chapter: 4shodhganga.inflibnet.ac.in/bitstream/10603/69881/9/chapter 4.pdf · phenotype) with...

Chapter: 4

Mechanism of erythromycin and tetracycline

resistance in lactic acid bacteria isolated from

fermented foods

Chapter 4 Phenotype and genotype of ER and TC resistance

Surya Chandra Rao, T 106

4.1. Overview

The aim of the study was to evaluate the acquired erythromycin resistance (ERr) in

all the selected 60 LAB isolates using phenotypic and genotypic tests. Employing

the characteristic macrolide-lincosamide-streptogramin B (MLSB) resistance

double disc diffusion, ‘D’ zone test was performed and the isolates were

categorized as constitutive (cMLSB), inducible (iMLSB), keyhole (KH),

lincosamide (L), intermediate (I), and synergistic intermediate (SI) phenotypes.

The LAB cultures displayed erythromycin minimum inhibitory concentration

(MIC) ranging from 8 to 256 g/ml. For most of the isolates obtained from

traditional fermented foods, the MIC values for erythromycin were lower (8-32

g/ml) when compared with those from fermented dry sausages. Positive PCR

amplifications were obtained for methylase encoding gene, erm(B) in 88% of the

total LAB isolates. Beside erm(B), the macrolide efflux gene, msr(C) was also

found in En. durans, P. pentosaceus, En. lactis and Lb. fermentum. None of the

isolates were positive for erm(A), erm(C) or mef(A). The evaluation of all the ERr

isolates for tetracycline resistance (TCr) displayed MIC values ranging from 8-

256 μg/ml. TCr determinants [tet(M), tet(W), tet(S) tet(O), tet(K) and tet(L)]

demonstrated their presence in Lactobacillus and Pediococcus and Enterococcus

species with simultaneous occurrence of genes with same or different

mechanisms. Besides tet and erm genes, lnu(B) was also detected in one each of

En. faecium and Lb. salivarius isolates. The results of the study underline the



prevalence of acquired ERr and TC

r in LAB of food origin. In addition, the

detection of diverse phenotypes among LAB indicated the presence of unidentified

ERr genes or mutations in the identified resistance genes. This study signifies

acquired ERr and TC

r genes in LAB isolates that displayed diverse MLSB

phenotypes.

4.2. Introduction

A variety of antibiotics especially the macrolides are currently used in human and

veterinary medicine because of their proven record to cure illness (Landers, 2012).

Their wide spread usage has also resulted in the development of strains resistant to

these life saving antibiotics (Bailey et al., 2008). Three principal mechanisms have

so far been found to be responsible for acquired macrolide resistance in bacteria;

target site modification, active efflux and antibiotic inactivation (Roberts, 2005).

The former, most prevalent mechanism usually depends on a post transcriptional,

methylase-mediated modification of 23S rRNA encoded by erythromycin

ribosomal methylation (erm) genes (Weisblum, 2000). The methylation of the

target (23S rRNA) causes cross-resistance among 3 antibiotic families; macrolides

(eg. erythromycin, azithromycin and clarithromycin), lincosamides (eg,

clindamycin) and group B streptogramins (pristinamycin) (MLSB) that share a

common binding/target site (Lambert, 2012).



Resistance to macrolides can also occur by a number of different genes

coding for transport (efflux) proteins that pump the antibiotic out of the cell

keeping intracellular concentration of the antibiotic low. Many of these proteins

[mef(A), mef(E), lmr(A), msr(A), msr(B) and msr(C)] are members of major

facilitator superfamily (MFS) or ABC transporter superfamily (Roberts, 2005).

The action of these proteins is characterized with low level resistance to 14- and

15-membered ring macrolides and streptogramins and remains sensitive to

lincosamides (Montanari et al., 2003; Steward et al., 2005). Another resistance

mechanism, inactivation of macrolides mediated by chemical modification

through esterase encoding ere variants confer high level resistance to macrolides

(Roberts, 2008).

The erm mediated resistance can be expressed either constitutively, with

high resistance levels to all the MLS antibiotics (cMLSB phenotype), or inducibly

(iMLSB phenotype) with macrolide induced lincosamide resistance (Montanari et

al., 2003). Similarly, efflux pumps conferring resistance to macrolide and

streptogramin or macrolides alone are characterized with MS and M phenotypes

respectively (Montanari et al., 2003; Steward et al., 2005). An in vitro double disc

diffusion test using erythromycin (15 μg) and clindamycin (2 μg) can distinguish

erm-mediated resistance phenotypes (iMLSB and cMLSB) from that of efflux

mediated M or MS phenotype (Woods, 2009). Resistance to MLSB antibiotics

employing double disc diffusion/D zone test have been well characterized in

Gram-positive pathogens such as Streptococcus agalactiae (Malbruny et al.,



2004), S. pyogenes (Giovanetti et al., 1999; Giovanetti et al., 2002) and several

clinically important pathogens. However, such studies in LAB isolates from food

origin are limited.

Tetracycline is a group of broad spectrum antibiotics that is continued to be

used for treatment in a variety of Gram-positive and Gram-negative bacterial

infections (Roberts, 2005). Bacterial resistance to these antibiotics is mediated

either by energy-dependant efflux systems or proteins that protect the bacterial

ribosomes or in rare cases through direct inactivation of the antibiotics and/or by

mutation in the 16S rRNA gene that prevent binding of tetracycline to the

ribosome. Due to the association of erythromycin and TCr genes with common

conjugative transposons (e.g. Tn916-Tn1545), ERr genes are often found linked

with TCr genes. The most common coexistence observed are between ribosomal

protection tet genes and mef(A)-msr(D) elements or erm genes detected in

plasmids and chromosomes of a variety of bacteria species (Roberts, 2005; 2008).

A number of initiatives have been recently launched across the globe to

address the bio-safety concerns of starter cultures and probiotic microorganisms.

In order to check for signs of transferable antibiotic resistance (AR) in starter

cultures, minimum inhibitory concentration (MIC) of the antimicrobials expressed

as mg/L or μg/ml should be determined for each of the test antibiotic. It is

essential that such tests are made in a consistent manner using internationally

recognized and standardized methods (EFSA, 2012). In this regard,

“Microbiological breakpoint” has been introduced by studying the distribution of



MIC values of LAB (Ammor et al., 2007) that have also been updated (EFSA,

2008, EFSA, 2012). When a bacterial strain demonstrates higher resistance to a

specific antibiotic than the other strains of the same taxonomical unit, the presence

of acquired resistance is indicated and additional information is needed on the

genetic basis of the AR (EFSA, 2012). Hence, phenotypic tests are accompanied

by molecular tests that detect specific AR genes using single or multiplex PCR,

real time PCR, hybridization assays and/or DNA microarrays (Ammor et al.,

2007).

In previous chapter, the LAB isolates resistant to high concentrations of

erythromycin (8 and 16 μg/ml) above the standard value (4 μg/ml) were

characterized. Hence, in the present chapter, acquired ERr among the 60 LAB

isolates was determined employing phenotype and genotypic tests. As ERr is often

linked with TCr determinants,

all the test LAB cultures were also evaluated for

phenotypic and genetic evidence for TCr.

4.3. Materials and Methods

4.3.1. Chemicals and Buffers

20 X SSC Solution: 3 M NaCl, 0.3 M Sodium citrate (pH-7.2)

Washing buffer: 0.1 M Maleic acid + 0.15 M NaCl, pH- 7.5, and 0.3% (v/v)

tween-20

Maleic acid buffer: 0.1 M Maleic acid + 0.15 M NaCl, pH- 7.5 (Using

NaOH pellets)



Blocking solution: 1 X working solution was prepared by diluting 10X

stock of blocking solution (provided with the DIG high prime detection and

labeling kit) with maleic acid buffer.

Detection buffer: 0.1 M Tris-HCl + 0.1 N NaCl, pH-9.5.

4.3.2. Materials

Nylon membrane was purchased from Sigma Aldrich, USA. Whatman filter paper

No.1 and No.3 were from Whatman, Germany. Dig High prime DNA labeling and

detection kit II for dot-blot were procured from Roche Inc. Germany, U.V cabinet,

Model No: E/340/OC, Superfit Laboratory Instruments, Mumbai, India. U.V

Spectrophotometer: UV1800ENG240V, SOFT, Shimadzu corporation, Japan,

Oligo Nucleotide primers were procured from Sigma Aldrich, Bangalore.

4.3.3. Bacterial strains

The bacteria strains used in this particular investigation include 60 LAB isolates

that were identified in previous chapter. The Micrococcus luteus ATCC 9341

strain was used as clindamycin sensitive culture. All LAB cultures were grown

under static condition at 37 °C while M. luteus was grown in Brain Heart Infusion

(BHI) broth at 37 °C under shaking.



4.3.4. Antibiotics

Tetracycline antibiotic powder was procured from Hi-Media, (India). Stock

solution of tetracycline was prepared using methanol. Hi-comb strips of

erythromycin and tetracycline with a range of 4, 8, 16, 32, 64, 128, and 256 g as

well as individual discs of erythromycin (15 μg), clindamycin (2 μg) and

pristinamycin (15 μg) rokitamycin (15) were procured from Hi-Media, India Pvt

Ltd.

4.3.5. Disk diffusion test

The double disk/D zone test with erythromycin (15 g) and clindamycin (2 g)

was performed to evaluate the phenotypes of the ERr LAB as described previously

(Seppala et al., 1993). Briefly, 1% inoculum from the overnight grown culture was

inoculated either into fresh MRS broth in case of Lactobacillus, Pediococcus and

Leuconostoc cultures or BHI broth for Enterococcus and allowed to grow for 4-5

h. The resulting log phase cultures were used for D zone test. Using sterile cotton

swabs culture was inoculated onto MRS/BHI agar medium in three directions. The

agar plates were then allowed to dry for 5 to 10 min. Using sterile forceps, the

erythromycin and clindamycin discs were placed with 2 mm apart and the plates

were incubated at 37 °C overnight. After incubation period, plates were observed

for growth or inhibition zone in presence of the antibiotic and blunting of the

clindamycin inhibition zone near the erythromycin disc is an indicative of



inducible type of MLSB (iMLSB) resistance. Growth in presence of clindamycin

and erythromycin with no inhibition zone is indicative of constitutive type of

MLSB (cMLSB) resistance. Susceptibility to clindamycin with no blunting of the

zone indicates M resistance phenotype.

In order to determine cross resistance among MLS antibiotics, multiple disc

diffusion test was performed by placing MLS discs of erythromycin (15 μg),

clindamycin (2 μg), rokitamycin (15 μg), and pristinamycin (15 μg) adjacent with

2 mm apart. Similarly, to investigate the inducible nature of streptogramin

antibiotics, triple disc test was performed by placing clindamycin (2 μg) at the

center of the agar plate. Pristinamycin and erythromycin discs of 15 μg

concentration each were placed on either side of clindamycin disc.

4.3.6. Determination of minimum inhibitory concentrations

The minimum inhibitory concentration (MIC) is defined as the lowest antibiotic

concentration that inhibits the visible growth after overnight incubation (Phillips et

al., 1991). MIC test was performed with erythromycin and tetracycline antibiotics

for all the 60 isolates using the agar dilution, Hi-comb strip and microbroth

dilution methods. All the tests were performed thrice in duplicates.

4.3.6.1. Agar dilution method

The agar dilution method was followed as per the protocol described by Rosander

et al. (2008). Briefly, the isolates were grown in MRS broth overnight at 37 °C.



The resulting culture was diluted to 105 CFU/ml and 2 l of each culture was

spotted onto MRS agar supplemented with either erythromycin or tetracycline at

concentrations of 4, 8, 16, 32, 64, 128, 256 and 512g/ml. A control plate was

kept with no added antibiotic in the medium and the growth of the culture was

compared in presence and absence of antibiotic. After adsorption of the drops, the

plates were incubated under microaerophilic condition at 37 °C for 24 h and the

changes in the growth were recorded.

4.3.6.2. Hi Comb/E-strip method/ Disc diffusion test

The MIC values of erythromycin for the selected LAB isolates was determined

using the Hi-comb strips of erythromycin and tetracycline which contained discs

with concentrations ranging from 0.5 to 512 g. The log phase test cultures were

inoculated onto MRS/BHI agar plates using the protocol described in section

4.3.5. The culture was allowed to dry and the Hi-comb strips were placed and

incubated overnight at 37 °C under microaerophilic conditions.

4.3.6.3. Microbroth dilution method

The MIC determination by microbroth dilution was performed according to the

method followed by CLSI, (2004). Briefly, a single colony of culture was

inoculated into fresh MRS broth and incubated at 37 °C overnight. The optical

density (OD) of the culture at 625 nm (OD 625) was adjusted to 0.2 in fresh MRS



broth and the suspension was diluted 500 times using the same medium. One

hundred microlitres of this dilution was then transferred to microtitre plate

containing 100 l of MRS broth supplemented with appropriate amount of

erythromycin or tetracycline with a range of 0, 4, 8, 16, 32, 64, 128, 256 and

512g/ml. The microtitre plates were then incubated at 37 °C for 24 h. Post

incubation, the growth was recorded at OD 625 nm. MRS broth containing no

culture served as control.

4.3.7. Detection of ERr and TC

r genes by PCR

Detection of ERr and TC

r in LAB isolates was determined by PCR analysis using

specific primers for the known antibiotic resistance genes (Table 4.3.7.1 and

4.3.7.2). The genes responsible for MLSB resistance were analyzed using the

primers specific for methylases viz. erm(A), erm(B), erm(C) and erm(T); and,

efflux genes- mef(A), msr(A) and msr(C) (Table 4.3.7.1). For TCr determinants,

initially PCR was carried out for tet genes encoding ribosomal protection proteins

(RPP) using degenerative primers DI and DII. Incase, the RPP genes getting

amplified with DI and DII, additional PCR assays were performed with primers

specific to tet(M), tet(W), tet(S) and tet(O). In addition to RPP tet genes, isolates

were also tested for tetracycline efflux genes tet(K) and tet(L) (Table 4.3.7.2). The

reaction mixture was composed of 10 mM primer each (forward and reverse), 0.2

mM dNTPs mix, 2.5 μl of 1X PCR buffer, 2.5 mM MgCl2, 4 l containing 10 ng



of genomic DNA as template and 1 Unit of Taq DNA polymerase. The reaction

mixtures were subjected to PCR with the following conditions; initial denaturation

at 95°C for 5 mins, followed by 35 cycles of 95 °C for 40 sec, annealing

temperature (as provided in Table 4.3.7.1 and 4.3.7.2) for 40 sec and extension at

72 °C for 1 min and final extension at 72 °C for 5 min. Details of primer sequence

and expected amplicon sizes are given in Table 4.3.7.1 and 4.3.7.2. PCR

amplifications were checked electrophoretically on 1% agarose gel and visualized

by ethidium bromide staining.

4.3.8. DOT BLOT EXPERIMENT

The Dot-blot hybridization was performed employing the non-radioactive labeling

method using digoxygenin labeling and detection kit method. All the procedures

were followed according to the manufacturer’s instructions (Roche Inc. Germany).

4.3.8.1. Labeling of the probe

DNA fragment of PCR product was purified using high pure PCR product

purification kit. The purified product was quantified using spectrophotometric

method. To 10 μl of 3 μg/μl concentration template DNA (PCR product), 16 μl of

nuclease free water was added in a reaction vial. The template DNA was

denatured by heating in a boiling water bath for 10 mins and quickly chilled on

ice. To the denatured DNA, 4 μl of the DIG-High prime labeling mixture



Table 4.3.7.1: Primers used in detecting erythromycin and clindamycin resistance genes

Gene Primer

pair

Sequence

5’ 3’

Annealing

temperature

(°C)

Expected

amplicon

(bp)

Reference

erm(A) ErmA-FW TCTAAAAAGCATGTAAAAGAA 52 645 Sutcliffe et al., (1996)

ErmA-RV CTTCGATAGTTTATTAATATTAGT

erm(B) ErmB-FW CATTTAACGACGAAACTGGC 55 405 Jensen et al., (1999)

ErmB -RV GGAACATCTGTGGTATGGCG

erm(C) ErmC-FW TCAAAACATAATATAGATAAA 52 642 Sutcliffe et al., (1996)

ErmC -RV GCTAATATTGTTTAAATCGTCAAT

msr(A/B) MsrA/B-FW-1 GCAAATGGTGTAGGTAAGACAACT 52 399 Sutcliffe et al., (1996)

MsrA/B-RV-2 ATCATGTGATGTAAACAAAAT

msr(A) MsrA -FW-3 GGCACAATAAGAGTGTTTAAAGG 40 939 Ojo et al., (2006)

MsrA -RV-4 AAGTTATATCATGAATAGATTGTCCTGT

T

msr(C) MsrC -FW AAGGAATCCTTCTCTCTCCG 55 343 Werner et al., (2001)

MsrC -RV GTAAACAAAATCGTTCCCG

lnu(B) LnuB-FW CCTACCTATTGTTTGAA 44 944 Gygax et al., (2006)

LnuB-RV ATAACGTTACTCTCCTATTC



Table 4.3.7.2: Primers used in detecting specific tetracycline resistance genes

N=A, C, G and T; R= A and G; W= A and T; Y= C and T

Gene Primer

pair

Sequence

5’ 3’

Annealing

temperature

(°C)

Expected

amplicon

(bp)

Reference

RPP DI GAYACNCCNGGNCAYRTNGAYTT 45 1,083 Clermont et al., (1997)

DII GCCCARWANGGRTTNGGNGGNACYTC

tet(M) DI GAYCANCCNGGNCAYRTNGAYTT 55 1,513 Clermont et al., (1997)

TetM-RV CACCGAGCAGGGATTTCTCCAC

tet(S) TetS-FW ATCAAGATATTAAGGAC 55 573 Charpentier et al., (1993)

TetS-RV TTCTCTATGTGGTAATC

tet(O) TetO-FW AATGAAGATTCCGACAATTT 55 781 Sougakoff et al., (1987)

TetO-RV CTCATGCGTTGTAGTATTCCA

tet(K) TetK-FW TTATGGTGGTTGTAGCTAGAAA 55 348 Gevers et al., (2003a)

TetK-RV AAAGGGTTAGAAACTCTTGAAA

tet(L) TetL-FW GTMGTTGCGCGCTATATTCC 55 696 Gevers et al., (2003a)

TetL-RV GTGAAMGRWAGCCCACCTAA

tet(W) TetW-FW GAGAGCCTGCTATATGCCAGC 57 168 Masco et al., (2006)

TetW-RV GGGCGTATCCACAATGTTAAC



(containing random primer mix (5X), 1U/μl Klenow polymerase, labeling

grade 1mM dATP, 1mM dCTP, 1mM dGTP, 0.65 mM dTTP, 0.35 mM DIG-

11-dUTP, alkali labile and 5 X stabilized reaction buffer in 50% (v/v) glycerol)

were added. The labeling mixture was vortexed gently and centrifuged briefly.

The mixture was then incubated for 1 hr to overnight at 37 °C. The reaction

was terminated by heating at 65 °C for 10 min. The digoxygenin labeled DNA

was stored at -20 °C until use.

4.3.8.2. Fixation

Five to 10 μl of the test DNA (Total or plasmid) containing 10 ng to 0.1 μg/μl

was denatured by heating in a boiling water bath for 10 min and quickly chilled

on ice. The DNA was centrifuged briefly and 5 μl of the denatured DNA was

spotted onto Nylon membrane and allowed to dry. The nylon membrane was

then placed on 3 mm thick Whatman filter paper soaked in 10 X SSC. The

DNA was then cross linked by exposing the wet nylon membrane to 254 nm

UV for 5 to 10 min. The membrane was then rinsed briefly using sterile

distilled water and allowed to air dry completely.

4.3.8.3. Pre-Hybridization

Appropriate volume (10 ml/ 100 cm2) of hybridization solution was pre-heated

at 37 to 42 °C. To the dried membrane taken in a container, the pre-heated

hybridization solution was added and incubated at 37 to 42 °C for 30 min with

gentle agitation. The appropriate hybridization temperature was calculated



according to GC content and percentage of the probe to the target according to

the following equation.

Tm = 49.82+0.41 (%G+C) – 600/length of hybrid in base pairs

Tm = Tm – 20 to 25 °C

4.3.8.4. Hybridization

Five microlitres (25 ng/μl) of DIG-labeled DNA probe was denatured in

boiling water and quickly chilled on ice/ice water. The denatured DNA probe

was added to the pre heated DIG hybridization buffer (3.5 ml/100 cm2) and

mixed gently by avoiding formation of bubbles. The pre-hybridization solution

was poured off from the container and the hybridization solution containing

denatured DNA probe was added to the membrane. Hybridization at 42 °C was

carried out for 4 h to overnight with gentle agitation.

4.3.8.5. Stringency washes

The hybridization solution was poured off and the membrane was washed

twice for 5 min under constant agitation with ample amount of 2 X SSC and

0.1% SDS. This was followed by 15 min washing with 0.5 X SSC and 0.1%

SDS at 65 to 68° C.

4.3.8.6. Immunological detection

All washings were performed at room temperature under constant agitation.

Post hybridization and stringency washes were carried out following brief



rinsing of membrane for 5-10 min in washing buffer. The membrane was then

incubated for 30 min in ample amount of blocking solution. The

antidigoxygenein-alkaline phosphatase (anti DIG-AP) was centrifuged at

10,000 rpm for 5 min before each use. The anti DIG-AP was diluted to 5000

times by adding appropriate volume 1 X blocking solution. The mixture

(blocking solution containing anti-DIG antibody) was then added to the

membrane and incubated for 30 min under gentle agitation. The solution was

then poured off from the membrane and washed twice for 15 min using ample

amount of washing buffer.

4.3.8.7. Detection/blot development

The washing buffer from the membrane was removed and equilibrated for 5-10

min with detection buffer. To the fresh detection buffer, appropriate volume of

color substrate was added. The mixture was added to the membrane and

incubated in dark without shaking. The membrane was observed intermittently

for the detection of any color development. The reaction was stopped when the

desired spot intensities were achieved by washing the membrane for 5 min with

50 ml of sterile water or TE buffer. The results obtained were documented by

photography or using gel-documentation system.



4.3.9. Determination of clindamycin resistance

4.3.9.1. Clindamycin inactivation test

The clindamycin resistant strains were subjected to modified Hodge test for

detection of lincosamide nucleotidyltransferase (lnu) activity (Noyal et al.,

2009). An overnight culture suspension of clindamycin sensitive M. luteus

ATCC 9341 adjusted to 0.5 O.D600 was inoculated using a sterile cotton swab

on the surface of a BHI agar medium. After drying, 2 µg clindamycin disk was

placed at the center of the plate and the test strain was streaked from the edge

of the disk to the periphery of the plate in four different directions. The plates

were incubated overnight at 37 °C. The presence of a ‘cloverleaf shaped’ zone

of inhibition due to lincosamide nucleotidyltransferase production by the test

strain was considered as positive.

The clindamycin inactivation test was also evaluated using the overlay

assay. Test LAB isolates were streaked on to BHI agar medium supplemented

with 2 μg/ml of clindamycin. Two percent of an overnight culture suspension

of clindamycin sensitive M. luteus ATCC 9341 adjusted to 0.5 O.D 600 was

inoculated to BHI soft agar and overlaid onto the streaked LAB test cultures.

The growth of M. luteus around the test culture was considered positive.

4.3.9.2. Detection of clindamycin resistance gene by PCR

The genomic DNA isolated was used as a template in PCR amplification

reaction for lnu(B) [lin(B)] employing gene specific primers as given in Table

4.3.7.1. PCR analysis was carried out as follows: 35 cycles of amplification



including 30 sec of denaturation at 94 °C, 40 sec of annealing at 44 °C and 40

sec of elongation at 72 °C.

4.3.10. Gene sequencing and nucleotide accession numbers

For determining the nucleotide sequences of antibiotic resistance determinants,

the PCR amplified products were purified using PCR purification kit, DNA

sequencing and its subsequent analysis was performed as described in chapter 3

(section 3.2.2.7.4).

The antibiotic resistance genes identified in the bacterial isolates

reported in this study were deposited in the GenBank with the following

accession numbers. The msr(C) sequence fragments identified in cultures CHS-

3E, ABM-1, KOV-3E, and RM-3-2 were deposited with accession numbers

HQ651919 to HQ651922, respectively. The erm(B) gene sequences identified

from cultures CHS-1E and IB8-3 were deposited under accession no

HQ651923 and HQ651924, respectively. Similarly, the tet(W), tet(M) and

tet(L) partial DNA sequences have been deposited under the accession numbers

HQ651925 (CH1-1-T32), HQ651926 (CHS-1E) and HQ651927 (IB4-2B).



4.4. Results

Macrolides, lincosamides and streptogramin antibiotics although structurally

distinct, they share a common mode of action and similar antibacterial spectra.

These antibiotics block the translation process by binding to the 23S rRNA,

close to the peptidyl transferase centre of the 50S ribosomal subunit (Lambert,

2012). Hence in the present study, the mechanism of resistance was

investigated among the native isolates.

4.4.1. MLSB phenotypes of ERr LAB

The principal mechanism of MLS resistance includes the 1) target

modification: encoded by 21 different erm genes. Regardless of erm gene, the

phenotype can be constitutive (cMLSB) when the methylation enzyme is

continuously produced or inducible (iMLSB) when an inductor (usually

macrolides) is necessary for the function of the methylase enzyme. 2) Efflux

system that reduces the cellular concentration of the antibiotic and results in the

M phenotype. 3). Antibiotic inactivation by enzymes and is responsible for

different phenotypes such as MLSB + SA and L phenotype in Gram-positive

bacteria. Such phenotypes are usually detected with a double disc diffusion test

using erythromycin (15 μg) and clindamycin (2 μg) discs.



4.4.1.1. Diversity in MLSB phenotype

With the aim of identifying the type of resistance, double disc diffusion test

was performed and diverse MLSB phenotypes were observed among the LAB

isolates as shown in Fig 4.4.1.1.1 to 4.4.1.1.3. Among the Lactobacillus

isolates, Lb. salivarius and Lb. reuteri isolated from fermented dry sausages

displayed cMLSB phenotype (Fig 4.4.1.1.1 c). Among the 4 Lb. fermentum

cultures, 2 strains (RM3-1 and RM3-2) of raw milk origin showed cMLSB

phenotype while other two strains (C-1 and C-3) isolated from curd were

found sensitive with large zones around clindamycin and erythromycin (Fig

4.4.1.1.1 a and b).

In case of enterococci, diverse phenotypes were observed (Fig 4.4.1.1.2).

One En. lactis and 13 En. durans isolates with erythromycin intermediate and

clindamycin resistance were assigned to lincosamide (L) phenotype. A total of

6 isolates with 3 each of En. durans and En. faecium were assigned to cMLSB

phenotype and 1of En. durans was assigned to iMLSB phenotype. When

erythromycin and clindamycin discs were placed side by side, an enhancement

of zone of inhibition between the two discs was observed in few isolates (1 of

En. durans, 2 of En. faecium and the sole En. casseliflavus). This erythromycin

induced clindamycin susceptibility was designated as keyhole (KH) phenotype

with its resemblance to a keyhole pattern. One En. lactis with low level

resistance to erythromycin and sensitive to clindamycin was assigned to M

phenotype. Three enterococcal isolates (1 of En. durans and 2 of En. faecium)

with similar inhibition zone size to erythromycin and clindamycin without any



change in the zone shape were assigned as intermediate (I) phenotype. In

addition, 3 isolates that displayed intermediate phenotype with erythromycin

induced clindamycin susceptibility were assigned to intermediate synergistic

(IS) phenotype.

Similar to results obtained with Enterococcus isolates, phenotypic variation

was also observed among strains of P. pentosaceus. As shown in Fig 4.4.1.1.3,

few isolates were found sensitive to both clindamycin and erythromycin.

However, majority of the isolates were found with MS phenotype a

characteristic of efflux system mechanism. It was only two isolates that

displayed cMLSB resistance phenotype. In addition, few isolates that were

isolated from naturally fermented foods showed L phenotype which was

similar to that observed among Enterococcus isolates.

Figure 4.4.1.1.1. D Zone test phenotypes of Lactobacillus cultures. a and b: Sensitive

phenotype (ER-S, CL-S), c: cMLSB phenotype. Right: Clindamycin (2-μg), Left:

Erythromycin (15-μg).



Figure 4.4.1.1.2. Diverse phenotypes among enterococci cultures. a: Keyhole phenotype,

b: cMLSB phenotype, c: Intermediate (ER-I, CL-S), d: Sensitive phenotype (ER-S, CL-S), e:

L phenotype (ER-I, CL-R), f: Synergistic sensitive phenotype. Right: Clindamycin (2-μg),

Left: Erythromycin (15-μg).

Figure 4.4.1.1.3. Different phenotypes among Pediococcus pentosaceus cultures. a:

Sensitive phenotype (ER-S, CL-S), b: cMLSB phenotype, c: MS phenotype (ER-I, CL-S), d:

L phenotype (ER-S, CL-I). I: Intermediate, L: lincosamide, MS: Macrolide and

Streptogramin, ER: erythromycin, CL: Clindamycin. Right: Erythromycin (15-μg), Left:

Clindamycin (2-μg).



4.4.1.2. Cross resistance among MLS antibiotics

In recent past with development of resistance to erythromycin, newer

macrolides have been developed that have remarkable pharmacokinetic

properties. However, the resistance mechanisms that operate against

erythromycin also apply to the newly discovered macrolides. In addition, with

the increase in complexity of target modification mediated (erm genes)

resistance, there is a cross resistance among MLSB antibiotics. In view of this,

multiple disc diffusion test was performed to investigate cross resistance

among different MLSB antibiotics and the results are shown in Fig. 4.4.1.2.1. In

this test, the streptogramin group of antibiotic i.e. pristinamycin was found to

induce clindamycin resistance in one En. durans (IB8-3) culture. The observed

phenotype was similar to that of iMLSB phenotype with erythromycin induced

clindamycin resistance. In addition to this, most of the resistance phenotypes

between lincosamides and streptogramins were similar with those observed

between macrolides and lincosamides.

4.4.1.3. Macrolide and streptogramin induced resistance to lincosamide

Pristinamycin antibiotic that belongs to streptogramin B antibiotics has a

similar mode of action as that of macrolides and lincosamides. Unlike

macrolides, pristinamycin is a non-inducing antibiotic. However,

prisitnamycin was found to induce clindamycin resistance in iMLSB phenotype

En. faecium isolate. With this observation, further aim was to evaluate such



phenotype in other isolates. Thus, enterococci and P. pentosaceus cultures

showing novel phenotypes in double disc diffusion test (erythromycin and

clindamycin) were subjected to triple disc diffusion using erythromycin,

clindamycin, and pristinamycin. The results obtained are shown in Fig.

4.4.1.3.1. The phenotypic results observed with pristinamycin and clindamycin

were similar to those obtained with erythromycin and clindamycin. In addition

to the D zone phenotype, the novel phenotype such as KH, L, I and IS

phenotypes observed with clindamycin and pristinamycin were similar to those

identified using erythromycin and clindamycin.

Figure 4.4.1.2.1. Multiple disc diffusion test for MLSB cross resistance. C: clindamycin

(2 μg), E: erythromycin (15 μg), R: Roxithromycin (15 μg) and P: pristinamycin (15 μg)

Figure: 4.4.1.3.1. Triple disc diffusion test phenotypes of enterococci.. a: iMLSB

phenotype, b: Synergistic phenotype, c: L phenotype. L: lincosamide. Right: Erythromycin

(15-μg), Center: Clindamycin (2-μg) and Left: Pristinamycin (15-μg).



4.4.2. Antimicrobial resistance determination

Recognition of bacterial isolates with acquired AR can be made by determining

the MIC value of a particular antibiotic. In order to determine the acquired

resistance to erythromycin, all the selected 60 LAB isolates were subjected to

MIC test using disc diffusion (Hi-comb strip method), microbroth and agar

dilution methods. As ERr is often found linked with TC

r, the test isolates were

also evaluated for acquired TCr. As per the FEEDAP panel report (EFSA,

2005), isolates were categorized as resistant to tetracycline, if the MIC values

reach 32 g/ml for Lb. plantarum, 8 g/ml for other Lactobacillus species, 16

g/ml for Enterococcus species and 4 g/ml for Pediococcus and Leuconostoc

species. Similarly, 4 g/ml of erythromycin concentration is considered as

breakpoint for all the above LAB isolates. Table 4.4.2.1. shows the range of

MIC values obtained for erythromycin and tetracycline using the test LAB

strains. These results are the mean values obtained with microbroth, agar

dilution and disc diffusion methods.

According to the FEEDAP panel criterion, erythromycin MIC values

(MIC range from 8-16 g/ml) obtained for Pediococcus, Leuconostoc,

Lactobacillus and Enterococcus isolated from the naturally fermented foods

indicated intermediate resistance. However, two En. faecium strains isolated

from idli batter displayed higher MIC values (256 g/ml). The MIC values of

erythromycin and tetracycline for Lactobacillus species such as Lb. salivarius

and Lb. reuteri isolated from fermented dry sausages exhibited a higher degree

of resistance to both the antibiotics.



Table 4.4.2.1. The range of MIC’s among LAB isolates for erythromycin and tetracycline

Source Species

Total

number

of isolates

Erythromycin Tetracycline

MIC values

(μg/ml)

Breakpoints (μg/ml) MIC values

(μg/ml)

Breakpoints (μg/ml)

CLSI

(2007)

EFSA

(2008)

CLSI

(2007)

EFSA

(2008)

Fermented dry

sausage

Lb. salivariusa

3 64-256 ≥1 --- 256 ≥1 ---

Lb. reuteria 2 256-512 ≥1 1 256- >512 ≥1 1

Dairy products, raw

milk and traditional

foods

Lb. fermentuma

4 8-32 ≥1 1 8-64 ≥1 1

Lb. plantaruma

1 32 ≥1 1 128 ≥1 1

En. faecium

b

9 8-256 ≥8 4 16-512 ≥8 4

En. durans

b

22 16-32 ≥8 4 16-32 ≥8 4

En. lactis

b

2 32 ≥8 4 16 ≥8 4

En. casseliflavus

b

1 32 ≥8 4 8 ≥8 4

P. pentosaceus

a

15 8-32 ≥1 1 8-128 ≥1 1

Leu. mesenteroides

a

1 32 ≥1 1 8 ≥1 1

a-Erythromycin and tetracycline resistance Breakpoints defined by CLSI (2007) for Streptococcus b-Erythromycin and tetracycline resistance Breakpoints defined by CLSI (2007) for Enterococcus



Among the 15 P. pentosaceus strains analyzed for ERr, 5 isolates showed

an MIC of 8 g/ml, while values of 16-32 g/ml were observed among the

remaining 10 isolates. For tetracycline, variation in their susceptibility was

observed wherein 7 strains exhibited an MIC of 128 g/ml, 6 with 64 g/ml and

two strains were found to be sensitive to tetracycline.

4.4.3. Detection of ERr and TC

r genes

With the aim of determining the genetic basis of acquired ERr

and TCr with the

observed phenotypic results, all the selected 60 LAB were subjected to PCR

amplification studies. The PCR results obtained are shown in Table 4.4.3.1 and

4.4.3.2. When all the isolates were analyzed for the presence of erm methylase

genes, a positive amplification of the expected size of nearly 400 bp for erm(B)

was obtained in all the isolates irrespective of the species and the genus except for

3 strains of P. pentosaceus and 2 strains of E. durans strains (Fig 4.4.3.1). No PCR

amplification of the expected size was obtained when analyzed for erm(A) and

erm(T) and erm(C) genes. The sequence of erm(B) gene identified in LAB isolates

also showed maximum identity with erm(B) associated with Tn916, Tn2010 and

Tn5253 like transposons of Streptococcus pneumoniae.

In addition to erm(B), several isolates were tested positive for msr(A) when

PCR was performed with the primer pair 1 and 2 (msrA/B) (Table 4.4.3.1, Fig

4.4.3.2). Interestingly, sequence analysis of the amplified product (399 bp)



exhibited 99% homology with the msr(C) gene of En. faecium (GenBank

accession no. AF313494.1). A homology of 61.1% was also observed for msr(A)

of Enterococcus species (accession no: DQ068449.1). Multialignment sequence

analysis of msr(A) and msr(C) indicated a high homology for the primer binding

regions (Fig 4.4.3.3) justifying the PCR amplification of msr(C) when msr(A)

gene specific primers (Primer pair 1 and 2) were used. The Lb. reuteri, Lb.

salivarius isolates from fermented dry sausages, Lb. planatrum from ice cream,

and the Leu. mesenteroides from curd did not show any amplification of msr(A).

To investigate the genetic basis of TCr, initial evaluation was performed

using the degenerative primers (DI and DII) for the ribosomal protection proteins

(RPP) encoding genes. Of all the isolates, only five Lactobacillus species such as

1 of Lb. plantarum, 1 of Lb. reuteri, 3 of Lb. salivarius and 1 of En. faecium

exhibited a positive amplification (Fig 4.4.3.4). Performance of PCR with primers

specific for RPP genes such as tet(W), tet(M), tet(O) and tet(S), showed a positive

amplification for tet(W) gene in all the six isolates. Along with tet(W) gene,

tet(M) was found in 3 strains of Lb. salivarius and 1 of En. faecium (Fig 4.4.3.5a

and b). One of Lb. salivarius strain also exhibited a positive amplification for

tet(O) (Fig 4.4.3.5c). None of the isolates were positive for tet(S).

In addition to the RPP genes, the efflux gene tet(L) was detected in the sole

Lb. plantarum (I2) and 1 Lb. salivarius (CH2-2). The two efflux genes tet(L) and

tet(K) were found in combination in 1 Lb. fermentum (C-3) and 6 P. pentosaceus

isolates (Fig 4.4.3.6). Additionally, tet(K) alone was detected in one isolate of P.



Table 4.4.3.1: Distribution of erythromycin resistance genes among LAB isolates of fermented foods

pentosaceus (IB3-3), while tet(L) alone was found in 2 isolates of P. pentosaceus

and 15 isolates of En. durans strains. The sole ERr Leu. mesenteroides isolate

encountered in this study did not carry any of the TCr determinants analyzed.

Similar to erm(B), the BLAST analysis of the tet(M) showed maximum identity

with the transposons such as Tn916, Tn5253 and Tn2010 of pathogenic bacteria

such as Streptococcus parauberis, Staphylococcus aureus and Clostridium difficle.

Erythromycin resistance genes

Source Species

Total

number of

isolates

erm(B)

msr(C)

Fermented dry

sausage

Lb. salivarius

3 3

---

Lb. reuteri 2 2 ---

Dairy products, raw


foods

Lb. fermentum

4 3

4

Lb. plantarum

1 1 ---

En. faecium

9 8 8

En. durans

22 20 18

En. lactis

2 2 2

En. casseliflavus

1 1 1

P. pentosaceus

15 12 8

Leu. mesenteroides

1 1 ---



Figure- 4.4.3.1. PCR amplification of erm(B) gene among LAB isolates. M: 10 kb marker,

Lanes 1 and 2: Lb. salivarius, Lanes 3 & 4: Lb. reuteri; Lanes 5-7: Lb. fermentum; Lane 8: Lb.

plantatum; Lanes 9-18: En. durans; Lanes 19-23 En. faecium; Lanes 24 and 25: En. casseliflavus

and En. lactis; Lanes 26-32: P. pentosaceus.

Figure 4.4.3.2. PCR amplification of msr(C) in LAB isolates using msr(A) gene specific

primers. M: 10-Kb marker. Lanes 1-4, En. faecium (Curd and Idli batter isolates); Lanes 5-9, En.

durans; Lanes 10-13, Lb. fermentum; Lanes 14-21, P. pentosaceus; Lanes 22 and 23, Lb.

salivarius and Lb. reuteri respectively.



Figure 4.4.3.3. Multiple sequence alignment of msr(A) and msr(C) gene sequences. The

shaded regions (green) indicate the primer (forward and reverse) binding regions of both the

genes. The sequence alignment was performed using multalin programme.



Table 4.4.3.2: Distribution of tetracycline resistance genes among LAB isolates of fermented foods

Tetracycline resistance genes

Source Species Total number of

isolates tet(W) tet(M) tet(O) tet(K) tet(L)

Fermented dry

sausage

Lb. salivarius

3 3 3 1 --- 1

Lb. reuteri 2 1 --- --- --- ---

Dairy products, raw


foods

Lb. fermentum

4 --- --- --- 1 1

Lb. plantarum

1 1 --- --- --- 1

En. faecium

9 1 1 --- --- 1

En. durans

22 --- --- --- --- 15

En. lactis

2 --- --- --- --- ---

En. casseliflavus

1 --- --- --- --- ---

P. pentosaceus

15 --- --- 7 8

Leu. mesenteroides

1 --- --- --- --- ---

-----: Not detected;



Figure- 4.4.3.4. Genotypic detection of tetracycline resistance using degenerative primers

of RPP encoding genes. M: 10 kb Marker, Lane 1: Lb. salivarius CHS-1E; Lanes 2-4: En.

durans; Lane 5 & 6: Lb. salivarius CH7-1E and CHS-2E respectively; Lane 7: Lb. reuteri CH2-2,

Lane 8: P. pentosaceus IB4-2B; Lane 9: En. faecium IB6-2B; Lane 10: En. lactis

Figure 4.4.3.5. PCR amplification of RPP genes using gene specific primers. a: tet(M) (1.4

kb), b: tet(W) (0.182 bp), c: tet(O) (1.2 kb). Lane 1: CHS-1E; Lane 2: CH7-1E, Lane 3: CH1-1,

Lane 4: IB6-2B, Lane 5: CH2-2 and Lane 6: I2.

Figure-4.4.3.6. PCR amplification of tetracycline efflux genes. a: tet(K) and b: tet(L). Lane 1-

8: P. pentosaceus (IB3-3, IB4-2A, IB4-2B, IB4-5, IB6-2A, 3, 4 and 8), Lane 9: Lb. fermentum

(C-1), Lane 10: Lb. plantarum (I2).



4.4.4. Dot-blot analysis of msr(C) gene in LAB

The representative LAB isolates that were positive for msr(C) gene through PCR

were subjected to dot-blot analysis using the probe of msr(C) gene. As shown in

Fig 4.4.4.1, all the En. durans were found to be positive. However, negative or a

weak signal was observed among few En. faecium and P. pentosaceus isolates that

were found positive with PCR analysis. Among the Lactobacillus cultures, only

Lb. fermentum that were isolated from raw milk were found positive. None of

those obtained from fermented dry sausage gave a positive signal and these results

were consistent with that of the PCR analysis.

Figure 4.4.4.1. Dot-blot analysis of ERr LAB using msr(C) gene probe. Isolates 1-4: P.

pentosaceus; 5-13: En. durans; 14-16: En. faecium; 17 and 18: Lb. fermentum.

4.4.5. Clindamycin resistance phenotype of LAB isolates

Apart from the target modification and efflux pumps responsible for resistance to

MLSB antibiotics, enzymatic inactivation mechanism can be specific to one

particular group or an individual antibiotic. Likewise lnu(B) confers antibiotic



inactivation mediated resistance to lincosamide and clindamycin. Thus in order to

understand the clindamycin resistance observed among several isolates with

diverse phenotypes, the antibiotic inactivation test was performed using

clindamycin sensitive M. luteus ATCC 9341. Among the Lactobacillus cultures

that displayed cMLSB phenotype, one Lb. salivarius isolate (CHS-2E) was found

positive with clover leaf formation. As shown in Fig 4.4.5.1A, the clindamycin

sensitive M. luteus was found growing around the streaked culture displaying the

clindamycin inactivation ability of the isolate. Similar results were also obtained

with cMLSB phenotypic strain En. faecium IB6-2B. All the other LAB isolates

were found negative. Similar results were also obtained with the overlay test

wherein the clindamycin sensitive M. luteus ATCC 9341 was found growing

around the cultures; CHS-2E (Fig 4.4.5.1.B) and IB6-2B (Fig 4.4.5.1. C) that were

streaked on BHI agar supplemented with clindamycin.

4.4.6. Genotypic detection of clindamycin resistance

To identify the cause of clindamycin resistance that was observed with the

phenotypic test, all the isolates were screened for the presence of lnu(B) gene. The

two isolates that were detected positive with the phenotypic clindamycin

inactivation gave an expected amplicon of 944 bp (Fig 4.4.6.1). The sequencing

analysis of the obtained PCR product had 99% similarity with that of the

lincosamide nucleotidyltransferase encoding gene lnu(B) detected among several

pathogens.



Figure 4.4.5.1. Clindamycin inactivation test: A: Clover leaf test (Modified Hodge test). B &

C: Overlay test with Lactobacillus and Enterococcus test cultures respectively.

Figure-4.4.6.1. PCR analysis of clindamycin inactivating lnu(B) gene. M: 10 kb marker, lane

1: En. faecium IB6-2B and lane 2: Lb. salivarius CHS-2E.



4.5. Discussion

The clinical implications of a positive D zone test commence with the cross

resistance among three antibiotic families (macrolides, lincosamides and type B

streptogramins) that share a common target (Woods, 2009). In the present

investigation, the findings indicated diverse MLS phenotypes among fermented

food isolates of LAB. Among the test isolates, cMLSB phenotypes were clearly

distinguishable from other phenotypes. This phenotype was also substantiated with

the positive erm(B) PCR results.

Among the enterococci and P. pentosaceus isolates considered in the

present study, majority of the cultures displayed L phenotype showing resistance

to clindamycin and intermediate resistance to erythromycin. The presence of

functional erm(B) would result in either cMLSB or iMLSB phenotype. However,

the observations made with these isolates indicated the reduced translation of

erm(B) gene which results with mutations in the Shine-Dalgarno sequences

(Srinivasan et al., 2011). Thus, this L phenotype observed among these

enterococcal isolates is independent of erm(B) gene.

Another unique phenotype we observed was the erythromycin induced

clindamycin sensitivity resembling the keyhole phenotype recently detected

among clinical isolates of Str. agalactiae (Srinivasan et al., 2011). In order to

determine the clindamycin resistance observed among the keyhole and L

phenotype isolates, the clindamycin inactivation test was performed along with

cMLSB isolates. However, none of the isolates with either L or keyhole phenotype



were positive. Instead, two isolates such as En. durans strain IB6-2B and Lb.

salivarius CHS-2E with cMLSB phenotype inactivated clindamycin and this

resistance was confirmed with the detection of lnu(B) gene. Srinivasan et al.

(2011) observed keyhole phenotype among isolates that were either erm(B) and/or

lnu(B) positive or negative. It was postulated that this phenotype could be due to

erm(B) or lnu(B) variants. This statement could be only partially agreed as we

could not observe any clindamycin inactivation among the isolates with keyhole

phenotype. However, molecular studies are further required to elucidate the

mechanism involved for such resistance phenotypes. Although implications of the

keyhole phenotype in LAB isolates are unknown, it is possible that clinically

important enterococcal isolates can respond to erythromycin and clindamycin

combination therapy.

In an attempt to determine cross resistance among the MLS antibiotics,

multiple disc diffusion tests were performed with MLS antibiotics. Interestingly,

we could detect an unusual pristinamycin inducible clindamycin resistance in

iMLSB En. durans strain IB8-3. This phenotype was similar to that observed with

erythromycin and clindamycin. Such type of induction has never been observed

between lincosamides and streptogramin antibiotics. In general, only 14- and 15-

membered macrolides are effective as inducers (Leclercq and Courvalin, 1991).

The specificity of induction is thought to be related to the mode of action of the

various macrolides. However, induction of erm(C) gene through non inducing

macrolides such as ketolides has been described (Bailey et al., 2008). Such



induction changes have also been reported in mutants of Staphylococcus aureus

where lincosamides could act as inducers indicating that resistance by ribosomal

methylation is crossed among MLS antibiotics. Such inducible resistance is

common among those isolates carrying erm genes. These observations illustrate

the considerable and apparently increasing complexity of resistance demonstration

among this group of antibiotics.

It is often the case, that erm(B) is found associated with mobile genetic

elements due to which it is found in multiple genera (Roberts 2008). The erm(B)

gene identified in LAB isolates of this study also showed maximum identity with

erm(B) associated with, Tn916, Tn2010 and Tn5253 like transposons of

Streptococcus pneumoniae. LAB are usually susceptible to macrolide group of

antibiotics (Ammor et al., 2007). However, the understanding of resistance to

these antibiotics in LAB comes with the detection of erm(B) in P. acidilactici

(Rojo-Bezares et al., 2006; Danielsen et al., 2007) and lactobacilli (Egervarn et al.,

2009, Devirgiliis et al., 2010, Toomey et al., 2010). In the recent time, a lot of

attention has been drawn to enterococci as reservoirs as they readily develop

antibiotic resistance in response to selective pressure (Wilcks et al., 2005).

Although reports are available indicating the presence of erm(B) in enterococci of

clinical origin, little is known for its occurrence in the food isolates of this genus

and also the industrially important species, P. pentosaceus. In the present

investigation, we have identified erm(B) in different species of Enterococcus and

several strains of P. pentosaceus isolated from the naturally fermented cereals and



dairy products. Probably, this is the first study to report the presence of erm(B)

gene in P. pentosaceus. These observations indicated that LAB acquired erm(B)

gene associated with either of the above mentioned transposons from other

pathogenic bacteria.

The msr(C) gene detected in En. faecium (Portillo et al. 2000; Hummel et

al., 2007b; Liu et al., 2009) has been reported to be an indigenous gene of this

species alone (Portillo et al., 2000). On the contrary, Werner et al. (2001) did not

detect msr(C) gene in all tested En. faecium cultures. The investigation

demonstrated the presence of msr(C) gene in LAB species viz. En. durans, En.

lactis, and En. casseliflavus, P. pentosaceus and Lb. fermentum. It should be

pointed out that this is the first report indicating the prevalence of msr(C) gene in

LAB other than En. faecium. The presence of msr(C) in different species of LAB

might represent a gene that has been acquired horizontally. However, sequencing

the regions surrounding the msr(C) gene is required to reveal the presence of

elements suggesting horizontal movement of this gene. As we could not

authenticate the presence of either msr(C) or msr(A) with the obtained PCR

amplicon, different sets of primers specific for msr(C) and msr(A) (Primer pair 3

and 4) were used where the resulting products differ in their amplicon size. None

of the isolates were positive for msr(A) indicating the prevalence of msr(C) in

LAB isolated from naturally fermented foods, dairy products and raw milk.



Despite the presence of erm(B) and msr(C) genes in several LAB isolates

from dairy products and cereal based foods, the MIC for erythromycin was low

and displayed diverse phenotypes. However, 1 En. faecium strain with iMLSB

phenotype showed high MIC value of 256 μg/ml. Such variation was also

observed in methylase encoding genes in Mycoplasma spp where the level of

expression dropped when cultivated in absence of erythromycin. However, a

second group of cells carrying homogenous MLS resistance expressed stable

resistance when grown in absence of erythromycin (Wiesblum, 1995a). Previous

studies have also shown that Enterococcus isolates carrying msr(C) displayed low

level resistance to erythromycin (Portillo et al., 2000). However, this was disputed

by disruption of msr(C) gene that resulted in two to eight fold increase in the

susceptibility to erythromycin (Singh et al., 2001). Hence, systematic studies need

to be conducted to reveal the appropriate role of msr(C) gene in exerting antibiotic

resistance in LAB and inducible resistance of erm(B) gene in all these isolates. On

the other hand, Lactobacillus cultures isolated from fermented dry sausages

harboring only erm(B) were highly resistant to erythromycin. These isolates

displayed cMLSB phenotype that results due to mutation in the leader peptide of

erm genes rendering continuous expression of these genes. Such resistant mutants

are selected with either tylosin, lincomycin or carbomycin that are used as growth

promoters in animal husbandry and poultry (Weibslum, 1995b). These resistant

bacteria present in the intestines of such farm animals subsequently contaminate



the meat products even when hygiene regulations are respected (Gevers et al.,

2003c).

The genetic basis of TCr in these isolates was investigated for the common

tet genes viz. tet(W), tet(M), tet(O) tet(S) tet(K) and tet(L). The resistance levels

conferred by these TCr genes varied among the LAB isolates. The three L.

salivarius strains carrying tet(W), tet(M), tet(O) and tet(L) and L. plantarum (I2)

harboring tet(W) and tet(L) displayed MIC value of 256 and 128 μg/ml

respectively. Similarly in case of Lb. reuteri (CH2-2) and En. faecium (IB6-2b)

harboring tet(W) and tet(L), tet(M), and tet(W), respectively, MIC values of 512

μg/ml was observed. However, reduced level of resistance was observed in En.

durans and P. pentosaceus isolates harboring only tet(L) gene which could be due

to its [tet(L)] low expression levels. Similar observations were made in previous

studies in Lb. sakei Rits 9, where the expression levels of tet(L) was low compared

to tet(M) but elevated in presence of low concentrations of tetracycline (Ammor et

al., 2008b). Thus, it appears that RPP genes confer high level TCr compared to

efflux genes as observed in Lactobacillus species harboring tet(W) and tet(M)

genes (Gevers et al., 2003a,b, Egervarn et al., 2009). However, in contrast,

Bifidobacterium species isolated from dairy products and humans harboring

tet(W) displayed low level of resistance to tetracycline (Florez et al., 2006,

Gueimonde et al., 2010). Similarly, among the 3 Streptococcus suis isolates

carrying tet(M), tet(O) and tet(L) genes, only one strain showed MIC of 256 μg/ml

while the other 2 strains had MIC values of 64 μg/ml (Hoa et al., 2011). These



observations indicated that simultaneous expression of RPP and efflux genes in

LAB results in higher level resistance to tetracycline. Difference in resistance

pattern was also observed among the isolates carrying tet(K) and tet(L) where the

isolates carrying the both tet(K) and tet(L) or tet(K) alone showed higher

resistance to tetracycline compared to those carrying tet(L) alone. Thus expression

studies are essential to elucidate the tolerance levels of all these genes to relate

with different levels of resistance to tetracycline they confer.

The tet(W) gene which is common in human and animal intestinal bacteria

was found to be less widely distributed in lactobacilli and so far only been

reported in Lb. crispatus, Lb. johnsonii, Lb. paracasei and Lb. reuteri (Egervarn et

al., 2009). The present investigation reports for the first time its [tet(W)]

prevalence in Lb. plantarum (I2) and Lb. salivarius (CH7-1E) along with tet(O).

TCr in Pediococcus spp such as P. acidilactici and P. pentosaceues have been

reported previously (Swenson et al., 1990; Tankoic et al., 1993; Danielsen et al.,

2007; Klare et al., 2007). Although, these reports illustrated higher resistance to

tetracycline, no tet genes were detected through PCR analysis. Hence, TCr in this

genus was thought to be an intrinsic characteristic (Danielsen et al., 2007).

However, tet(L) was detected in one P. parvulus strain isolated from wine (Rojo-

Bezares et al., 2006). The present study reports the membrane associated proteins

encoding efflux genes, tet(K) and tet(L) rendering resistance to tetracycline in P.

pentosaceus. The detection of tet genes in this species is a novel finding. Recent

studies on TCr in food isolates of Enterococcus have reported tet(L) to be



predominant followed by tet(M) and tet(K) in En. faecium and En. faecalis

(Wilcks et al., 2005; Hummel et al., 2007b) and tet(M) in En. durans (Huys et al.,

2004). Similarly in our study, tet(L) was the frequently found TCr gene among the

Enterococcus species. The frequency of RPP genes in these isolates was low with

tet(M) detected only in one En. faecium strain. This difference in the occurrence of

tet genes in enterococci can be more clearly explained taking into consideration a

large number of isolates and from different sources. The simultaneous occurrence

of tet genes such as tet(M)/ tet(W)/ tet(O)/ tet(L) in Lb. salivarius, tet(K)/ tet(L) in

P. pentosaceus, and tet(M)/ tet(L) in Lb. plantarum are in agreement with the

previous reports of Gram-positive bacteria containing multiple tet genes that either

have the same or different modes of action (Chopra and Roberts, 2001).

4.6. Conclusion

The present study illustrated that several acquired genes encoding for tetracycline

and ERr are found among LAB isolated from various foods especially the naturally

fermented foods (Idli and Dosa batter). The diverse MLSB phenotypes observed

among LAB indicate the prevalence of novel ERr or mutations in the existing

genes. The prevalence of TCr genes in several of these ER

r isolates demonstrated

that resistance genes encoding to both antibiotics (erythromycin and tetracycline)

are linked. The erm(B) and RPP genes isolated in LAB showed high homology

with those associated with different transposons. These observations indicated that



LAB has acquired the transposons that carried the resistance genes. The detection

of lnu(B) in food isolates of LAB indicated the prevalence of lincosamide

resistance genes in addition to ERr and TC

r genes. Further, the overlay assay

performed in this study can be employed for detecting the inactivation mechanism

among ART bacteria. In recent years, the question of antibiotic resistance in non-

pathogenic bacteria has been contemplated by the Scientific Panel on Additives

and Products or substances used in the Animal Feed (FEEDAP) of the European

Commission. In order to reduce the development of resistance, selective criteria

should also be applied to bacteria in human food, especially in case of starter

cultures where attempts are being made to promote them as probiotics. The results

of this study underline the prevalence of acquired ERr and TC

r genes in species

belonging to Lactobacillus, Pediococcus, Enterococcus and Leuconostoc. Thus, a

due selection and screening process have to be followed before using

environmental LAB strains as a new starter cultures or probiotic strains.

chapter: 4shodhganga.inflibnet.ac.in/bitstream/10603/69881/9/chapter 4.pdf · phenotype) with...

Documents