CHAPTER2

MATERIALS &

METHODS

Cha ter 2

2.1 Database searches and sequence alignment studies

The sequence features of Rv3014c from M tuberculosis H37Rv were analyzed

using the programs BLAST, Nrprot version 06.06 (Altscul et al. 1990; Madden et al.,

1996) and CLUSTALW (Thompson et al., 1994). Specific sequence motifs and domains

conserved in the protein with respect to other characterized ligases from Thermus

filiformis, Escherichia coli and Bacillus stearothermophilus (Lee et al., 2000; Lehman,

1974; Singleton et al., 1999) were identified.

2.2 Primers and vectors

Primers to PCR amplify and express the full length protein (with and without his­

tag) as well as three different truncated forms were designed using the sequence of

Rv3014c gene from M. tuberculosis H37Rv available in the database (Genbank™

accessiOn number NC 000962). Full length ligaseA (native) protein is denoted as

MtuLigA henceforth while the C-terminally his-tagged protein will be denoted as

MtuLigAc Truncated forms are called MtuLigA1 (residues: 1-604), MtuLigA2 (residues:

1-439) and MtuLigA3 (residues: 1-328) in the increasing order of truncation from C­

terminus respectively. Oligos corresponding to the truncated peptides were designed to

incorporate his-tags at the C-terminus. The primers were designed using the 'Oligo'

program. In case of different truncated forms the forward primer was the same while

different reverse primers were designed depending on the truncation.

MtuLigA

Forward primer Reverse primer

MtuLigAc

Forward primer Reverse primer

MtuLigAl

Forward primer Reverse primer

MtuLigA2

Forward primer Reverse primer

5' GGAA TTCCATGGGCTCCCCAGACGCCGAT 3' 5' TCACAAAGCTTTTACGTTCGTGACGCGGGTCC 3'

5' GGAATTCCATATGAGCTCCCCAGACGCCGA 3' 5' TCACA TCCA TGGCGTTCGTGACGCGGGTCC 3'

5' GGAATTCCATGGGCTCCCCAGACGCCGAT 3' 5' ATCGGATCCGTCACGCTCGTCGACCATTC 3'

5' GGAATTCCATGGGCTCCCCAGACGCCGAT 3' 5' ATCGGATCCGTTGGGGCAACGGATGTCGG 3'

28

MtuLigA3

Forward primer Reverse primer

5' GGAA TTCCATGGGCTCCCCAGACGCCGA T 3' 5' ATCGGATCCCTCGGGCGGGTACTTGT AGG 3'

Cha ter 2

Underlined nucleotides denote the sites recognized by corresponding-restriction

enzymes. MtuLigA has Nco! in forward and Hindiii in reverse; MtuLigAc contains Ndel

and Nco! in forward and reverse respectively while all the truncated forms had Nco! and

BamHI sites incorporated in their respective primers. MtuLigA and MtuLigAc were

cloned into pET2ld and pET41a respectively while all the truncated forms were cloned

intopQE60.

A description of the media, strains, vectors, chemicals and buffers used in this

study is detailed in Annexure.

2.3 Cloning and overexpression

2.3.1 MtuLigA and MtuLigAc

The putative DNA LigaseA gene (Rv3014c) was PCR amplified

[Denaturation - 97°C (2 min), annealing - 64°C (1 min), amplification - 72°C (2

min 30 sec), 35 cycles] from M. tuberculosis H37rv genomic DNA using the

primers described above using a GeneAmp PCR system 2400 (Perkin Elmer). The

PCR reaction products were electrophoresed in 1 % agarose gel and the products

were excised and purified from the gel using an extraction kit. The PCR product

corresponding to the native protein was digested with Nco! and Hindiii, while the

product corresponding to his-tagged protein was excised with Ndel and Nco! and

cloned into expression plasmidspET2ld andpET41a at the same sites respectively.

All the digestion and ligation steps were carried out as per standard protocol

(Sam brook et a/., 1989). The clones were screened by restriction digestion. The

resulting construct in pET21 d was transformed into E. coli BL21 (DE3 ). A single

colony was grown at 37°C in 5 ml of LB medium containing 100 j.!g/ml ampicillin

to an A6oo of 0.5, induced with 0.8 mM IPTG, and grown for 3 h. The construct in

pET41 a was transformed into BL21 (DE3) and grown at 30°C in 5 ml of LB

medium containing 50 j.tg/ml kanamycin to an A6oo of 0.5, induced with 0.5 mM

IPTG, and grown for 8 h. Inductions in both the cases were checked on a 1 0 %

SDS-polyacrylamide gel (Laemmli, 1976).

29

Cha ter 2

2.3.2 MtuLigAl, MtuLigA2 and MtuLigA3

PCR amplification of the three truncated forms MtuLigA 1, MtuLigA2 and

MtuligA3 were carried out (Section 2.3.1) using the respective set of primers and the PCR

products were purified as before. They were then digested with Nco! and BamHI and

cloned into pQE60. The constructs were screened by restriction digestion. The resulting

construct for MtuligA1 was transformed into E. coli BL21 (DE3). A single colony was

grown at 37°C in 5 ml of LB medium containing 100 j..lg/ml ampicillin to an A6oo of 0.5,

induced with 0.5 mM IPTG, and grown for 3 h while MtuligA2 and MtuLigA3 were

grown at 30°C in BL21 (DE3) and induced at A600 of0.5 with 0.5 mM IPTG for 8 h. The

level of induction for all three forms was monitored using 10% SDS-PAGE.

2.4 Purification

2.4.1 MtuLigA

One liter of LB medium containing 100 j..lg/ml ampicillin was inoculated with 5 ml

of starter culture and grown at 37°C I 180 rpm until the A6oo reached 0.5. Protein

expression was induced by the addition of 0.8 mM IPTG and the culture was grown

further for 4 h. After that the cells were harvested, resuspended in buffer A (50 mM Tris­

HCl, pH 8.0, 1 mM EDTA, 5 mM 2-mercaptoethanol), and lysed by sonication using a

Heat Systems Ultrasonic processor (New York) with a medium-size probe at 20% output

power, 50 % pulsar duty cycle for a pulse time of 8 min. Before lysis, 1000 !J.M of the

protease inhibitor phenyl methyl sulphonyl fluoride (PMSF) was added to the thawed

culture. The cell lysate was centrifuged at 27000g in SORVALL super T-21 (Kendro lab)

for 20 min at 4°C to remove the cell debris. The supernatant was loaded on a Q sepharose

column equilibrated with buffer A. The protein was eluted using a linear gradient ofbuffer

B (50 mM Tris-HCl, pH 8.0, 600 mM NaCl, 1 mM EDTA, 5 mM 2-mercaptoethanol). In

the next step, we used heparin-sepharose columns for further purification. Immobilized

heparin interacts with proteins by two different mechanisms: It can function as an affinity

ligand, in which case the protein (such as a DNA binding proteins) is eluted with a buffer

containing either salt or heparin. Heparin's anionic sulphate groups also give it the ability

to function as a high-capacity cation exchanger. In this case, the protein is recovered by

gradient elution with salt.

Fractions containing the protein were pooled and diluted to reduce the salt

concentration to 100 mM NaCl and loaded onto a Hi Trap heparin-sepharose column

10

Cha ter 2

which had been pre-equilibrated with buffer A. The protein was eluted with a linear

gradient of buffer B containing up to 600 mM NaCI. Protein fractions were pooled after

SDS-PAGE analysis.

For further purification, we used a blue-sepharose column, which is an affinity

chromatographic column and consists of a dye-ligand (cibacron blue F3G-A) affinity

matrix for purification of albumin, enzymes (including NAD+ and NADP+), coagulaion

factors, interferons and related proteins. The ligand, Cibacron Blue F3G-A, is covalently

coupled to sepharose through chlorotriazine ring. It is specific for the super-secondary

structure, which forms the binding sites for substrates and effectors like NAD+ on a wide

range of proteins to significantly improve the purification procedures. In our case, we used

HiTrap blue-sepharose CL-6B.

Salt concentration in the protein-containing fractions was reduced to 100 mM by

dilution with buffer A and applied onto the column pre-equilibrated with buffer A.

Column was washed with buffer A till O.D. reaches to basal level before protein was

eluted with a linear gradient of buffer C (50 mM Tris-HCl, pH 8.0, 2 M NaCl, 1 mM

EDTA, 5 mM 2-mercaptoethanol) containing 2 M NaCI. Purity was monitored by

electrphoresing the samples on a 10 % SDS-PAGE. Peak fractions were pooled and

protein was precipitated using ammonium sulphate (65 % saturation). The precipitate was

dissolved in minimum volume of buffer D (50 mM Tris-HCl, pH 8.0, 50 mM NaCl, 2 mM

2-mercaptoethanol and 1 mM EDTA) and applied onto a gel filtration column (Superdex

S-200 HR10/30) column equilibrated with buffer D on an AKTA-FPLC system. The

protein samples were then concentrated to -20 mg/ml using 50 kDa cutoff centricon.

Protein concentrations were determined by the Bradford method (Bradford, 1976) using

BSA as the standard.

2.4.2 MtuLigAc

500 ml medium of LB containing 50 f,lg/ml kanamycin was inoculated with a 5 ml

overnight grown culture of BL21 (DE3)-LigAc and grown at 30 °C until the A6oo reached

0.5. Protein expression was induced by the addition of 0.5 mM IPTG and growing the

culture for further 8 h. Induced cells were harvested, resuspended in 50 mM Tris-HCl, pH

8.0, 100 mM NaCI, 10 mM imidazole and lysed by sonication at 20 % output power, 50 %

pulsar duty cycle for a pulse time of 8 min. The cell lysate was centrifuged at 27000g in

SORVALL super T-21 for 20 min at 4°C to remove the cell debris. The clear supernatant

31

Cha ter 2

was loaded onto a Ni2+-IDA column.pre-equilibrated with Buffer A (50 mM Tris-HCl pH

8.0, 100 mM NaCl, 10 mM imidazole). The column was washed with 5 column volumes

of buffer A. Elution was carried out ,using stepwise gradient of 10 mM, 50 mM, 100 mM,

125 mM, 150 mM and 250 mM im~dazole with buffer B (50 mM Tris-HCl, pH 8.0, 100

mM NaCl). The eluted fractions were analyzed using 10 % SDS-PAGE. The fractions

containing the protein were pooled and precipitated using ammonium sulphate (70 %

saturation) and dissolved in Buffer C (50 mM Tris-HCl, pH 8.0, 50 mM NaCl, 2 mM 2-

mercaptoethanol, 1 mM EDTA). This was applied on a gel filtration Superdex S-200

column pre-equilibrated with buffer C. The protein was eluted in buffer C. The fractions

containing the protein were pooled and concentrated up to 20 mg/ml using a 50 k:Da cutoff

centricon (Amicon). The protein concentration was estimated by Bradford method.

2.4.3 MtuLigAl

500 ml of LB medium containing 100 J.tg/ml ampicillin was inoculated with 5 ml

of overnight grown culture of MtuLigA1 and grown at 37°C until the A6oo reached 0.5.

Protein expression was induced by the addition of 0.5 mM IPTG and grown further for 3

h. The cells were then harvested, resuspended in 50 mM Tris-HCl, pH 8.0, 200 mM NaCl,

10 mM imidazole and lysed by sonication at 20 % output power, 50 % pulsar duty cycle

with a pulse time of 8 min. The cell lysate was centrifuged at 27000g in SORVALL super

T-21 for 20 min at 4°C to remove the cell debris. The clear supernatant was loaded onto a

Ni2+-IDA column pre-equilibrated with Buffer A (50 mM Tris-HCl, pH 8.0, 200 mM

NaCl, 10 mM imidazole). The column was washed with approx. 5 column volumes of

buffer A till O.D. reaches to basal level. Elution was carried out using step-gradient of

imidazole with buffer B (50 mM Tris-HCl, pH 8.0, 200 mM NaCl) as in the case with

MtuLigAc. The fractions were subjected to 10% SDS-PAGE analysis.

Fractions containing the protein were then pooled and precipitated usmg

ammonium sulphate (50 % saturation). The precipitate was dissolved in Buffer C (50 mM

Tris-HCl, pH 8.0, 50 mM NaCl, 2 mM mercaptoethanol, 1 mM EDTA) and applied on a

Superdex S-200 column pre-equilibrated with buffer C (50 mM Tris-HCl, pH 8.0, 50 mM

NaCl, 2 mM 2-mercaptoethanol, 1 mM EDTA). The protein was eluted in buffer C. The

fractions containing the protein were pooled and concentrated up to 12 mg/ml using 50

k:Da cutoff centricon. The protein concentration was estimated by Bradford method as

before using BSA as a standard.

32

Cha ter 2

2.4.4 MtuLigA2 and MtuLigA3

Purification was done more or less in the same way as described for MtuLigA 1.

500 ml of LB medium containing 100 !J.g/ml ampicillin was inoculated with a 5 ml culture

of MtuLigA2 and MtuLigA3 grown overnight. It was grown at 30°C until the A6oo reached

0.5. Protein expression was induced by the addition of 0.5 mM IPTG along with 100

!J.g/ml ampicillin for 8 h. Induced cells were harvested, resuspended in 50 mM Tris-HCl,

pH 8.0, 200 mM NaCl, 10 mM imidazole and lysed by sonication at 20% output power,

50 % pulsar duty cycle for a pulse time of 8 min. 1000 !J.M PMSF was added to thawed

culture just before lysis. The cell lysate was centrifuged at 27000g in SORV ALL super T-

21 for 20 min at 4°C to remove the cell debris. The clear supernatant was loaded on a Ni2+­

IDA column pre-equilibrated with Buffer A (50 mM Tris-HCl, pH 8.0, 200 mM NaCl, 10

mM imidazole). Elution was carried-out in the manner as described in the case of

MtuLigAc and MtuLigAl. The purification was subjected to 10% SDS-PAGE analysis.

Fractions containing pure protein were pooled and precipitated using ammonium

sulphate (50 % saturation). The precipitate was dissolved in Buffer C (50 mM Tris-HCl,

pH 8.0, 50 mM NaCl, 2 mM mercaptoethanol, 1 mM EDTA) and applied on a Superdex-

200 column pre-equilibrated with buffer C (50 mM Tris-HCl, pH 8.0, 50 mM NaCl, 2 mM

mercaptoethanol, 1 mM EDTA). The protein was eluted in ~r C. The fractions

containing the protein were pooled and concentrated upto 15 mg/ml using 10 kDa cutoff

centricons. The protein concentration was estimated by Bradford method using BSA as a

standard. All the protein solutions were stored at 4°C

2.5 Characterization of protein

2.5.1 Preparation of substrate

In vitro assays for ligase activity were performed using a synthetic double-stranded

40 bp DNA substrate carrying a single-strand nick between bases 22 and 23 (Timson and

Wigley, 1999).

Al 5' ATG TCC AGT GAT CCA GCT AAG GTA CGA GTC TAT GTC CAG G 3'

A2 5' CCT GGA CAT AGA CTC GTA CCT T 3'

A3 5' AGC TGG ATC ACT GGA CAT 3'

This substrate was created in TE buffer by annealing a 22-mer A2 (5'-CCT GGA

CAT AGA CTC GTA CCT T-3') and 18-mer A3 (5'-AGC TGG ATC ACT GGA CAT-3')

33

Cha ter 2

to a complementary 40-mer Al (5'-ATG TCC AGT GAT CCA GCT AAG GTA CGA

GTC TAT GTC CAG G-3'). At the 5' end, the 18-mer constituting the donor strand was 32P-labeled by incubating 10 )lg of the oligonucleotide with 100 )lCi of [y-32P]-ATP (3000

Ci/mmol) and 30 units ofT4 polynucleotide kinase for 1 h followed by kinase inactivation

for 10 min at 70°C (Doherty et a/., 1996). The unincorporated label was removed by

centrifugation at 4000 rpm for 5 min at room temperature through sephadex G-25 column.

Labeled substrates were stored at -20°C. In the course of handling, guidelines to avoid

biosafety hazard were strictly followed.

2.5.2 Activity of MtuLigA, MtuLigAc and deletion mutants

Prior to all assays protein was kept in 50 mM Tris-HCl, pH 8.0, 5 mM DTT at 4°C.

Reaction mixtures (10 )ll) containing 50 mM Tris-HCl, pH 8.0, 5 mM dithiothreitol {DTT), 10

mM MgCh, 50 )lM NAD+, 2 pmol of 32P-labeled nicked duplex DNA substrate and 2 - 10

pmol of different forms ofligases (MtuLigA, MtuLigAc, MtuLigAl, MtuLigA2, MtuLigA3)

were incubated for 1 0 min at 25 °C. Reactions were quenched with formamide loading buffer

(Annexure) and reaction products were resolved by electrophoresis through a 15 %

polyacrylamide gel containing 8 M urea in 1 X TBE (90 mM Tris-borate and 2.5 mM EDTA).

Autoradiogram of the gel was developed and extent of ligation was measured by scanning the

gel using Image Master 1D Elite software (Amersham).

2.5.3 Kinetic and physio-chemical parameters

Using the above assay procedure Km and V max of the ligation reaction for the

designed synthetic DNA substrate as well as for NAD+ were determined. Effect of

different external factors viz. salt dependence, pH, divalent, Mg2+ dependence and

specificity of co factors on the activity of the enzyme were determined using the following

assay procedures. In all the assay procedures, reactions mixture were quenched with

formamide and EDT A and reaction products were resolved by electrophoresis through a

15 %polyacrylamide gel containing 8 M urea in 1 X TBE. Autoradiogram of the gel was

developed and extent of ligation was measured by scanning the gel using Image Master

1D Elite software.

2.5.3.1 Effect of different co-factors and divalents

To check the specificity for cofactors, reaction mixtures (15 )ll) containing 50 mM

Tris-HCl, pH 8.0, 5 mM DTT, 10 mM MgCh, 2 pmol nicked labeled substrate, 2 pmol

34

Cha ter 2

ligase and 1 mM NTP or dNTP were incubated for 10 min at 25°C. Nucleotide was

omitted in control reactions.

For divalent cations, reaction mixtures (15 J..tl) containing 50 mM Tris-HCI, pH 8.0,

5 mM DTT, 50 J.!M NAD+, 2 pmol nicked labeled substrate, 2 pmol ligase and 10 mM

divalent cations (Mg, Mn, Ca, Cu, Cd, Zn and Ni) were incubated for 10 min at 25°C.

Extent of ligation was plotted against different cations. Magnesium, Manganese, Calcium

and Zinc were added as the chloride salts; Copper and Cadmium were added as sulphates.

Similarly, reaction mixtures containing 5 mM DTT, 50 J.!M NAD+, 2 pmol nicked

DNA substrate, 2 pmolligase and 50 mM Tris-HCl, pH 8.0 were incubated for 10 min at

25°C at varying Mg2+ concentration ranging from 0 to 40 mM. Extents of ligation were

plotted as a function of divalent concentration.

2.5.3.2 Effect of pH and salt on ligation

Reaction mixtures (15 J..tl) containing 5 mM DTT, 10 mM MgC}z, 50 J.!M NAD+, 2

pmol nicked DNA substrate, 2 pmolligase arid 50 mM Tris-HCI (pH 6.5, 7.0, 7.5, 8.0, 8.5,

9.0. 9.5) were incubated for 30 min at 25°C. Extents of ligation were plotted as a function

of pH of the buffer.

Similarly, reaction mixtures containing 5 mM DTT, 10 mM MgC}z, 50 J.!M NAD+,

2 pmol nicked DNA substrate, 2 pmolligase and 50 mM Tris-HCI, pH 8.0 were incubated

for 30 min at 25°C at NaCl and KCl concentration ranging from 0 to 400 mM. Extent of

ligation was plotted as a function of salt concentration.

2.5.4 Adenylation and deadenylation reactions

Deadenylation and subsequent adenylation reactions were carried out as described

previously (Timson and Wigley, 1999). Briefly, deadenylated MtuLigA or truncated forms

of IigAs (10 J.!M) were incubated for 15 minutes at room temperature with e2P] NAD+

(0.0 1 J.!M) in the presence of ligase assay buffer in a total reaction volume of 10 J.!l. After

this time, the volume was increased to 50 J.!l by the addition of water and excess

nucleotide was removed using an S-200 micro-spin column. Deadenylation assays were

carried out with a substrate that was identical with the ligase assay substrate except that it

was phosphorylated with unlabelled ATP. 32P-labelled adenylated MtuLigA or truncated

IigAs (0.1 J.!M) were incubated with this nicked DNA substrate (5.0 pmol) in the presence

of ligase assay buffer and in a total volume of 10 J..ll for four hours. Reactions were

terminated by the addition of SDS to a final concentration of 3.3 % (v/v) and heating to

35

Cha ter 2

95°C for three minutes. Products were analysed by 10% SDS-PAGE. The gels were dried

and bands were visualized by autoradiography.

All the proteins were deadenylated by adding 10 mM NMN and 10 mM MgCh to

100 J.!M protein solutions in 50 mM Tris-HCl. pH 8.0 in a total reaction volume of 100 J.tl

(Timson and Wigley, 1999). This mixture was incubated at 25°C for 30 minutes.

Deadenylated ligA, truncated ligAs were diluted threefold in 50 mM Tris, pH 8.0, 5 mM

DTT and separated from free nucleotides using centricon through buffer exchange.

2.5.6 Gel shift assays

DNA band shift assays were carried out in band shift buffer (50 mM Tris-HCl, pH

8.0, 10 mM EDTA, 5 mM DTT). LigaseA (0, 5, 10, 20,40 J.tM) were incubated with 32P­

labeled ligase assay substrate and an identical 5' labeled intact substrate with no nick in

between (5 pmol) in a total assay volume of 10 J.tl for at least 30 minutes at room

temperature. After this time 2.5 J.!l of gel loading buffer (Annexure) was added and the

mixture was analyzed on native 6% acrylamide gels containing 5% (v/v) glycerol and 0.5

X TBE (45 mM Tris-borate, pH 8.0, 1.25 mM EDTA) (Timson and Wigley, 1999). Bands

were visualized by autoradiography of dried gels. Truncated ligAs were also checked for

DNA substrate affinity in the same way.

2.6 Crystallization

2.6.1 Preparation

Extraneous substances may act as initial nuclei for crystal formation. Control of

excessive nucleation by filtration and general cleanliness has been shown to be conducive

to the formation of better crystals (Chayan et al., 1993; Blow et al., 1994). All buffers,

crystallization reagents, solutions were therefore filtered. Protein solutions were

centrifuged at 1 O,OOOg for 5 min to settle extraneous debris prior to setting up drops.

Microscopic cover slips used in vapour diffusion method needed special cleaning

treatments. These cover slips were thoroughly washed with cleaning solution, rinsed with

milliQ, dried and then coated with dilute siliconizing solution.

2.6.2 Crystallization trials

Preliminary crystallization trials of native protein, his-tagged protein and . the

truncated forms MtuligA 1, MtuLigA2 and MtuLigA3 were carried out alone and in

36

complex with NAD+ and Mg2+,

formulation of 50 solutions (J

Kim, 1991 ; Cudney et al., 1994)

(Mazeed et al., 2003). The protocol

combinations of pH, salts, precipitants,

crystallization trials for all the forms were

50 mM Tris-HCl, pH 8.0, 50 mM NaCl, 1 mM

mM NAD+) with an equal volume of rf"<;:f"nrn

diffusion method at different temperatures \ .

trials and variation in different physical parameter.s, .

different lead conditions, which were further explored

for analysis by X-ray diffraction.

2.6.2.1 ~~~:!!..!!..!!.!....!~~~~~~...!!!!~~~~

Following crystal leads were obtained in case ofMtuLigAl

A. 0.1 M Ca-Acetate hydrate, 0.1 M Na-cacodylate, pH 7.2, 10%

B. 0.1 M MES, pH 5.7, 8% w/v PEG 20,000

Crystal leads obtained from condition "A" were very fine clusters,

unsuitable for diffraction so further optimization became essential.

Various inorganic and organic additives were used in an attempt to

crystalline conditions. Additives were used in range from 5 mM to 10 mM in a

range of pH and different PEGs.

Crystal leads obtained from condition "B" had very fine needles thickly clustered

in hundreds of numbers, which were further optimized by systematically changing various

parameters.

Following crystal lead was obtained for MtuLigA2.

C. 0.1 M Tris-HCl, 7.8, 14% PEG 4000

This condition was optimized from sparse matrix condition 6 (Jancarik and Kim,

1991) at 24°C. These crystals also appeared as thin long needles unsuitable for diffraction,

so were optimized further by varying different physical parameters.

2.6.2.1.1 Seeding techniques for MtuLigAl and MtuLigA2

Microseeding was used as another approach to improve the crystallization

conditions as described earlier (Thaller et al., 1981, 1985). For the microseeding

experiments, a few crystals ofMtuLigA1 in both the conditions 'A' and 'B' were crushed

37

Cha ter 2

with the help of capillary jets and transferred to a microcentrifuge tube and mixed in 10 111

well solution; centrifuged at 6000g for 5 min to exclude large nuclei, precipitate etc. These

were streaked with the help of a fine hair to low supersaturating solutions to perform

microseeding.

2.6.2.2 Crystallization trials for MtuLigA3

Crystallization trials led to a condition in which distinct hexagonal shape crystals

grew at 22-24°C within couple of days and increased to maximum size within a week.

D. 0.1 M NaCl, 0.1 M Na-HEPES, pH 7.6, 1.5 M (NH4)zS04

2. 7 Structure solution of MtuLigA3

2.7.1 Data collection

The author during the course of his work has collected data on a MAR imaging

plate system. MAR-XDS (Kabsch, 1988, 1993) and DENZO/SCALEPACK (Otwinowski,

1997) packages were used for processing the data. The data collection strategies and the

programs used are outlined in the sections below.

2.7.1.1 Instrument

Using a copper-rotating anode, X-rays are produced with a wavelength of 1.54 A.

They are directed into a collimating system consisting of two slits (horizontal and vertical)

each backed by an ion chamber. The whole assembly is mounted on a motor-driven table

whose position can be adjusted vertically and horizontally. The slits are adjusted to

produce a beam of X-rays 0.3 mm square, which impinge on the sample. The sample

scatters the beam and this radiation is captured by the detector. A backstop absorbs the X­

rays, which have not struck the sample. CDRI, Lucknow has an in-house x-ray

crystallography facility, equipped with Rigaku (Japan) RU 300 rotating anode generator

with Cu anode.

2.7.1.2 Detector

The imaging plate detector is a solid-state device. It is an amorphous thin film of

barium (Ba), europium (Eu), and bromium (Br). This material absorbs X-rays to form F­

centers. These F-centers are the regions, which store photon energy as excited electrons.

After the exposure is complete the plate is read by a He-Ne (2 eV) red laser. Absorption of

photons induces excited electrons to return to ground state with the emission of blue light

(4 eV) which is quantitatively read by a photo multiplier. The plate is then erased by

exposing it to intense white radiation.

38

Cha ter 2

The MAR (Germany) imaging plate system consists of the imaging plate detector,

detector base, the controller box, remote control and the TV monitor. MAR detectors are

either 300 mm in diameter or 345 mm and are designated MAR 300 or MAR 345

respectively.

The movement of the detector is controlled by a Linux based computer with 64

MB RAM and a hard disc of 1 GB, through a controller box. Every frame is stored on the

hard disk (in I data directory). Each image is about 8 MB that could be further

compressed to about 3 MB. The TV monitor displays the image of the crystal using a

sensitive CCD camera located underneath the crystal, which is attached to the MAR 345

image plate detector.

Selected crystals of MtuLigA3 were mounted in capillaries and data were collected

using Rigaku RU 300 rotating anode X-ray generator on which a MAR 345 image plate

detector had been mounted. The beam alignment optics used in the in-house setup also

consists of a long mirror. Data were collected at room temperature. Although the best

crystals diffract to about 3.3 A, usable data, according to the signal to noise ratio and

statistics, could be extracted to about 3.8 A. It is known (Yang et al., 1999) that osmic

mirrors improve the incident x-ray intensity by upto 40-50 %. We therefore collected a

data set at the Department of Biophysics, Structural Biology lab, AIIMS (New Delhi)

where osmic mirror optics were available. The best crystals here diffract to about 3.1 A

and a usable data set could be extracted to 3.15 A. It must be mentioned that extensive

attempts at flash freezing the crystal, led to the conclusion that the crystal mosaicity

increased inordinately but the diffraction limit did not change. Detector distance was kept

fixed at 220 mm. Detector radiuses and scanning beam size were 345 mm and 150 Jlm

respectively. Oscillation of 1° per frame with an exposure time of 10 min was used for

data collection.

2.7.2 Data processing

Both the data sets were processed and scaled using the HKL program suite (HKL

1.96.1 ). The diffraction images were displayed using XdisplayF (the visualization

software) and peak search options were used to generate a set of peaks. The crystals were

auto indexed using Denzo with appropriate options. The scaling and merging of different

data sets as also post-refinement of crystal parameters were performed by the program

Scalepack.

39

The HKL suite is a package of programs intended

diffraction data collected from single crystals, and consists of three programs:

for visualization of the diffraction pattern, Denzo for data reduction and integration, and

Scalepack for the merging and scaling of intensities obtained by Denzo or other

programs.

The steps carried out by Denzo and XdisplayF are:

1. Visualization and preliminary analysis of the original, unprocessed detector data.

2. Indexing of the diffraction pattern.

3. Refinement of the crystal and detector parameters.

4. Integration of the diffraction maxima.

The program Scalepack carries out the steps given below.

1. Finding the relative scale factors between frames.

2. Precise refinement of the crystal parameters using the whole data set.

3. Merging and statistical analysis of the measurements related by space group

symmetry.

The package offers two indexing options viz. auto and interactive indexing. The

five parameters that specify the orientation of the crystal relative to X-ray beam are: the

vertical axis, the spindle axis and the crystal rotx, roty, and rotz values. The autoindexing

routine deduces crystal unit cell parameters and crystal orientation parameters from a

single oscillation image. A distortion index given for all the 14 possible Bravais lattices by

the program enables us to identify the lattice with the highest symmetry, which fits the

data with minimal distortion. The autoindexing program also gives the crystal orientation

parameters.

Once the unit cell parameters and the Bravais lattice are determined using the

autoindexing program, then various parameters like crystal orientation, beam position, unit

cell parameters, beam crossfire parameters, the film cassette parameters and the crystal to

film distance are refined. These parameters are usually refined in the following order.

1. CRYSTAL rotx roty rotz 2. Y BEAM, X BEAM

3. UNIT CELL 4. CROSSFIRE x y xy

5. CASSETTE rotx roty 6. RADIAL/ANGULAR OFFSET

7. DISTANCE

The crystal to film DISTANCE, RADIAL OFFSET and the unit cell parameters

are highly correlated. Hence these parameters should be refined with care especially for

poor data. The user input values for the program with the typical values given in

40

parenthesis include mosaicity value (0.3), spot shape (0.5), background shape (0.7),

collection parameters like the crystal to detector distance and the kind of detector

imaging plate) used during data collection. The reflections can be defined as 'elliptical' in

shape by specifying the major and minor axis of the ellipse. The user has the choice of

interactively selecting reflections for input to the autoindexing routine.

After each cycle of refinement of the parameters, Denzo updates the display and

prints out the numerical summary of the refinement cycle. The output gives the new values

for the refined parameters and the shift in their values during the refinement cycle. The

output also gives the y} values for the X and Y positions of the predicted spots. The x2

represents the average ratio, squared, of the error in the fitting and the expected error. A

good crystal will show x2 values near 1.0. x2 values of even 2.0 or 3.0 are accepted,

because the position of the predicted reflection, and hence the intensity, is still very

accurate. Denzo finally gives the list ofhkl's and unsealed intensities for each image.

The program Scalepack is used to scale the unsealed intensities output by Denzo.

This program calculates single isotropic scale and B factors for each of the "films" or

"batches" of the processed data that are input. The output gives scaled, merged data. The

multiplicative correction factor applied to intensities (I) and cr(I) is given as

(sin B )

2

2B-e .._ s =

scale

Merging of symmetry related measurements are done as follows:

The multiplicative factor that is applied to each measurement is calculated from the

scale and B factor of the corresponding frame and applied to intensity I to give Icorr.

(lcorr) is obtained by:

1 w

where E1 and E2 are the input variables "error scale factor" and "estimated error",

respectively, and

~)corr. W \Icorr) = Iw

41

Cha ter 2

The output cr (I) is

1

During the refinement, the scale (and B if requested) for all frames are refined

simultaneously to minimize the difference between the (Icorr)'s and the Icorr's for

individual measurements, summed over all reflections on all films. (Icorr)'s are

redetermined in each cycle as described earlier. One or more "films" or "batches" that is

input is designated as the reference, and its scale and B factors are not refined.

Diederichs and. Karplus (1997) had suggested a parameter called Rmeans, which is

better than Rmerge as it is independent of the multiplicity of the data. This value was also

used to assess the data quality.

The quality of the data 1s also assessed using statistical approaches. The

normalized x2 given by

:Lo - <I>).2

Error 2 * N

N -1

is an important parameter of the data quality. The R1inear and Rsquare are defined as

LII - (I) I Rtinear = LI L( I - (I)) 2

Rsquare = LI 2

A good data set should show r! values close to 1.0. The estimated and statistical

errors should match closely. The R1inear and Rsquare values should also be close to each

other.

2. 7.3 Structure determination and model building

In order to calculate the electron density distribution inside the crystal, we need the

F (hkl) and the phase a (hkl) but from a diffraction experiment, we know only their

magnitude IFhkll. The equation for electron density p (x, y, z) is given by,

p (x, y, z) = IN :Ehki F (h k I) exp [- 2ni (hx + ky + lz) + ia (h k 1)]

where F (h k 1) is the structure factor for the corresponding reflection and a (h k I) are

the phases for each point xyz, in the unit cell.

Phases can be obtained by means of different techniques:

42

Cha ter 2

2.7.3.1 Multiple isomorphous replacement method (MIR) requires preparation of

one or more heavy atom containing derivatives of the protein in the crystalline state. This

method uses the differences observed in the diffraction intensities, upon incorporating

heavy atoms into the crystals. The first step in this method requires attachment of heavy

atoms and the determination of the coordinates of these heavy atoms in the unit cell. The

position and occupancy of the heavy atoms is determined using difference Patterson

function that serves as the starting point for the determination of the protein phase angles.

2.7.3.2 In multiwavelength anomalous dispersion (MAD), information from

anomalously scattering atom forms the basis for structure determination. The MAD and

MIR approaches to structure solution are conceptually very similar and share several

important steps. In each method, partial structure of heavy atoms or anomalously

scattering atom is often obtained by inspection of difference Patterson maps.

2.7.3.3 Molecular Replacement (MR) is a method to obtain an initial model of the

protein using a homologous protein with known structure as a search model to calculate a

starting set of phases that can be iteratively refined. For that, the search molecule must be

oriented and positioned in the unit cell of the target molecule. Thus, the related structure

(phasing model) is used to obtain phase information after orienting the model in the unit

cell of the protein.

The main steps in MR are:

1. Finding the orientation of the search model in the unknown crystal cell

(Rotation).

2. Placing this oriented model in the unit cell relative to the crystallographic

symmetry elements (Translation).

3. Assessing the quality of the solution.

In other words, the problem in molecular replacement is to find the six parameters,

three rotational and three translational, which would place the search model in the unit cell

of the crystal. In the first step the rotational parameters used to orient the model to that in

the crystal are determined while in the next step, translation parameters to place the now

correctly oriented molecule in the asymmetric unit is calculated.

The Rotation function formulation developed by Rossman and Blow (1962),

involves rotation of the Patterson function of one group or molecule with respect to the

other in all possible ways and the superpositions of the two Patterson functions. A degree

of overlap is then evaluated for every rotation by calculating an index defined as

43

Cha ter 2

x1 in Patterson P1 is related to xz in Patterson Pz by the relationship

xz= [C] XI

where the matrix [C] is the rotation matrix. The integration is carried out within the

volume U in which the two groups or molecules are expected to be similar.

The translation [T] of the molecule X with an orientation [R] relative to the model

M involves the maximisation of the function

T (o) = ~uJ<2r P1 (u +o) Pz ([R] u- o) du

where T (o) is the translation function (Rossman and Blow, 1964; Tollin, 1966; Tollin

et al., 1966; Crowther and Blow, 1967).

The three dimensional structure solutions can be obtained from the simple relation.

X= [R] M + [T]

where [R] is the appropriate rotation and [T] the required translation to correctly

position the model in the unit cell.

To date there are several programs which are popularly utilized to solve the

structure using molecular replacement.

Amore is a complete molecular replacement system in one program, from Jorge

Navaza (Navaza, 1994).

Beast brute-force molecular replacement with Ensemble Average Statistics,

Maximum likelihood-based molecular repaclement (Read, 2001 ).

Molrep automated program for molecular replacement, from Alexei Vagin. (Vagin

et al., 1997).

Epmr is a program that finds crystallographic molecular replacement solutions

using an evolutionary search algorithm (Kissinger et al., 1999).

2.7.3.3.1 AMoRe (Automated Molecular Replacement package)

This program is written by Jorge Navaza (Navaza, 1993; Navaza, 1994; Navaza

and. Vemoslova, 1995). Adequate functions are computed by powerful and fast

algorithms.

1. Many potential solutions are explored serially.

44

Cha ter 2

2. The information from the already positioned models is automatically incorporated

into the search procedure for subsequent molecules.

3. The correlation coefficient is used as the main criterion of selection of the correct

solution.

4. There is a high degree of automation incorporated in the package leading to its

ease ofuse.

Unlike in conventional methods where the programs only accept coordinate input,

AMoRe also accepts electron density, which makes the model unbiased. The links

between the various programs are established by OIC (Output Input Cards generating

program) that provides the automation to the program, by reading the data parameters in

the input files and preparing the input data files for various programs. In the current stand­

alone version of AMoRe, all the standard inputs to OIC are generated by the JOB control

code. In most of the cases, the default settings are appropriate and lead to the correct

solution.

The various sub-programs in this suite are given below:

1. The program SORTING sorts, packs and assesses the quality of the

experimentally measured diffraction data, and is run in the first step.

2. The program TABLING calculates the continuous Fourier coefficients from the

model plac~d in the artificial cell.

The cross rotation function calculation is carried out by the program ROTING,

which uses Crowther's algorithm (Crowther, 1972). The program expands the Patterson

function in spherical harmonics as in Crowther's formulation but the radial variables are

handled differently, leading to more accurate results. The basic formulae used in ROTING

have been derived by Navaza and coworkers (Navaza, 1987; Navaza, 1990). The rotation

function takes the factorized form: 00 I

R (a, p, y) = I I c~m' D~m' (a' ,8, y) 1=0 m m'= -1 ' '

' Where D1

m, m' are the matrices of the irreducible representation of the rotation

group and a, p, y refer to the eulerian angles. C1m, m' depend on the intensities

corresponding to the crystal and model and on the definition of the spherical domain of

integration but not on angular variables. These are given in terms of radial functions. In

practice C1m, m' are calculated by numerical integration.

45

Cha ter 2

3. ROTING exploits several properties of the Bessel functions and samples the

radial functions depending on the data resolution and the interval of integration so

as to enhance the resolution of the rotation peaks. The standard output contains all

the peaks greater than 50 % of the maximum value of the rotation function;

however the user can change this to any other value.

4. TRAING is then used to calculate the translation function. The input is the whole

list of peaks from the rotation function output. The program can perform four

different kinds of translation functions. Two of these are overlap functions while

the other two are fast translation functions. The option C-0, centered overlap

option, proposed by Crowther and Blow (Crowther and Blow, 1967) measures the

overlap between the observed and calculated Patterson functions. The PT option

employs another overlap function approach, but is based on the full-symmetry

phased translation function (Cygler and Desrochers, 1989). The program uses the

reciprocal-space version (Bentley and Houdasse, 1992) of this approach. The

other two functions calculate correlation coefficients. This method was

proposed by Harada et a!. ( 1981) and calculates correlation coefficients in terms

of intensities. The expression may be evaluated as a Fourier transform. This

function can be regarded as a measure of the intermolecular overlap within

the crystal. The other function calculates the correlation coefficient in terms of

amplitudes rather than the intensities. The disadvantage in such a procedure is

that it can not be computed as Fourier summations. The cumulated experience

with the package shows that it is advantageous to select the solutions based

on the correlation coefficients of computed and observed amplitudes rather

than on the basis of the overlap function.

If more than one molecule is to be placed within the asymmetric unit, a series of

n-body translation functions are executed. At each stage, a potential solution of

the previous step (in general the one with the highest correlation coefficient)

provides the fixed contribution to the n-body translation function. The strategy

used for n-body translation function makes AMoRe more powerful than other

molecular replacement programs. The asymmetric unit that needs to be searched

for the translation function (1-body) is the Cheshire cell (Hirshfeld, 1968) while

for n-body translation it is the whole cell.

46

Cha ter 2

5. Finally, FITING is used to refine the orientational and positional parameters of

the molecule corresponding to the potential solutions, as a rigid body. This

procedure was first proposed by Huber and Schneider (Huber and Schneider,

1985). The algorithm used in AMoRe was developed by Castellano eta!. (1992).

The function is minimized with respect to positional parameters, and overall scale

and temperature factors. The minimization results in optimizing the correlation

between the observed and calculated structure factor amplitudes.

2.7.4 Structure refinement and validation Once the phase problem is solved, it is possible to calculate the electron density

distribution inside the crystal and to fit an initial molecular model into it. Refinement is

the process of adjusting the model to find a closer agreement between the calculated and

the observed structure factors. Molecular model coordinates x, y, z and thermal parameters

are changed in order to improve the agreement between the calculated IFcl and the

observed IFol. Given the unfavorable ratio between the number of observations and the

refined parameters, it is necessary to introduce some geometrical restrains (expected bond

length, bond angle and torsional angle).

The quality of the final model can be established on the basis of several quality

indicators:

-Quality of the electron density maps.

- R-factor I FreeR-factor (least square residual for the working and test dataset).

-Final model geometry.

R-factor = ~hkliiFol- kiF ell I ~hkliFol

Where F 0 and F c are observed and calculated structure factors for hkl reflections.

Programs, which are used to refine the structure

RefmacS Refine or idealize structures, using intensity or amplitude based least

squares or maximum likelihood refinement (Murshudov eta!., 1997).

Arplwarp of the Automated Refinement Procedure (Lamzin and Perrakis, 1998).

Objective interpretation of crystallographic electron density maps and automatic

construction and refinement of macromolecular models.

Xplor X-ray and molecular dynamics refinement program. It can be used to

perform simulated annealing, conjugate gradient minimization etc (BrUnger et a!., 1989).

CNS Package for macromolecular structure determination and refinement (Brunger et

al., 1998).

47

Cha ter 2

2.7.4.1 X-PLOR

Molecular dynamics methods are exploited by X-PLOR to probe conformational

space of the molecule while minimising the difference between the observed and

calculated structure factors (BrUnger et al., 1987; Brunger, 1988, 1991). The refinement

options supported by the program are conjugate gradient minimisation, rigid body

refinement (Konnert, 1976), normal least squares refinement (Hendrickson and Konnert,

1980) and simulated annealing (BrUnger, 1988). The advantage in using X-PLOR is that

the user can write routines using the powerful X-PLOR shell language to suit the

requirements of the problem. The various standard options used in the refinements are

given below:

2.7.4.1.1 Rigid body minimisation

This procedure (Konnert, 1976; Head-Gordon and Brooks, 1991) minimises the

differences in the observed and calculated structure factors by refining the three rotational

and the three translational degrees of freedom of the user defined 'rigid' groups. Each

group is treated as a continuous mass distribution located at the center of mass position

defined by:

where

RJ= (1/MJ) L miri

M1=Imi

The mi 's are the atomic masses and J labels the rigid bodies. The parts of the molecule

not included in any group are kept fixed.

2.7.4.1.2 Conjugate gradient refinement

There are two shell programs PREPSTAGE and POSITIONAL available in X­

PLOR for conjugate gradient least-squares refinement using Powell minimisation (Powell,

1977). The former refines the geometry by fixing the harmonic terms to a constant value

with higher freedom on main-chain atoms and relieves the model from short contacts. This

is especially useful before simulated annealing and to relieve short contacts. The latter

shell program is used for conventional refinement and minimises grad (E) where E is the

Etotal described below. There are also options to refine the overall B-factor, the restrained

and unrestrained individual B-factors, group B-factors and occupancy.

The target function against which conjugate gradient minimisation is carried out

has the general form

Etotal = Echem + W Exray

48

Cha ter 2

Eehem consists of the geometric parameters, which describe covalent (bond lengths,

bond angles, dihedral angles, chiral centres, planarity etc.) and non-bonded interactions

(van der Waals, hydrogen bonding, electrostatic etc.). The constant w is the user input

weight for the X-ray term. This constant is suggested by the shell program CHECK after

performing a molecular dynamics routine.

In the following equation

Echem =I Kb (x- Xo) 2 +IKe (8-80 )

2 +I ~cos (n~ +d)+ I.Ko(ro-ro0 ) 2 +I (ar"12 + br"6 + cr" 1

)

where b, e, <!> and co are the actual bond length, bond angle, torsion angle and chiral

volume, X0 , 90 , <j>0 , and C00 are equilibrium constants, Kb, Ke, ~ and Km are energy

constants, n is the periodicity, d is the phase shift, r is the distance between two non­

bonded atoms and a, b and c are constants, (Engh and Huber, 1991). Parameters are

used for the empirical energy Eehem· The CHARMM (Brooks eta!., 1983) force field is

used here.

The Exray term is defined as:

Exray = L (lfobs(h,k,l)- kFeaie(h,k,l)l)2

Where Fobs (h, k, I) and Fealc (h, k, I) are the observed and calculated structure factors

respectively, and k is the scale factor. It is advisable to run the refinement protocol with

different weights for the X-ray term and use the best results for further analysis.

2.7.4.1.3 Simulated annealing

In this routine, the energy of the target function in the solid state to be minimised is

increased by heating it and thus randomising it in the liquid phase, followed by slowly

cooling through lowering the temperature of the system (BrUnger, 1988, 1991; BrUnger et

a!., 1989, 1990). The parameter 'temperature' used does not have any physical

significance and is correlated to the likelihood of overcoming the energy barriers. The

typical user-input values of 'T' range between 1000-3000°. VERLET minimiser (Verlet,

1967) is used fort seconds with the temperature 'T' falling by 8T (typically 25°) in a time

interval 8t. The time frame is normally of the order of femto to pico seconds (typically

2.0-3.0 picoseconds). The output coordinates obtained from the simulated annealing

refinement is further subjected to a few cycles of positional and B-factor refinements.

2.7.4.2 Fourier maps and map interpretation

After every round of refinement the model was inspected and manual adjustments

to it were made using 2Fo- Fe and F0 - Fe maps. The maps were usually contoured at 1.0 cr

49

Cha ter 2

and 2.5 cr respectively, where cr refers to the r.m.s. deviation (root mean square) in the

mean density in electrons/ A3 in the maps.

2.7.4.2.1 Omit maps

Omit maps are used to remove systematic errors arising out of model bias due

to the initial model used in the structure solution, and I or subsequent refinement. This

is done by refining the molecule after omitting the region of interest. A subsequently

calculated map is largely free from model bias in the omitted region. One of the ways

to do this is through the use of 'Omit-type' maps (Vijayan, 1980; Bhat and Cohen,

1984).

2.7.4.3 Geometric analysis

Using a shell program called GEOMANAL, X-PLOR analyses the deviations in

bond lengths and bond angles, short contacts between symmetry related atoms etc. The

program also lists the energies that deviate from weights used for the refinement (Brooks

et al., 1983; Engh and Huber, 1991). Furthermore, X-PLOR has options to calculate B­

factor; Luzzati (Luzzati, 1952) plots etc.

2.7.4.3.1 PROCHECK

This program (Laskowski et al., 1993), checks the stereochemical quality of

protein structures. It forms a part of the CCP4 suite of programs (CCP4, SERC Daresbury

laboratory, 1994). The output consists of a number of 'postscript' files and comprehensive

residue-by-residue listing of the parameters. It highlights the regions of the model that

may need further investigation. It compares and assesses the quality of the model vis-a-vis

other structures at comparable resolutions. It also suggests corrections in the atom

numbering in line with the guidelines given by the IUPAC-IUB Commission on

Biochemical Nomenclature, 1970. PROCHECK was used to assess the quality of the

model after every round of refinement.

2.7.4.3.2 Hydrogen bonds

Hydrogen bonds were analyzed using the program CONTACT in the CCP4

package. Interactions between the protein atoms are considered as hydrogen bonds if the

distance between the donor and the acceptor is less than 3.6 A and if the following angle

criterion is satisfied: In the case of hydrogen bonds where the nitrogen atom is the donor,

the N-H ... O angle should be greater than 120°. When an oxygen atom is the donor, a cut­

off value of 90° is used. When water oxygens are involved, only a distance cut-off of 3.6

A has been used.

50

Cha ter 2

2. 7.4.3.3 Superposition of structures

The analysis presented in the thesis used superposition programs frequently.

Structures were superposed mainly usmg PROFIT (Martin, A. C. R.,

http://www.bioinf.org.uk!software/profit) though in a few instances the similar option in

Insightll (Accelrys Inc., San Diego, CA) was also used.

2.8 In silico ligand docking and analysis

In silica screening methods support the decision-making process in drug discovery

by the evaluation of large virtual libraries I databases, which further helps in zeroing in on

a smaller number of potential hits. Automated docking procedures coupled with

biochemical assays have been successfully applied to database screening, de novo design

and the analysis of binding modes of individual molecules.

Docking programs used nowadays are designed to carry out both 'docking' as well

as 'scoring' tasks. The distinction between docking and scoring defines also the two major

technical challenges faced by docking programs to predict the binding mode of a molecule

correctly (herewith also referred to as 'pose prediction', where 'pose' refers to the

orientation and conformation of a molecule at the receptor binding site) (Verkhivker eta!.,

2000) and to predict the binding affinity of compounds (or to produce a relative rank­

ordering for a number of compounds) in a reliable manner (Stahl and Rarey, 2001).

Basically, ligand-docking studies can be carried out using three distinct algorithms:

1. Lamarckian Genetic Algorithm (LGA)

2. Genetic Algorithm (GA)

3. Simulated Annealing (SA)

LGA is a more robust algorithm and generally provides better-docked results than

the other two. It is a hybrid search technique that implements an adaptive global optimizer

with local search. The local search method is based on the optimization algorithm of Solis

and Wets (SW), which has the advantage that it does not require gradient information in

order to proceed.

Genetic Algorithm (GA) uses ideas of natural genetics and biological evolution. In this

case of molecular docking, the particular arrangement of a ligand and a protein can be defined

by a set of values describing transition, orientation and conformation of the ligand with respect

to the protein. These are ligand state variables and in the GA each state variable corresponds to

a genotype whereas atomic co-ordinates correspond to the phenotype.

51

Cha ter 2

Representatives of these approaches are Hammerhead (Welch eta/., 1996), DOCK

(Ewing and Kuntz, 1997) and FlexX (Rarey et a/., 1996). In other approaches, such as

Autodock (Morris eta/., 1998), GOLD (Jones eta/., 1997), ICM-Dock (Totrov and Abagyan,

1997) and QXP (McMartin and Bohacek, 1997), the ligand is treated in its entirety.

Due to the well-known fact that amino acid sequence homology at a given level

leads to similar 3D structure of proteins, several databases are interrelating the databases

of sequences and structures. However, the term homology, a fundamental concept in

bioinformatics, is often used incorrectly. Sequences are homologous if they are related by

divergence from a common ancestor (as a first consequence, the search for homology in

the sequence database is used to determine indications for function of proteins).

Conversely, analogy relates to the acquisition of common structural or functional features

via convergent evolution from unrelated ancestors. Homology is not a measure of

similarity, but rather an absolute statement that sequences have a divergent rather than a

convergent relationship. Among homologous sequences we can distinguish orthologs

(proteins having the same function in different species) and paralogs (proteins performing

different but related functions within one organism).

The model building of a target sequence based on the comparison with the data

extracted from homologous sequences with known structures (parents or templates) is

termed comparative modelling. This can also be extended to homologs with low

percentage of identity. Several software tools I Servers are available for homology

modeling, e.g. CASP, Swiss-model server, Modeller, Wloop, Homology (Insightii),

UCLA-DOE etc to name a few.

All current comparative modelling methods consist of four sequential steps:

1. fold assignment and template selection;

2. template-target alignment;

3. model building; and

4. model evaluation.

2.8.1 Software

In order to carry out docking calculations on NAD+ ligases from M tuberculosis

(Present study) and Enterococcus faecalis and ATP ligases from bacteriophage T4 and DNA

ligase I from Homo sapiens, we used Autodock 3.0.5 as well as GOLD v 2.2 to analyse and

cross validate the ranking of the ligands. Model for T41igase was made using Modeller 6.5.2

(Marti-Renom eta/., 2000). Brief descriptions of these programs are as follows:

52

Cha ter 2

2.8.1.1 Autodock 3.0.5

The program Autodock (Morris et al., 1998) was developed at The Scripps Research

Institute and provides an automated procedure for predicting the interaction of ligands with

biomacromolecular targets using LGA. Docking procedure can be divided into 4 steps:

1. Preparing Macromolecule

2. Preparing Ligand

3. Generating Grid Maps

4. Running Autodock

Step 1: Macromolecule preparation involves removal of all non-protein atoms and

addition of all I polar hydrogens. This is followed by addition of Kollman united atom

charges and solvation parameters defined for each residue in Addsol.

Step 2: Ligand preparation involves addition of all hydrogens followed by

Gasteiger charge calculation. Non-polar hydrogens and their corresponding charges are

merged with the parent heavy atom. Rotatable bonds in the ligand are identified with

Autotors and appropriate records are written to an output file.

Step 3: Autodock requires pre-calculation of grid maps one for each atom type

present in the ligand being docked. This helps to make the docking calculations extremely

fast. These maps are calculated by AutoGrid. A grid map consists of a three dimensional

lattice of regularly spaced points, surrounding and centered on some region of interest.

Figure 2.1 (Autodock manual) illustrates the main features of a grid map:

gnd spacing I A -...:

grid poin1

11,11

prubc alllm

11,+1

Fig. 2.1: Features of a grid map

53

Cha ter 2

The user must specify an even number of grid points in each dimension. This is

because AutoGrid adds a central point and Autodock requires an odd number of grid

points.

The probe's energy at each grid point is determined by the set of parameters

supplied for that particular atom type and is the surrimation of non-bonded cutoff radius

over the entire macromolecule. Parameters for Autogrid can be defined using mkgpf 3

script (Autodock manual).

Step 4: Docking through Autodock can be done using any one of the several

methods available. Parameters are different for each docking algorithm. These parameters

can be defined using mkdpf3 script (Autodock manual).

Autodock 3.0.5 implements a new scoring function that is based on the principles

of QSAR (Quantitative Structure-Activity Relationships).

+0 AG,,trrJJngnJruo ...

D.G lwwlng.~i>Jtllliin ...

Fig. 2.2: Binding of enzyme and inhibitor

+

{0

iQ 0

'b (0

·o

Figure 2.2 (Autodock manual) shows the thermodynamic cycle for the binding of

an enzyme 'E' and an inhibitor 'F in both the solvated phase and in vacuo. The solvent

molecules indicated by filled circles tend to be ordered around the larger molecules, but

when E and I bind, several solvent molecules are liberated and become disordered.

This is an entropic effect and is the basis of the hydrophobic effect. The solvent

ordering around E and I, both bound and unbound, is strongly influenced by the hydrogen

54

Cha ter 2

bonding between these molecules. These hydrogen bonds between solvent and E, and

solvent and I, contribute enthalpic stabilization.

According to Hess's law of heat summation, the change in free energy between

two states will be the same, no matter what the path. So, the free energy of binding in

solvent b.Gbinding, solution can be calculated by the following equation:

b.Gbinding, solution= b.Gbinding, vacuo+ b.Gsolvation (EI) - b.Gsolvation (E+I)

b.Gbinding, vacuo is calculated during docking runs.

2.8.1.2 GOLD v2.2

GOLD v2.2 (Genetic Optimization for Ligand Docking) is a program used to

predict how flexible molecules bind to proteins by using a non-deterministic sampling

method (Verdonk et al., 2003). The specific features ofthe program are:

1. A parallel genetic algorithm (GA) for protein-ligand docking, which performs a

stochastic search for preferred orientation and conformation of the ligand;

2. Full-ligand and partial protein flexibility;

3. Special energy functions that are derived, m part, from the analysis of

conformation and non-bonded contacts observed in crystal structures of small

molecules.

4. Choice of scoring functions: GoldScore, ChemScore and now User defined score.

The GOLD Scoring Function Application Programming Interface (API) allows

users to modify the GOLD scoring-function mechanism in order to:

1. Calculate and write out additional data after each docking.

2. Add extra terms to the scoring function.

3. Implement a completely new scoring function

It has an option of a number of constraints, or restraints, to allow greater control

over the output solutions.

In contrast to the majority of docking algorithms operating directly on real-value

variables, GOLD employs a bit-string (chromosome) representation of conformations and

possible hydrogen-bonding interactions between the ligand and the receptor. The GA

provides a search paradigm that enables the identification of good (though not necessarily

optimal) solutions. Typically, several docking runs are required to identify most high

affinity binding modes. One advantage of this evolutionary sampling technique is its

ability to find solutions in a highly complex search space, as given by flexible-ligand and

protein-surface atoms.

55

Cha ter 2

2.8.1.3 MODELLER 6v2

MODELLER is widely used for homology or comparative modeling of protein

three-dimensional structures (Marti-Renom et al., 2000). The user provides an alignment

of a sequence to be modeled with known related structures and MODELLER

automatically calculates a model containining all non-hydrogen atoms. MODELLER

implements comparative protein structure modeling by satisfaction of spatial restraints

(S~li and Blundell, 1993; Fiser et a!., 2000), and can perform many additional tasks,

including de novo modeling of loops in protein structures, optimization of various models

of protein structure with respect to a flexibly defined objective function, multiple

alignment of protein sequences and/or structures, clustering, searching of sequence

databases, comparison of protein structures, etc. MODELLER is written in Fortran-90 and

is meant to run on a UNIX system. In obtaining a 3D model, Modeller tries to optimize the

molecular probability density function with the variable target function procedure in

cartesian space using methods of conjugate gradient and molecular dynamics with

simulated annealing.

2.8.2 Docking Procedure

Docking experiments were carried out with NAD+ as well as ATP dependent

ligases for comparative studies in search ofNAD+ -dependent ligase specific inhibitors.

2.8.2.1 Ligand preparation

The ligands database form part of an in-house collection of about 15,000

compounds whose synthesis expertise is also available. All the ligands were sketched and

converted to 3D and optimised in Builder module of Insightii. Optimized ligands were

converted into respective pdbs.

2.8.2.2 Target preparation

Following DNA ligases were selected for docking studies.

MtuLigANAD - This model of MtuLigA3 crystal structure (PDB: 1ZAU) was

generated by superposing the individual sub-domains in the MtuLigA crystal structure

onto the EfaLigA-NAD+ co-crystal structure (PDB: lTAE) and adjusting the

conformations of interacting residues to match those in the EfaLigA complex.

E. faecalis ligase - We took another NAD+ -dependent ligase from

Enterococcus faecalis crystal structure (PDB: 1 TAE) in which NAD+ binding pocket

has been defined.

56

Cha ter 2

To compare results of docked ligands with NAD+ ligases, we took well-defined

ATP ligases from two different sources, viral (T4) and eukaryotic (Human).

T4 DNA ligase and Human ligase I - T4 ligase has been extensively studied

biochemically and is a prototype ATP dependent ligase while crystal structure of human

ATP ligase I (PDB: 1X9N) has been recently solved in which the binding mode of DNA

and subsequent changes in the ligase action has been described. More so Mycobacterium

tuberculosis H37Rv is a major human pathogen.

Model for T4 ligase was generated by MODELLER 6v2 using T7 DNA ligase

(PDB: 1AOI) as a template. Model was refined by subjecting it to few rounds of

minimization and dynamics using DISCOVER_3 module oflnsightii and stereo-chemical

quality of the model was verified using PROCHECK (Section 2.7.4.3.1) and ERRAT

(Colovos and Yeates, 1993).

2.8.2.3 Screening protocol (Autodock 3.0.5)

We used a PERL/Python based script to add the capability of automated docking

against a ligand database to Autodock. A computer cluster consisting of SGI ORIGIN350

servers and SGI OCTANES were used for the computation and analysis of docked

complexes.

Prior to docking studies, the ligands translation, rotation and internal torsions were

assigned. Crystallographic waters and heteroatoms were removed from target molecules.

Polar hydrogens were added. Kollman charges were assigned to all atoms. The active site

centered on Lys123 for MtuLigANAD; Lys159 for T4 ligase, Lys 120 for EfaLigA (PDB:

1TAE) and Lys568 for human-ligase I (PDB: 1X9N) were chosen for the docking studies.

80 X 80 X 80 3D affinity grid centered on the active site with 0.375 A spacing were

calculated respectively, for each of the following atom types C, A (aromatic C), N, 0, S,

H, F, Cl, Br and e by the Auto grid 3.

For each compound, docking parameters were as follows-

Trials of 100 dockings, population size of 150, random starting position and

conformation translation step ranges of 1.5 A, rotation step ranges 35, elitism of 1,

mutation rate of 0.02, cross-over rate of 0.8, local search rate of 0.06 and 10 million

energy evaluations. The jobs were distributed to the SGI ORIGIN350 cluster.

Final docked conformations were clustered by the use of a tolerance of 1.5 A RMSD.

57

Cha ter 2

2.8.2.4 Screening protocol (GOLD v2.2)

Gold trials were performed using the default parameters (1 X speed-up, 6/12

internal potential, no flipping of amide bonds, etc.). All docking trials for GOLD v2.2

were performed with active site radius of 10.0 A for all the target molecules. Binding site

was defined using cavity.atoms, file containing the list of all solvent accessible atoms

making-up the protein active site. All the parameters used by GOLD (e.g. hydrogen bond

energies, atom radii and polarisabilities, torsion potentials, hydrogen bond directionalities

etc.) are specified in gold.params file. Configuration file gold.conf reads parameter

settings from a previously saved configuration file and loads the parameter values into the

front end of GOLD window.

All the heteroatoms were removed from the target pdbs and all the hydrogens were

added using Insightll to all the docking templates, MtuligANAD, 1 TAE, 1X9N and modeled

T4 ligase.

Ligand input files were prepared and optimized by Builder module of Insightll.

Ligand pdbs were converted into Sybyl Mol2 format.

2.9 Inhibitory analysis of selected compounds

Based on the docking scores, selected compounds from the top 10 % docked

complexes (as observed from the Autodock scoring and GOLD fitness scores) were taken

up further for in vitro and in vivo ligase assays to analyze the specificity of ligands against

NAD+ -dependent ligases.

2.9.1 In vitro assays

The compounds were assayed against MtuLigA, T4 DNA ligase and human DNA

ligase I for their inhibitory activity. We used the same substrate and assay procedure as

described in section 2.5.1 for inhibitory analysis. The substrate was prepared as described

in section 2.5 .1. Exposures of the gel to x-ray films were standardized as per the counts of

the y-32P labeled substrate. Films were developed as per the standard protocol (Sambrook,

et a!., 1989). All the reactions were set up in 15 JJl reaction mix containing respective

buffers and enzymes. In each case, reactions were quenched with formamide and EDT A.

The reaction products were resolved electrophoretically by a 15 % polyacrylamide gel

containing 8 M urea in 1 X TBE. Autoradiograms of the gels were developed and extents

ofligation were measured by scanning the gel using Image Master 1D Elite software.

58

Cha ter 2

All the compounds were dissolved in 100 % Me2SO. The compound solutions

comprised one-tenth volume of the ligation reaction mixture; thus 10 % Me2SO was

included in all the control reactions.

The MtuLigA full-length protein was purified according to standard procedures

(Section 2.4.2). The assays were performed with 2 ng of the purified protein. Reaction

mixtures (15 )ll) containing 50 mM Tris-HCl, pH 8.0, 5 mM dithiothreitol (DTT), 10 mM

MgClz, 10% Me2SO, 2 )lM NAD+, 2 pmol of 32P-labeled nicked duplex DNA substrate

and different amount of compounds were incubated for 1 h at 25 °C.

The activity assay was performed in the same way for T4 ligase with 0.05 units of

enzyme (Amersham), 2 pmol of labeled template, and 66 )lM ATP in 66 mM Tris-HCl,

pH 7.6, 6.6 mM MgClz, and 10 mM DTT and 10% Me2SO.

The Human DNA ligase I expression plasmid was transformed into E. coli BL21

(DE3) and purified as described previously (Mackenney et al., 1997). Purified protein was

concentrated up to 2 mg/ml. 2)lg protein was used for assay in 50 mM Tris-HCl, pH 8.0,

10 mM MgClz, 5 mM DTT, 50 Jlg/ml BSA and 1 mM ATP as described above.

The IC5o values were determined by plotting the relative ligation activity versus

inhibitor concentration and fitting to the equation:

ViNo = ICso I (ICso +[I])

Using GraphPad Prism®. Vo and Vi represent rates of ligation in the absence and

presence of inhibitor respectively and [I] refer to the inhibitor concentration.

2.9.2 Determination of mode of inhibition

These assays were also performed with 2 ng of the purified protein. Reaction mixtures

(15 )ll) containing 50 mM Tris-HCl, pH 8.0, 5 mM dithiothreitol (DTT), 10 mM MgClz, 10%

MezSO, 0- 50 JlM NAD+, 0.85 JlM of 32P-labeled nicked duplex DNA substrate and different

amount of compounds ranging from 2 JlM up to 20 JlM were incubated for 1 h at 25 °C. In

each case, reactions were quenched with formamide and EDT A. The reaction products were

resolved electrophoretically by a .15 % polyacrylamide gel containing 8 M urea in 1 X TBE.

Autoradiograms of the gels were developed and extents of ligation were measured by

scanning the gel using Image Master 1D Elite software.

Michaelis-Menten kinetics graphs were plotted between ligation rate and

corresponding NAD+ concentration. Corresponding Lineweaver-Burk kinetics were

plotted against IN and 1/NAD+ to determine the mode of inhibition as well as apparent Km

59

Cha ter 2

values at corresponding inhibitor concentration. To determine Ki. linear regression of

apparent Km values were plotted against corresponding compound concentration. All the

kinetic analysis was done using GraphPad prism® using Michaelis-Menten kinetics.

2.9.3 DNA-inhibitor interaction

In this assay DNA intercalating properties of the inhibitors were measured by the

ability to compete with ethidium bromide for DNA binding. Detection of ethidium

bromide displacement from DNA, if any, is based on the strong loss in fluorescence that

should occur upon its detachment from DNA (Le-Pecq and Paoletti, et al., 1967). The

assay mixture contained in a volume of 100 J.ll, 5 J.lg of calf thymus DNA, 5 J.!M ethidium

bromide, 25 mM Tris-HCl, pH 8.0, 50 mM NaCI, and 1 mM EDTA. Upon addition of the

compounds in increasing concentrations, ethidium bromide fluorescence was immediately

detected at an excitation wavelength of 485 nm and an emission wavelength of 612 nm.

Gel shift assay was performed using 100 ng of plasmid DNA (pUC18, Stratagene),

incubated with increasing inhibitor concentrations in TE buffer for 1 h at room

temperature. Subsequently, the DNA was analyzed in a 1 % agarose gel.

2.9.4 Antibacterial activity

Selected compounds from in vitro assays were further verified for their in vivo I

antibacterial activity.

2.9.4.1 Bacterial strains and plasmids

Two different well-defined strains, temperature sensitive ligase deficient mutant E.

coli GR501 (Lavesa-Curto et al., 2004); Salmonella typhimurium LT2 wild type and its

DNA ligase minus (null) derivative TT15151 which had been "rescued" with a plasmid

(pBR313/598/8/1 b) encoding the gene for T4 DNA ligase (Wilson and Murray, 1979),

were utilized for antibacterial activity of the selected compounds. In order to compare and

determine the inhibitory potency or sensitivity of selected compounds against NAD+ and

ATP ligases, we chose pTrc99A (Amann et al., 1988) based system of MtuLigA and T4

A TP ligase in E. coli GR50 1. Brief descriptions of these are as follows.

2.9.4.1.1 E. coli GR501

E. coli GR501 (Hfr LAM ligA251 relAJ spoTJ thi-1 ptsT) is a temperature sensitive

(ts) ligase (ligA251) deficient mutant of E. coli. Its 'ts' phenotype was due to a mutation in

ligA251, resulting in a reduction in DNA replication at high temperatures (Dermody et al.,

60

Cha ter 2

1979). This conclusion has been reinforced by the observation that it can be complemented

by DNA ligases that participate in replication in other systems e.g. E. coli, human DNA

ligase I and bacteriophage T4 ligase. Thus, E. coli GR501 has been particularly useful for

the analysis of DNA ligase function in bacteria. It is shown (Lavesa-Curto et al., 2004) that

the ligA251 mutation in E. coli GR501 strain is a cytosine to thymine transition at base 43,

which results in a substitution ofleucine by phenylalanine at residue 15. The protein product

of this gene (LigA251) is accumulated to a similar level at permissive ( <30°C) and non­

permissive temperatures (> 3 7°C). However, compared to wild-type LigA, at 20°C purified

LigA251 has 20-fold lower ligation activity in vitro, and its activity is reduced further at

42°C, resulting in 60-fold lower ligation activity than wild-type LigA (Lavesa-Curto et al.,

2004). It is proposed that the mutation in LigA251 affects the structure of the N-terminal

region of LigA. The resulting decrease in DNA ligase activity at the non-permissive

temperature is likely to occur as the result of a conformational change that reduces the rate

of adenylation of the ligase. E. coli GR50 1 ligA ts mutant was a kind gift of Dr. Richard

Bowater (University of East Anglia, Norwich, UK).

2.9.4.1.2 Salmonella typhimurium LT2 and its DNA ligase null derivative TT15151

Deletion experiments with NAD+ -dependent DNA ligase (Park et al., 1989) of

Salmonella typhimurium L T2 have proved it to be essential for survival of this pathogenic

bacterium. In order to check if the selected compounds are broadly specific against NAD+

ligases from different sources, we chose this strain and its DNA ligase-minus (null)

derivative TT15151 (lig-2:: Mu dJ/pBR313/598/8/1b [T4 Lig+] AMPr [Wilson and

Murray, 1979]) which had been "rescued" with a plasmid (pBR313/598/8/1 b) encoding

the T4 DNA ligase gene. Salmonella typhimurium LT2 wild type strain and its DNA

ligase-minus (null) derivative TT15151 containing T4 Lig+ plasmid pBR313/598/8/lb

were kindly provided by Dr. J. R. Roth (University of Utah, Utah).

2.9.4.1.3 pTrc99A based system

Plasmid pTrc99A and clone pRBL (Ren et al., 1997) containing the gene for T4

ligase in pTrc99A were kindly provided by Prof. Richard Bowater (University of East

Anglia, Norwich, UK). The recombinant plasmid pRBL containing the gene forT4 DNA

ligase in pTrc99A was transformed into E. coli GR501 ligA1s mutant. In order to have the

same genetic background in E. coli GR501 ligA1s, the MtuLigA gene was PCR amplified

(Section 2.3.1) from genomic DNA using primers containing sites for Nco! and Hindlll

(Section 2.2), cloned into Nco! and Hindlll-digested pTrc99A and transformed into E. coli

GR501 ligA1s mutant. In growth experiments, the strains expressing MtuLigA or T4 DNA

61

Cha ter 2

ligases were compared with a control GR501 strain carrying empty pTrc99A without any

gene insertions at 37°C. As reported earlier (Lavesa-Curto et al., 2004) and reproduced by

us, the temperature sensitive E. coli GR501 ligAts strain grows well at 30°C while growth

is strongly delayed at 37°C. Complementation with pTrc99A based system of either

MtuLigA or T4 ligase restores the growth of the mutant strain at higher temperatures.

Growth conditions for E. coli GR501 ligAts (with and without pTrc99A based

system of MtuLigA and T4 ligase) and S. typhimurim strains were optimized at different

temperature. LB media was used for E. coli GR501ts based cultures whileS. typhimurium

strains were grown in nutrient broth.

2.9.4.2 Determination of minimum inhibitory concentration (MIC)

MIC values of the inhibitors were determined for MtuLigA and T4 ATP ligase in

E. coli GR50 1 ligAts mutant along with S. typhimurium LT2 and its DNA ligase minus

(null) mutant derivative which had been rescued with a plasmid (pBR313/5981811 b)

encoding the gene for T4 ATP -dependent DNA ligase, in order to check the specificity of

compounds for NAD+ -dependent ligases from other sources as well. Antimicrobial

activity was monitored in microtiter plates using microdilution assay technique in a

volume of200 ).ll. Approximately 105 CFU I ml in case of E. coli LigAts mutant, 106 CFU

I ml in case of S.typhimurium LT2 and its mutant LigA- strain, rescued with T4 ATP DNA

ligase, were incubated with different compound concentrations under ambient conditions

for 20 h and MIC were determined on the basis of presence of any visible growth (Brotz­

Oesterhelt et al., 2003). The media contained 20 ).lg/ml polymyxin B nonapeptide to

facilitate passage of the inhibitors across the outer membrane.

2.9.4.3 Growth inhibition studies

To investigate the specificity and sensitivity <?f the compounds towards NAD+ -

dependent ligase, exponentially growing cultures of S. typhimurium L T2 and its DNA

ligase minus (null) mutant derivative TT15151 containing T4 Lig + plasmid

pBR313/598/8/1 bin nutrient broth were treated at an A6oo of 0.4 to increasing compound

concentrations. The effect on growth and viability of both the strains was compared by

monitoring the A6oo and the number of CFU for 4-5 h after addition of the compound.

Serially diluted culture aliquots of both the strains in phosphate buffered saline

(Annexure) were plated on nutrient agar and visible colonies were counted after

incubating the plates for 15 h at 3 7°C. Nutrient agar plates contained ampicillin at a final

concentration of 100 J.lg/ml in case of S. typhimurium mutant strain TT 15151.

62