skin is more intact in first and second degree burns, however healing does not
progress as rapidly because the necrotic tissue must first be eliminated (Davidson, 2001).
Granulation tissue wound healing models, also known as dead space models, are
designed to measure the amount of newly deposited connective tissue, hydroxyproline
formation, collagen formation and fibrils, as well as identification of different cell types
(Davidson, 2001). Subcutaneous implants lead to the formation of a fibrin clot, and
granulation tissue formation (Davidson, 2001). These models selectively study
connective tissue formation during wound healing by placing polyvinyl alcohol sponges,
48
consisting of a small piece of perforated silicone tubing filled with silicone strips of
polyvinyl alcohol sponge, in the subcutaneous space of the skin, and removed after a
certain number of days (Davidson, 2001). Histological and biochemical analysis is then
done to examine properties of healing (Diegelmann, Lindblad, & Cohen, 1986). PVC
tubes can also be implanted, consisting of a PVC tube with polyester-polyurethane
sponges (Paulini, Korner, Beneke, & Endres, 1974). Alternatively, vicose cellulose
sponges of different designs have also been used (Pallin, Ahonen, Rank, & Zederfeldt,
1975). Other materials that can be used include porous Teflon tubing and nylon mesh
(Davidson, 2001).
Challenges to translating mouse wound healing studies to humans arise due to differences
between mouse and human wound healing. Mice have a subcutaneous muscle layer,
called the panniculus carnosus, which heals wounds mainly by contraction, rather than by
granulation tissue formation and fibrosis as seen in humans (Perez & Davis, 2008). This
is the primary method of wound healing in rodents. However, the excisional wound splint
method offers a murine model that closely resembles wound healing in humans, because
the splint keeps the wound open. Healing occurs from the wound margins, and the
process of epithelization, granulation tissue formation, scar formation, contraction, and
angiogenesis takes place, as the splint prevents contraction of the skin (Galiano et al.,
2004). In full thickness wounds occurring in mice as well as humans, there is a loss of the
basement membrane, hence the wound must heal by re-epithelization by keratinocytes as
well as by extracellular matrix production (Stroncek JD, 2008). MSCs have been used as
a cellular therapy and have shown many therapeutic effects in cutaneous wound repair.
For instance, the application of MSCs on excisional wounds in db/db mice has shown to
49
exhibit a decreased epithelial gap, increased granulation tissue formation, acceleration of
wound closure by promoting cell migration to the wound site, as well as increased
neovascularization, hence supplying a greater amount of oxygen and nutrients to the
wound site (Arno et al., 2014; Javazon et al., 2007). MSCs promote wound repair not by
engrafting into the injury site or by differentiation into other cell types, but rather by the
secretion of various cytokines, such as vascular endothelial growth factor (VEGF),
epidermal growth factor (EGF), and erythropoietin (Chen, Wong, & Gurtner, 2012).
These factors have various anti-inflammatory, angiogenic, and chemotactic properties,
stimulating the recruitment of keratinocytes, macrophages and other cell types (Chen et
al., 2012). Overall, MSCs have been shown to accelerate the healing of chronic cutaneous
wounds, thus making them ideal therapeutic candidates in clinical settings.
50
1.6 Rationale, Hypothesis and Objectives
1.6.1 Rationale
Previous work on MSCs has largely focused on isolation of the cells from BM. UC-
MSCs have been investigated in some studies for their therapeutic potential in various
models, mainly using enzymatic digestion of the tissue to isolate cells. However, isolation
of UC-MSCs using an explant culture of the whole umbilical cord tissue has not been
previously studied in detail for large sample sizes. Preceding studies in our lab have
proven that MSCs isolated from the umbilical cord are able to enhance wound healing in
a db/db excisional wound mouse model. However, the patient to patient differences in
MSC samples has not been looked at, and the passage variation in immunophenotype has
also not been investigated. Literature suggests that different MSC populations exhibit
variations in their therapeutic potential in murine models, and that the gene TSG-6 may
be used as an informative biomarker to predict the in vivo efficacy of cells. This work has
been done with BM-MSCs, however whether the same trend is seen with UC-MSCs
applied in a murine diabetic excisional wound model, and the impact this may have on
cytokine secretion profiles of MSC populations, remains largely unknown.
1.6.2 Hypothesis and Objectives
I propose the following hypothesis: MSCs isolated from different cord tissue units may
exhibit variations in their immunophenotype with increasing passage number and show
varying TSG-6 mRNA expression profiles, thus this may impact the cytokine secretion
profile and wound healing capabilities of different cell populations.
51
To test this hypothesis, I propose the following four aims:
1. Determine the isolation efficiency from 40 different umbilical cord samples.
2. Study the phenotypic profile of 20 MSC samples with passage number and between
patient samples.
3. Investigate the cytokine secretion profile of UCT-MSCs.
4. Assess TSG-6 as a potential candidate marker to evaluate the wound healing efficacy
of two UCT-MSCs populations, expressing high and low levels of TSG-6 mRNA, in a
db/db excisional wound mouse model.
52
Chapter Two: Experimental Methods and Materials
53
2. Experimental Methods and Materials
2.1 Umbilical Cord Collection and Preparation
Cord tissue (n=40) was obtained from full-term, vaginal and caesarean deliveries from
across Canada. Cord tissue was sprayed with 70% ethanol, and alcohol gauze was used to
wipe down the entire length of the cord until the exterior surface was clean. The cord
tissue was transferred to a petri dish and a scalpel was used to cut off the end portions of
the tissue, which were discarded. Five ringlets, each approximately 4 mm in length, were
cut from each tissue, and washed twice with 10 ml of phosphate buffered saline (PBS -/-).
The arteries as well as the vessels were flushed with PBS (-/-) to remove any blood clots.
All four pieces were transferred to a 2 ml cryovial and 1.8 ml of cold CryoStor (BioLife
Solutions, Lot# 15003) was added to each, ensuring that all sections were free-floating in
the freezing solution. Each cryovial was chilled for 10 minutes at 4°C and then
transferred into a pre-chilled freezing device, and placed in the -80°C freezer overnight.
Cyrovials were then transferred into liquid nitrogen the next day for long term storage.
Sterility testing was done for each cord tissue sample, with BacT/ALERT Standard
Aeorbic and BacT/ALERT Standard Anaerobic bottles (bioMerieux Inc., USA), using 4
ml of PBS (-/-) obtained from washing each cord tissue unit.
2.2 MSC Isolation
MSCs were isolated using an explant culture protocol. Pieces of umbilical cord were
thawed in a 37°C water bath for 2 minutes. Tissues were then submerged in 10 ml of
medium (complete alpha-MEM, 10% Fetal Bovine Serum, 1x Antibiotic-Antimycotic;
Life Technologies Lot #1631429). Tissue pieces were evenly plated in a single well of a
6-well polystyrene dish (Falcon) in 1 ml of complete alpha-MEM, labelled as "P0I".
54
Medium change was done 24 hours post thaw and every 2 days afterwards. MSCs started
to migrate from the cord tissue explants at various time points, ranging from 5-38 days
(Figure 4). When 80% confluency was reached, the cells were passaged using 0.25%
trypsin-EDTA solution and the whole contents of the plate were transferred on 10-cm
plates (Falcon), labelled as P1. At this point, tissue pieces were moved to a new well in a
6-well polystyrene dish, labelled as "P0II." The cells from P0II were passaged when
confluency was reached.
55
Figure 4. Images depict primary culture of human UCT-MSCs, illustrating the umbilical
cord surrounded by MSCs which have migrated from the tissue and adhered to the plastic
dish. Cell isolation can be seen at 5 days after initial plating of the tissue (Figure A). Cells
become more confluent at 8 days (Figure B) and at 14 days (Figure C). Magnification, 4X.
Figure 4: Explant culture of human umbilical cord samples.
56
2.3 Cell Culture
At each passage, cells were plated at a density of ~230,000 cells/10 cm plate (Falcon),
with 10 ml/plate of complete alpha-MEM. Cultures of cells were maintained in an
incubator at 37°C with 5% CO2. Complete medium change was done every 2 days. Once
the cell cultures were 80-90% confluent, cells were replated 1:4 in 10 cm tissue culture
plates with 10 ml of complete alpha-MEM for expansion.
2.4 Cryopreservation
Cells at specific passages were cryopreserved using 80% serum (complete alpha-MEM,
10% Fetal Bovine Serum, 1x Antibiotic-Antimycotic) and 20% dimethyl sulfoxide
(Sigma Life Science, Lot# RNBD5041), in either 1 ml or 1.5 ml cryovials. The vials were
placed in an isopropanyl buffered container (Mr. Frosty) for step freezing at a rate of -
1ºC/minute to -80ºC overnight and then transferred to liquid nitrogen for long term
storage.
2.5 Flow Cytometry Analysis
Cell surface antigen expression was analyzed by flow cytometry. Cells at passage 1
(n=40), p5 (n=20), and p10 (n=20) were harvested by treatment with 0.25% trypsin-
EDTA, washed using 10 ml of PBS (-/-), and re-suspended in stain buffer (PBS -/- with
1% fetal bovine serum) at a concentration of 1x107 cells/ml. When cell number was a
limiting factor, cells were re-suspended at a concentration of 5x106 cells/ml, or lower.
100 μl of prepared cell suspension was aliquoted into a total of nine tubes. Cells were
incubated with 2 μl of IgG from mouse serum (Sigma, Canada) in the dark for 10 minutes.
Cells were then stained using the Human MSC Analysis Kit (BD Biosciences, Canada)
57
with the appropriate antibody diluted 1:10 or 1:30, as listed in Table 1. After incubation
for 30 minutes on ice in the dark, cells were washed twice with 1 ml of stain buffer and
centrifuged at 400xg for 2 minutes. Afterwards, cells were re-suspended in 300 μl of stain
buffer and 0.5 μl of DAPI was added to each tube. Antibody binding was analyzed using
a Beckman Coulter flow cytometer. Multicolour fluorescent beads (Flow-Set Pro
Fluorospheres, Beckman Coulter Ireland, Inc., Lot#3125121) were used for instrument
standardization and to ensure reproducibility of each experiment, where the fluorescence
of the beads in each channel was adjusted to match the fluorescence values from previous
experiments. All plots were generated using Kaluza Flow Analysis Software (Beckman
Coulter). Debris and auto-fluorescence were removed by using forward scatter (FS) and
side scatter (SS). Two light scatter parameters, FS and SS, were used to ensure a stringent
gating of single cells. A dot plot depicting side scatter time of flight (SS TOF) vs. SS
peak was first used to gate single cells. Aggregates which escaped the single cell gate
could be seen as the few events which were high in forward scatter time of flight (FS
TOF) signal in the second dot plot. The 488 nm blue laser detected both scatter
parameters. DAPI was then used to discriminate between live, apoptotic, and dead cell
populations. A gate was used to select DAPI negative (live cells) on a FL9: DAPI vs.
forward scatter peak dot plot. The maximum number of events that was used for each
analysis was 15,000 cells. Isotype controls were included in the analysis to identify
positive and negative cell populations, ensuring that the observed staining is due to
antibody binding to surface epitopes, rather than artefact, and that non-specific binding to
Fc receptors is excluded (AbD Serotec, 2015). Compensation controls were done for each
fluorochrome and this was used to subtract the spectral overlap of specific fluorochromes.
58
Table 1: Antibodies and fluorochromes used to analyze UCT-MSCs.
Tube Test
1 FITC Mouse Anti-Human CD90 (1:30 dilution)
2 PE Mouse Anti-Human CD44 (1:30 dilution)
3 PerCP-Cy5.5 Mouse Anti-Human CD105 (1:30 dilution)
4 APC Mouse Anti-Human CD73 (1:30 dilution)
5 Nothing
6 hMSC Positive Isotype Control Cocktail (1:10 dilution)
PE hMSC Negative Isotype Control Cocktail (1:10 dilution)
7 hMSC Positive Cocktail (1:10 dilution)
PE hMSC Negative Cocktail (1:10 dilution)
8 hMSC Positive Isotype Control Cocktail (1:10 dilution)
PE Mouse IgG2b,k hMSC Positive Isotype Control Cocktail (1:10 dilution)
9 hMSC Positive Cocktail (1:10 dilution)
PE Mouse Anti-Human CD44 (1:30 dilution)
Table 1. Antibody markers used to stain each sample, PE, phycoerythrin; FITC,
fluorescein isothiocyanate; PerCP-Cy5.5, peridin chlorophyll protein-cyanine 5.5; APC,
allophycoerythrin.
59
2.6 RNA Extraction and Real-Time PCR
Total RNA was extracted (RNeasy Mini kit; Quigen) from 16 randomly chosen MSC
umbilical cord samples (passage 4), from cryopreserved cells. Cryovials were obtained
from liquid nitrogen, and immediately incubated in a 37°C water bath for 2 minutes. The
cells were then transferred, drop-wise, to a 50 ml Falcon tube containing 10 ml of alpha-
MEM medium. Cells were pelleted at 290xg for 5 minutes, after which the supernatant
was removed and RNA was extracted from each sample. RNA concentration was
quantified using a Nanodrop Spectrophotometer and for a subset of samples, RNA
integrity was looked at using the Agilent RNA ScreenTape Assay (Agilent Technologies,
Canada). 0.38 µl/µg of total RNA per sample was used for cDNA synthesis using reverse
transcriptase (Superscript III Reverse Transcriptase; Invitrogen). cDNA concentrations
were quantified using a Nanodrop Spectrophotometer. Real time RT-PCR analysis was
completed in triplicate for human GAPDH and human TSG-6 for all samples (Table 2). A
primer optimization protocol was done to determine the ideal concentration for each
primer pair. The optimal concentration for TSG-6 was found to be 300 nM of forward
primer and 900 nM of reverse primer. The primer concentrations for GAPDH used was
300 nM of forward primer and 300 nM of reverse primer. SYBR Green PCR MasterMix
(Invitrogen, Canada) was used for gene amplification and analyzed using the Applied
Biosystems 7900HT PCR machine. Reaction profiles consisted of an incubation at 95°C
for 10 seconds, followed by 40 cycles at 95°C for 15 seconds and 60°C for 1 minute, and
lastly 95°C for 15 seconds, 60°C for 15 seconds, and 95°C for 15 seconds. Data was
analyzed with the Sequence Detection Software 2.1 (Life Technologies), using the
standard curve method.
60
Table 2: Real time RT-PCR Primer Sequences.
Gene Forward and Reverse Primer Sequence (5′ to 3′) Amplicon Size (bp)
TSG-6
F: AGCACGGTCTGGCAAATACA
129
R: GCAGCACAGACATGAAATCCAAT
GAPDH
F: CGAGCCACATCGCTCAGA
95
R: AGTTAAAAGCAGCCCTGGTGA
Table 2. List of the forward and reverse primer sequences for human TSG-6 and human
GAPDH and the amplicon size. The melting temperature of the primers was 60°C.
GAPDH= Glyceraldehyde 3-phosphate dehydrogenase, TSG-6= TNF-alpha stimulated
gene 6.
61
2.7 Cytokine Array
2.7.1 Array Procedure
The cytokine and growth factor expression profile of three umbilical cord samples were
compared using a proteome assay (R&D Systems, Minneapolis, USA). Passage 5 were
obtained from liquid nitrogen, and thawed in a 37°C water bath for 2 minutes. The cells
were then transferred, drop-wise, to a 50 ml Falcon tube containing 10 ml of alpha-MEM
medium. Cells were pelleted at 290xg for 5 minutes. The supernatant was then removed
and cells were re-suspended in 1 ml of complete alpha-MEM, after which 0.5 ml of the
suspension was plated onto one 10 cm tissue culture dish. 10 ml of complete alpha-MEM
was added to each dish afterwards and cells were incubated at 37°C with 5% CO2. A
complete medium change was done 24 hours post-thaw and every 2 days afterwards.
Cells were passaged 1:4 onto 10 cm culture dishes when confluency was reached. At
passage 7, cells were plated at 100,000 cells/well in a 24 well dish. Duplicate wells were
done for each cord sample. Cells were maintained in 2 ml/well of complete alpha-MEM
and medium change was done every two days. The cells were allowed to reach 80%
confluency, at which point 1 ml of complete alpha-MEM was added to each well. The
supernatant was conditioned for 48 hours prior to the assay. All reagents and the protocol
outline were conducted according to the manufacturer's instructions using the Human
Cytokine Array C1000: AAH-CYT-1000 (R&D Systems, Minneapolis, USA). This
antibody array kit analyzed 55 different cytokines and chemokines in duplicate on each
membrane (Table 3). The conditioned medium was collected (1 ml for each sample) and
centrifuged at 290xg for 5 minutes. The array membranes were incubated for 1 hour in
blocking buffer. Membranes were then incubated with 1 ml of prepared sample,
62
containing cell supernatant with a detection antibody cocktail, overnight in a cold room
(2-4°C) on a rocking platform. Membranes were then washed for 10 minutes on a rocking
platform. This was repeated three times, after which diluted streptavidin-HRP was added.
The membranes were incubated for 0.5 h at room temperature on a rocking platform.
Afterwards, membranes were washed three times for 10 minutes each followed by
incubation for 1 minute with a Chemi Reagent Mix. Membranes were exposed to X-ray
film (Denville Scientific Inc., Metuchen NJ) for 2, 5, and 10 minutes. Pixel density was
measured using the ImageJ Software (National Institutes of Health).
63
Table 3: Cytokines detected in the array kit.
Systematic Name Abbreviation Alternative
Nomenclature
Reference Spot
Activin A
ADAMTS-1
Angiogenin ANG
Angiopoietin-1 Ang-1
Angiopoitein-2 Ang-2
Angiostatin/Plasminogen
Amphiregulin AR
Artemim
Reference Spot
Coagulation Factor III TF
Chemokine (C-X-C motif) ligand 16 CXCL16
Dipeptidyl Peptidase IV DPPIV CD26
Epidermal Growth Factor EGF
Endocrine Gland-Derived Endothelial
Growth Factor
EG-VEGF PK1
Endoglin CD105
Endostatin/Collagen XVIII
Endothelin-1 ET-1
Fibroblast Growth Factor acidic FGF acidic FGF-1
Fibroblast Growth Factor basic FGF basic FGF-2
Fibroblast Growth Factor-4 FGF-4
Fibroblast Growth Factor-7 FGF-7 KGF
Glial Cell-Derived Neurotrophic Factor GDNF
Granulocyte-Macrophage Colony-
Stimulating Factor
GM-CSF
Heparin-binding EGF-like Growth Factor HB-EGF
Hepatocyte Growth Factor HGF
Insulin-like Growth Factor-Binding Protein 1 IGFBP-1
Insulin-like Growth Factor-Binding Protein 2 IGFBP-2
Insulin-like Growth Factor-Binding Protein 3 IGFBP-3
Interleukin-1β IL-1β IL-1F2
Interleukin-8 IL-8 CXCL8
LAP (TGF-β1)
Leptin
Monocyte Chemoattractant Protein-1 MCP-1 CCL2
Macrophage Inflammatory Protein-1α MIP-1α CCL3
Matrix Metalloproteinase-8 MMP8
Matrix Metalloproteinase-9 MMP9
NRG1- β1 HRG- β1
Pentraxin 3 PTX3 TSG-14
64
Platelet-Derived Endothelial Cell Growth
Factor
PD-ECGF
Platelet-Derived Growth Factor-AA PDGF-AA
Platelet-Derived Growth Factor-AB/ Platelet-
Derived Growth Factor-BB
PDGF-AB/PDGF-
BB
Persephin
Platelet Factor 4 PF4 CXCL4
Placental Growth Factor PIGF
Prolactin
Serpin B5 Maspin
Serpin E1 PAI-1
Serpin F1 PEDF
Tissue Inhibitor of Metalloproteinases-1 TIMP-1
Tissue Inhibitor of Metalloproteinases-4 TIMP-4
Thrombospondin-1 TSP-1
Thrombospondin-2 TSP-2
Urokinase-type Plasminogen Activator uPA
Vasohibin
Vascular Endothelial Growth Factor VEGF
Vascular Endothelial Growth Factor-C VEGF-C
Reference Spots
Negative Control
Table 3. A list of the 55 cytokines and chemokines detected in duplicate on nitrocellulose
membranes, showing the systematic names and alternative nomenclature.
65
2.7.2 Data Analysis
Pixel density was quantified using ImageJ Software (National Institutes of Health). In
order to obtain the net cytokine value, each image was converted to greyscale and an
inverted value for each cytokine was calculated by subtracting the pixel density obtained
on ImageJ, for each cytokine, from 255. The background pixel density from each
membrane was subtracted from the net cytokine value. Afterwards, each cytokine value
was normalized to the loading control. The average of four density values was then
calculated to obtain the final pixel density for each respective cytokine.
2.8 Excisional Murine Model
2.8.1 Surgical Procedure
Ten-week old db/db C57BL/6 mice were purchased from The Jackson Laboratories
(Jackson Laboratories, Stock #000642). Twelve-week old db/db C57BL/6 mice were
used for their impaired wound healing capabilities. Mice were individually housed for
two weeks prior to surgeries in an animal facility with a 12-hour light/dark schedule.
Each mouse was provided ad libitum access to food and water. On the day of the
surgeries, the back of each mouse was shaved with an electric clipper followed by the
application of Nair, to ensure that all hair was removed. The surgery site was wiped clean
with an alcohol swab. An isoflurane gas chamber was used to induce anaesthesia in each
mouse, at 1-4% isoflurane. Each mouse was maintained at a 1-2% isoflurane level during
the surgery. Mice were individually anesthetised using a subcutaneous injection of
buprenorphine Temgesic (0.15 mg/kg). A silicone splint was attached to the back of each
mouse using an adhesive (Krazy Glue, Elmer's Inc., Columbus, OH) and four nylon
sutures were used to ensure that the splint was fixed to the back of each mouse. A sterile
66
6-mm biopsy punch was used to induce a full thickness wound extending through the
panniculus carnosus, centered in the middle of the splint, on the back of each mouse.
CT15P8 and CT16P8 MSCs were obtained from liquid nitrogen and thawed, after which
3x106 cells were resuspended in 40 μl of PBS (-/-) and applied topically on each wound,
followed by 40 μl of a fibrin sealant. For control mice, 40 μl of alpha-MEM media was
applied to the wound bed, followed by 40 μl of a fibrin sealant. A clear polyurethane
dressing (Tagaderm) was placed over the entire wound area. Animals were transferred to
a clean cage, and placed under a warming lamp for 10 minutes to recover from the
procedure. The mice were house in the animal facility at LTRI.
2.8.2 Wound Analysis
Digital pictures of the wounds were taken with a Nikon camera at day 0, day 3, day 7,
day 10 and day 14 post surgery. The wound area was analyzed by measuring the area of
splint (the inner diameter only) and the area of the wound (by delineating the margins of
the wound) on each respective day, using ImageJ Software (National Institutes of Health)
(Figure 5). The ratio of the percent of remaining wound relative to the splint was
calculated. The final wound area was calculated as a percent of the original wound
(denoted as 100%), created on day 0.
67
Figure 5. Representative images illustrating how wound closure and healing are
calculated. The splint as well as wound area were traced, after which the inner area of the
splint (A) was compared against the area of the wound (B). Final wound closure on each
respective day was calculated as a percent of the original wound size (day 0, denoted as
100%).
Figure 5: Wound healing calculations.
68
2.8.3 Tissue Collection and Fixation
An isoflurane gas chamber was used to induce anaesthesia in each mouse, at a 1-4%
isoflurane concentration, for approximately 1 minute. Mice were euthanized by cervical
dislocation. Tagaderm dressing was removed, and the wound area, including the splint
was excised, cut in half, and fixed in 10% formalin for 120 minutes at 4°C. Tissues were
washed in 1 x PBS (-/-) and stored in 70% ethanol for 48 hours. The tissues were then
dehydrated in a graded ethanol series (80% for 30 minutes, 95% for 45 minutes, and
twice in 100% ethanol for 60 minutes). The tissues were cleared in toluene two times for
60 minutes, immersed in paraffin at 65°C, and embedded in paraffin blocks. The
embedded tissues were sectioned on a microtome and cut into 5 µm sections, placed on
Fisherbrand Superfrost Plus (Fisher Scientific) microscope slides, and allowed to dry
overnight.
2.8.4 Immunohistochemistry
Immunohistochemistry was done on paraformaldehyde fixed tissue sections. All samples
were embedded in paraffin and underwent routine histological processing. Sections were
deparaffinized in xylene and rehydrated using an ethanol gradient on a Leica staining
machine. TBE buffer or citrate buffer was used for antigen retrieval, performed in a
microwave. Tissue sections were blocked using goat serum. Sections from all mice were
incubated, overnight at 4°C, with the following antibodies: rabbit anti-Ki-67 (Thermo
Fisher Scientific Inc., USA), mouse anti-smooth muscle actin (Dako, CA, USA), rabbit
anti-human collagen IV (Abcam, Crambridge, MA, USA), and mouse anti-cytokeratin 6
(Biolegend, CA, USA). Sections were stained with secondary antibodies conjugated to
Alexa Fluor 488 Goat Anti-Mouse IgG or Alexa Fluor 594 Donkey Anti-Rabbit IgG.
69
Sections were then incubated in DAPI for five minutes for nucleus visualization. Slides
were mounted using DABCO. Each section was visualized under using a Zeiss LSM 510
confocal microscope. Sections were also stained with haematoxylin and eosin. A wound
was considered entirely healed if the wound bed was completely filled in with new tissue,
spanning the area of the whole wound.
2.9 Statistical Analysis
A two-tail student’s t-test for paired data was done to assess significance between passage
numbers for immunophenotypic analysis. Wound closure comparisons were performed
by a two-way ANOVA followed by a Bonferroni post hoc test. Statistical analysis was
done using GraphPad Prism Software. Significance was assumed for p<0.05.
70
Chapter Three: Results
71
3. Results
3.1 MSC Isolation Efficiency and Explant Culture
Most MSC studies have used cells derived from the BM. As a result, there is a plethora of
information regarding BM-MSCs, specifically in regards to their growth characterises,
immunophenotype, and passage variation. Among the other sources of MSCs being
studied are MSCs derived from the UCT. Although some research groups have looked at
characterizing this cell type, the information is sparse or contradictory. As a result we
aimed to characterize a large sample size of MSCs derived from human umbilical cord
tissue. Characterization includes; isolation efficiency, growth characteristics,
immunophenotype, passage variation and therapeutic potential.
Information pertinent to collection was recorded, such as the mother's age, the type of
birth, gender and baby weight (Table 4). Information that was not collected at the time of
birth is denoted as N/A. Most cord samples were collected from vaginal deliveries, from
a maternal age range of 21-41 years old.
There are different methods to isolate MSCs from UCT, the most common is to first
isolate the Wharton's jelly followed by collagenase treatment to separate out the MSCs.
In this study we opted for the less expensive and less labour intensive method of directly
isolating MSCs from explant cultures. This method relies on a culture medium that
selectively supports the growth of MSCs and not other cells of the cord such as
endothelial cells. Cutting small sections of cord tissue and plating them in selective
medium allows for minimal manipulation and does not require the use of collagenase,
which is both expensive and adds an extra regulatory hurdle when obtaining approval for
clinical use of the UCT-MSCs. Although the different types of cells that can be isolated
72
from UCT, including MSCs, endothelial cells, muscle, pericytes and blood, all have
proven therapeutic properties, for clinical use the population of cells must be defined. In
this study I set out to determine the characteristics and properties of the cells isolated
using a defined explant culture system.
As described in the materials and methods, freshly collected umbilical cords, drained of
blood were washed, sectioned and frozen. Cell isolation was done on frozen tissue that
was quickly thawed at 37ºC for 2 minutes, rinsed in alpha-MEM/5% FBS. Tissue was
placed onto dry tissue culture plates and medium was added as to not disrupt the tissue.
Cell outgrowth appeared 5-38 days after the initial plating (Table 5). Figure 6 depicts the
results as a bar graph. All cells that appeared from the tissue were heterogeneous in size
however demonstrated a typical MSC spindle shaped appearance. There were also few
cells that resembled endothelial cells. The cells migrated away from the tissue and at first
were scattered and demonstrated no organization. As the cells proliferated and became
more confluent they aligned forming parallel organized sheets of cells. For all samples
plated the cells were not passaged until the 35 mm well was 80% confluent. The contents
of the well was counted and all of it was passaged onto a 10 cm plate (designated as
passage 1). The average number of cells obtained at first passage, from one 35 mm well,
was 75, 000 for a subset of 9 UCT-MSC samples (Figure 7). At this point all samples
exhibited elongated spindle shaped appearance. Cells were passaged 1:4 onto 10 cm
plates once confluency was reached. Cord tissue samples yielded different cell counts
with passaging (Figure 8).
73
Table 4: Personal data collected for each cord sample.
Table 4. Personal data collected for each cord tissue sample includes maternal age, type
of birth, gender of newborn, as well as weight of newborn (g).
Cord Tissue
Sample
Age of Mother Type of Birth Gender of
Newborn
Weight of Baby
(g)
CT 16 27 Vaginal Male 3164
CT 17 35 Vaginal Female 3840
CT 18 21 Vaginal Female N/A
CT 19 39 Vaginal Female N/A
CT 20 31 Vaginal Female N/A
CT 21 34 Vaginal Male 3101
CT 22 31 Vaginal Male 2795
CT 23 33 Vaginal Female 4015
CT 24 38 Vaginal Female 2380
CT 25 41 N/A N/A N/A
CT 26 34 Vaginal Male 2965
CT 27 34 Caesarian Female 3528
CT 28 30 Caesarian Female 3359
CT 29 30 Vaginal Male 3294
CT 30 31 Vaginal N/A 3355
CT 31 34 Vaginal N/A 2930
CT 32 29 Vaginal Female 6700
CT 33 30 Vaginal Female N/A
CT 34 35 Caesarian Female 3355
CT 35 40 Vaginal Male N/A
74
Table 5: Growth characteristics of individual cord samples.
Table 5. Time to cell outgrowth ranged from 5-38 days, depending on the cord tissue
sample.
Cord Tissue Sample Time to Cell Outgrowth (Days)
CT 16 15
CT 17 16
CT 18 16
CT 19 16
CT 20 16
CT 21 16
CT 22 16
CT 23 16
CT 24 16
CT 25 14
CT 26 17
CT 27 27
CT 28 14
CT 29 17
CT 30 22
CT 31 14
CT 32 22
CT 33 14
CT 34 14
CT 35 14
CT 36 38
CT 37 38
CT 38 17
CT 39 17
CT 40 17
CT 41 17
CT 42 5
CT 43 5
CT 44 5
CT 45 5
CT 46 5
CT 47 38
CT 48 5
CT 49 5
CT 50 20
CT 51 5
CT 53 5
CT 54 5
CT 55 5
75
Figure 6. Time to cell outgrowth for 40 UCT-MSC samples.
Figure 6. Time to cell outgrowth ranged from 5-38 days, depending on the cord tissue
sample.
76
Figure 7. Cell number obtained at first passage for 9 UCT-MSC samples.
Figure 7. The average number of cells obtained at first passage was 75,000 cells/ 35 mm
well dish for a subset of 9 UCT-MSCs.
77
Figure 8. Cell number obtained at each passage for three MSC populations.
Figure 8. Variable cell numbers were attained for CT17, CT19, and CT22 with passaging.
Cell counts at each passage represent the results obtained for one 10 cm plate. Each plate
was passaged 1:4 when confluency was reached.
78
3.2 MSC Immunophenotype
Immunophenotypic analysis of MSCs obtained from explant culture was done by flow
cytometry analysis for each cord sample at early (n=40), mid (n=20) and late (n=20)
passages to analyze cell surface marker expression. All UCT-MSC samples were
analyzed using the BD Stem Flow Human MSC Analysis Kit. Cells at each passage were
collected, and stained with a positive cocktail of markers, consisting of a set of markers
showing specificity for stromal cells, a negative cocktail, containing a set of markers used
to identify hematopoietic cells, compensation controls, as well as respective isotope
controls. All samples analyzed illustrated similar phenotypic cell surface expression
profiles. Figure 9 shows three cord samples stained for the positive and negative human
monoclonal antibodies at early, mid, and late passages.
When analyzing the same 20 samples at early, mid, and late passages, we observed that
the greatest number of cells expressing makers indicative of hematopoietic cells were
found at the earliest passage analyzed (p2), indicating that the isolation procedure results
in a heterogeneous cell population. There is a significant decrease in the number of cells
expressing hematopoietic markers from p2 to p10 (P<0.01). The percent of cells showing
CD45 expression was significantly reduced at mid and late passages, thus suggesting that
the media selects for MSCs specifically (Figure 10). No difference in the detection
profiles of the expression levels of CD44 was noticed at low (99.7% ± 0.059), mid
(99.5% ± 0.374), or high (99.2% ± 0.372) passage. The same trend was observed for
CD90 at low (99.7% ± 0.0787), mid (99.8% ± 0.05029) and high (99.0% ±0.56848)
passage, as well as with CD73 at low (99.7% ± 0.0579) mid (99.5% ± 0.0146) and high
(99.2% ± 0.3415) passage. It was noticed that CD105 expression was lower when
79
compared to the other positive markers, and its expression levels also decreased with
increasing passage numbers, illustrating the lowest expression at passage 10 (84.7% ±
3.525). There was a significant decrease in cell surface expression of CD105 from p5 to
p10 (P<0.05).
Because I started with 40 independent samples but only carried 20 samples all the way
through the ten passages, a graph with the complete data is presented in Figure 11. This
includes the additional 20 UCT-MSC samples for passage 2 only. A significant decrease
of CD105 expression was noticed from p2 to p10, and from p5 to p10.
80
P2
FS Peak
FS Peak
CD
90
FIT
C
CD
73
AP
C
CD
44
PE
Figure 9: Colour density plots of CT16, CT24, and CT15 at early, mid and late
passages.
A.
B.
C.
.
CD
34
/11
b/1
9/4
5/H
LA
-DR
PE
C
D3
4/1
1b
/19
/45
/HL
A-D
R P
E
P5
P10
P2
P5
P10
CD
10
5 P
er-C
P-C
Y5
.5
CD
90
FIT
C
CD
34
/11
b/1
9/4
5/
HL
A-D
R P
E
CD
73
AP
C
CD
44
PE
CD
10
5 P
er-C
P-C
Y5
.5
CD
90
FIT
C
CD
73
AP
C
CD
44
PE
CD
10
5 P
er-C
P-C
Y5
.5
FS Peak
81
Figure 9. Flow cytometry analysis of cord samples of CT16 at p2, p5, and p10 (Figure
9A), CT24 at p2, p5, and p10 (Figure 9B) and CT15P7 (Figure 9C) showing cell surface
expression of hematopoietic makers and the stromal makers CD44, CD73, CD90, and
CD105 at each time point.
82
Figure 10. Flow cytometry analysis of cord samples (n=20) at early, mid and late
passages illustrates decreasing expression of hematopoietic markers with passaging while
exhibiting constant expression of CD44, CD90, and CD73. Hematopoietic markers
significantly decrease from p2 to p10 and CD105 expression is significantly lower from
p5 to p10. Values are ± SE. *P<0.05, **P<0.01.
Figure 10: Percent of cells illustrating expression of hematopoietic and stromal
markers at early, mid, and late analysis for 20 samples analyzed at each passage.
83
Figure 11: Percent of cells illustrating expression of hematopoietic and stromal
markers at early, mid, and late analysis for 40 samples analyzed at early passage
and 20 cord tissues analyzed at mid and late passages.
Figure 11. Flow cytometry analysis of cord samples at early (n=40), mid (n=20) and late
passages (n=20) illustrates decreasing expression of hematopoietic markers with
passaging while exhibiting constant expression of CD44, CD90, and CD73. CD105
expression is significantly decreased when comparing p2 to p10 and p5 to p10. Values
are ± SE. *P<0.05.
84
3.3 MSC Wound Healing Efficiency
Cultures of MSCs from different donors are being used in animal models as well as many
clinical trials, however, the cells have shown to be heterogeneous in nature, exhibiting
variations in their therapeutic efficacy. The therapeutic capacity of MSCs have been
proposed to be due to the secretion of various cytokines and chemokines. These trophic
factors have been shown to affect migration, proliferation, and survival of the cells
surrounding the wound (Maxson, Lopez, Yoo, Danilkovitch-Miagkova, & Leroux, 2012).
Others have suggested that the expression levels of a subset of key genes are responsible
for the immune suppressive and inflammation modulating capabilities of the cells, such
as hemeoxygenase 1, cyclooxygenase 2, IL1 receptor antagonist, and TGF-β1. However
it has recently been shown that in BM-MSCs, these markers are not significantly
correlated with the ability of the cells to attenuate the inflammatory response. Several
recent studies have suggested that a strong significant correlation can be found with the
gene TSG-6. BM-MSCs that express high mRNA levels of TSG-6 show better efficacy in
various animal models. The potent anti-inflammatory effects of MSCs have been
suggested to be due to TSG-6 protein secretion, and various mechanisms of action have
been proposed. TSG-6 has been suggested to bind to hyaluronic acid as well as inter-
alpha-inhibitor, interacting through the CD44 receptor found on macrophages, ultimately
decreasing the nuclear translocation of NF-kB through TLR-2, hence reducing the
inflammatory response (Choi et al., 2011). Respectively, TSG-6 was suggested to be a
correlative gene that may be used as a marker of the in vivo efficacy of MSCs. To our
knowledge, there is limited information regarding the correlation between TSG-6 and the
cytokine secretion profile of UCT-MSCs. Consequently, we aimed to test the levels of
85
TSG-6 mRNA in a subset of UCT-MSC samples and examine whether this is closely
correlated with the cytokine secretion profiles as well as wound healing capabilities of
UCT-MSCs.
3.4 TSG-6 Expression
Total RNA was isolated from each sample and RNA integrity was analyzed from a subset
of cord samples (P4) (n=15) using Agilent RNA ScreenTape Assay (Agilent
Technologies, Canada) (Table 6). All of the samples analyzed had a RNA integrity
number (RIN) greater than 9.3, indicating high integrity RNA. We noticed that the
expression levels of TSG-6 mRNA varied widely among the samples, where some UCT-
MSCs expressed high levels of TSG-6 mRNA, and others showed a markedly decreased
expression (Figure 12). Not all of the samples analyzed for TSG-6 mRNA expression
levels contained data pertaining to maternal age and newborn weight. However, for the
cord tissue samples for which this information was available, no correlation between
TSG-6 mRNA expression and maternal age (Figure 13A) or the weight of the newborn
(Figure 13B) was found.
86
Table 6: RNA integrity analysis for a subset of UCT-MSCs analyzed for TSG-6
mRNA expression levels.
Table 6. Each MSC population that was analysed by real time RT-PCR was tested for the
integrity of the RNA samples extracted and the ratio of 28S:18S ribosomal RNA.
Figure 12. Real-time RT-PCR assays for human-specific mRNA for TSG-6. MSCs from
different cord samples at passage 4 express varying levels of TSG-6. Values are
normalized by standard curve for hGAPDH and for CT34P4. Values are ± SE.
Sample RIN
CT16P4 9.7
CT17P4 9.4
CT20P4 9.6
CT21P4 9.7
CT26P4 9.3
CT30P4 9.4
CT33P4 9.3
CT29P4 9.6
CT34P4 9.9
CT35P4 9.7
CT15P7 9.3
Figure 12: Variable TSG-6 mRNA expression among a subset of UCT-MSC
samples.
87
Figure 13: TSG-6 mRNA correlation with maternal age and newborn weight.
A.
B.
Figure 13. Maternal age (Figure 13A) and newborn weight (Figure 13B) are not
correlated with TSG-6 mRNA levels.
y = -0.0477x + 1.9153
R² = 0.281
-0.5
0
0.5
1
1.5
2
0 5 10 15 20 25 30 35 40 45
Maternal Age
Rel
ativ
e TS
G-6
mR
NA
Exp
ress
ion
Lev
el
y = -0.0001x + 0.9088
R² = 0.0091
0
0.2
0.4
0.6
0.8
1
1.2
1.4
1.6
1.8
2
0 500 1000 1500 2000 2500 3000 3500 4000 4500
Newborn Weight (g)
Rel
ativ
e TS
G-6
mR
NA
Exp
ress
ion
Lev
el
88
3.5 Cytokine Secretion Analysis
Previous studies on MSCs from various sources has yielded insight into the secreted
cytokines and has suggested that the trophic factors released by the cells depends on the
tissue of isolation, but does not vary widely from donor to donor among identical
isolation sources (Park et al., 2009). To our knowledge, limited insight is available on the
trophic factors secreted by UCT-MSCs. In our study, a comparison was done between
three cord samples, CT15P8 showing low TSG-6 mRNA expression, CT24P8 illustrating
no TSG-6 mRNA expression, and CT16P8 illustrating a high TSG-6 mRNA expression.
A cytokine antibody array kit was used to analyse the expression of 55 proteins in the
conditioned medium of three respective samples. Each array was done in duplicate, and
the results of those experiments are plotted separately (Figure 14). A threshold of 0.3 was
chosen to discriminate between cytokines secreted at high and low amounts. The results
obtained illustrate that even though there were slight variations in the cytokines secreted
for each MSC sample, the cytokines secreted at high levels were the same among the
three samples. Activin A, ANG, IGFBP-3, IL-8, PTX-3, TIMP-1, thromobosondin-1, and
urokinase-type uPA were highly expressed in all three samples, while DPPIV and
PDGFAA was high only in CT15 (Figure 14A), and angiopoietin 1 and HGF was highly
expressed only in CT16 (Figure 14B). GM-CSF and serpin F1 were found to be highly
expressed only for CT15 and CT16. No cytokines were found to be uniquely expressed
for CT24 only (Figure 14C).
89
Figure 14: Cytokine secretion profiles of CT15 expressing low TSG-6 mRNA, CT16
expressing high TSG-6 mRNA, and CT24 illustrating no TSG-6 mRNA expression.
A.
B.
90
C.
D.
Figure 14. Analysis of CT15P8 having low TSG-6 mRNA expression (Figure 14A),
CT16P8 illustrating high TSG-6 mRNA expression (Figure 14B), and CT24P8 showing
no TSG-6 mRNA expression (Figure 14C) indicates similar cytokine secretion profiles of
cord units expressing low vs. high TSG-6 mRNA levels. Figure 14D shows media only.
Values are ± SE.
91
3.6 Murine Excisional Wound Healing
Diabetes is a systemic disease that affects the whole body, mainly characterized by an
inability of beta cells to sufficiently supply the body with insulin and hence adjust for
increased glucose concentrations (Kahn, Cooper, & Del Prato, 2014). Type II diabetes is
characterized by insulin resistance, declining insulin production, and eventual pancreatic
beta-cell failure (Kahn et al., 2014). One of the complications arising from diabetes
includes chronic non-healing wounds. There have been many animal models that have
been used to replicate human physiology in diabetes. However, many rodent models do
not effectively replicate human wound healing, which is characterized by re-
epithelization and granulation tissue formation. One of the factors responsible for this
discrepancy is the significant difference between murine and human wound healing. Mice
heal mainly by contraction, due to a subcutaneous panniculus carnosus muscle layer,
whereas humans heal by granulation tissue formation and re-epithelization (Wong, Sorkin,
Glotzbach, Longaker, & Gurtner, 2011). Our lab has developed a murine excisional splint
wound healing model, which closely mirrors human wound healing. This is done by
creating a full thickness wound, which effectively removes the panniculus carnosus layer,
on the back of mice. Splints are then centered and fixed on the skin using an adhesive and
four sutures. The main goal of our study was to compare the wound healing efficiencies
of UCT-MSCs isolated from CT15P8, showing low levels of TSG-6 mRNA expression,
to cells isolated from CT16P8, expressing high levels of TSG-6 mRNA. Mice
administered only media were used as controls. Digital pictures were taken on day 0, 3, 7,
10, and day 14 (Figure 15A). Upon analysis of digital pictures, no significant differences
were noticed between mice receiving CT15 or CT16. However, there was a significant
92
difference between wound closures for CT15 and CT16 treated mice versus controls at
most of the time points studied. CT-treated mice showed a progressive closure of the
wound lesion, with 72% ±2.64 of the original wound by day 3, 53% ±2.122 by day 7,
39% ±5.54 by day 10, and 28% ±3.35 by day 14. A similar trend was seen for CT16-
treated mice, with 72% ±5.63 of the wound closed by day 3, 61% ± 8.93 closed by day 7,
47% ±6.23 closed by day 10, and 32% ±2.15 closed by day 14 (Figure 15B). Histological
analysis of CT16 (Figure 16) and CT15 (Figure 17) illustrated complete wound closure,
whereas analysis of digital photos only showed a 28% ±3.96 and 32% ±2.15 wound
closure by day 14, respectively. Excisional wounds treated with CT15 and CT16 showed
a more robust and faster rate of healing when compared with control mice. Some control
mice (2 out of 4 mice studied) did not show any healing of the wound bed (Figure 18A),
while two mice illustrated complete re-epithelisation of the wound bed with small blood
vessels visible within the wound (Figure 18 B,C). Additionally, some fat cells could be
seen within the newly formed tissue of a control mouse. However, a thick distinct keratin
layer was seen for control mice that had healed. As a result, even though the wound was
fully closed, this suggests that there may be more scarring in the control mice when
compared with CT15 and CT16 treated mice. All mice for both cord tissues illustrated
complete wound closure. Histological examination of the wounds from CT16, CT15 and
control mice disclosed variations in the thickness of granulation formation, presence and
number of newly formed blood vessels, as well as fat within the new tissue. For all the
animals studied, the wound bed was not developed enough for there to be striations of the
skin, specifically fully stratified squamous epithelium. Many chronic inflammatory cells,
such as lymphocytes as well as neutrophils, could be seen, as detected by cell
93
morphology. Fibroblasts could be seen at the top of the wounds. Immunohistochemistry
illustrated that CT16-treated mice showed a trend towards a greater number of cells
positive for Ki67 than for CT15-treated wounds (Figure 19B). A greater amount of
collagen IV, appearing in the epidermis and dermis, as well as β-catenin positive sections
were noticed for CT16 (Figure 19 B,C) rather than CT15 treated wounds (Figure 20).
Collagen IV, cytokeratin 6, and β-catenin staining was seen around the around the wound
margins for CT15-treated mice (Figure 20). Even though some muscle could be seen in
the histology sections for CT16 and CT15- treated mice, this was most likely not newly
formed muscle.
94
Figure 15: Wound closure analysis.
A. Control CT15P8 CT16P8
Day 0
Day 3
Day 7
Day 10
Day 14
B.
95
Figure 15. Digital pictures (Figure 15A) illustrate wound closure of CT15 (having low
TSG-6 mRNA expression) and CT16 (having high TSG-6 mRNA expression) when
compared with control mice at days 0, 3, 7, 10, and 14. Wound area analysis (Figure 15B),
done by comparing the % of the original wound on day 0 with each respective day
analyzed, illustrates that CT15 and CT16 had a similar rate of healing and show a greater
wound closure when compared with control mice. aa, P<0.01 for CT15 versus control;
aaa, P<0.001 for CT15 versus control, b, P<0.05 for CT16 versus control, bb, P<0.01 for
CT16 versus control.
96
Figure 16: Wound bed histology for CT16-treated mice.
97
Figure 16. H&E staining of wounds treated with CT16. (A) All mice (n=5) illustrated
complete wound closure by day 14. Arrows in Figure 16A indicates original wound edges
(H&E, x1.25). (B) Mice illustrated different thickness of granulation tissue formation, as
well as blood vessels and some fat cells that have formed within the wound lesion. The
wound beds were infiltrated with chronic inflammatory cells (H&E, x5, inset, x20). (C)
Fibroblast cells can be noticed at the top of the wound. Arrows indicate fibroblast cells.
(H&E, x20). Ke= keratin, AT= adipose tissue, V=blood vessels, GT=granulation tissue.
Images show one representative animal.
98
Figure 17: Wound bed histology for CT15-treated mice.
99
Figure 17. H&E staining of wounds treated with CT15. (A) All mice (n=5) illustrated
complete wound closure by day 14. Arrows in Figure 17A indicates original wound edges
(H&E, x1.25). (B) Mice illustrated different thickness of granulation tissue formation, as
well as blood vessels and some fat cells that have formed within the wound lesion. The
wound beds were infiltrated with many inflammatory cells (H&E, x5, inset, x20). (C)
Fibroblast cells can be noticed at the top of the wound. Arrows indicate fibroblast cells
(H&E, x20). Ke= keratin, AT= adipose tissue, V=blood vessels, GT=granulation tissue.
Images show one representative animal.
100
Figure 18: Wound bed histology for control mice.
101
Figure 18. H&E staining of control mice. (A) Some mice (n=2) did not show wound
closure after 14 days. Arrows in Figure 18A indicates original wound edges (H&E,
x1.25). (B) A subset of mice (n=2) showed complete wound closure. Arrows in Figure
18B indicates original wound edges (H&E, x1.25). (C) Mice illustrated granulation tissue
formation, with blood vessels and some fat cells present within the wound lesion. The
wounds bed were infiltrated with many chronic inflammatory cells, such as lymphocytes.
Fibroblast cells can be seen at the top of the wound (H&E, x5, inset, x40). Ke= keratin,
AT= adipose tissue, V=blood vessels, GT=granulation tissue. Images show two
representative animals.
102
Figure 19. (A) Confocal microscopy illustrated that there was greater expression of
collagen IV around the wound edge for CT16-treated mice with compared with CT15-
treated mice. (B) A trend toward a greater number of Ki67 positive cells was also noticed,
based on observations of the sections. Arrows indicate cells stained positive for Ki67. (C)
β-catenin staining was also seen at the edge of the wound. Arrow indicates delineation
between wound bed and wound edge. Scale bar= 50 µm.
Figure 19: Wound bed immunohistochemistry for CT-16 treated mice.
103
Figure 20. (A) Confocal microscopy illustrated the expression of collagen IV, noticed
around the wound edge for CT15 treated mice. Arrow indicates boundary between wound
bed and wound edge. (B) Cytokeratin 6 staining was also seen around the wound edge.
(C) β-catenin staining was seen near the wound lesions for CT15-treated mice. Scale bar=
50 µm.
Figure 20: Wound bed immunohistochemistry for CT-15 treated mice.
104
Chapter Four: Discussion
105
4. Discussion
4.1 Changes in MSC profile with culture
MSCs have emerged in recent years as cells that can be used as ideal therapeutic
candidates for tissue repair, various diseases and pathologies. Traditionally, MSCs were
isolated from hematopoietic sources, such as bone marrow, peripheral blood, and
umbilical cord blood. They have also been isolated from parenchymal non-hematopoietic
tissues such as muscle, fat, or liver (Tolar, Le Blanc, Keating, & Blazar, 2010). However,
isolation from some sources, such as the bone marrow, can be painful and lead to possible
infection. Other sources, such as peripheral blood, contain only a very small number of
MSCs. As a result, our lab has used an explant method of MSC isolation from umbilical
cord tissue. This method is cost effective, simple, and yields a large number of expanded
cells over a few passages. Moreover, it does not impact the donor negatively or incur any
pain or risk of infection, as cord tissue is usually discarded as medical waste. In our study,
the cord samples were collected from across Canada, from both vaginal and caesarean
delivery, from a maternal age range of 21-41 years old.
It has been suggested that all cultures of MSCs are homogenous, while others have shown
differences in immunophenotype and wound healing capabilities between patients. MSCs
which are isolated and expanded under different culture conditions differ in their
properties and therapeutic potential (Prockop, 2009). MSCs expanded from various
sources have been used in many animal models as well as some clinical trials. Earlier
passages have been documented to be ideal, as some reports suggest that ex vivo
prolonged culture may be correlated with genomic alterations, changes in cell
morphology as well as surface marker profile expression (Otte, Bucan, Reimers, & Hass,
106
2013; Y. Wang et al., 2013). Phenotypic characterization studies have shown that UCT-
MSCs express CD73, CD90 and CD105 in 99% of the cells in P1, however, this
decreases slightly during passaging until P11 (Otte et al., 2013). Others have suggested
that passaging does not have an effect on the immunophenotypic profile of UCT-MSCs,
exhibiting the ability to maintain a stable expression of stromal markers even at higher
passages (Shi, Zhao, Qiu, He, & Detamore, 2015). UCT-MSCs have been shown to be
negative for markers indicative of hematopoietic cells (Shi et al., 2015). As a result, we
sought to address the question of patient to patient differences and also passage variation
for surface epitopes in MSC populations isolated from 40 umbilical cord tissue samples
analyzed at p2, and 20 analyzed at p5 and p10, using the protocol developed in our lab.
The data obtained demonstrates that by using our explant isolation procedure as well as
culture conditions, a heterogeneous population of cells are isolated at early passages,
including both stromal as well as hematopoietic cells. However, with passaging, the
hematopoietic cells are lost, suggesting that the media conditions are specific for MSCs.
We have also demonstrated that CD105 expression is lower when compared with CD44,
CD73, and CD90, and that there is a significant decrease in CD105 expression with
passaging. The reduction in surface expression of CD105 has also been shown with cord
blood derived MSCs (Gaebel et al., 2011). CD105, also known as Endoglin, is a type I
membrane glycoprotein belonging to the TGF-β complex. It has important functions in
angiogenesis, proliferation, and adhesion (Mark et al., 2013). Additionally, TGF-β and
Endoglin have been suggested to play important roles in wound healing, regulating
different cellular functions, such as recruitment of stem cells to the wound (Valluru,
Staton, Reed, & Brown, 2011). Endoglin is also decreased on MSCs with an increased
107
differentiation potential (Valluru et al., 2011). Cord blood derived MSCs selected for
high CD105 surface expression were seen to enhance heart performance and reduce scar
formation (Gaebel et al., 2011). This illustrates that MSC populations that show a higher
expression of CD105 may be more effective in treating cardiac ischemia (Gaebel et al.,
2011). Also, the percentage of MSCs expressing Endoglin have been shown to be
increased during brain injury (Valluru et al., 2011). Taken together, this could suggest
that MSCs from earlier passages, expressing higher levels of CD105, may have better
wound healing properties.
Although MSCs have been shown to have many positive effects in various animal models
of injury, such as stroke, type I and type II diabetes, and GvHD, the engraftment of MSCs
and the differentiation into different cell types at the wound site is usually low. As a
result, several studies have looked at various optimization strategies to increase the
efficacy of MSC based therapies. This includes transgenic approaches in which MSCs
over-express proteins of interest, preconditioning of MSCs by in vitro priming (for
example culture in hypoxic conditions), and attempting to shift MSC distribution in the
body by altering cell surface receptors (J. Wagner, Kean, Young, Dennis, & Caplan,
2009). However, despite these various optimization approaches, MSCs alone have been
shown to have significant wound healing capabilities. This has mainly been attributed to
paracrine and trophic factors released by the cells, having pro-regenerative roles in anti-
inflammation, angiogenesis, immunomodulation, and antifibrosis (J. Wagner et al., 2009).
4.2 Paracrine Signalling
MSCs rarely engraft into tissues or generate newly differentiated cells, thus attributing
their mode of action on surrounding cells and tissues to a multitude of secreted trophic
108
factors (Caplan & Dennis, 2006). Key cytokines that have been identified as being
secreted by MSCs include VEGF-A, MCP-1, FGF-1, MMP-8, and MMP-9 (Briquet et al.,
2010). Other cytokines, adhesion molecules, and metalloproteinases that have been
detected in human BM-MSC conditioned medium include IL-6, IL-8, vascular cell
adhesion protein 1 (VCAM-1), intercellular adhesion molecule 1 (ICAM-1), MMP-2,
MMP-3, MMP-13 and TIMP-4 (Briquet et al., 2010). Various other studies have also
looked at the secretome of different donor derived BM-MSCs, applying a similar assay
that was used in our study, and found that the key cytokines constitutively expressed
included IL-6, IL-8, MCP-1, Chemokine (C-C motif) ligand 5 (CCL5), chemokine (C-X-
C motif) ligand 1 (CXCL1), INF-γ, IL1-α, TGF-β, GM-CSF, and angiogenin (Hwang et
al., 2009). The same study did not find constitutive expression of MIP-1α, IL-2, IL-4, IL-
10, IL-12, and IL-13, however showed that BM-MSCs were very similar to CB-MSCs in
regards to the cytokines secreted (Hwang et al., 2009). The findings in our study are in
accordance with these sources, as highly expressed cytokines from three different cord
tissue samples included activin A, MCP-1, IL-8 and others such as TIMP-1, angiopoietin,
and GM-CSF. In the context of wound healing, VEGF is a crucial promoter of cell
proliferation, migration and chemotaxis, and angiogenesis (Guo & Dipietro, 2010). Along
with VEGF, angiopoietins also have effects on the vascular endothelium, however unlike
VEGF, angiopoietins do not regulate endothelial cell proliferation (Werner & Grose,
2003). In diabetic mice, wounds exhibit an imbalance of VEGF-A and angiopoietins,
specifically showing higher levels of angipoietin-2 (causing vessel destabilization and
remodeling) and lower levels of VEGF-A (Werner & Grose, 2003). Conversely,
angiopoietin-1 has been shown to stabilize blood vessels in healing wounds (Werner &
109
Grose, 2003). MCP-1, a chemokine known as macrophage chemoattractant protein-1, is a
major chemoattractant for monocytes/macrophages and influences the gene expression of
murine macrophages (Werner & Grose, 2003). It has also been shown to attract T cells
and mast cells to the wound site and is a major bioactive chemoattractant for neutrophils
(Werner & Grose, 2003). High amounts of IL-8 has been found to stimulate inflammation
and inhibit wound contraction (Werner & Grose, 2003). In vitro, wound repair was
impaired by IL-8 due to inhibition of keratinocyte proliferation and collagen lattice
contraction by fibroblasts, however others have found stimulatory effects of IL-8 on
keratinocyte proliferation (Werner & Grose, 2003). GM-CSF, granulocyte-macrophage
colony stimulating factor, was another highly expressed cytokine found in our study. It is
mitogenic for keratinocytes and stimulates migration and proliferation of endothelial cells,
thus enhancing neovascularization and granulation tissue formation (Werner & Grose,
2003). TIMPs (tissue inhibitors of matrix metalloproteinases), also found to be highly
expressed in our study, are capable of inhibiting all of the MMPs, endopeptidases which
have diverse roles in wound healing, such as degradation of the extracellular matrix,
facilitating migration of cells to the centre of the wound, eliminating damaged protein
(Muller et al., 2008). However, their expression in chronic wounds is reduced (Muller et
al., 2008). Additionally, the levels of MMPs usually decrease in normal wound healing,
but chronic wounds have been shown to have an increased production of pro-
inflammatory cytokines and proteases such as MMPs (Muller et al., 2008). Chronic
wounds are thus characterized by a reduced expression of TIMPs, usually produced by
fibroblasts, and this results in an imbalance of the ratio of TIMPs and MMPs in wounds,
ensuing in poor healing by the breakdown of too many components of the extracellular
110
matrix and by the inhibition of growth factors that are essential for tissue synthesis
(Muller et al., 2008). Thus, the presence of TIMP-1 in the conditioned medium of MSCs
could restore this imbalance. Activin A, a member of the TGF-β superfamily, regulates
various aspects of cell growth and differentiation, such as inducing the expression of
growth factors in dermal fibroblasts, which can thus stimulate keratinocyte proliferation
in a paracrine manner (Werner & Grose, 2003). The important role of Activin A in the
timely formation of granulation tissue and scar has been shown with transgenic mice
overexpressing soluble activin antagonist in the epidermis (Werner & Grose, 2003).
Among the three cord tissue samples studied, we found that the cytokine secretion profile
was similar and comparable, thus suggesting that MSCs isolated from any cord tissue can
be used as a potential therapeutic agent, without major differences in the therapeutic
capacity of the cells. Our finding is consistent with other reports which have
demonstrated that MSCs derived from different sources, such as human placenta, cord
blood and bone marrow have a common cytokine expression pattern, including
expression of macrophage migration inhibitory factor (MIF), IL-8, serpin E1, Gro-α, and
IL-6 (Hwang et al., 2009). It should be noted that contradictory to these findings, a subset
of studies have also noticed differences between the secretome profiles of MSCs from
various anatomical locations. For example, MSCs derived from the bone marrow, adipose
tissue, and dermal tissue showed similar expression of VEGF-A, angiogenin, FGF basic,
and nerve growth factor, however, MSCs derived from adipose tissue expressed
significantly higher levels of IGF-1, VEGF-D, and IL-8 (Hsieh et al., 2013). Our study
suggests that the MSCs from cord tissue are similar, and that we are isolating comparable
cell populations from different patient samples. However, it should be taken into account
111
that there have been reported differences between cytokine secretion analysis using a
proteome profiler, like we used in our study, and PCR analysis (Hwang et al., 2009). This
suggests that future studies may look to address if there are differences in cytokine
expression between different cord samples by also using PCR analysis. Other techniques
that could be used to verify the results obtained using the cytokine array could be by
Western blot analysis.
4.3 Diabetes Complications
MSCs have been used as potential therapeutic agents in many animal models. Particularly,
it has been shown that growth factor deficiencies have been accounted for as an important
factor contributing to diabetic wound healing impairment. Many complications can arise
from diabetes, including obesity, various metabolic abnormalities such as impaired
function of many cells types, inflammation, alterations in adipokines, cardiovascular
disease characterized by atherogenic dyslipidemia and increased levels of free fatty acids,
changes in thrombosis and fibrinolysis, as well as non-healing wounds (Pandey, Chawla,
& Guchhait, 2015). Healing requires an orderly, but overlapping, progression of three key
events, specifically inflammation, proliferation and angiogenesis and remodelling.
However, in those with diabetes, these events are often prolonged, lacking, or faulty. This
is mainly due to an impairment of cytokine production by local cells, such as fibroblasts
and endothelial cells, and also reduced angiogenesis (Wu et al., 2007). Additionally,
aging has shown to cause a delay in wound healing, and every stage of the wound healing
process has shown be affected in advanced age (Guo & Dipietro, 2010). This includes
enhanced platelet aggregation, increased secretion of inflammatory mediators, delayed
infiltration of macrophages and lymphocytes, impaired macrophage function, decreased
112
secretion of growth factors, delayed re-epithelization, delayed angiogenesis and collagen
deposition, reduced collagen turnover and remodelling, and decreased wound strength
(Guo & Dipietro, 2010). Effective treatment options are still lacking, as currently
available options are able to achieve only a 50% healing rate (Wu et al., 2007). UCT-
MSCs have been proposed to be the optimal therapeutic cells for enhancing tissue repair
due to ease of isolation as well as the multiple paracrine factors that they release. In order
to study the effects of the cells on cutaneous wounds, our lab has developed a db/db
excisional wound mouse model. We use a splint model because it prevents healing of
murine skin by contraction, which is the main mechanism of wound healing in mice, and
allows the wound to heal by re-epithelization and granulation tissue formation. Full-
thickness wounds also ensure removal of the panniculus carnosus layer, which is present
in loose skinned species, such as mice, and is attached to the base of the dermis
(Davidson, 2001). Wounds in splinted mice have shown to have an increased time to
complete wound closure, as well as increased granulation tissue formation when
compared to non-splinted mice (Galiano et al., 2004).
4.4 TSG-6 and Wound Healing
Even though numerous clinical trials have been done with MSCs, there is a large
variability in the quality of MSCs isolated due to heterogeneity of cell cultures (R. H. Lee
et al., 2014). Recent data has suggested that TSG-6 could be used as an informative
biomarker to predict the in vivo efficacy of the cells. However, MSCs derived from BM,
rather than UC, were used in these studies. As a result, we were interested in knowing if
there are variations in wound healing capacities among cord tissue samples dependent on
their TSG-6 mRNA expression levels of TSG-6. Ultimately, we wanted to know if TSG-6
113
gene expression could be used as a marker in our model to reliably predict the wound
healing capacity of the cells in vivo. MSCs from two different cord tissues, CT16
expressing high levels of TSG-6 mRNA, and CT15, expressing low levels of TSG-6
mRNA, were topically applied to excisional wounds in mice and wound lesions were
monitored over a period of 14 days by taking digital pictures. We found that between the
two cord samples, there was no significant difference in wound closure although both
resulted in a statistically significant faster wound closure compared to controls.
Histological analysis illustrated that the new tissue extended across the wound and that
blood vessels, both large and small (depending on the mouse), could be noticed within
the wound bed for both CT16 and CT15-treated wounds. There were variations in the
number and size of blood vessels for each mouse but no difference attributed to the cord
tissue used were noted. In some mice, fat cells could also be noticed within the newly
formed tissue. The granulation tissue is characterized by small capillaries and fibroblasts.
Many late stage inflammatory cells could be noticed within the wound lesion for both
animals, such as lymphocytes. Fibroblasts could be noticed within the wound bed, but
also at the top of the wounds, most likely trying to make collagen to replace lost tissue.
Since the basement membrane between the epidermis and dermis is damaged in full
thickness skin wounds, the wound cannot healing by re-epithelization alone and
fibroblasts are needed to make new ECM (Stroncek JD, 2008). Some dark pieces of
tissue could be noticed next to the wound, and sometimes even extending into the wound.
This is probably scab that has formed, containing dead cells. However, complete healing
of the skin, specifically, formation of fully stratified squamous epithelium, was not seen.
Unwounded skin has three main layers, the epidermis which is composed of a squamous
114
epithelium which proliferates and produces a layer of keratin, which is constantly shed
(Barbara Young, 2014). The layer below is the dermis, which is tightly bound to the
epidermis by a basement membrane (Barbara Young, 2014). It supports the epidermis
and is composed of fibrous and fibroadipose tissue (Barbara Young, 2014). Residing in
this layer are blood vessels, sensory receptors, and nerves (Barbara Young, 2014). The
layer beneath the dermis is called the hypodermis, and it contains larger vessels which
support and drain the blood vasculature (Barbara Young, 2014). This layer extends to the
underlying connective tissue. Additionally, in later stages of the healing process,
myofibroblasts undergo apoptosis, the granulation tissue, which is initially rich is cells,
becomes scar tissue characterized by an excess of ECM and limited cell numbers
(Stroncek JD, 2008). Capillary density also is reduced, and the wound becomes paler,
rather than the pink colour that is characteristic of the earlier phases of wound healing
(Stroncek JD, 2008). However, these structures were not noticed to have formed for the
time frame used in our study.
Some control mice did not heal at all (2 out of 4). A thin collagen section was observed,
as a result, there was no scaffold for epithelial cells to migrate across the wound.
However, two out of four control mice did illustrate healing and new tissue formation,
however the quantity as well as quality of granulation tissue differed from MSC treated
wounds. Small blood vessels as well as fat could be noticed within the wound bed and
next to the wound lesion of these mice, many inflammatory cells could be noticed, which
have probably migrated from the surrounding vessels. Additionally, neovascularisation
was reduced in control mice used in this study. This may be due to the fact that MSCs
secrete many cytokines that play a role in angiogenesis. Such as VEGF, as well as FGF2,
115
both promoting angiogenesis in wounds (P. Martin, 1997) In genetically diabetic mice, it
has been shown that VEGF is not expressed at wound lesions, hence impairing healing
and neovascularisation (P. Martin, 1997). Cytokine secretion analysis using conditioned
medium from three cord tissue units illustrated that the highly secreted cytokines are
similar between the three samples. Generally, MSCs secrete high levels of growth factors
from the chemkoine family and those associated with angiogenesis (Potian et al., 2003).
The factors that were found to be highly expressed in our study are known to have roles
in wound healing. Activins, members of the TGF-β superfamily of proteins, have shown
to regulate various aspects of cell growth and differentiation in many tissues and organs
(Werner & Grose, 2003). Angiopoietin along with VEGF act on the vascular endothelium,
however unlike VEGF, angiopoietins do not regulate endothelial cell proliferation
(Werner & Grose, 2003). Rather angiopoietin-1 causes stabilization of blood vessels,
whereas angiopoietin-2 causes vessel destabilization and remodelling (Werner & Grose,
2003). Other highly expressed factors in our study, such as IL-8, have been found to be
important for neutrophil chemoattraction, stimulation of re-epithelization and
keratinocyte proliferation (Werner & Grose, 2003). Our study did not look at cell
engraftment because we used a model that was equivalent to a non-matched allogeneic
transplant model. We chose this model to specifically study paracrine signalling effects
without confounding factors related to engraftment or differentiation. Initially, it was
thought that MSCs accelerate the wound healing process due to direct participation in the
repair process and incorporation into the regenerated tissue (Shin & Peterson, 2013).
Nonetheless, previous studies have shown that MSCs are not maintained within the
wound bed, and that there is a rapid decline in the number of cells in the wound bed (Shin
116
& Peterson, 2013). It is now known that MSC act indirectly, facilitating the host repair
process (Shin & Peterson, 2013). Hence, our model uses mice with a functional immune
system, therefore we are mainly looking at the cytokine effects of MSCs rather than cell
engraftment or differentiation.
Observational analysis of immunohistochemistry staining illustrated there was a trend
toward more Ki67 positive cells around the wound bed in CT16-treated mice, illustrating
greater cellular proliferation. The cells staining positive were not found on the newly
formed tissue, but rather in the adjacent or more distal areas from the wound. Staining
was found to be mostly distributed in the epidermis or dermis, rather than the basal layer
of the skin. Ki67 staining during wound healing has also been indicative of the activation
of keratinocytes around the wound lesion (Xu et al., 2012). During wound healing,
keratinocytes are first present at the leading edge of the wound, then migrate across the
wound bed to dissolve the fibrin clot that has been created (P. Martin, 1997). There was
also more collagen IV positive areas that were noticed for CT16 rather than CT15, seen at
the wound margins. Collagen IV is a major protein of the basement membrane, and it
plays important roles in the maintenance of basement membrane integrity, has filtration
functions, and also stores growth factors (Poschl et al., 2004). Collagen IV staining was
expected due to the fact that reproduction of collagen in the dermal layer is an important
part of wound healing (Xu et al., 2012). Keratin 6 staining was found in small amounts
for mice treated with CT16. The keratin 6 gene is activated in cells within the hair
follicles surrounding the wound and are a source of keratinocytes. The keratinocytes
migrate up the hair shaft and form a proliferating pool of cells at the wound edge and then
migrate across the wound.
117
Alpha-smooth muscle actin staining could not be found in mice treated with either CT15
or CT16. In the more advanced stages of healing, about a week after wound induction,
wound fibroblasts transform into myofibroblasts which have been shown to express
alpha-smooth muscle actin (P. Martin, 1997). These cells are vital for generating strong
contractile forces and bringing the edges of the wound closer together (P. Martin, 1997).
However, in our study no staining for alpha-smooth muscle, a main constituent of large
blood vessels, could be detected in the newly formed tissue. Muscle could be noticed in
the basal layer of the wound for a small number of mice by haematoxylin and eosin
examination. This appears to be skeletal muscle in the transverse plane. Nevertheless, it is
most likely not newly formed muscle, as the tissue is not developed enough for new
muscle to have been generated. β-catenin staining was noticed around the wound edges,
but more positive areas could be seen for CT16, rather than CT15-treated wounds. β-
catenin levels are usually elevated during the proliferative phases of wound healing, and
have been shown to mediate fibroblast proliferation (Cheon et al., 2006). It has also been
suggested to maintain cells in a less differentiated state during wound healing,
particularly mesenchymal progenitor cells (Cheon et al., 2006).
Despite our histological examination that confirmed full wound closure, analysis of
digital pictures did not yield full closure by day 14. This is due to the fact that in some
mice, a large white/yellow substance formed in the middle of the wound by day 3 and
remained thereafter, hence making accurate measurement of wound closure difficult. This
was seen for both control mice as well as MSC treated mice. A possible explanation for
the formation of this could be the accumulation of dead cells in the centre of the wound.
This could also be necrotic fibrin, alternatively known as fibrin eschar (Joseph M
118
McCulloch, 2010). Necrotic fibrin can be identified by a yellow or tan appearance, which
is in accordance with the observed colour of the yellow pellet formed in the middle of the
wound (Joseph M McCulloch, 2010). The technique of analyzing serial pictures of the
same animal to assess wound closure (macroscopic analysis) does not always represent a
reliable measurement of the repair process, as factors such as inflammation or matrix
deposition cannot be seen visually (Ansell et al., 2014). As a result, histological analysis
is considered the gold standard method to obtain reliable and accurate information
(Ansell et al., 2014). It has been shown that incisional wounds show a greater correlation
between macroscopic wound examination and histology analysis (Ansell et al., 2014).
Also, the results obtained regarding digital analysis of wound closure are subjective and
interpretation may vary from person to person in delineating the margins of new tissue
formation and wound closure. Hence, there may be differences in wound closure
measurement when it is done by different interpreters. This obstacle occurred in our study,
where the results I obtained of wound closure, differed from the results that were
obtained when the analysis was done by a more experienced interpreter (Figure 21A vs.
Figure 21B). Interpretation of data in this thesis was done using the results obtained from
the more experienced interpreter in our lab to ensure accuracy, reliability and
reproducibility of the data. Additionally, two mice for CT15 on days 7, 10 and 14 were
removed from the analysis. This is due to fact that the wound bed contained excessive
amount of exudate, and hence an accurate measurement of wound closure could not be
made (Figure 22).
119
Figure 21: Wound closure analysis illustrating different interpretations.
A.
B.
Figure 21. Wound closure analysis of digital photographs can be subjective. Figure 21A
is the analysis of wound closure done by a more experienced interpreter in our lab.
However, Figure 21B is the analysis of wound closure I obtained. Values are ± SE. a,
P<0.05 for CT15 versus control; aa, P<0.01 for CT15 versus control, b, P<0.05 for CT16
versus control, bb, P<0.01 for CT16 versus control.
120
Day 0
Day 3
Day 7
Day 10
Day 14
Figure 22. CT15-treated mouse wound calculations excluded for days 7, 10 and 14 due
to copious exudate formation, hence making wound healing interpretations difficult.
Figure 22: CT15-treated mouse wound healing calculations excluded for days 7, 10,
and 14.
121
5. Conclusion and Future Studies
MSCs have shown therapeutic potential in a plethora of in vivo animal models, and
positive effects, mainly using BM-MSCs, have also been documented in clinical trials.
Even though various tissues have been used for cell isolation, UCT represents an ideal
source due to the ease of collection and a lack of complications associated with cell
isolation. We have used an explant method to isolate MSCs from 20 different cord tissues,
and have shown that phenotypically, the cells look identical among all the patient
samples analyzed. A heterogeneous population of cells is first isolated, showing some
cells expressing markers indicative of hematopoietic cells, however, with passaging a
more homogenous population of MSCs is obtained. No variation in standard stromal
surface epitopes was noticed with passaging, with the exception of a significant decrease
of CD105 surface expression from early to late passages, although at p10 over 80% of the
cells were positive.
It has been suggested that the wound healing capacity of MSCs differs among various
cell populations, and that TSG-6 gene expression can be used to predict the in vivo
efficacy of the cells. Our results demonstrated that the relative expression of TSG-6
mRNA varied widely among a subset of 15 cord samples, however this variation did not
seem to correlate with the cytokine secretion profile of umbilical cord tissues. Moreover,
TSG-6 mRNA levels were not predicative of the wound healing capacity of UCT-MSC
preparations in a db/db excisional wound healing mouse model since both low and high
expressing UCT-MSC populations demonstrated similar rates of wound closure. Overall,
we can conclude from this study that umbilical cord tissue may be an ideal source of
122
MSCs, as regardless of patient source or of the gene expression profile, cells seem to
possess the same positive therapeutic potential, which is ideal for clinical settings.
Future studies could look to document cell engraftment. As a result, differentiation
studies could also be done in the future, as this information would be pertinent to
engraftment studies. Perhaps TSG-6 could affect differentiation efficiency into
mesenchymal cell sources such as bone, adipose, and cartilage. Also, future studies could
be done to assess different MSC populations in regards to CD105 expression for wound
healing, comparing the efficacy of CD105 high and CD105 low MSC populations.
Additional studies might be warranted to investigate if other delivery systems, besides the
fibrin matrix used in this study, would be more beneficial for growth factor secretion as
well as cell survival. A number of different delivery systems exist which could be tested
in this model, for example collagen matrices as well as hydrogels, such as collagen-
pullulan hydrogels (Chen et al., 2012). Also, the stage of wound healing that was seen by
histological examination was not advanced. Future studies could perhaps allow healing to
occur for a longer duration of time (three weeks instead of two weeks), so that fully
stratified squamous epithelium might be formed. Lastly, the primary goal of this study is
to be able to apply UCT-MSCs for cell based therapies for cutaneous non-healing wounds
for diabetic patients in the future. Clinical trials could be carried out to test the potential
of UC-MSCs clinically, in diabetic patients with foot ulcers.
123
6. References
AbD Serotec. (2015). Isotype controls in flow cytometry. Retrieved August 18, 2015,
2015, from https://www.abdserotec.com/flow-cytometry-isotype-controls.html
Aggarwal, S., & Pittenger, M. F. (2005). Human mesenchymal stem cells modulate
allogeneic immune cell responses. Blood, 105(4), 1815-1822. doi: 10.1182/blood-
2004-04-1559
Ankrum, J. A., Ong, J. F., & Karp, J. M. (2014). Mesenchymal stem cells: immune
evasive, not immune privileged. Nat Biotechnol, 32(3), 252-260. doi:
10.1038/nbt.2816
Ansell, D. M., Campbell, L., Thomason, H. A., Brass, A., & Hardman, M. J. (2014). A
statistical analysis of murine incisional and excisional acute wound models.
Wound Repair Regen, 22(2), 281-287. doi: 10.1111/wrr.12148
Armulik, A., Genove, G., & Betsholtz, C. (2011). Pericytes: developmental,
physiological, and pathological perspectives, problems, and promises. Dev Cell,
21(2), 193-215. doi: 10.1016/j.devcel.2011.07.001
Arno, A. I., Amini-Nik, S., Blit, P. H., Al-Shehab, M., Belo, C., Herer, E., . . . Jeschke, M.
G. (2014). Human Wharton's jelly mesenchymal stem cells promote skin wound
healing through paracrine signaling. Stem Cell Res Ther, 5(1), 28. doi:
10.1186/scrt417
Badiavas, E. V., & Falanga, V. (2003). Treatment of chronic wounds with bone marrow-
derived cells. Arch Dermatol, 139(4), 510-516. doi: 10.1001/archderm.139.4.510
Bara, J. J., Richards, R. G., Alini, M., & Stoddart, M. J. (2014). Concise review: Bone
marrow-derived mesenchymal stem cells change phenotype following in vitro
culture: implications for basic research and the clinic. Stem Cells, 32(7), 1713-
1723. doi: 10.1002/stem.1649
Barbara Young, P. W., Geraldine O'Dowd. (2014). Skin Wheater's Functional Histology
(Sixth ed.). Philadelphia, PA: Elsevier Ltd.
Bernardo, M. E., Locatelli, F., & Fibbe, W. E. (2009). Mesenchymal stromal cells. Ann N
Y Acad Sci, 1176, 101-117. doi: 10.1111/j.1749-6632.2009.04607.x
Bianco, P., Robey, P. G., & Simmons, P. J. (2008). Mesenchymal stem cells: revisiting
history, concepts, and assays. Cell Stem Cell, 2(4), 313-319. doi:
10.1016/j.stem.2008.03.002
Bieback, K., Kern, S., Kluter, H., & Eichler, H. (2004). Critical parameters for the
isolation of mesenchymal stem cells from umbilical cord blood. Stem Cells, 22(4),
625-634. doi: 10.1634/stemcells.22-4-625
Boroviak, T., Loos, R., Bertone, P., Smith, A., & Nichols, J. (2014). The ability of inner-
cell-mass cells to self-renew as embryonic stem cells is acquired following
epiblast specification. Nat Cell Biol, 16(6), 516-528. doi: 10.1038/ncb2965
Brem, H., & Tomic-Canic, M. (2007). Cellular and molecular basis of wound healing in
diabetes. J Clin Invest, 117(5), 1219-1222. doi: 10.1172/JCI32169
Briquet, A., Dubois, S., Bekaert, S., Dolhet, M., Beguin, Y., & Gothot, A. (2010).
Prolonged ex vivo culture of human bone marrow mesenchymal stem cells
influences their supportive activity toward NOD/SCID-repopulating cells and
committed progenitor cells of B lymphoid and myeloid lineages. Haematologica,
95(1), 47-56. doi: 10.3324/haematol.2009.008524
124
Bryder, D., Rossi, D. J., & Weissman, I. L. (2006). Hematopoietic stem cells: the
paradigmatic tissue-specific stem cell. Am J Pathol, 169(2), 338-346. doi:
10.2353/ajpath.2006.060312
Campagnoli, C., Roberts, I. A., Kumar, S., Bennett, P. R., Bellantuono, I., & Fisk, N. M.
(2001). Identification of mesenchymal stem/progenitor cells in human first-
trimester fetal blood, liver, and bone marrow. Blood, 98(8), 2396-2402.
Caplan, A. I., & Dennis, J. E. (2006). Mesenchymal stem cells as trophic mediators. J
Cell Biochem, 98(5), 1076-1084. doi: 10.1002/jcb.20886
Chamberlain, G., Fox, J., Ashton, B., & Middleton, J. (2007). Concise review:
mesenchymal stem cells: their phenotype, differentiation capacity, immunological
features, and potential for homing. Stem Cells, 25(11), 2739-2749. doi:
10.1634/stemcells.2007-0197
Chen, J. S., Wong, V. W., & Gurtner, G. C. (2012). Therapeutic potential of bone
marrow-derived mesenchymal stem cells for cutaneous wound healing. Front
Immunol, 3, 192. doi: 10.3389/fimmu.2012.00192
Cheon, S. S., Wei, Q., Gurung, A., Youn, A., Bright, T., Poon, R., . . . Alman, B. A.
(2006). Beta-catenin regulates wound size and mediates the effect of TGF-beta in
cutaneous healing. FASEB J, 20(6), 692-701. doi: 10.1096/fj.05-4759com
Choi, H., Lee, R. H., Bazhanov, N., Oh, J. Y., & Prockop, D. J. (2011). Anti-
inflammatory protein TSG-6 secreted by activated MSCs attenuates zymosan-
induced mouse peritonitis by decreasing TLR2/NF-kappaB signaling in resident
macrophages. Blood, 118(2), 330-338. doi: 10.1182/blood-2010-12-327353
Choudhery, M. S., Khan, M., Mahmood, R., Mehmood, A., Khan, S. N., & Riazuddin, S.
(2012). Bone marrow derived mesenchymal stem cells from aged mice have
reduced wound healing, angiogenesis, proliferation and anti-apoptosis capabilities.
Cell Biol Int, 36(8), 747-753. doi: 10.1042/CBI20110183
Chua, S. J., Bielecki, R., Yamanaka, N., Fehlings, M. G., Rogers, I. M., & Casper, R. F.
(2010). The effect of umbilical cord blood cells on outcomes after experimental
traumatic spinal cord injury. Spine (Phila Pa 1976), 35(16), 1520-1526. doi:
10.1097/BRS.0b013e3181c3e963
Conget, P. A., & Minguell, J. J. (1999). Phenotypical and functional properties of human
bone marrow mesenchymal progenitor cells. J Cell Physiol, 181(1), 67-73. doi:
10.1002/(SICI)1097-4652(199910)181:1<67::AID-JCP7>3.0.CO;2-C
Czechanski, A., Byers, C., Greenstein, I., Schrode, N., Donahue, L. R., Hadjantonakis, A.
K., & Reinholdt, L. G. (2014). Derivation and characterization of mouse
embryonic stem cells from permissive and nonpermissive strains. Nat Protoc, 9(3),
559-574. doi: 10.1038/nprot.2014.030
da Silva Meirelles, L., Caplan, A. I., & Nardi, N. B. (2008). In search of the in vivo
identity of mesenchymal stem cells. Stem Cells, 26(9), 2287-2299. doi:
10.1634/stemcells.2007-1122
Dash, N. R., Dash, S. N., Routray, P., Mohapatra, S., & Mohapatra, P. C. (2009).
Targeting nonhealing ulcers of lower extremity in human through autologous
bone marrow-derived mesenchymal stem cells. Rejuvenation Res, 12(5), 359-366.
doi: 10.1089/rej.2009.0872
Davidson, J. M. (2001). Experimental Animal Wound Models. Wounds. 13(1). Retrieved
August 17, 2015
125
De Ugarte, D. A., Alfonso, Z., Zuk, P. A., Elbarbary, A., Zhu, M., Ashjian, P., . . . Fraser,
J. K. (2003). Differential expression of stem cell mobilization-associated
molecules on multi-lineage cells from adipose tissue and bone marrow. Immunol
Lett, 89(2-3), 267-270.
Deans, R. J., & Moseley, A. B. (2000). Mesenchymal stem cells: biology and potential
clinical uses. Exp Hematol, 28(8), 875-884.
Di Nicola, M., Carlo-Stella, C., Magni, M., Milanesi, M., Longoni, P. D., Matteucci,
P., . . . Gianni, A. M. (2002). Human bone marrow stromal cells suppress T-
lymphocyte proliferation induced by cellular or nonspecific mitogenic stimuli.
Blood, 99(10), 3838-3843.
Diegelmann, R. F., Lindblad, W. J., & Cohen, I. K. (1986). A subcutaneous implant for
wound healing studies in humans. J Surg Res, 40(3), 229-237.
Dykstra, B., Kent, D., Bowie, M., McCaffrey, L., Hamilton, M., Lyons, K., . . . Eaves, C.
(2007). Long-term propagation of distinct hematopoietic differentiation programs
in vivo. Cell Stem Cell, 1(2), 218-229. doi: 10.1016/j.stem.2007.05.015
English, K., French, A., & Wood, K. J. (2010). Mesenchymal stromal cells: facilitators of
successful transplantation? Cell Stem Cell, 7(4), 431-442. doi:
10.1016/j.stem.2010.09.009
Evans, M. J., & Kaufman, M. H. (1981). Establishment in culture of pluripotential cells
from mouse embryos. Nature, 292(5819), 154-156.
Falanga, V. (2005). Wound healing and its impairment in the diabetic foot. Lancet,
366(9498), 1736-1743. doi: 10.1016/S0140-6736(05)67700-8
Falanga, V., Iwamoto, S., Chartier, M., Yufit, T., Butmarc, J., Kouttab, N., . . . Carson, P.
(2007). Autologous bone marrow-derived cultured mesenchymal stem cells
delivered in a fibrin spray accelerate healing in murine and human cutaneous
wounds. Tissue Eng, 13(6), 1299-1312. doi: 10.1089/ten.2006.0278
Fraser, J. K., Wulur, I., Alfonso, Z., & Hedrick, M. H. (2006). Fat tissue: an
underappreciated source of stem cells for biotechnology. Trends Biotechnol, 24(4),
150-154. doi: 10.1016/j.tibtech.2006.01.010
Friedenstein, A. J., Chailakhjan, R. K., & Lalykina, K. S. (1970). The development of
fibroblast colonies in monolayer cultures of guinea-pig bone marrow and spleen
cells. Cell Tissue Kinet, 3(4), 393-403.
Gaebel, R., Furlani, D., Sorg, H., Polchow, B., Frank, J., Bieback, K., . . . Steinhoff, G.
(2011). Cell origin of human mesenchymal stem cells determines a different
healing performance in cardiac regeneration. PLoS One, 6(2), e15652. doi:
10.1371/journal.pone.0015652
Galiano, R. D., Michaels, J. t., Dobryansky, M., Levine, J. P., & Gurtner, G. C. (2004).
Quantitative and reproducible murine model of excisional wound healing. Wound
Repair Regen, 12(4), 485-492. doi: 10.1111/j.1067-1927.2004.12404.x
Galkowska, H., Wojewodzka, U., & Olszewski, W. L. (2006). Chemokines, cytokines,
and growth factors in keratinocytes and dermal endothelial cells in the margin of
chronic diabetic foot ulcers. Wound Repair Regen, 14(5), 558-565. doi:
10.1111/j.1743-6109.2006.00155.x
Ghannam, S., Bouffi, C., Djouad, F., Jorgensen, C., & Noel, D. (2010).
Immunosuppression by mesenchymal stem cells: mechanisms and clinical
applications. Stem Cell Res Ther, 1(1), 2. doi: 10.1186/scrt2
126
Gilbert, S. F. (2000). Developmental Biology (6th ed.): Sunderland (MA): Sinauer
Associates.
Giordano, A., Galderisi, U., & Marino, I. R. (2007). From the laboratory bench to the
patient's bedside: an update on clinical trials with mesenchymal stem cells. J Cell
Physiol, 211(1), 27-35. doi: 10.1002/jcp.20959
Gittel, C., Brehm, W., Burk, J., Juelke, H., Staszyk, C., & Ribitsch, I. (2013). Isolation of
equine multipotent mesenchymal stromal cells by enzymatic tissue digestion or
explant technique: comparison of cellular properties. BMC Vet Res, 9, 221. doi:
10.1186/1746-6148-9-221
Goodwin, H. S., Bicknese, A. R., Chien, S. N., Bogucki, B. D., Quinn, C. O., & Wall, D.
A. (2001). Multilineage differentiation activity by cells isolated from umbilical
cord blood: expression of bone, fat, and neural markers. Biol Blood Marrow
Transplant, 7(11), 581-588.
Guo, S., & Dipietro, L. A. (2010). Factors affecting wound healing. J Dent Res, 89(3),
219-229. doi: 10.1177/0022034509359125
Gurtner, G. C., Werner, S., Barrandon, Y., & Longaker, M. T. (2008). Wound repair and
regeneration. Nature, 453(7193), 314-321. doi: 10.1038/nature07039
Han, Y. F., Tao, R., Sun, T. J., Chai, J. K., Xu, G., & Liu, J. (2013). Optimization of
human umbilical cord mesenchymal stem cell isolation and culture methods.
Cytotechnology, 65(5), 819-827. doi: 10.1007/s10616-012-9528-0
Harris, R. B., Mitchell, T. D., Yan, X., Simpson, J. S., & Redmann, S. M., Jr. (2001).
Metabolic responses to leptin in obese db/db mice are strain dependent. Am J
Physiol Regul Integr Comp Physiol, 281(1), R115-132.
Hass, R., Kasper, C., Bohm, S., & Jacobs, R. (2011). Different populations and sources of
human mesenchymal stem cells (MSC): A comparison of adult and neonatal
tissue-derived MSC. Cell Commun Signal, 9, 12. doi: 10.1186/1478-811X-9-12
Horwitz, E. M., & Dominici, M. (2008). How do mesenchymal stromal cells exert their
therapeutic benefit? Cytotherapy, 10(8), 771-774. doi:
10.1080/14653240802618085
Horwitz, E. M., Prockop, D. J., Fitzpatrick, L. A., Koo, W. W., Gordon, P. L., Neel,
M., . . . Brenner, M. K. (1999). Transplantability and therapeutic effects of bone
marrow-derived mesenchymal cells in children with osteogenesis imperfecta. Nat
Med, 5(3), 309-313. doi: 10.1038/6529
Hsieh, J. Y., Wang, H. W., Chang, S. J., Liao, K. H., Lee, I. H., Lin, W. S., . . . Cheng, S.
M. (2013). Mesenchymal stem cells from human umbilical cord express
preferentially secreted factors related to neuroprotection, neurogenesis, and
angiogenesis. PLoS One, 8(8), e72604. doi: 10.1371/journal.pone.0072604
Hu, Y., Liao, L., Wang, Q., Ma, L., Ma, G., Jiang, X., & Zhao, R. C. (2003). Isolation
and identification of mesenchymal stem cells from human fetal pancreas. J Lab
Clin Med, 141(5), 342-349. doi: 10.1016/S0022-2143(03)00022-2
Huang, S., Feng, C., Wu, Y., Yang, S., Ma, K., Wu, X., & Fu, X. (2013). Dissimilar
characteristics of umbilical cord mesenchymal stem cells from donors of different
ages. Cell Tissue Bank, 14(4), 707-713. doi: 10.1007/s10561-013-9364-2
Hummel, K. P., Coleman, D. L., & Lane, P. W. (1972). The influence of genetic
background on expression of mutations at the diabetes locus in the mouse. I.
C57BL-KsJ and C57BL-6J strains. Biochem Genet, 7(1), 1-13.
127
Hwang, J. H., Shim, S. S., Seok, O. S., Lee, H. Y., Woo, S. K., Kim, B. H., . . . Park, Y.
K. (2009). Comparison of cytokine expression in mesenchymal stem cells from
human placenta, cord blood, and bone marrow. J Korean Med Sci, 24(4), 547-554.
doi: 10.3346/jkms.2009.24.4.547
in 't Anker, P. S., Noort, W. A., Scherjon, S. A., Kleijburg-van der Keur, C.,
Kruisselbrink, A. B., van Bezooijen, R. L., . . . Fibbe, W. E. (2003). Mesenchymal
stem cells in human second-trimester bone marrow, liver, lung, and spleen exhibit
a similar immunophenotype but a heterogeneous multilineage differentiation
potential. Haematologica, 88(8), 845-852.
Isakson, M., de Blacam, C., Whelan, D., McArdle, A., & Clover, A. J. (2015).
Mesenchymal Stem Cells and Cutaneous Wound Healing: Current Evidence and
Future Potential. Stem Cells Int, 2015, 831095. doi: 10.1155/2015/831095
Isern, J., Garcia-Garcia, A., Martin, A. M., Arranz, L., Martin-Perez, D., Torroja, C., . . .
Mendez-Ferrer, S. (2014). The neural crest is a source of mesenchymal stem cells
with specialized hematopoietic stem cell niche function. Elife, 3, e03696. doi:
10.7554/eLife.03696
Iso, Y., Spees, J. L., Serrano, C., Bakondi, B., Pochampally, R., Song, Y. H., . . . Prockop,
D. J. (2007). Multipotent human stromal cells improve cardiac function after
myocardial infarction in mice without long-term engraftment. Biochem Biophys
Res Commun, 354(3), 700-706. doi: 10.1016/j.bbrc.2007.01.045
Javazon, E. H., Keswani, S. G., Badillo, A. T., Crombleholme, T. M., Zoltick, P. W.,
Radu, A. P., . . . Flake, A. W. (2007). Enhanced epithelial gap closure and
increased angiogenesis in wounds of diabetic mice treated with adult murine bone
marrow stromal progenitor cells. Wound Repair Regen, 15(3), 350-359. doi:
10.1111/j.1524-475X.2007.00237.x
Jeffcoate, W. J., & Harding, K. G. (2003). Diabetic foot ulcers. Lancet, 361(9368), 1545-
1551. doi: 10.1016/S0140-6736(03)13169-8
Jiang, Y., Jahagirdar, B. N., Reinhardt, R. L., Schwartz, R. E., Keene, C. D., Ortiz-
Gonzalez, X. R., . . . Verfaillie, C. M. (2002). Pluripotency of mesenchymal stem
cells derived from adult marrow. Nature, 418(6893), 41-49. doi:
10.1038/nature00870
Joseph M McCulloch, L. C. K. (2010). Wound Healing: Evidence-Based Management:
F.A. Davis.
Joyce, N., Annett, G., Wirthlin, L., Olson, S., Bauer, G., & Nolta, J. A. (2010).
Mesenchymal stem cells for the treatment of neurodegenerative disease. Regen
Med, 5(6), 933-946. doi: 10.2217/rme.10.72
Kahn, S. E., Cooper, M. E., & Del Prato, S. (2014). Pathophysiology and treatment of
type 2 diabetes: perspectives on the past, present, and future. Lancet, 383(9922),
1068-1083. doi: 10.1016/S0140-6736(13)62154-6
Karp, J. M., & Leng Teo, G. S. (2009). Mesenchymal stem cell homing: the devil is in the
details. Cell Stem Cell, 4(3), 206-216. doi: 10.1016/j.stem.2009.02.001
Kawase, E., Suemori, H., Takahashi, N., Okazaki, K., Hashimoto, K., & Nakatsuji, N.
(1994). Strain difference in establishment of mouse embryonic stem (ES) cell
lines. Int J Dev Biol, 38(2), 385-390.
Keating, A. (2012). Mesenchymal stromal cells: new directions. Cell Stem Cell, 10(6),
709-716. doi: 10.1016/j.stem.2012.05.015
128
Kern, S., Eichler, H., Stoeve, J., Kluter, H., & Bieback, K. (2006). Comparative analysis
of mesenchymal stem cells from bone marrow, umbilical cord blood, or adipose
tissue. Stem Cells, 24(5), 1294-1301. doi: 10.1634/stemcells.2005-0342
King, A. J. (2012). The use of animal models in diabetes research. Br J Pharmacol,
166(3), 877-894. doi: 10.1111/j.1476-5381.2012.01911.x
Klampfer, L., Chen-Kiang, S., & Vilcek, J. (1995). Activation of the TSG-6 gene by NF-
IL6 requires two adjacent NF-IL6 binding sites. J Biol Chem, 270(8), 3677-3682.
Klampfer, L., Lee, T. H., Hsu, W., Vilcek, J., & Chen-Kiang, S. (1994). NF-IL6 and AP-
1 cooperatively modulate the activation of the TSG-6 gene by tumor necrosis
factor alpha and interleukin-1. Mol Cell Biol, 14(10), 6561-6569.
Kraitchman, D. L., Heldman, A. W., Atalar, E., Amado, L. C., Martin, B. J., Pittenger, M.
F., . . . Bulte, J. W. (2003). In vivo magnetic resonance imaging of mesenchymal
stem cells in myocardial infarction. Circulation, 107(18), 2290-2293. doi:
10.1161/01.CIR.0000070931.62772.4E
Le Blanc, K., & Davies, L. C. (2015). Mesenchymal stromal cells and the innate immune
response. Immunol Lett. doi: 10.1016/j.imlet.2015.05.004
Le Blanc, K., & Ringden, O. (2007). Immunomodulation by mesenchymal stem cells and
clinical experience. J Intern Med, 262(5), 509-525. doi: 10.1111/j.1365-
2796.2007.01844.x
Lee, O. K., Kuo, T. K., Chen, W. M., Lee, K. D., Hsieh, S. L., & Chen, T. H. (2004).
Isolation of multipotent mesenchymal stem cells from umbilical cord blood.
Blood, 103(5), 1669-1675. doi: 10.1182/blood-2003-05-1670
Lee, R. H., Pulin, A. A., Seo, M. J., Kota, D. J., Ylostalo, J., Larson, B. L., . . . Prockop,
D. J. (2009). Intravenous hMSCs improve myocardial infarction in mice because
cells embolized in lung are activated to secrete the anti-inflammatory protein
TSG-6. Cell Stem Cell, 5(1), 54-63. doi: 10.1016/j.stem.2009.05.003
Lee, R. H., Yu, J. M., Foskett, A. M., Peltier, G., Reneau, J. C., Bazhanov, N., . . .
Prockop, D. J. (2014). TSG-6 as a biomarker to predict efficacy of human
mesenchymal stem/progenitor cells (hMSCs) in modulating sterile inflammation
in vivo. Proc Natl Acad Sci U S A, 111(47), 16766-16771. doi:
10.1073/pnas.1416121111
Lee, T. H., Wisniewski, H. G., & Vilcek, J. (1992). A novel secretory tumor necrosis
factor-inducible protein (TSG-6) is a member of the family of hyaluronate binding
proteins, closely related to the adhesion receptor CD44. J Cell Biol, 116(2), 545-
557.
Lesley, J., Gal, I., Mahoney, D. J., Cordell, M. R., Rugg, M. S., Hyman, R., . . . Mikecz,
K. (2004). TSG-6 modulates the interaction between hyaluronan and cell surface
CD44. J Biol Chem, 279(24), 25745-25754. doi: 10.1074/jbc.M313319200
Liu, Y., Yin, Z., Zhang, R., Yan, K., Chen, L., Chen, F., . . . Jiang, X. (2014). MSCs
inhibit bone marrow-derived DC maturation and function through the release of
TSG-6. Biochem Biophys Res Commun, 450(4), 1409-1415. doi:
10.1016/j.bbrc.2014.07.001
Loot, M. A., Kenter, S. B., Au, F. L., van Galen, W. J., Middelkoop, E., Bos, J. D., &
Mekkes, J. R. (2002). Fibroblasts derived from chronic diabetic ulcers differ in
their response to stimulation with EGF, IGF-I, bFGF and PDGF-AB compared to
controls. Eur J Cell Biol, 81(3), 153-160.
129
Lv, F. J., Tuan, R. S., Cheung, K. M., & Leung, V. Y. (2014). Concise review: the
surface markers and identity of human mesenchymal stem cells. Stem Cells, 32(6),
1408-1419. doi: 10.1002/stem.1681
Ma, S., Xie, N., Li, W., Yuan, B., Shi, Y., & Wang, Y. (2014). Immunobiology of
mesenchymal stem cells. Cell Death Differ, 21(2), 216-225. doi:
10.1038/cdd.2013.158
Maehle, A. H. (2011). Ambiguous cells: the emergence of the stem cell concept in the
nineteenth and twentieth centuries. Notes Rec R Soc Lond, 65(4), 359-378.
Mark, P., Kleinsorge, M., Gaebel, R., Lux, C. A., Toelk, A., Pittermann, E., . . . Ma, N.
(2013). Human Mesenchymal Stem Cells Display Reduced Expression of CD105
after Culture in Serum-Free Medium. Stem Cells Int, 2013, 698076. doi:
10.1155/2013/698076
Martin, G. R. (1981). Isolation of a pluripotent cell line from early mouse embryos
cultured in medium conditioned by teratocarcinoma stem cells. Proc Natl Acad
Sci U S A, 78(12), 7634-7638.
Martin, G. R., & Evans, M. J. (1975). Differentiation of clonal lines of teratocarcinoma
cells: formation of embryoid bodies in vitro. Proc Natl Acad Sci U S A, 72(4),
1441-1445.
Martin, P. (1997). Wound healing--aiming for perfect skin regeneration. Science,
276(5309), 75-81.
Maxson, S., Lopez, E. A., Yoo, D., Danilkovitch-Miagkova, A., & Leroux, M. A. (2012).
Concise review: role of mesenchymal stem cells in wound repair. Stem Cells
Transl Med, 1(2), 142-149. doi: 10.5966/sctm.2011-0018
Mayor, R., & Theveneau, E. (2013). The neural crest. Development, 140(11), 2247-2251.
doi: 10.1242/dev.091751
Meirelles Lda, S., Fontes, A. M., Covas, D. T., & Caplan, A. I. (2009). Mechanisms
involved in the therapeutic properties of mesenchymal stem cells. Cytokine
Growth Factor Rev, 20(5-6), 419-427. doi: 10.1016/j.cytogfr.2009.10.002
Meisel, R., Zibert, A., Laryea, M., Gobel, U., Daubener, W., & Dilloo, D. (2004). Human
bone marrow stromal cells inhibit allogeneic T-cell responses by indoleamine 2,3-
dioxygenase-mediated tryptophan degradation. Blood, 103(12), 4619-4621. doi:
10.1182/blood-2003-11-3909
Mellor, A. L., & Munn, D. H. (1999). Tryptophan catabolism and T-cell tolerance:
immunosuppression by starvation? Immunol Today, 20(10), 469-473.
Michaels, J. t., Churgin, S. S., Blechman, K. M., Greives, M. R., Aarabi, S., Galiano, R.
D., & Gurtner, G. C. (2007). db/db mice exhibit severe wound-healing
impairments compared with other murine diabetic strains in a silicone-splinted
excisional wound model. Wound Repair Regen, 15(5), 665-670. doi:
10.1111/j.1524-475X.2007.00273.x
Milner, C. M., & Day, A. J. (2003). TSG-6: a multifunctional protein associated with
inflammation. J Cell Sci, 116(Pt 10), 1863-1873. doi: 10.1242/jcs.00407
Mitalipov, S., & Wolf, D. (2009). Totipotency, pluripotency and nuclear reprogramming.
Adv Biochem Eng Biotechnol, 114, 185-199. doi: 10.1007/10_2008_45
Moretta, A. (2002). Natural killer cells and dendritic cells: rendezvous in abused tissues.
Nat Rev Immunol, 2(12), 957-964. doi: 10.1038/nri956
130
Morikawa, S., Mabuchi, Y., Niibe, K., Suzuki, S., Nagoshi, N., Sunabori, T., . . .
Matsuzaki, Y. (2009). Development of mesenchymal stem cells partially originate
from the neural crest. Biochem Biophys Res Commun, 379(4), 1114-1119. doi:
10.1016/j.bbrc.2009.01.031
Muller, M., Trocme, C., Lardy, B., Morel, F., Halimi, S., & Benhamou, P. Y. (2008).
Matrix metalloproteinases and diabetic foot ulcers: the ratio of MMP-1 to TIMP-1
is a predictor of wound healing. Diabet Med, 25(4), 419-426. doi: 10.1111/j.1464-
5491.2008.02414.x
Nagy, A., Rossant, J., Nagy, R., Abramow-Newerly, W., & Roder, J. C. (1993).
Derivation of completely cell culture-derived mice from early-passage embryonic
stem cells. Proc Natl Acad Sci U S A, 90(18), 8424-8428.
Nichols, J., Zevnik, B., Anastassiadis, K., Niwa, H., Klewe-Nebenius, D., Chambers,
I., . . . Smith, A. (1998). Formation of pluripotent stem cells in the mammalian
embryo depends on the POU transcription factor Oct4. Cell, 95(3), 379-391.
Nombela-Arrieta, C., Ritz, J., & Silberstein, L. E. (2011). The elusive nature and function
of mesenchymal stem cells. Nat Rev Mol Cell Biol, 12(2), 126-131. doi:
10.1038/nrm3049
Oedayrajsingh-Varma, M. J., van Ham, S. M., Knippenberg, M., Helder, M. N., Klein-
Nulend, J., Schouten, T. E., . . . van Milligen, F. J. (2006). Adipose tissue-derived
mesenchymal stem cell yield and growth characteristics are affected by the tissue-
harvesting procedure. Cytotherapy, 8(2), 166-177. doi:
10.1080/14653240600621125
Ortiz, L. A., Gambelli, F., McBride, C., Gaupp, D., Baddoo, M., Kaminski, N., &
Phinney, D. G. (2003). Mesenchymal stem cell engraftment in lung is enhanced in
response to bleomycin exposure and ameliorates its fibrotic effects. Proc Natl
Acad Sci U S A, 100(14), 8407-8411. doi: 10.1073/pnas.1432929100
Otte, A., Bucan, V., Reimers, K., & Hass, R. (2013). Mesenchymal stem cells maintain
long-term in vitro stemness during explant culture. Tissue Eng Part C Methods,
19(12), 937-948. doi: 10.1089/ten.TEC.2013.0007
Pallin, B., Ahonen, J., Rank, F., & Zederfeldt, B. (1975). Granulation tissue formation in
viscose cellulose sponges of different design. Acta Chir Scand, 141(8), 697-701.
Pandey, A., Chawla, S., & Guchhait, P. (2015). Type-2 diabetes: Current understanding
and future perspectives. IUBMB Life, 67(7), 506-513. doi: 10.1002/iub.1396
Park, C. W., Kim, K. S., Bae, S., Son, H. K., Myung, P. K., Hong, H. J., & Kim, H.
(2009). Cytokine secretion profiling of human mesenchymal stem cells by
antibody array. Int J Stem Cells, 2(1), 59-68.
Paulini, K., Korner, B., Beneke, G., & Endres, R. (1974). A quantitative study of the
growth of connective tissue: investigations on implanted polyester-polyurethane
sponges. Connect Tissue Res, 2(4), 257-264.
Perez, R., & Davis, S. C. (2008). Relevance of animal models for wound healing.
Wounds, 20(1), 3-8.
Phinney, D. G., & Prockop, D. J. (2007). Concise review: mesenchymal stem/multipotent
stromal cells: the state of transdifferentiation and modes of tissue repair--current
views. Stem Cells, 25(11), 2896-2902. doi: 10.1634/stemcells.2007-0637
131
Pittenger, M. F., Mackay, A. M., Beck, S. C., Jaiswal, R. K., Douglas, R., Mosca, J.
D., . . . Marshak, D. R. (1999). Multilineage potential of adult human
mesenchymal stem cells. Science, 284(5411), 143-147.
Poschl, E., Schlotzer-Schrehardt, U., Brachvogel, B., Saito, K., Ninomiya, Y., & Mayer,
U. (2004). Collagen IV is essential for basement membrane stability but
dispensable for initiation of its assembly during early development. Development,
131(7), 1619-1628. doi: 10.1242/dev.01037
Prockop, D. J. (1997). Marrow stromal cells as stem cells for nonhematopoietic tissues.
Science, 276(5309), 71-74.
Prockop, D. J. (2009). Repair of tissues by adult stem/progenitor cells (MSCs):
controversies, myths, and changing paradigms. Mol Ther, 17(6), 939-946. doi:
10.1038/mt.2009.62
Prosdocimi, M., & Bevilacqua, C. (2012). Impaired wound healing in diabetes: the
rationale for clinical use of hyaluronic acid plus silver sulfadiazine. Minerva Med,
103(6), 533-539.
Puri, M. C., & Nagy, A. (2012). Concise review: Embryonic stem cells versus induced
pluripotent stem cells: the game is on. Stem Cells, 30(1), 10-14. doi:
10.1002/stem.788
Qi, Y., Jiang, D., Sindrilaru, A., Stegemann, A., Schatz, S., Treiber, N., . . . Scharffetter-
Kochanek, K. (2014). TSG-6 released from intradermally injected mesenchymal
stem cells accelerates wound healing and reduces tissue fibrosis in murine full-
thickness skin wounds. J Invest Dermatol, 134(2), 526-537. doi:
10.1038/jid.2013.328
Ramalho-Santos, M., & Willenbring, H. (2007). On the origin of the term "stem cell".
Cell Stem Cell, 1(1), 35-38. doi: 10.1016/j.stem.2007.05.013
Rebelatto, C. K., Aguiar, A. M., Moretao, M. P., Senegaglia, A. C., Hansen, P., Barchiki,
F., . . . Correa, A. (2008). Dissimilar differentiation of mesenchymal stem cells
from bone marrow, umbilical cord blood, and adipose tissue. Exp Biol Med
(Maywood), 233(7), 901-913. doi: 10.3181/0712-RM-356
Reubinoff, B. E., Pera, M. F., Fong, C. Y., Trounson, A., & Bongso, A. (2000).
Embryonic stem cell lines from human blastocysts: somatic differentiation in vitro.
Nat Biotechnol, 18(4), 399-404. doi: 10.1038/74447
Rodriguez, A. M., Elabd, C., Amri, E. Z., Ailhaud, G., & Dani, C. (2005). The human
adipose tissue is a source of multipotent stem cells. Biochimie, 87(1), 125-128.
doi: 10.1016/j.biochi.2004.11.007
Rogers, I., Yamanaka, N., Bielecki, R., Wong, C. J., Chua, S., Yuen, S., & Casper, R. F.
(2007). Identification and analysis of in vitro cultured CD45-positive cells capable
of multi-lineage differentiation. Exp Cell Res, 313(9), 1839-1852. doi:
10.1016/j.yexcr.2007.02.029
Rojas, M., Xu, J., Woods, C. R., Mora, A. L., Spears, W., Roman, J., & Brigham, K. L.
(2005). Bone marrow-derived mesenchymal stem cells in repair of the injured
lung. Am J Respir Cell Mol Biol, 33(2), 145-152. doi: 10.1165/rcmb.2004-
0330OC
Rosova, I., Dao, M., Capoccia, B., Link, D., & Nolta, J. A. (2008). Hypoxic
preconditioning results in increased motility and improved therapeutic potential of
132
human mesenchymal stem cells. Stem Cells, 26(8), 2173-2182. doi:
10.1634/stemcells.2007-1104
Sarugaser, R., Hanoun, L., Keating, A., Stanford, W. L., & Davies, J. E. (2009). Human
mesenchymal stem cells self-renew and differentiate according to a deterministic
hierarchy. PLoS One, 4(8), e6498. doi: 10.1371/journal.pone.0006498
Sato, K., Ozaki, K., Oh, I., Meguro, A., Hatanaka, K., Nagai, T., . . . Ozawa, K. (2007).
Nitric oxide plays a critical role in suppression of T-cell proliferation by
mesenchymal stem cells. Blood, 109(1), 228-234. doi: 10.1182/blood-2006-02-
002246
Schreml, S., Babilas, P., Fruth, S., Orso, E., Schmitz, G., Mueller, M. B., . . . Prantl, L.
(2009). Harvesting human adipose tissue-derived adult stem cells: resection
versus liposuction. Cytotherapy, 11(7), 947-957. doi:
10.3109/14653240903204322
Secco, M., Zucconi, E., Vieira, N. M., Fogaca, L. L., Cerqueira, A., Carvalho, M. D., . . .
Zatz, M. (2008). Multipotent stem cells from umbilical cord: cord is richer than
blood! Stem Cells, 26(1), 146-150. doi: 10.1634/stemcells.2007-0381
Seita, J., & Weissman, I. L. (2010). Hematopoietic stem cell: self-renewal versus
differentiation. Wiley Interdiscip Rev Syst Biol Med, 2(6), 640-653. doi:
10.1002/wsbm.86
Shake, J. G., Gruber, P. J., Baumgartner, W. A., Senechal, G., Meyers, J., Redmond, J.
M., . . . Martin, B. J. (2002). Mesenchymal stem cell implantation in a swine
myocardial infarct model: engraftment and functional effects. Ann Thorac Surg,
73(6), 1919-1925; discussion 1926.
Shi, Z., Zhao, L., Qiu, G., He, R., & Detamore, M. S. (2015). The effect of extended
passaging on the phenotype and osteogenic potential of human umbilical cord
mesenchymal stem cells. Mol Cell Biochem, 401(1-2), 155-164. doi:
10.1007/s11010-014-2303-0
Shin, L., & Peterson, D. A. (2013). Human mesenchymal stem cell grafts enhance normal
and impaired wound healing by recruiting existing endogenous tissue
stem/progenitor cells. Stem Cells Transl Med, 2(1), 33-42. doi:
10.5966/sctm.2012-0041
Sonnemann, K. J., & Bement, W. M. (2011). Wound repair: toward understanding and
integration of single-cell and multicellular wound responses. Annu Rev Cell Dev
Biol, 27, 237-263. doi: 10.1146/annurev-cellbio-092910-154251
Spaggiari, G. M., Capobianco, A., Becchetti, S., Mingari, M. C., & Moretta, L. (2006).
Mesenchymal stem cell-natural killer cell interactions: evidence that activated NK
cells are capable of killing MSCs, whereas MSCs can inhibit IL-2-induced NK-
cell proliferation. Blood, 107(4), 1484-1490. doi: 10.1182/blood-2005-07-2775
Spangrude, G. J., Heimfeld, S., & Weissman, I. L. (1988). Purification and
characterization of mouse hematopoietic stem cells. Science, 241(4861), 58-62.
Stojadinovic, O., Brem, H., Vouthounis, C., Lee, B., Fallon, J., Stallcup, M., . . . Tomic-
Canic, M. (2005). Molecular pathogenesis of chronic wounds: the role of beta-
catenin and c-myc in the inhibition of epithelialization and wound healing. Am J
Pathol, 167(1), 59-69.
133
Stolzing, A., Jones, E., McGonagle, D., & Scutt, A. (2008). Age-related changes in
human bone marrow-derived mesenchymal stem cells: consequences for cell
therapies. Mech Ageing Dev, 129(3), 163-173. doi: 10.1016/j.mad.2007.12.002
Stroncek JD, R. W. (2008). Overview of Wound Healing in Different Tissue Types. In R.
WM (Ed.), Indwelling Neural Implants: Strategies for Contending with the In
Vivo Environment.: Boca Raton (FL): CRC Press.
Takahashi, K., & Yamanaka, S. (2006). Induction of pluripotent stem cells from mouse
embryonic and adult fibroblast cultures by defined factors. Cell, 126(4), 663-676.
doi: 10.1016/j.cell.2006.07.024
Terness, P., Bauer, T. M., Rose, L., Dufter, C., Watzlik, A., Simon, H., & Opelz, G.
(2002). Inhibition of allogeneic T cell proliferation by indoleamine 2,3-
dioxygenase-expressing dendritic cells: mediation of suppression by tryptophan
metabolites. J Exp Med, 196(4), 447-457.
Tesar, P. J., Chenoweth, J. G., Brook, F. A., Davies, T. J., Evans, E. P., Mack, D. L., . . .
McKay, R. D. (2007). New cell lines from mouse epiblast share defining features
with human embryonic stem cells. Nature, 448(7150), 196-199. doi:
10.1038/nature05972
The Jackson Laboratory, T. J. (2014). BKS.Cg-Dock7m +/+ Leprdb/J. JAX Mice
database. Retrieved August 17, 2015, from
http://jaxmice.jax.org/strain/000642.html
Thomson, J. A., Itskovitz-Eldor, J., Shapiro, S. S., Waknitz, M. A., Swiergiel, J. J.,
Marshall, V. S., & Jones, J. M. (1998). Embryonic stem cell lines derived from
human blastocysts. Science, 282(5391), 1145-1147.
Tolar, J., Le Blanc, K., Keating, A., & Blazar, B. R. (2010). Concise review: hitting the
right spot with mesenchymal stromal cells. Stem Cells, 28(8), 1446-1455. doi:
10.1002/stem.459
Trivanovic, D., Kocic, J., Mojsilovic, S., Krstic, A., Ilic, V., Djordjevic, I. O., . . .
Bugarski, D. (2013). Mesenchymal stem cells isolated from peripheral blood and
umbilical cord Wharton's jelly. Srp Arh Celok Lek, 141(3-4), 178-186.
Uccelli, A., Moretta, L., & Pistoia, V. (2008). Mesenchymal stem cells in health and
disease. Nat Rev Immunol, 8(9), 726-736. doi: 10.1038/nri2395
Valluru, M., Staton, C. A., Reed, M. W., & Brown, N. J. (2011). Transforming Growth
Factor-beta and Endoglin Signaling Orchestrate Wound Healing. Front Physiol, 2,
89. doi: 10.3389/fphys.2011.00089
Vivier, E., Tomasello, E., Baratin, M., Walzer, T., & Ugolini, S. (2008). Functions of
natural killer cells. Nat Immunol, 9(5), 503-510. doi: 10.1038/ni1582
Vuorisalo, S., Venermo, M., & Lepantalo, M. (2009). Treatment of diabetic foot ulcers. J
Cardiovasc Surg (Torino), 50(3), 275-291.
Wagner, J., Kean, T., Young, R., Dennis, J. E., & Caplan, A. I. (2009). Optimizing
mesenchymal stem cell-based therapeutics. Curr Opin Biotechnol, 20(5), 531-536.
doi: 10.1016/j.copbio.2009.08.009
Wagner, W., Wein, F., Seckinger, A., Frankhauser, M., Wirkner, U., Krause, U., . . . Ho,
A. D. (2005). Comparative characteristics of mesenchymal stem cells from human
bone marrow, adipose tissue, and umbilical cord blood. Exp Hematol, 33(11),
1402-1416. doi: 10.1016/j.exphem.2005.07.003
134
Wang, H. S., Hung, S. C., Peng, S. T., Huang, C. C., Wei, H. M., Guo, Y. J., . . . Chen, C.
C. (2004). Mesenchymal stem cells in the Wharton's jelly of the human umbilical
cord. Stem Cells, 22(7), 1330-1337. doi: 10.1634/stemcells.2004-0013
Wang, Y., Zhang, Z., Chi, Y., Zhang, Q., Xu, F., Yang, Z., . . . Han, Z. C. (2013). Long-
term cultured mesenchymal stem cells frequently develop genomic mutations but
do not undergo malignant transformation. Cell Death Dis, 4, e950. doi:
10.1038/cddis.2013.480
Waterman, R. S., Tomchuck, S. L., Henkle, S. L., & Betancourt, A. M. (2010). A new
mesenchymal stem cell (MSC) paradigm: polarization into a pro-inflammatory
MSC1 or an Immunosuppressive MSC2 phenotype. PLoS One, 5(4), e10088. doi:
10.1371/journal.pone.0010088
Werner, S., & Grose, R. (2003). Regulation of wound healing by growth factors and
cytokines. Physiol Rev, 83(3), 835-870. doi: 10.1152/physrev.00031.2002
Whiteley, J., Bielecki, R., Li, M., Chua, S., Ward, M. R., Yamanaka, N., . . . Rogers, I. M.
(2014). An expanded population of CD34+ cells from frozen banked umbilical
cord blood demonstrate tissue repair mechanisms of mesenchymal stromal cells
and circulating angiogenic cells in an ischemic hind limb model. Stem Cell Rev,
10(3), 338-350. doi: 10.1007/s12015-014-9496-1
Wild, S., Roglic, G., Green, A., Sicree, R., & King, H. (2004). Global prevalence of
diabetes: estimates for the year 2000 and projections for 2030. Diabetes Care,
27(5), 1047-1053.
Wisniewski, H. G., Maier, R., Lotz, M., Lee, S., Klampfer, L., Lee, T. H., & Vilcek, J.
(1993). TSG-6: a TNF-, IL-1-, and LPS-inducible secreted glycoprotein
associated with arthritis. J Immunol, 151(11), 6593-6601.
Wong, V. W., Sorkin, M., Glotzbach, J. P., Longaker, M. T., & Gurtner, G. C. (2011).
Surgical approaches to create murine models of human wound healing. J Biomed
Biotechnol, 2011, 969618. doi: 10.1155/2011/969618
Wu, S. C., Driver, V. R., Wrobel, J. S., & Armstrong, D. G. (2007). Foot ulcers in the
diabetic patient, prevention and treatment. Vasc Health Risk Manag, 3(1), 65-76.
Xu, W., Jong Hong, S., Jia, S., Zhao, Y., Galiano, R. D., & Mustoe, T. A. (2012).
Application of a partial-thickness human ex vivo skin culture model in cutaneous
wound healing study. Lab Invest, 92(4), 584-599. doi: 10.1038/labinvest.2011.184
Yoon, J. H., Roh, E. Y., Shin, S., Jung, N. H., Song, E. Y., Chang, J. Y., . . . Jeon, H. W.
(2013). Comparison of explant-derived and enzymatic digestion-derived MSCs
and the growth factors from Wharton's jelly. Biomed Res Int, 2013, 428726. doi:
10.1155/2013/428726
Young, H. E., Duplaa, C., Young, T. M., Floyd, J. A., Reeves, M. L., Davis, K. H., . . .
Black, A. C., Jr. (2001). Clonogenic analysis reveals reserve stem cells in
postnatal mammals: I. Pluripotent mesenchymal stem cells. Anat Rec, 263(4),
350-360.
Zucconi, E., Vieira, N. M., Bueno, C. R., Jr., Secco, M., Jazedje, T., Costa Valadares,
M., . . . Zatz, M. (2011). Preclinical studies with umbilical cord mesenchymal
stromal cells in different animal models for muscular dystrophy. J Biomed
Biotechnol, 2011, 715251. doi: 10.1155/2011/715251