ccaat-enhancer-bindingprotein (c/ebp )and ...( 80 c) after delivery for storage or processing. an...

CCAAT-enhancer-binding Protein � (C/EBP�) andDownstream Human Placental Growth Hormone Genes AreTargets for Dysregulation in Pregnancies Complicated byMaternal Obesity*

Received for publication, April 8, 2013, and in revised form, June 16, 2013 Published, JBC Papers in Press, June 19, 2013, DOI 10.1074/jbc.M113.474999

Hana Vakili‡, Yan Jin‡, Savas Menticoglou§, and Peter A. Cattini‡1

From the ‡Department of Physiology, Division of Endocrinology and Metabolic Disease and the §Department of Obstetrics,Gynecology, and Reproductive Sciences, Faculty of Medicine, University of Manitoba, Winnipeg R3E 0J9, Canada

Background: Effect ofmaternal obesity onmetabolically important human placental growth hormone (CS andGH-V) geneexpression has not been studied.Results: CS, GH-V, and C/EBP�, a factor that binds CS-related enhancer chromatin, are decreased by maternal obesity.Conclusion: C/EBP� is a target for maternal obesity that negatively affects placental CS/GH-V gene expression.Significance: Genes regulated by C/EBP�, a placenta development factor, are targeted in pregnancies complicated by obesity.

Human chorionic somatomammotropin (CS) and placentalgrowth hormone variant (GH-V) act as metabolic adaptors inresponse to maternal insulin resistance, which occurs in “nor-mal” pregnancy. Maternal obesity can exacerbate this “resis-tance,” suggesting that CS, GH-V, or transcription factors thatregulate their production might be targets. The human CSgenes, hCS-A and hCS-B, flank the GH-V gene. A significantdecrease in pre-term placental CS/GH-V RNA levels wasobserved in transgenic mice containing the CS/GH-V genes in amodel of high fat diet (HFD)-induced maternal obesity. Simi-larly, a decrease in CS/GH-V RNA levels was detected in termplacentas from obese (body mass index (BMI) > 35 kg/m2) ver-sus lean (BMI 20–25 kg/m2) women. A specific decrease in tran-scription factor CCAAT-enhancer-binding protein � (C/EBP�)RNA levels was also seen with obesity; C/EBP� is required formouse placenta development and is expressed, like CS andGH-V, in syncytiotrophoblasts. Binding of C/EBP� to the CSgene downstream enhancer regions, which by virtue of theirposition distally flank the GH-V gene, was reduced in placentachromatin from mice on a HFD and in obese women; a corre-sponding decrease in RNA polymerase II associated withCS/GH-V promoters was also observed. Detection of decreasedendogenous CS/GH-V RNA levels in human placental tumorcells treated with C/EBP� siRNA is consistent with a directeffect. These data provide evidence for CS/GH-V dysregulationin acute HFD-induced obesity in mouse pregnancy and chronicobesity in human pregnancy and implicate C/EBP�, a factorassociated with CS regulation and placental development.

The prevalence of obesity is increasing in women of repro-ductive age such that it has been suggested that more than onein five pregnant women are obese (1–3). Normal human preg-nancy is characterized as a metabolic stress involving a seriesof metabolic changes promoted by insulin resistance. Thedemand for increased maternal insulin in normal pregnancydue to insulin resistance is related to weight gain and placentalhormone production as well as increased food intake and fetalburden (4, 5). To compensate, there are increases in insulinsecretion per pancreatic �-cell and in �-cell proliferation suchthat �-cell mass increases 50% in pregnancy (5, 6). Chorionicsomatomammotropin (CS)2 and placental growth hormonevariant (GH-V) aremajor stimuli of�-cell proliferation in preg-nancy (5, 7, 8). CS/GH-V are also involved in shifting themater-nal energy metabolism from carbohydrate to lipid substrates,thereby reducing insulin-mediated utilization of glucose. Thus,they contribute to fetal growth and development by mobilizingthemother’s nutritional resources, primarily glucose, andmak-ing them available to the fetus (9, 10). Maternal obesity mayexacerbate insulin resistance associated with pregnancy byaffectingCS/GH-V levels. Thus, the combination of obesity anddecreased insulin sensitivity increases the long term risk formetabolic syndrome and associated problems. Furthermore,genetic variation associated with the CS/GH-V genes does notcause, but can contribute substantially to, development of met-abolic syndrome (11). Thus, if these metabolic effects arerelated to the dysregulation of CS/GH-V hormones as a resultof genetic variation, it is possible that similar CS/GH-V genedysregulation will be observed as a result of physiological/pathophysiological perturbation resulting from maternal obe-sity and its associated health complications.

* This work was supported by Canadian Institutes of Health Research GrantsMT-10853 and RPA-12495 and a studentship from the Manitoba Instituteof Child Health and Manitoba Health Research Council and Canadian Insti-tutes of Health Research.

1 To whom correspondence should be addressed: Endocrinology and Meta-bolic Disease, Dept. of Physiology, University of Manitoba, 745 BannatyneAve., Winnipeg, Manitoba, Canada, R3E 0J9. Tel.: 204-789-3505, E-mail:[email protected].

2 The abbreviations used are: CS, chorionic somatomammotropin; GH-V,growth hormone (GH) variant; hGH, human GH; BMI, body mass index; LCR,locus control region; TEF, transcription enhancer factor; C/EBP, CCAAT-enhancer-binding protein; TG, transgenic; LFD, low fat diet; GD, gestationday; GTT, glucose tolerance test; qPCR, quantitative RT-PCR; PL, placentallactogen; pol II, RNA polymerase II.

THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 288, NO. 31, pp. 22849 –22861, August 2, 2013© 2013 by The American Society for Biochemistry and Molecular Biology, Inc. Published in the U.S.A.

AUGUST 2, 2013 • VOLUME 288 • NUMBER 31 JOURNAL OF BIOLOGICAL CHEMISTRY 22849

by guest on April 26, 2020

http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

CS and GH-V are members of the human growth hormone(GH) family and are synthesized and secreted by syncytiotro-phoblasts on the maternal side of placenta (12). CS is the prod-uct of either of two geneshCS-A andhCS-B, which flank a singleGH-V gene (hGH-V); a third CS gene (hCS-L) is a pseudogene(13). The placental CS/GH-V genes are all located at a singlelocus on chromosome 17 together with the pituitary GH gene,hGH-N (13). Efficient CS/GH-V production is closely related tovillus syncytiotrophoblast development and placental massduring pregnancy (12, 14–17). Activation and expression of thehuman GH/CS genes has been linked to a set of remote regula-tory elements associated with five nuclease hypersensitive sites(I-V). These sites are found in the loci of theCD79b and SCN4Agenes that lie upstream and adjacent to the GH/CS locus onchromosome 17. Hypersensitive sites III and V comprise thepituitary GH locus control region (LCR) (18–21), which per-mits the site of integration-independent and appropriate pitu-itary-specific hGH-N expression (20, 21). It is unclear, however,whether sequences included in the LCR alone are sufficientfor appropriate placental expression of CS/GH-V. There isevidence to suggest cooperation between remote GH LCRsequences and DNA elements more proximal to the CS/GH-Vgenes that might collectively act to regulate individual promot-ers. Candidates for highly conserved and more proximal regu-latory regions include 5�-enhancer/repressor P sequences,located �2 kb upstream of each of the placental GH/CS genes(22–24) and efficient 3�-enhancer regions located 2 kb down-stream of the CS genes, which by virtue of their position alsoflank, albeit distally, hGH-V (25–34). The placenta-specificenhancer activity was localized to a 126-base pair (bp) fragment(25, 26), and these 3�-enhancer regions were shown to containhyperacetylated histoneH3 andH4 in primary humanplacentaland choriocarcinoma (BeWo) cells in culture (35). These dataimply an open chromatin configuration with higher levels ofaccessibility to transcription factors. Two nuclease-protectedsites were identified within the 126-bp CS 3�-enhancer regionswith placenta nuclear protein (25, 26).Onewas characterized asa transcription enhancer factor 1(TEF-1) or TEF-5-binding site(25–33), and subsequently, a consensus binding site for theCCAAT-enhancer-binding protein (C/EBP) family and associ-ated enhancer activity was identified (33) that corresponds tothe second nuclease protected site within the 126-bp 3�-en-hancer regions (25, 26). Furthermore, C/EBP� was shown toassociate with the CS 3�-enhancer regions in human term pla-centa chromatin in situ, suggesting a possible role in vivo (33).C/EBP� levels increase in human termplacenta and like CS andGH-V are also linked to villous syncytiotrophoblast versuscytotrophoblasts (37). A physiological role for C/EBP� inplacenta morphogenesis is suggested based on genetic deletionof C/EBP family members in mice (38–40). Most important inthe context of the current study, C/EBP� is implicated in adi-pogenesis/glucose metabolism in the context of obesity (41–43). Together these observations suggest C/EBP� as a strongcandidate to be targeted by obesity and in turn to modulate CSgene expression during pregnancy.Although useful, both human choriocarcinoma cell lines and

primary termplacenta cell cultures are limited in their ability toallow testing of CS/GH-V gene regulation during pregnancy

(44–46). By contrast, murine systems provide a model to studyevents during pregnancy but are limited by structural differ-ences between the CS genes in primates and non-primates (47)as well as the absence of the GH-V gene in non-primates (48).Thus, in vivo CS/GH-V gene regulation under physiological orpathophysiological conditions, such as maternal obesity, hasnot been well studied. We generated “humanized” hGH/CStransgenic (TG) CD-1 mice containing all five GH/CS genesunder the control of the GH/CS LCR, which includes GH LCR,P, and 3�-enhancer related sequences (18). The GH/CS LCRdirects placenta-specific expression of CS/GH-V in the labyrin-thine layer, which represents the region of maternal-fetalexchange in themouse placenta and corresponds in function tothe villous syncytium in the human placenta (18, 21).Here we have used a combination of hGH/CS-TG mouse

studies, human placenta samples, and choriocarcinoma cells toprovide evidence for the first time that the CS/GH-V genes canbe regulated during pregnancy. Specifically, C/EBP� andCCAAT elements are components of composite CS enhancerregions that are targeted in pregnancies complicated by mater-nal obesity.

EXPERIMENTAL PROCEDURES

Mice and Diet—All procedures involving animals, their tis-sues, and cells conform to the Guide for the Care and Use ofLaboratory Animals published by the United States NationalInstitutes of Health (NIH Publication, 8th Ed., 2011) and wasapproved by the animal Protocol Management and ReviewCommittee at the University of Manitoba. Animals were indi-vidually housed with ad libitum access to food and water in anenvironmentally controlled room maintained on a 12-h light/dark cycle. Four-week-old female hGH/CS-TG mice (49, 50)andnon-TGCD-1micewere assigned at random to either a lowfat diet (LFD) (20% protein, 10% total fat; Research Diets, NewBrunswick, NJ) or high fat diet (HFD) (20% protein, 60% totalfat; Research Diets) group. After 4 weeks of dietary interven-tion, mice were allowed to breed overnight in a 1:2 (male:fe-male) ratio. Mating was confirmed by inspection for the pres-ence of a vaginal mucous plug the next morning and if so wasdesignated gestation day (GD) 0.5. Body weights were recordedweekly before and through gestation.Daily food intakewas esti-mated by weighing remaining food at the end of each week andwas used to calculate average daily caloric intake. Mice weremaintained on their respective diets until time of euthanizationand assay. Placentas and litter size (and GD 18.5 pup weight)were weighed and recorded.Glucose Tolerance Test (GTT)—After 4 weeks of feeding

micewith LFDorHFD, atGD�1 (before pregnancy) and atGD16.5 mice were food-deprived overnight for 16 h with onlywater available. A base-line blood sample was taken via a smalltail nick for determination of blood glucose by a handheld glu-cose meter (OneTouch Ultramini, Lifescan, Inc). A GTT wasperformedusing 2 g/kg of intraperitoneal glucose (Sigma). Tail-vein blood glucose level was monitored 15, 30, 45, 60, 90, and120 min post-glucose injection.Human Study Subjects—The human study was performed

after approval of the Health Research Ethics Board at the Uni-versity of Manitoba. Signed informed consent forms were

Regulation of Human Placental GH Genes in Obesity

22850 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 288 • NUMBER 31 • AUGUST 2, 2013


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

obtained from all participants. Our study group consisted ofhealthy lean (body mass index (BMI) 20–25 kg/m2; n � 9) andobese (BMI �35 kg/m2; n � 5) women with no gestationalcomplications, including preeclampsia or gestational diabetes.BMI was assessed based on the pre-pregnancy weight. Thebasic clinical characteristics of the study population are sum-marized in Table 1.Detection of RNA by Reverse Transcription and Quantitative

Polymerase Chain Reaction (qPCR)—Total RNA was obtainedfrommouse placental tissue enriched for labyrinthine cells, themajor site of CS and GH-V production as reported previously(18, 51). Human placentas were collected on ice, and tissuesamples (10 mm3) were removed and immediately frozen(�80 °C) after delivery for storage or processing. An effort wasmade to take a villous syncytiotrophoblast-rich sample fromthe same region of the chorion. The RNeasy Plus Mini kit wasused for all RNAextractions (Qiagen).One�g of total RNAwasreverse-transcribed by the QuantiTect Reverse Transcriptionkit (Qiagen) according to the manufacturer’s instructions.qPCR using specific primers (Table 2) was done as describedpreviously (49). �RT controls were performed using the samePCR primers and thermal cycle conditions as a control forthe presence of genomic DNA. Specific amplifications wereidentified by a single peak in the melting curve and a singleband in the final PCR product visualized in an agarose gel.The gene expression level in each sample (absolute quantifi-cation) was calculated from the standard curve and normal-ized to mouse/human glyceraldehyde 3-phosphate dehydro-genase (GAPDH) expression as appropriate. Tests werenormally run in duplicate on six independent samples unlessotherwise indicated.Electrophoretic Mobility Shift Assay (EMSA)—EMSA was

performed using nuclear extracts from human choriocarci-noma JEG-3 cells overexpressing C/EBP� and a 32P-labeledoligonucleotides corresponding to wild type and mutatedsequences from the 126-bpCS enhancer regions (25, 26). JEG-3cells were grown inmonolayer in Roswell ParkMemorial Insti-tute (RPMI) 1640 medium supplemented with 10% (v/v) fetalbovine serum and antibiotics (10 IU/ml penicillin, 10 mg/mlstreptomycin). Cells were incubated in humidified atmosphereof 95% air and 5% CO2. Transfection of JEG-3 cells was donewith TransIT-LT1 transfectin reagent (Mirus, Madison, WI)according to the manufacturer’s protocol. Briefly, cells wereseeded at 1 � 106 cells per well in 100-mm plates 1 day beforetransfection. Cells were transfected with a total of 10 �g ofexpression plasmids, pcDNA3.1 (empty vector as negative con-trol), or pCMV-C/EBP� (a kind gift fromDr. L. Laimins,North-

western University, Chicago, IL) (52). Cells were harvested at72 h post-transfection, and nuclear protein was isolated usingEpiSeeker Nuclear Extraction kit (Abcam). EMSA and compe-tition was done with oligonucleotides or specific antibodies toC/EBP� (sc-150; Santa Cruz Biotechnology, Inc.). Briefly, 8 �gof nuclear extract was incubated with EMSA buffer containing2 �g of poly-dI�dC for 5 min. Radiolabeled oligonucleotideprobes (1 ng) were then added, and the reactions were incu-bated for a further 20min at room temperature. In competitionexperiments, 50- and 100-fold molar excesses of unlabeledoligonucleotide duplexes or antibody were added and preincu-bated on ice for 10 min before adding radiolabeled probes. TheDNA-protein complexes were resolved in non-denaturing 5%(w/v) polyacrylamide gels and visualized by autoradiography.Chromatin Immunoprecipitation (ChIP) on Chip Tiling

Array Assays and ChIP-qPCR—“ChIP on chip” tiling arrayassays were performed by Active Motif (Carlsbad, CA). Theassay and methodologies have been reported previously (33).Briefly, chromatin from placental labyrinth tissue was isolated,and subsequently immunoprecipitated DNA was amplifiedusing aGenomePlexWGAkit (Sigma). The amplifiedDNAwasfragmented and labeled using the DNA terminal labeling kitfrom Affymetrix (Santa Clara, CA) and then hybridized toAffymetrixGeneChipTiling arrays. Arrayswere analyzed usingAffymetrix TAS software. Thresholds were selected and ana-lyzed using Genpathway software (proprietary) that providescomprehensive information on genomic annotation, peakmet-rics, and sample comparisons for all peaks (intervals). To verifypeaks, the results for ChIP DNAwere normalized against exist-ing input DNA array data (Active Motif database).ChIP assays were performed according to the protocol from

Millipore (EZ-Magna ChIP A/G chromatin immunoprecipita-

TABLE 1Basic clinical features of lean and obese women who participated inthis studyValues are expressed as the mean � S.E.

Demographic characteristics Lean Obese p Value

Age (years) 22.8 � 1.2 25.5 � 1.5 0.1944Pre-pregnancy BMI (kg/m2) 22.2 � 0.5 38.7 � 1.4 �0.0001Fasting/postprandial glucoselevels (mM)

4.2 � 0.3 4.1 � 0.1 0.8075

Systolic pressure (mm Hg) 111.6 � 3.9 121.8 � 6.4 0.2133Diastolic pressure (mm Hg) 62.8 � 2.1 68.8 � 2.7 0.1226Birth weight (g) 3564.1 � 162.1 3776.4 � 126.9 0.3929

TABLE 2Primers used for qPCRh, human; m, mouse.

RNA Primer sequence

CS-A Forward: GGCTTCTAGGTGCCCGAGTAReverse: GCACTGGAGTGGCACCTTCA

CS-B Forward: CAGCAAGTTTGACACAAACTCAReverse: AGAAGCCACAGCTACCCTCT

GH-V Forward: GTTTGAAGAAGCCTATATCCTGReverse: TCACCCTGTTGGAAGGTGTT

m PL-I Forward: GACTACCCTGCTTGGACTGGReverse: GGGCACTCAACATTCGTTCT

m PL-II Forward: CACCAGACAACATCGGAAGAReverse: TGACCATGCAGACCAGAAAG

m Leptin Forward: AATGTGCTGGAGACCCCTGTGReverse: CATTCAGGGCTAACATCCAAC

m C/EBP� Forward: CAAGCTGAGCGACGAGTACAReverse: AGCTGCTCCACCTTCTTCTG

m/h C/EBP� Forward: TGTATACCCCTGGTGGGAGAReverse: TCATAACTCCGGTCCCTCTG

m TEF-1 Forward: TTGAGTTGCAAAGGATGCAGReverse: GCTGGGTTACCAGCAACAAT

m TEF-5 Forward: CCAAGGACAAAGCTCTCCAGReverse: GGCTGTTGTCCTAGCAGAGG

mGAPDH Forward: TCACCACCATGGAGAAGGCReverse: CCTAAGCAGTTGGTGGTGCA

h C/EBP� Forward: GACAAGCACAGCGACGAGTAReverse: AGCTGCTCCACCTTCTTCTG

h TEF-1 Forward: GGAAGCCTCAAACTGAGACGReverse: GGGCTGGAACATTCTTTGAA

h TEF-5 Forward: GGACCCTCTCAGGACATCAAReverse: CACCTCCATGAAGGCTGAAT

h GAPDH Forward: TTGATTTTGGAGGGATCTCGCReverse: GAGTCAACGGATTTGGTCGT




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

tion kit). Placental tissues were cross-linked with 1% formalde-hyde before lysis. Chromatin was fragmented by sonication (10times in 10-s pulses), then insoluble material was removed bycentrifugation, and theDNAcontent wasmeasured by spectro-photometry. Soluble chromatin was immunoprecipitated with4 �g of antibodies against C/EBP� (Santa Cruz) or RNA poly-merase II (Santa Cruz, sc-899 and Covance, MMS-134R) over-night at 4 °C as well as with normal rabbit immunoglobulins(Millipore) as a control. Protein A/G magnetic beads (Milli-pore) were added to immunoprecipitation reactions along withthe antibodies and rotated for 24 h at 4 °C. Themagnetic beads-antibody complexes were subjected to a series of washes beforeelution. The eluted antibody complexes were reverse-cross-linked at 65 °C overnight, and DNA was isolated using theQIAquick PCR purification kit (Qiagen). Quantitative PCRwasperformed in a 7500 Fast Real Time PCR system (AB AppliedBiosystems) under conditions standardized for each primer set(Table 3). Dissociation curves were analyzed as a means toensure the quality of amplicons and to monitor primer dimers.Final PCR products were visualized as a single band in an aga-

rose gel. ChIP enrichment was determined based on a percentinput method as described previously (50).C/EBP� RNA Interference-mediated Knockdown in JEG-3

Cells—Cellular transfection to knockdown C/EBP� expressionwas performed using TransIT-TKO Transfection Reagentaccording to the manufacturer’s protocol (Mirus). C/EBP�small interfering RNAs (siRNA; pools of five target-specific19–25-nucleotides siRNAs) were purchased from Santa CruzBiotechnology, Inc. (sc-29229). The knockdown of the C/EBP�gene was performed in 24-well plates at cell density of 1 � 105

cells/well using 50 nM siRNA and scrambled siRNA (Qiagen,siRNA negative control-1027280).Whole Cell Protein Extraction and Detection—For detection

of C/EBP� protein, 10 �g of whole cell protein was analyzedby protein immunoblotting as previously described (50).Proteins were separated by 12.5% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), trans-ferred to polyvinylidene fluoride membrane, and immuno-blotted with two independent antibodies specific to C/EBP�(Santa Cruz, sc-150, and Millipore, 04-1153). �-Tubulin (sc-9104, Santa Cruz) was assessed as control for protein loading.The proteins were visualized using horseradish peroxidase-conjugated anti-immunoglobulin G (IgG) secondary antibodyand ECL plus immunoblotting detection reagents (ThermoFisher Scientific Inc., Nepean, ON, Canada).Statistical Analysis—Statistical analysis was performed using

GraphPad Instat� software. For single comparisons, paired ttests were applied as appropriate. For multiple comparisons,one-way analysis of variance was used with the Tukey-Krameror Dunnet’s post-test as appropriate. A value of p � 0.05 wasconsidered statistically significant and is represented in figuresas: *, p � 0.05; **, p � 0.01; ***, p � 0.001.

FIGURE 1. A high saturated fat diet leads to significant weight gain accompanied by glucose intolerance in mice during pregnancy. A, shown is dailyfood and caloric intake. B, shown is the effect of a 4-week LFD or HFD on female hGH/CS-TG mouse body weight gain before and during pregnancy. Values arethe mean � S.E. (*, p � 0.05; **, p � 0.01; ***, p � 0.001, n � 9). LFD � black-filled; HFD � white-filled. C, shown are differences in gonadal white adipose tissue(fat pad) between the pregnant mice on a LFD or HFD at GD 18.5 (*, p � 0.05, n � 6). D, the effect of a HFD on glucose homeostasis before (GD �1) and inpregnancy (GD 16.5) was assessed by a GTT. Mice were fasted 16 h overnight and injected with 2 g/kg body weight of glucose intraperitoneal followed byblood glucose measurement for 2 h. E, glucose excursions were also measured as area under the curve (AUC) (mM glucose � min) and expressed asmean � S.E. (*, p � 0.05, **, p � 0.01, n � 6).

TABLE 3Primers used for ChIP-qPCRUntr6, untranscribed region on chromosome 6.

Region Primer sequence

Mouse Untr6 Forward: TCAGGCATGAACCACCATACReverse: AACATCCACACGTCCAGTGA

Human Untr12 Forward: TGGACCTTTACCTGCTTTATCAReverse: AGCAAGGACTAGGATGACAGAA

CS enhancer Forward: TCATTTGCGGTCCCTAACReverse: AGCCCTCACTCCCTGAGATT

CS promoter Forward: GACACTCTGTGCACAATCCTTReverse: CAGTTCTCTCTCCCTGCTTGA

GH-V promoter Forward: AGTGGCCCCAGGCCTAAACAReverse: CCTTCTCTCTCGCTGCTTCT




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

RESULTS

A HFD Leads to Significant Weight Gain before and duringPregnancy and Is Accompanied by Glucose Intolerance in hGH/CS-TG Mice—To study the effects of maternal obesity onhuman placental CS/GH-V levels, hGH/CS-TG (CD-1) micewere placed on a LFD or HFD. Mice fed the HFD had a greaterdaily calorie intake than those fed the LFD (Fig. 1A). The obe-sogenic high fat feeding for 4 weeks before and during preg-nancy resulted in a profound increase in body weight. A signif-icant increase in body weight gain in transgenic mice fed theHFD was evident after only 1 week (5.2-fold, p � 0.01, n � 9),and this trend continued throughout the dietary protocol andpregnancy (1.5-fold at GD 18.5, p � 0.05, n � 9) (Fig. 1B). Thetotal weight of the maternal gonadal fat pad was increased 3.3-fold in hGH/CS-TG mice fed with the HFD (p � 0.05, n � 6)(Fig. 1C). In conjunction with the changes in body weight, glu-cose clearance was assessed by a GTT at GD �1 (after 4 weeksof HFD and before pregnancy) and at GD 16.5. Mice main-tained on the HFD showed normal fasting blood glucose levelscompared with the LFD group (data not shown) but were glu-cose-intolerant and insulin-resistant before and during preg-nancy as demonstrated by impaired clearance of an intraperi-toneal glucose challenge (p � 0.05, n � 6) (Fig. 1D). Glucoseexcursions were also measured as area under the curve (AUC),which was significantly higher in mice on the HFD relative tothe control LFD group (p � 0.05, n � 6) (Fig. 1E). The sametrend in weight gain seen in hGH/CS-TGmice was detected inwild type, non-TG, and CD1mice 2 weeks after initiation of theHFD (2.4-fold, p � 0.05, n � 6) (Fig. 2A). A GTT was alsoperformed on non-TG CD1 mice, and similar significantimpaired glucose-load clearances as seen inTGmice before andduring pregnancywere also observed (p� 0.05, n� 6) (Fig. 2B).Placentas and litter size weight were not affected by the HFD-induced obesity in hGH/CS-TG and non-TG CD1 mice, andthey were comparable to the LFD group (data not shown).CS-A, CS-B, and GH-V RNA Levels Are Reduced by High Fat

Diet-induced Obesity and Glucose Intolerance in hGH/CS-TGMice in Pregnancy—To assess whether the CS/GH-V genes aretargets formaternal obesity, CS-A, CS-B, andGH-VRNA levelsin placental labyrinthRNA fromhGH/CS-TGmice on a LFDorHFD were examined by qPCR at GD 18.5. The HFD, initiatedbefore and during pregnancy, resulted in an apparent decreasein CS-A (30%, n � 9), CS-B (60%, n � 9), and GH-V (40%, n �

FIGURE 2. A high HFD leads to significant weight gain accompanied with glucose intolerance in wild type CD1 mice during pregnancy. A, shown is theeffect of a 4-week LFD or HFD on female wild type CD1 mouse body weight gain before and during pregnancy. Values are the mean � S.E. (**, p � 0.01), n �6. LFD � black-filled; HFD � white-filled. B, the effect of a HFD on glucose homeostasis before (GD �1) and in pregnancy (GD 16.5) was assessed by a GTT. Micewere fasted 16 h overnight and injected with 2 g/kg body weight of glucose intraperitoneally followed by blood glucose measurement for 2 h. Data areexpressed as the mean � S.E. (*, p � 0.05, n � 6).

FIGURE 3. Expression of CS (hCS-A and hCS-B) and GH-V (hGH-V) genes is nega-tively regulated by maternal obesity. A, total labyrinth RNA from hGH/CS-TG miceat GD18.5 on a LFD (black-filled) or a HFD (white-filled) was assessed by qPCR. HFDinitiatedbeforeandduringpregnancyresultedinanapparentdecreaseinCS-A,CS-B,and GH-V RNA (A) as well as mouse PL-I RNA (B) levels in the placental labyrinth.Induction of a diabetes-like state is supported by an increase in adipokine (placental)leptin transcripts (n � 8–10). C, RNA was isolated from term placenta samples andassessed by qPCR for CS-A, CS-B, and GH-V relative to GAPDH transcripts in placentasfrom obese (BMI �35 kg/m2, n � 5) (black-filled) compared with lean (BMI 20–25kg/m2, n � 9) women (white-filled). Values were calculated from a standard curve(absolute quantification). The results are expressed as mean percentage changemean�S.E. relativetoLFD,whichisarbitrarilysetto100%.Significancewasassessedby t test (*, p � 0.05; **, p � 0.01).




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

9) RNA levels (Fig. 3A). Induction of a diabetes-like state wasalso supported by an increase in adipokine (placental) leptintranscripts (3.4-fold, n� 6) (Fig. 3B), which is a characteristic ofpregnancies complicated with diabetes that require insulintherapy in humans (53). Mouse placental lactogen (PL) I andPL-II expression were also investigated, as they play a majorrole in maternal metabolic adaptation in the mouse by regulat-ing pancreatic �-cell expansion in pregnancy (54, 55); glucoseintolerance and diabetes developswhen prolactin receptors, forwhich PL-I/II are ligands, are lacking in pregnancy (56). Mater-nal obesity in hGH/CS-TG mice resulted in an apparent 55%decrease in PL-I RNA levels (p � 0.05, n � 9) but no significantchange in PL-II (Fig. 3B). The same pattern of expression forPL-I and PL-II RNAwas also observed in wild type CD1mice atGD 18.5 (p � 0.05, n � 6) (data not shown).CS-A, CS-B, and GH-V RNA Levels Are Decreased in Full-

term Human Placenta Samples from Pregnancies Complicatedby Maternal Obesity—Human term placenta CS/GH-V RNAlevels were assessed relative to GAPDH in pregnancies compli-cated by extreme maternal obesity by qPCR. There was a sig-nificant decrease in CS-A (88%), CS-B (93%), and GH-V (81%)RNA expression in placentas from obese (BMI � 35 kg/m2)compared with lean (BMI 20–25 kg/m2) women (p� 0.01, n�5–9) (Fig. 3C).Placental C/EBP� RNA Levels and Protein Binding to CS

Enhancer Regions Are Decreased in Obese hGH/CS-TG andPregnant Women—RNA levels for CS enhancer binding pro-teins C/EBP�, C/EBP�, TEF-1, and TEF-5 were assessed in pla-centa samples from both hGH/CS-TG mice fed a HFD andobese individuals. A significant 20% decrease in C/EBP� RNAlevels was detected in the placental labyrinth samples from TGmice on the HFD (p � 0.01, n � 9); however, no change inC/EBP�, TEF-1, and TEF-5 transcripts was observed (n � 9)(Fig. 4A). Similarly, a 62% decrease in C/EBP� RNA levels (p �0.01, n � 5) was also detected in human full-term placentaobtained from obese women, but again no significant effect onC/EBP�, TEF-1, and TEF-5 transcripts was seen (Fig. 4B).Maternal hepatic C/EBP� and C/EBP� transcript levels fromhGH/CS-TG mice fed a HFD were also assessed. A significant2.5-fold increase in C/EBP� RNA levels was detected in theliver samples from TG mice on a HFD compare with the LFD

group (p � 0.001, n � 4); however, no change in C/EBP� tran-scripts was observed (n � 4) (Fig. 4C).The association of C/EBP� protein with the equivalent

nuclease-protected sequences in CS-A and CS-B gene 3�-en-hancer regions (25, 26) (Fig. 5A) and identified as a componentof placenta CS enhancer activity was assessed via EMSA invitro. Elevated levels and a specific complex were detectedbetween putative CS-A and CS-B 3�-enhancer sequences andnuclear protein from JEG-3 cells overexpressingC/EBP� versus“control” JEG-3 cells (Fig. 5B). To confirmC/EBP� binding, theEMSA was repeated with C/EBP� antibodies, and a “super-shifted” band was detected (open arrowhead, Fig. 5B). Theabove-mentioned bandwas also effectively competedwith a 50-and 100-foldmolar excess of awell characterizedC/EBP�DNAelement (positive control) (57). By contrast, oligonucleotidescontaining nucleotides 61–86 of the CS-A and CS-B enhancerregions in which the C/EBP sequences were mutated were notefficient competitors (Fig. 5C). To assess the impact ofmaternalobesity on in vivo association of C/EBP� protein with CS geneenhancer regions, isolated placental labyrinth chromatin fromhGH/CS-TG mice fed a LFD versus HFD was assessed using atiling array. The reason for use of the ChIP on chip tiling arrayassay as opposed to ChIP-qPCR was the extensive sequencesimilarities between the enhancer regions of the three CS genesincluding hCS-A, hCS-B, and pseudo-hCS-L (overall �95%)(Fig. 5A). Levels ofC/EBP� associatedwith theCS-A,CS-B, andpseudo-CS-L enhancer regions were significantly reduced inplacental chromatin from TG mice fed with the HFD (p �0.001, in a pool of three samples) (Fig. 6,A and B). The C/EBP�peak intervals spanned nucleotides 59300535 to 59303012,which includes the full 241-bp enhancer regions (33); nucleo-tide numbering corresponds to human chromosome 17sequences as included in the University of California SantaCruz Genome Browser, Human 2004. This pattern of C/EBP�association with the enhancer regions in chromatin of TGmicewas comparable to our previous observation seen in humanterm placenta in situ (33). The decrease in C/EBP� bindingassociated with mice fed the HFD versus LFD was further vali-dated by ChIP-qPCR using specific primers that amplify thethree enhancer regions of the CS-A, CS-B and pseudo-CS-Lgenes (Fig. 6C). The association of C/EBP� with the CS

FIGURE 4. A significant decrease in transcription factor C/EBP� RNA levels, but not C/EBP�, TEF-1, and TEF-5, is detected in the placenta with maternalobesity. Levels of C/EBP�, C/EBP�, TEF-1, and TEF-5 in total RNA from placental labyrinth from hGH/CS-TG mice at GD18.5 on a LFD (black-filled) or a HFD(white-filled) (n � 9) (A) human full term placenta obtained from lean (n � 9) (black-filled) and obese (n � 5) (white-filled) women (B) or maternal liver fromhGH/CS-TG mice at GD18.5 on a LFD (black-filled) or a HFD (white-filled) (n � 4) (C) were assessed relative to GAPDH transcripts by qPCR. Values were calculatedfrom a standard curve (absolute quantification). The results are expressed as mean percentage change (mean � S.E.) relative to LFD, which is arbitrarily set to100%. Significance was assessed by t test (**, p � 0.01, ***, p � 0.001).




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

enhancer regions was also assessed in isolated term placentachromatin from obese versus lean women by ChIP-qPCR (Fig.6D). A significant 94% reduction in C/EBP� associated with theCS enhancers was observed in placentas from obese women(p � 0.001, in a pool of 5 samples).A loss of enhancer activity is expected to decrease transcrip-

tion. Association of RNA polymerase II (pol II) with the CS-A,CS-B, and GH-V promoter regions was assessed as an indica-tion of transcriptional status of the CS/GH-V promoters byChIP-qPCR assay. Samples of placenta chromatin from hGH/CS-TG mice on a LFD versusHFD as well as from pregnancies

complicated by chronic maternal obesity were investigated.There was a significant 40–60% reduction in RNA pol II asso-ciated with the upstream flanking promoter regions of theCS/GH-V genes (p � 0.01, n � 3) (Fig. 7, A and B).Interference with Human C/EBP� Production Decreases

Human CS/GH-V RNA Levels—Human choriocarcinomaJEG-3 cells were used to determine whether a decrease inhuman C/EBP� production will affect endogenous humanCS-A and CS-B RNA levels. JEG-3 cells were treated withsiRNAs to specifically knock down C/EBP�, and subsequentlyCS/GH-V as well as C/EBP� RNA levels were assessed at 72 h

FIGURE 5. C/EBP� binds to sequences within the CS-A and B placental enhancer regions. A, shown is alignment and comparison of conserved human CS-A,CS-B, and pseudo-CS-L 241 bp downstream enhancer regions. Nucleotides common to all three CS genes are marked with an asterisk, and arrows indicate theupstream and downstream boundaries for the 126-bp fragment linked to placenta enhancer activity; the footprint regions identified with placenta cell proteincorresponding to the putative C/EBP site (DF3) and TEF site (DF4) are boxed (25). Primer sequences used to amplify the 241-bp region and containing the C/EBPDNA element (C/EBP site, underlined) at nucleotides 61– 86 are identified with bolded text. B, the wild type duplex oligonucleotides corresponding to C/EBP sitesfrom CS-A (5�-CTAGGGTGTTTTCTAAACGATGCAT-3�) and CS-B (5�-CTAGGATGTTTTCTAAACGATGCAT-3�) 3�-enhancer regions were radiolabeled and incu-bated with nuclear extract (NE) from JEG-3 cells transfected with pcDNA3.1 (Control) or pCMV-C/EBP� (C/EBP�) expression plasmids. A specific binding event(closed arrowhead) and supershifted band seen in the presence of C/EBP� antibody (Ab, open arrowhead) are indicated. C, the effects of 50- and 100-fold massexcess of competitor duplex oligonucleotide including a known C/EBP site (5�-TGCAGATTGCGCAATCTGCAAC-3�) as a positive control (57) and mutations ofthe wild type C/EBP sites from CS-A and CS-B at the underlined sequences (from AAACG to gacta) were used with their respective wild type radiolabeledcounterpart and assessed by EMSA. A specific DNA-protein complex is indicated (closed arrowhead).




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

by qPCR. A significant 55% (p � 0.01) reduction in C/EBP�RNA was accompanied by an 85% (p � 0.05) reduction inC/EBP� protein levels (Fig. 8, A[en]C), and this was associatedwith significant decreases in CS-A (66%, p � 0.01), CS-B (77%,p � 0.001), and GH-V (83%, p � 0.05) RNA levels (Fig. 8C).

DISCUSSION

Expression of the metabolic homeostatic placental CS andGH-Vhormone geneswas decreased in twomodels ofmaternalobesity in pregnancy, specifically, acute HFD-induced obesityin mouse pregnancy and chronic obesity in human pregnancy.C/EBP� binds to the downstream CS gene enhancer regions,which although distal, would also flank the GH-V gene, andstimulates CS/GH-V promoter activity. Maternal obesityresulted in decreased association of C/EBP� with the CSenhancer regions as well as a corresponding reduction in RNA

pol II binding at CS and GH-V gene promoters. Further evi-dence for a direct effect of C/EBP�was provided through knockdown of endogenous human C/EBP�, which decreased CS andGH-V RNA levels in human placenta tumor cells. These datasuggest CS/GH-V gene expression can be modified duringpregnancy through the effects on C/EBP accessibility and alsosupports the use of humanized mice as an additional and com-plementary tool to study CS/GH-V gene control during preg-nancy at the molecular level.The C/EBP family consists of six highly related members (�,

�, �, �, �, and �) that are widely involved in controlling prolifer-ation and differentiation in various cell types (for review, seeRef. 58). C/EBP� is expressed abundantly in the placental lab-yrinth as well as in adipose tissue and liver (59). C/EBP� isknown to play a role in mouse placental development andembryonic outcome (38–40). C/EBP� expression in white adi-

FIGURE 6. Effect of maternal obesity on C/EBP� binding to CS 3�-enhancer regions. A, the association of C/EBP� protein with CS 3�-enhancer regions inlabyrinth chromatin isolated from hGH/CS-TG mice fed a low versus high fat diet was assessed by ChIP on chip tiling array. Arrays were analyzed usingAffymetrix TAS software. Thresholds were selected (�1.5) and were analyzed using Genpathway software (proprietary) that provides comprehensive infor-mation on genomic annotation, peak metrics, and sample comparisons for all peaks (intervals). Gray arrows under the map of the GH/CS locus indicate thepositions of the five GH/CS genes. White filled arrows indicate the positions of CS 3�-enhancer regions. B, to verify peaks, the results for ChIP DNA werenormalized against existing input DNA array data. Intervals on the CS-A (2130 nucleotides, 59323740-59325870) and CS-B (2477 nucleotides, 59300535-59303012) genes that include enhancer sequences were assessed. The equivalent CS-L interval (1045 nucleotides, 59338177-59339222) was also included.Significant reductions in C/EBP� association with the CS-A, CS-B, and pseudo-CS-L downstream enhancers in the hGH/CS-TG mice fed with a HFD wereobserved (p � 0.001, in a pool of 3 samples). C, tiling array results were also validated by ChIP-qPCR using an anti-C/EBP� antibody and primers (bold sequencein Fig. 5A) to amplify the equivalent CS-A, CS-B, and pseudo-CS-L 3�-enhancer regions. The binding events data were normalized to the amount of inputchromatin used for the C/EBP� immunoprecipitation reaction and the untranscribed region on chromosome 6 (Untr6) in the mouse, used as a negative control.D, ChIP-qPCR was also used to assess the binding of C/EBP� to the CS 3�-enhancer regions in human term placenta chromatin from lean (black-filled) and obese(white-filled) women. Negative controls represent primer pairs for the well characterized untranscribed human genomic region Untr12. The results areexpressed as relative mean -fold change, mean � S.E. compared with the control value, which is arbitrarily set to 1.0. Significant differences were assessed byt test and are indicated by: **, p � 0.01 and ***, p � 0.001, n � 3–5.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

pose tissue and liver is implicated in adipogenesis/glucosemetabolism in the context of obesity (42, 43). The absence ofC/EBP� protects mice from HFD-induced obesity, suggestingits active involvement in the pathogenesis of obesity (43, 60).C/EBP� is also known to play a role in obese type 2 diabeticindividuals (61). Consistent with a role in obesity, we observeda significant up-regulation of hepatic C/EBP� in hGH/CS-TGmice on the HFD versus LFD. We show for the first time, how-ever, that placental C/EBP� is a target for maternal obesity andthat its expression is significantly reduced in placentas frompregnancies complicated by obesity from two species, humanandmouse. The basis for the differential expression of C/EBP�in placenta versus liver is not yet clear but likely reflects differ-ences in functional and possibly tissue-specific targets linkedwith different physiological outcomes.The humanCS genes are expressed at high levels in placental

villus syncytiotrophoblasts throughout pregnancy (12). The

specific sequence requirements for efficient in vivo CS expres-sion have not as yet been determined. Placental enhancer activ-ity (300–400-fold) was detected about 2 kb downstream of theCS genes and has been linked to a 126-bp region containing twosites of DNA-protein interaction, as detected in both CS-A andCS-B sequences with placental cell protein (25, 26). TEF wasshown to bind one of these sites (27, 34, 36); however, the iden-tity of the protein, detected in placental and non-placental cellextracts capable of binding the second site, referred to as FP2for CS-A and DF3 for CS-B 3�-enhancer sequences, was notdefined (25, 26). Subsequently, we identified putative C/EBPsites in these sequences using transcription factor databases(33). We also showed that C/EBP overexpression significantlystimulated the expression of hybrid reporter genes driven by aminimal (496 bp) CS promoter and containing either CS-A orCS-B 3�-enhancer regions in JEG-3 cells (33). Our data nowconfirm C/EBP� binding to nucleotides 61–86 of the CS-A orCS-B 3�-enhancer regions in vitro, which correspond to thepreviously identified “footprint” regions FP2 and DF3, which islinked to placental enhancer (25, 26). This is also consistentwith our previous observation that C/EBP� associates with theCS 3�-enhancer regions in normal human term placenta chro-matin in situ (33). Furthermore our finding is consistent with asignificant role for C/EBP� as a physiological regulator of theCS genes as well as a target for maternal obesity in pregnancy;decreases in C/EBP� RNA, protein binding, and CS RNA levelswere all detected in placentas from hGH/CS-TG mice andhuman full term placenta associated with acute HFD-inducedmouse and/or chronic human obesity in pregnancy. Thedecrease in C/EBP� association with CS 3�-enhancer regionswas also accompanied by a corresponding decrease in RNA polII levels at the CS-A and CS-B promoters, suggesting a directeffect of C/EBP� on CS gene expression. A direct effect ofC/EBP� was also supported by the decrease in endogenousCS-A andCS-BRNA levels observedwith siRNAknockdownofhuman C/EBP� in JEG-3 cells.

The decrease in C/EBP� with maternal obesity in mouse orhuman pregnancies as well as through knockdown in JEG-3cells resulted in decreases in GH-V RNA levels and RNA pol IIassociation with the GH-V promoter. Unlike the CS genes, theGH-V gene has no conserved downstream enhancer region orequivalent CCAAT-binding site (assessed by using availabletranscription factor databases). This then raises a question as tothe mechanism by which GH-V gene expression is down-regu-lated in response to a loss of C/EBP�. An explanationmay lie inthe position ofhGH-V betweenhCS-A andhCS-B in theGH/CSgene locus, which would result in the GH-V gene being flankedat both ends by two potent placental CS 3�-enhancer and CSpromoter regions. An assessment of hyperacetylated histoneH3 and H4 in human syncytiotrophoblast versus cytotropho-blast cultures indicated that the CS and GH-V genes reside in aregion of hyperacetylated chromatin centered between hCS-Aand hCS-B, presumably reflecting increased accessibility (35).In addition, examples of transcriptional regulation by enhanc-ers from an adjacent gene have been described (62). Thedecrease in RNApol II levels detected at theGH-V aswell as theCS-A and CS-B promoters in human and murine placentalsamples with maternal obesity is consistent with this possibil-

FIGURE 7. RNA polymerase II (pol II) levels are reduced at the CS/GH-Vpromoters with maternal obesity. ChIP was performed with an anti-RNApol II antibody to assess changes in association of the transcriptional machin-ery with CS and GH-V promoter regions in placental chromatin from hGH/CS-TG mice with acute HFD-induced maternal obesity (A) and human preg-nancies complicated by more chronic maternal obesity (B). The bindingevents data were normalized to the amount of input chromatin used for theRNA polymerase II immunoprecipitation reaction and the control untran-scribed regions of mouse (Untr6) and human (Untr12) as appropriate. Theresults are expressed as relative mean -fold change, mean � S.E. comparedwith the control value, which is arbitrarily set to 1.0. Significant differences areindicated by: *, p � 0.05; **, p � 0.01; ***, p � 0.001, n � 3–5.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

ity. The mechanism of enhancer-promoter looping is a wellcharacterized model for regulation of a neighboring gene by anenhancer (63, 64). In this case hGH-V expression, like hCS-Aand hCS-B, might be influenced by a reduction inC/EBP� bind-ing at the downstream CS 3�-enhancers and, as a result, a cor-responding decrease in CS enhancer activity. Relatively longdistances and looping out of intervening sequences are requiredto bring enhancers and target promoters into close proximity.This allows delivery and interaction of bound “enhancer” and“basal promoter” proteins, thereby activating and controllinggene expression (65). Physical and functional interactionbetween C/EBP� and chromatin remodeling complexes hasbeen described, whichwould be consistent with this role for theCS and potentially GH-V genes (66).C/EBP� production in placenta is localized to syncytiotro-

phoblasts in both human and non-human primates, which isconsistent with a role in CS/GH-V gene regulation (67).Remarkably, the villous cytotrophoblasts are negative forC/EBP� immunostaining at all stages of gestation (37, 68, 69),and as the syncytial layer derives from the fusion of cytotropho-blasts, this might predict a role for C/EBP� in cytotrophoblastdifferentiation into syncytiotrophoblast (70). By extension, adecrease inC/EBP� availability resulting frommaternal obesitymight be expected to preserve cytotrophoblasts and potentiallyan immature placental structure with compromised function.Histopathological assessments of placentas complicated by

obesity are variable and, as such, are inconclusive. In a recentstudy no substantial difference in placental maturity and thedegree of terminal villi formation was observed in placentasfrom obese compared with lean women; placental immaturitywas characterized as larger chorionic villi and more centeredblood vessels (71). By comparison, in an earlier study, severeplacental villous immaturity as defined by delayed villous mat-uration was detected in some obese women (BMI � 30 kg/m2)who showed signs of mild glucose intolerance but did not meetthe criteria for gestational diabetes (72). Placentas from obesenon-human primates also showed signs of decreased placentalsyncytiotrophoblast amplification factor and thicker villi,which is consistent with structural impairment of the syncy-tiotrophoblast microvilli surface (73). Thus, the possibility thatmaternal obesity may interfere with the transition of cytotro-phoblasts to syncytiotrophoblast and, as result, indirectly affectCS/GH-V gene expression cannot be ruled out (70). Of course,the possible indirect and direct effects of C/EBP� on CS geneexpression are not mutually exclusive.Although the mechanism by which the CS/GH-V genes are

regulated byC/EBP� appears conserved, the degree of responseobserved in the “acute” mouse model was reduced relative tothe “chronic” humanmodel ofmaternal obesity. Possible expla-nationsmay relate to the nature of the obese state and exposuretime to the obesity-associated endocrine complications, speciesdifferences including related to placental structure as well as

FIGURE 8. Knockdown of human C/EBP� in JEG-3 cells results in a decrease in endogenous CS and GH-V RNA levels. JEG-3 cells were treated with siRNAsfor C/EBP� or a “scrambled sequence” as a negative control for 72 h. After siRNA transfection, C/EBP� RNA levels were assessed relative to GAPDH transcriptsby qPCR (A), and protein (�45 kDa) levels in whole cell lysate (10 �g) were examined by SDS-PAGE and immunoblotting (IB) (B). Two independent antibodieswere used and detected the same pattern by chemiluminescence; a representative blot using Millipore, 04-1153 C/EBP� antibody is shown. �-Tubulin (�55kDa) was used as loading control. C, C/EBP� and �-tubulin protein levels were quantified using Image J software. D, CS/GH-V RNA levels were assessed at 72 hrelative to GAPDH transcripts by qPCR post C/EBP� siRNA transfection. The results are expressed as mean percentage change, mean � S.E., relative to thescrambled sequence control siRNA, which is arbitrarily set to 100%. Significance was assessed by t test, and significant differences are indicated by: *, p � 0.05;**, p � 0.01; ***, p � 0.001, n � 4.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

redundancy related to the C/EBP family. The differences in thetime course of obesity, acute versus chronic, may provide vari-able opportunity for metabolic derangements, like inflamma-tion, to influence placental gene expression (71, 73). Themouseand human placenta serve the same function but have differentcellular composition and organization. Inmice, a bilayer of syn-cytiotrophoblasts separates fetal capillaries from the maternalside, whereas in humans this separation involves only one layerof syncytiotrophoblasts (74, 75). Moreover, the properties ofthese cell types may be different; the major placental lactogen(PL-II) in mouse is expressed predominantly by trophoblasts(74–76), whereas themajor source of placental lactogen (CS) inthe human placenta is syncytiotrophoblasts (12). CS expressionis localized to cells positioned adjacent to the maternal-fetalinterface and throughout the labyrinth in the hGH/CS-TGmice (18, 21). This is consistent with CS expression in bothsyncytiotrophoblasts as well as trophoblast cells (18). There isalso evidence for redundant functions of C/EBP� and C/EBP�in placentas based on null mutations inmice, although C/EBP�is most abundant in human andmouse placenta (37, 38, 68, 69).Despite these differences, the data presented are consistentwith a negative impact of maternal obesity, whether short orlong term, on the expression of C/EBP� and its downstreamtargets, which would include the CS genes.Three placenta tissue/cell systems were used to study the

effects ofmaternal obesity and/orC/EBP� onhumanCS/GH-Vgene regulation. Multiple human choriocarcinoma cell lines aswell as primary term placental cultures have helped increaseour understanding of how placental members of GH gene fam-ily are controlled by various metabolic and endocrine factors.They have proven to be invaluable tools and models for thestudy of the cellular and molecular aspects of human placentaltrophoblasts (77, 78). The humanized hGH/CS-TG mousecomplements these cell systems by modeling pregnancy andallowing assessment of CS/GH-V gene expression in the pres-ence of an intact endocrine system, with sampling as pregnancyprogresses; this includes pregnancies with complications, suchas the HFD-induced maternal obesity and insulin-resistantstate as used here.

Acknowledgments—We thank the women who generously consentedto participate in this study. We are also very grateful to our researchnurse, Fran Mulhall, who helped facilitate recruitment of partici-pants to the study. We also thankMargaret Bock for excellent techni-cal assistance in sampling the human placental tissues.

REFERENCES1. Heslehurst, N., Ells, L. J., Simpson, H., Batterham, A., Wilkinson, J., and

Summerbell, C. D. (2007) Trends in maternal obesity incidence rates,demographic predictors, and health inequalities in 36,821 women over a15-year period. BJOG 114, 187–194

2. Heslehurst, N., Lang, R., Rankin, J.,Wilkinson, J. R., and Summerbell, C. D.(2007) Obesity in pregnancy. a study of the impact of maternal obesity onNHS maternity services. BJOG 114, 334–342

3. Denison, F. C., Roberts, K. A., Barr, S. M., and Norman, J. E. (2010) Obe-sity, pregnancy, inflammation, and vascular function. Reproduction 140,373–385

4. Kawai, M., and Kishi, K. (1999) Adaptation of pancreatic islet B-cells dur-ing the last third of pregnancy. Regulation of B-cell function and prolifer-

ation by lactogenic hormones in rats. Eur. J. Endocrinol. 141, 419–4255. Parsons, J. A., Brelje, T. C., and Sorenson, R. L. (1992) Adaptation of islets

of Langerhans to pregnancy. Increased islet cell proliferation and insulinsecretion correlates with the onset of placental lactogen secretion. Endo-crinology 130, 1459–1466

6. Butler, A. E., Cao-Minh, L., Galasso, R., Rizza, R. A., Corradin, A., Cobelli,C., and Butler, P. C. (2010) Adaptive changes in pancreatic beta cell frac-tional area and beta cell turnover in human pregnancy. Diabetologia 53,2167–2176

7. Sorenson, R. L., and Brelje, T. C. (1997) Adaptation of islets of Langerhansto pregnancy. Beta cell growth, enhanced insulin secretion, and the role oflactogenic hormones. Horm. Metab. Res. 29, 301–307

8. Nielsen, J. H., Galsgaard, E. D.,Møldrup, A., Friedrichsen, B. N., Billestrup,N., Hansen, J. A., Lee, Y. C., and Carlsson, C. (2001) Regulation of beta cellmass by hormones and growth factors. Diabetes 50, S25–S29

9. Vickers, M. H., Gilmour, S., Gertler, A., Breier, B. H., Tunny, K., Waters,M. J., and Gluckman, P. D. (2009) 20-kDa placental hGH-V has dimin-ished diabetogenic and lactogenic activities compared with 22-kDahGH-N while retaining antilipogenic activity. Am. J. Physiol. Endocrinol.Metab. 297, E629–E637

10. Handwerger, S. (2009) The growth hormone gene cluster Physiologicalactions and regulation during pregnancy. Growth Genet. Horm. 25, 1–8

11. Day, I. N., Chen, X. H., Gaunt, T. R., King, T. H., Voropanov, A., Ye, S.,Rodriguez, S., Syddall, H. E., Sayer, A. A., Dennison, E. M., Tabassum, F.,Barker, D. J., Cooper, C., and Phillips, D. I. (2004) Late life metabolicsyndrome, early growth, and common polymorphism in the growth hor-mone and placental lactogen gene cluster. J. Clin. Endocrinol. Metab. 89,5569–5576

12. Hoshina,M., Boothby,M., and Boime, I. (1982) Cytological localization ofchorionic gonadotropin � and placental lactogen mRNAs during devel-opment of the human placenta. J. Cell Biol. 93, 190–198

13. Goossens,M. (1986) hGH andmolecular biology.Ann. Endocrinol. (Paris)47, 363–371

14. Gordon, Y. B., Grudzinskas, J. G., Lewis, J. D., Jeffrey, D., and Letchworth,A. T. (1977) Circulating levels of pregnancy-specific �1-glycoprotein andhuman placental lactogen in the third trimester of pregnancy. Their rela-tionship to parity, birth weight, and placental weight. Br. J. Obstet. Gynae-col. 84, 642–647

15. Saxena, B.N., Emerson, K., Jr., and Selenkow,H.A. (1969) Serumplacentallactogen (HPL) levels as an index of placental function. N. Engl. J. Med.281, 225–231

16. McWilliams, D., and Boime, I. (1980) Cytological localization of placentallactogen messenger ribonucleic acid in syncytiotrophoblast layers of hu-man placenta. Endocrinology 107, 761–765

17. Boime, I., Boothby,M.,Hoshina,M., Daniels-McQueen, S., andDarnell, R.(1982) Expression and structures of human placental hormone genes as afunction of placental development. Biol. Reprod. 26, 73–91

18. Jin, Y., Lu, S. Y., Fresnoza, A., Detillieux, K. A., Duckworth, M. L., andCattini, P. A. (2009) Differential placental hormone gene expression dur-ing pregnancy in a transgenic mouse containing the human growth hor-mone/chorionic somatomammotropin locus. Placenta 30, 226–235

19. Jin, Y., Surabhi, R. M., Fresnoza, A., Lytras, A., and Cattini, P. A. (1999) Arole for A/T-rich sequences and Pit-1/GHF-1 in a distal enhancer locatedin the human growth hormone locus control region with preferentialpituitary activity in culture and transgenic mice. Mol. Endocrinol. 13,1249–1266

20. Jones, B. K., Monks, B. R., Liebhaber, S. A., and Cooke, N. E. (1995) Thehuman growth hormone gene is regulated by a multicomponent locuscontrol region.Mol. Cell. Biol. 15, 7010–7021

21. Su, Y., Liebhaber, S. A., and Cooke, N. E. (2000) The human growth hor-mone gene cluster locus control region supports position-independentpituitary- and placenta-specific expression in the transgenicmouse. J. Biol.Chem. 275, 7902–7909

22. Norquay, L. D., Yang, X., Sheppard, P., Gregoire, S., Dodd, J. G., Reith,W.,and Cattini, P. A. (2003) RFX1 andNF-1 associate with P sequences of thehuman growth hormone locus in pituitary chromatin. Mol. Endocrinol.17, 1027–1038

23. Norquay, L. D., Jin, Y., Surabhi, R.M., Gietz, R. D., Tanese, N., and Cattini,




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

P. A. (2001) A member of the nuclear factor-1 family is involved in thepituitary repression of the human placental growth hormone genes.Biochem. J. 354, 387–395

24. Elefant, F., Su, Y., Liebhaber, S. A., and Cooke, N. E. (2000) Patterns ofhistone acetylation suggest dual pathways for gene activation by a bifunc-tional locus control region. EMBO J. 19, 6814–6822

25. Jacquemin, P., Oury, C., Peers, B.,Morin, A., Belayew, A., andMartial, J. A.(1994) Characterization of a single strong tissue-specific enhancer down-stream from the three human genes encoding placental lactogen. Mol.Cell. Biol. 14, 93–103

26. Jiang, S. W., and Eberhardt, N. L. (1994) The human chorionic somato-mammotropin gene enhancer is composed of multiple DNA elementsthat are homologous to several SV40 enhansons. J. Biol. Chem. 269,10384–10392

27. Lytras, A., and Cattini, P. A. (1994) Human chorionic somatomammotro-pin gene enhancer activity is dependent on the blockade of a repressormechanism.Mol. Endocrinol. 8, 478–489

28. Walker, W. H., Fitzpatrick, S. L., and Saunders, G. F. (1990) Human pla-cental lactogen transcriptional enhancer. Tissue specificity and bindingwith specific proteins. J. Biol. Chem. 265, 12940–12948

29. Xiao, J. H., Davidson, I., Matthes, H., Garnier, J. M., and Chambon, P.(1991) Cloning, expression, and transcriptional properties of the humanenhancer factor TEF-1. Cell 65, 551–568

30. Jacquemin, P., Martial, J. A., and Davidson, I. (1997) Human TEF-5 ispreferentially expressed in placenta and binds to multiple functional ele-ments of the human chorionic somatomammotropin-B gene enhancer.J. Biol. Chem. 272, 12928–12937

31. Jiang, S. W., Wu, K., and Eberhardt, N. L. (1999) Human placental TEF-5transactivates the human chorionic somatomammotropin gene enhancer.Mol. Endocrinol. 13, 879–889

32. Jacquemin, P., Oury, C., Belayew, A., and Martial, J. A. (1994) A TEF-1binding motif that interacts with a placental protein is important for thetranscriptional activity of the hCS-B enhancer. DNA Cell Biol. 13,1037–1045

33. Lytras, A., Detillieux, K., and Cattini, P. A. (2011) Identification of func-tional CCAAT/enhancer-binding protein and Ets protein binding sites inthe human chorionic somatomammotropin enhancer sequences. J. Mol.Endocrinol. 47, 179–193

34. Rogers, B. L., Sobnosky, M. G., and Saunders, G. F. (1986) Transcriptionalenhancer within the human placental lactogen and growth hormonemul-tigene cluster. Nucleic Acids Res. 14, 7647–7659

35. Kimura, A. P., Sizova, D., Handwerger, S., Cooke, N. E., and Liebhaber,S. A. (2007) Epigenetic activation of the human growth hormone genecluster during placental cytotrophoblast differentiation. Mol. Cell. Biol.27, 6555–6568

36. Lytras, A., Surabhi, R. M., Zhang, J. F., Jin, Y., and Cattini, P. A. (1996)“Repair” of the chorionic somatomammotropin-A “enhancer” region re-veals a novel functional element in the chorionic somatomammotropin-Benhancer.Mol. Cell. Endocrinol. 119, 1–10

37. Bamberger, A. M., Makrigiannakis, A., Schröder, M., Bamberger, C. M.,Relakis, C., Gellersen, B., Milde-Langosch, K., and Löning, T. (2004) Ex-pression pattern of the CCAAT/enhancer-binding proteins C/EBP-�,C/EBP-�, and C/EBP-� in the human placenta. Virchows Arch. 444,149–152

38. Bégay, V., Smink, J., and Leutz, A. (2004) Essential requirement ofCCAAT/enhancer binding proteins in embryogenesis.Mol. Cell. Biol. 24,9744–9751

39. Holland, M. P., Bliss, S. P., Berghorn, K. A., and Roberson, M. S. (2004) Arole for CCAAT/enhancer-binding protein� in the basal regulation of thedistal-less 3 gene promoter in placental cells. Endocrinology 145,1096–1105

40. Liang, X. H., Zhao, Z. A., Deng, W. B., Tian, Z., Lei, W., Xu, X., Zhang,X. H., Su, R. W., and Yang, Z. M. (2010) Estrogen regulates amiloride-binding protein 1 throughCCAAT/enhancer-binding protein-� inmouseuterus during embryo implantation and decidualization. Endocrinology151, 5007–5016

41. Schroeder-Gloeckler, J.M., Rahman, S.M., Janssen, R. C.,Qiao, L., Shao, J.,Roper,M., Fischer, S. J., Lowe, E., Orlicky, D. J.,McManaman, J. L., Palmer,

C., Gitomer, W. L., Huang, W., O’Doherty, R. M., Becker, T. C., Klemm,D. J., Jensen, D. R., Pulawa, L. K., Eckel, R. H., and Friedman, J. E. (2007)CCAAT/enhancer-binding protein � deletion reduces adiposity, hepaticsteatosis, and diabetes in Lepr(db/db) mice. J. Biol. Chem. 282,15717–15729

42. Ramji, D. P., and Foka, P. (2002) CCAAT/enhancer-binding proteins.Structure, function and regulation. Biochem. J. 365, 561–575

43. Millward, C. A., Heaney, J. D., Sinasac, D. S., Chu, E. C., Bederman, I. R.,Gilge, D. A., Previs, S. F., and Croniger, C. M. (2007) Mice with a deletionin the gene for CCAAT/enhancer-binding protein � are protected againstdiet-induced obesity. Diabetes 56, 161–167

44. Klassen, M. E., Nachtigal, M. W., and Cattini, P. A. (1989) Human chori-onic somatomammotropin gene expression in primary placental cell cul-tures. Placenta 10, 321–329

45. Nachtigal, M. W., Bock, M. E., Kowaluk, B. A., and Cattini, P. A. (1992)Chorionic gonadotrophin and c-myc expression in growing and growth-inhibited (intermediate) trophoblasts. Placenta 13, 371–383

46. Nickel, B. E., and Cattini, P. A. (1991) Tissue-specific expression and thy-roid hormone regulation of the endogenous placental growth hormonevariant and chorionic somatomammotropin genes in a human choriocar-cinoma cell line. Endocrinology 128, 2353–2359

47. Haig, D. (2008) Placental growth hormone-related proteins and prolactin-related proteins. Placenta 29, S36–S41

48. Lacroix, M. C., Guibourdenche, J., Frendo, J. L., Pidoux, G., and Evain-Brion, D. (2002) Placental growth hormones. Endocrine 19, 73–79

49. Vakili, H., Jin, Y., Nagy, J. I., and Cattini, P. A. (2011) Transgenic miceexpressing the human growth hormone gene provide a model system tostudy human growth hormone synthesis and secretion in non-tumor-derived pituitary cells. Differential effects of dexamethasone and thyroidhormone.Mol. Cell. Endocrinol. 345, 48–57

50. Vakili, H., Jin, Y., and Cattini, P. A. (2012) Negative regulation of humangrowth hormone gene expression by insulin is dependent on hypoxia-inducible factor binding in primary non-tumor pituitary cells. J. Biol.Chem. 287, 33282–33292

51. Matt, D. W., and Macdonald, G. J. (1985) Placental steroid production bythe basal and labyrinth zones during the latter third of gestation in the rat.Biol. Reprod. 32, 969–977

52. Gunasekharan, V., Haché, G., and Laimins, L. (2012) Differentiation-de-pendent changes in levels of C/EBP� repressors and activators regulatehuman papillomavirus type 31 late gene expression. J. Virol. 86,5393–5398

53. Lepercq, J., Cauzac, M., Lahlou, N., Timsit, J., Girard, J., Auwerx, J., andHauguel-de Mouzon, S. (1998) Overexpression of placental leptin in dia-betic pregnancy. A critical role for insulin. Diabetes 47, 847–850

54. Brelje, T. C., Scharp, D. W., Lacy, P. E., Ogren, L., Talamantes, F., Robert-son, M., Friesen, H. G., and Sorenson, R. L. (1993) Effect of homologousplacental lactogens, prolactins, and growth hormones on islet B-cell divi-sion and insulin secretion in rat, mouse, and human islets. Implication forplacental lactogen regulation of islet function during pregnancy. Endocri-nology 132, 879–887

55. Kondegowda, N. G.,Mozar, A., Chin, C., Otero, A., Garcia-Ocaña, A., andVasavada, R. C. (2012) Lactogens protect rodent and human beta cellsagainst glucolipotoxicity-induced cell death through Janus kinase-2(JAK2)/signal transducer and activator of transcription-5 (STAT5) signal-ling. Diabetologia 55, 1721–1732

56. Huang, C., Snider, F., and Cross, J. C. (2009) Prolactin receptor is requiredfor normal glucose homeostasis and modulation of beta cell mass duringpregnancy. Endocrinology 150, 1618–1626

57. Vinson, C. R., Sigler, P. B., andMcKnight, S. L. (1989) Scissors-grip modelfor DNA recognition by a family of leucine zipper proteins. Science 246,911–916

58. Lekstrom-Himes, J., and Xanthopoulos, K. G. (1998) Biological role of theCCAAT/enhancer-binding protein family of transcription factors. J. Biol.Chem. 273, 28545–28548

59. Birkenmeier, E. H., Gwynn, B., Howard, S., Jerry, J., Gordon, J. I., Land-schulz, W. H., and McKnight, S. L. (1989) Tissue-specific expression, de-velopmental regulation, and genetic mapping of the gene encodingCCAAT/enhancer binding protein. Genes Dev. 3, 1146–1156




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

60. Lefterova, M. I., Zhang, Y., Steger, D. J., Schupp, M., Schug, J., Cristancho,A., Feng,D., Zhuo,D., Stoeckert, C. J., Jr., Liu, X. S., and Lazar,M.A. (2008)PPAR� and C/EBP factors orchestrate adipocyte biology via adjacentbinding on a genome-wide scale. Genes Dev. 22, 2941–2952

61. Dubois, S. G., Heilbronn, L. K., Smith, S. R., Albu, J. B., Kelley, D. E., andRavussin, E. (2006) Decreased expression of adipogenic genes in obesesubjects with type 2 diabetes. Obesity 14, 1543–1552

62. Kim, T. K., Hemberg, M., Gray, J. M., Costa, A. M., Bear, D. M., Wu, J.,Harmin, D. A., Laptewicz, M., Barbara-Haley, K., Kuersten, S., Marken-scoff-Papadimitriou, E., Kuhl, D., Bito, H., Worley, P. F., Kreiman, G., andGreenberg, M. E. (2010) Widespread transcription at neuronal activity-regulated enhancers. Nature 465, 182–187

63. Bulger,M., andGroudine,M. (2011) Functional andmechanistic diversityof distal transcription enhancers. Cell 144, 327–339

64. Montavon, T., Soshnikova, N.,Mascrez, B., Joye, E., Thevenet, L., Splinter,E., de Laat, W., Spitz, F., and Duboule, D. (2011) A regulatory archipelagocontrols Hox genes transcription in digits. Cell 147, 1132–1145

65. Harju, S., McQueen, K. J., and Peterson, K. R. (2002) Chromatin structureand control of beta-like globin gene switching. Exp. Biol. Med. (Maywood)227, 683–700

66. Steinberg, X. P., Hepp, M. I., Fernández García, Y., Suganuma, T., Swan-son, S. K., Washburn, M., Workman, J. L., and Gutiérrez, J. L. (2012)Human CCAAT/enhancer-binding protein � interacts with chromatinremodeling complexes of the imitation switch subfamily.Biochemistry 51,952–962

67. Chen, H., Lin, B., Chen, C. L., Johnson, P. F., and Chou, J. Y. (1995) Role ofthe transcription factor C/EBP � in expression of a rat pregnancy-specificglycoprotein gene. DNA Cell Biol. 14, 681–688

68. Radde, J., Löning, T., and Bamberger, A. M. (2004) Expression pattern ofthe CCAAT/enhancer-binding protein C/EBP-� in gestational tropho-blastic disease. Int. J. Gynecol. Pathol. 23, 373–377

69. Kannan, A., Fazleabas, A. T., Bagchi, I. C., and Bagchi, M. K. (2010) The

transcription factor C/EBP� is a marker of uterine receptivity and ex-pressed at the implantation site in the primate. Reprod. Sci. 17, 434–443

70. Hoshina, M., Boime, I., andMochizuki, M. (1984) Cytological localizationof hPL, hCG, and mRNA in chorionic tissue using in situ hybridization.Nihon Sanka Fujinka Gakkai Zasshi 36, 397–404

71. Roberts, K. A., Riley, S. C., Reynolds, R.M., Barr, S., Evans,M., Statham,A.,Hor, K., Jabbour, H. N., Norman, J. E., and Denison, F. C. (2011) Placentalstructure and inflammation in pregnancies associated with obesity. Pla-centa 32, 247–254

72. Schäfer-Graf, U. M., Dupak, J., Vogel, M., Dudenhausen, J. W., Kjos, S. L.,Buchanan, T. A., and Vetter, K. (1998) Hyperinsulinism, neonatal obesity,and placental immaturity in infants born to women with one abnormalglucose tolerance test value. J. Perinat. Med. 26, 27–36

73. Farley, D., Tejero, M. E., Comuzzie, A. G., Higgins, P. B., Cox, L., Werner,S. L., Jenkins, S. L., Li, C., Choi, J., Dick, E. J., Jr., Hubbard, G. B., Frost, P.,Dudley, D. J., Ballesteros, B., Wu, G., Nathanielsz, P. W., and Schlabritz-Loutsevitch,N. E. (2009) Feto-placental adaptations tomaternal obesity inthe baboon. Placenta 30, 752–760

74. Watson, E. D., and Cross, J. C. (2005) Development of structures andtransport functions in the mouse placenta. Physiology 20, 180–193

75. Cross, J. C. (2005) How to make a placenta. Mechanisms of trophoblastcell differentiation in mice. A review. Placenta 26, S3–S9

76. Colosi, P., Marr, G., Lopez, J., Haro, L., Ogren, L., and Talamantes, F.(1982) Isolation, purification, and characterization ofmouse placental lac-togen. Proc. Natl. Acad. Sci. U.S.A. 79, 771–775

77. Zeck, W., Widberg, C., Maylin, E., Desoye, G., Lang, U., McIntyre, D.,Prins, J., and Russell, A. (2008) Regulation of placental growth hormonesecretion in a human trophoblast model. The effects of hormones andadipokines. Pediatr. Res. 63, 353–357

78. Alsat, E., Guibourdenche, J., Luton, D., Frankenne, F., and Evain-Brion, D.(1997) Human placental growth hormone. Am. J. Obstet. Gynecol. 177,1526–1534




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Hana Vakili, Yan Jin, Savas Menticoglou and Peter A. CattiniComplicated by Maternal Obesity

Growth Hormone Genes Are Targets for Dysregulation in Pregnancies ) and Downstream Human Placentalβ (C/EBPβCCAAT-enhancer-binding Protein

doi: 10.1074/jbc.M113.474999 originally published online June 19, 20132013, 288:22849-22861.J. Biol. Chem.

10.1074/jbc.M113.474999Access the most updated version of this article at doi:

Alerts:

When a correction for this article is posted•

When this article is cited•

to choose from all of JBC's e-mail alertsClick here

http://www.jbc.org/content/288/31/22849.full.html#ref-list-1

This article cites 78 references, 24 of which can be accessed free at


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/lookup/doi/10.1074/jbc.M113.474999

http://www.jbc.org/cgi/alerts?alertType=citedby&addAlert=cited_by&cited_by_criteria_resid=jbc;288/31/22849&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/288/31/22849

http://www.jbc.org/cgi/alerts?alertType=correction&addAlert=correction&correction_criteria_value=288/31/22849&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/288/31/22849

http://www.jbc.org/cgi/alerts/etoc

http://www.jbc.org/content/288/31/22849.full.html#ref-list-1

http://www.jbc.org/

ccaat-enhancer-bindingprotein (c/ebp )and ...( 80 c) after delivery for storage or processing. an...

Documents