chelonian diagnostics, pathology and treatment
TRANSCRIPT
![Page 1: Chelonian diagnostics, pathology and treatment](https://reader030.vdocuments.net/reader030/viewer/2022032422/55a97dae1a28ab94668b46af/html5/thumbnails/1.jpg)
Chelonian
Diagnostics,
Pathology, and
Treatment
Matt Allender, DVM, MS, PhD, Diplomate ACZM
Ranavirus Symposium
July 2013
@Turtle_Doc
#RV13
![Page 2: Chelonian diagnostics, pathology and treatment](https://reader030.vdocuments.net/reader030/viewer/2022032422/55a97dae1a28ab94668b46af/html5/thumbnails/2.jpg)
Ranavirus epidemiology Disease events are often clustered in local epizootics
Some occur on annual basis
Several sources report a significant threat to
biodiversity
Population density mortality in salamander studies
Environmental factors change prevalence
Restoration efforts
![Page 3: Chelonian diagnostics, pathology and treatment](https://reader030.vdocuments.net/reader030/viewer/2022032422/55a97dae1a28ab94668b46af/html5/thumbnails/3.jpg)
![Page 4: Chelonian diagnostics, pathology and treatment](https://reader030.vdocuments.net/reader030/viewer/2022032422/55a97dae1a28ab94668b46af/html5/thumbnails/4.jpg)
Quantitative PCR TaqMan primer-probes were designed using Primer
Express targeting a portion of the MCP that was
contained within the 531 bp product
Forward: AACGCCGACCGAAAACTG
Reverse: GCTGCCAAGATGTCGGGTAA
Probe: CCGGCTTTCGGGC
Resultant segment was a 54 bp product
![Page 5: Chelonian diagnostics, pathology and treatment](https://reader030.vdocuments.net/reader030/viewer/2022032422/55a97dae1a28ab94668b46af/html5/thumbnails/5.jpg)
Conventional PCR
Level of Detection:
529,000 viral
copies
52 viral copies
Quantitative PCR
![Page 6: Chelonian diagnostics, pathology and treatment](https://reader030.vdocuments.net/reader030/viewer/2022032422/55a97dae1a28ab94668b46af/html5/thumbnails/6.jpg)
![Page 7: Chelonian diagnostics, pathology and treatment](https://reader030.vdocuments.net/reader030/viewer/2022032422/55a97dae1a28ab94668b46af/html5/thumbnails/7.jpg)
Epidemiologic evidenceCategory Institution FV3 positive FV3
negative
Prevalence 95% CI
Free-living* OR 1 308 0.3% 0 – 1.8 %
Rehabilitation* 7 217 3.13% 1.5 – 6.3%
UT 3 35 7.9% 2.7 – 20.1 %
WCV 2 120 1.6% 0.4 – 5.9 %
NCSU 0 46 0.00% 0 – 7.7 %
AWC 2 14 14.3% 4.0 – 39.9 %
UGA 0 9 0.00% 0 – 29.9 %
Total 8 525 1.5% 0.8 – 2.9%
* Significant difference between prevalence in free-living population and
rehabilitation populations, p=0.01, one-tailed
![Page 8: Chelonian diagnostics, pathology and treatment](https://reader030.vdocuments.net/reader030/viewer/2022032422/55a97dae1a28ab94668b46af/html5/thumbnails/8.jpg)
Results
Variable FV3 positive FV3 negative Prevalence 95% CI
Female 3 168 1.8 % 0.6 – 5.0 %
Male 0 218 0.00% 0 – 1.7 %
Adult 2 398 0.5 % 0.1 – 1.8 %
Juvenile 2 55 3.5 % 0.9 – 11.9 %
Sex: p=0.157, observed power = 0.73
Age: p=0.081, observed power = 0.91
![Page 9: Chelonian diagnostics, pathology and treatment](https://reader030.vdocuments.net/reader030/viewer/2022032422/55a97dae1a28ab94668b46af/html5/thumbnails/9.jpg)
Housing
Environmental chamber within Division of Animal
Resources at UI-CVM
15’9” x 12”
Temperature was acclimated for 1 week prior to
beginning study
Recorded daily and maintained +/- 1°C throughout
duration of study
Adult female red-eared sliders maintained in 45 or 50
gallon plastic enclosures with ~20 gallons freshwater
and basking spot
![Page 10: Chelonian diagnostics, pathology and treatment](https://reader030.vdocuments.net/reader030/viewer/2022032422/55a97dae1a28ab94668b46af/html5/thumbnails/10.jpg)
Virus Ranavirus isolated from infected eastern box turtle
100% sequence homology to MCP of FV3
Grown to confluence in TH-1
Divided into aliquots of 5 x 105 TCID50
Quantitative PCR performed on virus
Four animal in each temperature group were administered 1 aliquot (0.67 ml) in the right forelimb muscle
Uninfected controls administered same volume crude cell lysate
![Page 11: Chelonian diagnostics, pathology and treatment](https://reader030.vdocuments.net/reader030/viewer/2022032422/55a97dae1a28ab94668b46af/html5/thumbnails/11.jpg)
Sample collection
Weight, whole blood, oral and cloacal swabs collected twice prior to inoculation to confirm negative status, then twice weekly throughout duration of study PCV, TS, WBC, differential performed each sample
Clinical signs were recorded daily
Animals were euthanized when clinical signs were severe (as described in IACUC) or at 30 days post-inoculation Control animal was euthanized at same time as inoculated
animal
Gross necropsy performed within 48 hours
Histopathology of 8 tissues
qPCR of necropsy tissues
![Page 12: Chelonian diagnostics, pathology and treatment](https://reader030.vdocuments.net/reader030/viewer/2022032422/55a97dae1a28ab94668b46af/html5/thumbnails/12.jpg)
Results Survival
22°C – all inoculated turtles
were euthanized due to
severity of signs
28°C – only 2 turtles were
euthanized due to clinical
signs
One uninfected control
died of sepsis
Median survival times
22°C = 24 days (14 -30)
28°C = 30 days (17-30)
22C28C
![Page 13: Chelonian diagnostics, pathology and treatment](https://reader030.vdocuments.net/reader030/viewer/2022032422/55a97dae1a28ab94668b46af/html5/thumbnails/13.jpg)
Results
*Significant increase over time (F=11.1, p=0.045) Significant difference between control and inoculated turtles
(p=0.035)
#Significant increase over time (F=7.13, p=0.026)
Time 22°C
Weight
28°C
Weight
Pre-inoculation 1693.5625* 2063.1250#
Initial post-
inoculation
1692.50* 2082.50#
Terminal 1802.50* 2159.50#
![Page 14: Chelonian diagnostics, pathology and treatment](https://reader030.vdocuments.net/reader030/viewer/2022032422/55a97dae1a28ab94668b46af/html5/thumbnails/14.jpg)
![Page 15: Chelonian diagnostics, pathology and treatment](https://reader030.vdocuments.net/reader030/viewer/2022032422/55a97dae1a28ab94668b46af/html5/thumbnails/15.jpg)
![Page 16: Chelonian diagnostics, pathology and treatment](https://reader030.vdocuments.net/reader030/viewer/2022032422/55a97dae1a28ab94668b46af/html5/thumbnails/16.jpg)
![Page 17: Chelonian diagnostics, pathology and treatment](https://reader030.vdocuments.net/reader030/viewer/2022032422/55a97dae1a28ab94668b46af/html5/thumbnails/17.jpg)
Results
Tissue Parameter 22C
Viral Copies
28C
Viral Copies
Tongue Mean/median* 1.25 x 109* 5.94 x 106*
Skeletal
Muscle
Mean/median* 3.7 x 1010* 3.64 x 108*
Lung Mean/median* 6.29 x 109* 5.01 x 109*
Heart# Mean/median* 2.92 x 1010 1.27 x 109*
Liver^ Mean/median* 2.15 x 109 1.70 x 107*
Spleen Mean/median* 2.23 x 1010* 5.44 x 107*
Ovary Mean/median* 8.93 x 109* 9.06 x 106*
Kidney Mean/median* 3.46 x 1010* 2.54 x 108*
# Significant difference between environmental temperatures, p=0.012
^ Significant difference between environmental temperatures, p=0.011
![Page 18: Chelonian diagnostics, pathology and treatment](https://reader030.vdocuments.net/reader030/viewer/2022032422/55a97dae1a28ab94668b46af/html5/thumbnails/18.jpg)
Results
![Page 19: Chelonian diagnostics, pathology and treatment](https://reader030.vdocuments.net/reader030/viewer/2022032422/55a97dae1a28ab94668b46af/html5/thumbnails/19.jpg)
Temperature evidence
Mortality
22°C
Significant association between inoculation and disease
(p=0.014)
28°C
No significant association between inoculation and
disease (p=0.214)
Non-significant mortality was seen at lower
temperature (100%) than higher temperature (50%)
Power = 0.34
![Page 20: Chelonian diagnostics, pathology and treatment](https://reader030.vdocuments.net/reader030/viewer/2022032422/55a97dae1a28ab94668b46af/html5/thumbnails/20.jpg)
Temperature evidence qPCR
Viral copies quickly went from undetectable to millions/billions of copies
All positive turtles had between 2 and 4 positive samples prior to death
Highest in whole blood, lowest in cloacal swab (non-significant) at 22°C
Specificity and Sensitivity
Whole blood
100% specific and 100% sensitive
Oral swab and cloacal swab
100% specific and 83% sensitive
![Page 21: Chelonian diagnostics, pathology and treatment](https://reader030.vdocuments.net/reader030/viewer/2022032422/55a97dae1a28ab94668b46af/html5/thumbnails/21.jpg)
![Page 22: Chelonian diagnostics, pathology and treatment](https://reader030.vdocuments.net/reader030/viewer/2022032422/55a97dae1a28ab94668b46af/html5/thumbnails/22.jpg)
Results
![Page 23: Chelonian diagnostics, pathology and treatment](https://reader030.vdocuments.net/reader030/viewer/2022032422/55a97dae1a28ab94668b46af/html5/thumbnails/23.jpg)
![Page 24: Chelonian diagnostics, pathology and treatment](https://reader030.vdocuments.net/reader030/viewer/2022032422/55a97dae1a28ab94668b46af/html5/thumbnails/24.jpg)
![Page 25: Chelonian diagnostics, pathology and treatment](https://reader030.vdocuments.net/reader030/viewer/2022032422/55a97dae1a28ab94668b46af/html5/thumbnails/25.jpg)
Conclusions Prevalence in surveys of free-ranging populations are
low
Are chelonians a spill-over host?
Natural history characteristics make it difficult to identify
mortality events?
Are chelonians a reservoir host and fail to develop signs?
Are mechanisms of transmission different in chelonians
which provide natural protection?
![Page 26: Chelonian diagnostics, pathology and treatment](https://reader030.vdocuments.net/reader030/viewer/2022032422/55a97dae1a28ab94668b46af/html5/thumbnails/26.jpg)
Conclusions Environmental temperature leads to differences in
mortality in red-eared sliders
Both host and pathogen factors that may lead to
protection at higher temperatures
May play a role in persistence or transmission
Do other species have similar response to changes in
temperature?
Opportunity for therapeutic intervention
![Page 27: Chelonian diagnostics, pathology and treatment](https://reader030.vdocuments.net/reader030/viewer/2022032422/55a97dae1a28ab94668b46af/html5/thumbnails/27.jpg)
Funding Sources Morris Animal Foundation
qPCR development and prevalence study
CRESO
Prevalence study
Fluker’s Farms/Cox Pharmacology lab
PK study
![Page 28: Chelonian diagnostics, pathology and treatment](https://reader030.vdocuments.net/reader030/viewer/2022032422/55a97dae1a28ab94668b46af/html5/thumbnails/28.jpg)
Questions?