cloning and characterization of goose interleukin-17a cdna
TRANSCRIPT
Accepted Manuscript
Cloning and characterization of goose interleukin-17A cDNA
Shuangshi Wei, Xiaomei Liu, Mingchun Gao, Wenlong Zhang, Yunhui Zhu,Bo Ma, Junwei Wang
PII: S0034-5288(13)00325-1DOI: http://dx.doi.org/10.1016/j.rvsc.2013.10.008Reference: YRVSC 2555
To appear in: Research in Veterinary Science
Received Date: 6 March 2013Accepted Date: 20 October 2013
Please cite this article as: Wei, S., Liu, X., Gao, M., Zhang, W., Zhu, Y., Ma, B., Wang, J., Cloning andcharacterization of goose interleukin-17A cDNA, Research in Veterinary Science (2013), doi: http://dx.doi.org/10.1016/j.rvsc.2013.10.008
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customerswe are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, andreview of the resulting proof before it is published in its final form. Please note that during the production processerrors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
1
Cloning and characterization of goose interleukin-17A cDNA 1
Shuangshi Wei1, 2
, Xiaomei Liu1, 2
, Mingchun Gao2, Wenlong Zhang
2, Yunhui Zhu
3, Bo Ma
2*, 2
Junwei Wang2* 3
(2 College of Veterinary Medicine, Northeast Agricultural University, Harbin 150030, PR China 4
3 School of Life Science, Sun Yat-Sen University, Guangdong 510006, PR China) 5
1 Shuangshi Wei, Xiaomei Liu contributes equally as first authors. 6
Correspondence and phone calls about the paper should be directed to Bo Ma and Junwei Wang at 7
the following address, phone number and e-mail address： 8
Bo Ma 9
College of Veterinary Medicine 10
North-east Agricultural University 11
No. 59 Mucai Street, Harbin, Heilongjiang 150030, China 12
Tel：+86-0451-55191244 13
Fax：+86-0451-55191672 14
E-mail：[email protected] 15
16
Junwei Wang 17
College of Veterinary Medicine 18
North-east Agricultural University 19
No. 59 Mucai Street, Harbin, Heilongjiang 150030, China 20
Tel：+86-0451-55191244 21
E-mail：[email protected] 22
2
Abstract: Interleukin-17 (IL-17 or IL-17A) is a proinflammatory cytokine produced by activated 23
T cells. IL-17A plays important roles in inflammation and host defense. In this study, the cDNA of 24
the goose IL-17A (GoIL-17A) gene was cloned from thymocytes. Recombinant GoIL-17A 25
(rGoIL-17A) was expressed using a baculovirus expression system and then biologically 26
characterized. The complete open reading frame (ORF) of GoIL-17A contains 510 base pairs that 27
encode 169 amino acid residues, including a 29-amino acid signal peptide and a single potential 28
N-linked glycosylation site. This protein has a molecular weight of 18.9 kDa. The amino acid 29
sequence showed 95.9%, 84.6%, 45.0% and 38.4% similarity with the corresponding duck, 30
chicken, rat, and human IL-17A sequences, respectively. The six conserved cysteine residues were 31
also observed in GoIL-17A. A recombinant, mature form of GoIL-17A was produced and its 32
biological activities in goose embryonic fibroblasts were investigated. RT-PCR analysis revealed a 33
marked up-regulation of IL-6 and IL-8 mRNA expression in goose embryonic fibroblasts treated 34
with 1-50 μg of rGoIL-17A for 12 h. The GoIL-17A gene sequence and the biologically active 35
recombinant protein may be useful for understanding the role of IL-17A in immune regulation. 36
Keywords: goose; IL-17A; characterization; biological activity 37
38
1. Introduction 39
It has been almost two decades since the identification of interleukin (IL)-17 by Rouvier et al. 40
(1993). IL-17 was cloned from a murine cytotoxic T lymphocyte hybridoma cDNA library as 41
CTLA-8 (CTL antigen-8). Subsequently, CTLA-8 was confirmed to be a novel cytokine that binds 42
to a novel cytokine receptor; the cytokine and receptor are now referred to as IL-17 and IL-17R, 43
respectively (Yao et al., 1995a). 44
3
Classically, effector T helper cells have been classified as type 1 (Th1) or type 2 (Th2) based 45
on their cytokine expression profiles and immune regulatory functions. A third subset of 46
IL-17-producing effector T helper cells, Th17 cells, was discovered and characterized in 2005 47
(Harrington et al., 2005, Park et al., 2005). IL-17 has six family members (IL-17A to IL-17F). 48
Although IL-17A and IL-17F share the highest amino acid sequence homology, they perform 49
distinct functions; IL-17A is involved in the development of autoimmunity, inflammation, and 50
tumours, and also plays important roles in the host defenses against bacterial and fungal infections, 51
whereas IL-17F is mainly involved in mucosal host defense mechanisms. 52
IL-17 acts as a proinflammatory cytokine that can induce the release of certain chemokines, 53
cytokines, matrix metalloproteinases (MMPs) and antimicrobial peptides. The release of these 54
molecules leads to the expansion and accumulation of neutrophils during innate immune responses 55
and links innate and adaptive immunity in vivo. Furthermore, increasing evidence indicates that 56
the IL-17 and IL-17-producing cells are involved in the pathogenesis of various diseases, such as 57
allergies, autoimmune diseases, allograft rejection and even malignancy (Xu and Cao, 2010). 58
Moreover, it is becoming apparent that IL-17 plays protective roles against infectious diseases, 59
especially in the mucosa (Dubin and Kolls, 2008). A critical characteristic of IL-17 in mucosal 60
immunology is its ability to increase the production of granulocyte colony-stimulating factor 61
(G-CSF) and CXC chemokines, resulting in the recruitment of neutrophils and contributing to 62
bacterial and fungal clearance at mucosal sites. IL-17 also increases the expression of 63
antimicrobial peptides and enhances epithelial repair functions that are important for controlling 64
extracellular fungal pathogens. In the setting of vaccine-induced immunity, Th17 cells can induce 65
the production of ligands for CXCR3 and enhance the recruitment of interferon-γ-producing Th1 66
4
cells to control the replication of intracellular pathogens (Khader et al., 2009). 67
The IL-17 genes of other species, including chickens IL-17A (Min and Lillehoj, 2002) and 68
IL-17F (Kim et al., 2012), pigs (Katoh et al., 2004), cows (Riollet et al., 2006), ducks (Yoo et al., 69
2009) and horses (Tompkins et al., 2010), have been cloned previously. This is the first report of 70
the cloning of the goose IL-17A gene, its expression using a baculovirus system and the 71
determination of its biological activities in primary cultures of goose embryonic fibroblasts 72
(GEFs).The results of our experiments allow for a better understanding of the proinflammatory 73
effect of goose IL-17A and provides the basis for further studies on its potential use as a mucosal 74
vaccine adjuvant. 75
76
2. Materials and methods 77
2.1. RNA extraction and cDNA synthesis 78
Total RNA was isolated from 50 mg of goose thymus tissue using the E.Z.N.A. ® HP Total 79
RNA Isolation Kit (OMEGA Bio-Tek, Doraville, Georgia, USA). Its concentration and purity 80
were determined using a NanoDrop 2000 Spectrophotometer (Thermo Scientific, Hudson, NH, 81
USA). RNA was stored at −80C until required for cDNA synthesis. The cDNA was synthesized 82
from the total RNA isolated from goose thymus tissue using SMART (Switching Mechanism at 5’ 83
End of RNA Transcript) Reverse Transcriptase (Clontech, Palo Alto, CA, USA). 84
85
2.1.1. First-strand cDNA synthesis 86
One microliter of the First-dT20 primer (Table 1) was added to 3.5 μl (59 ng/μl) of total RNA. 87
The tube was then mixed, spun briefly and then placed at 72°C for 3 min, followed by incubation 88
5
at 42°C for 2 min. The cDNA synthesis was performed with a prepared mix of 1 μl of 89
SMARTScribe Reverse Transcriptase (Clontech, Palo Alto, CA, USA) in the presence of 2 μl of 90
5× First-Strand Buffer, 0.25 μl of DTT (100 mM), 1 μl of dNTP Mix (10 mM), 0.25 μl of RNase 91
Inhibitor (TaKaRa Bio, Otsu, Japan), 3G primer (Table 1) and deionized water to a final volume of 92
10 μl. This reaction mixture was incubated at 42°C for 1.5 h. 93
94
2.1.2. cDNA PCR amplification reaction 95
Two microliters of cDNA from the previous reaction was amplified with 1 μl of 96
PrimeSTARTM
HS DNA Polymerase (TaKaRa Bio, Otsu, Japan) in the presence of 20 μl of 5× 97
PrimeSTAR Buffer, 2 μl of dNTP Mix (2.5 mM), 1 μl each of the 5’ PCR primer and the 3’ PCR 98
primer (Table 1) and deionized water to a final volume of 100 μl. The reaction contents were then 99
mixed. The PCR was completed using a Mastercycler ep Gradient thermocycler (Eppendorf, 100
Hamburg, Germany) with the following program: 95°C for 3 min followed by 30 cycles of 98°C 101
for 30 sec, 65°C for 30 sec, and 72°C for 6 min. The dsDNA product was stored at -20°C until 102
use. 103
104
2.2 Cloning of Go-IL17A 105
GoIL-17A-specific primers (Table 1) were designed based on the sequence of chicken 106
IL-17A (GenBank ID: NM_204460.1) and were used to acquire the actual sequence of goose 107
IL-17A. Touchdown PCR was performed as follows: an initial step at 94°C for 5 min, followed by 108
30 cycles each of denaturation at 94°C for 1 min, annealing at a variable temperature (65°C to 109
50°C) for 30 sec, and extension at 72°C for 1 min. For the first cycle, the annealing temperature 110
6
was set to 65°C. For each of the 29 subsequent cycles, the annealing temperature was decreased 111
by 0.5°C. These 30 cycles were followed by 10 cycles of 94°C for 1 min, 50°C for 30 sec, and 112
72°C for 1 min. Amplified fragments were inserted into the pEASY-Blunt vector (TransGen 113
Biotech, Beijing, China). DNA sequencing was performed using the dideoxy chain termination 114
method. Sequences were initially analyzed using a BLAST search to confirm that the correct gene 115
had been cloned. The CLUSTALW (Larkin et al., 2007) program was used to align the sequences, 116
and ESPript (Gouet et al., 1999) was used to format the multiple sequence alignments in a single 117
postscript file. 118
119
2.3 Expression of GoIL-17A in E. coli and baculovirus-infected insect cells 120
To subclone the GoIL-17A cDNA without the signal peptide region, sense and antisense 121
primers were designed that included BamHI and HindIII restriction sites at the 5’-ends of the 122
primers. After digestion with BamHI and HindIII, the PCR fragment was ligated into both the 123
pET32a (Novagen) expression vector and the pFastBac HTB donor vector, which is part of the 124
baculovirus expression system (Invitrogen). 125
The pET32a expression vector containing the GoIL-17A gene was transformed into the E. 126
coli Rosetta (DE3) pLysS strain (Promega). Transformants were selected for on LB-ampicillin 127
agar plates. Log phase cultures (approximate OD600=0.6) were induced at 37°C for 4 h by adding 128
IPTG (Sigma) to a final concentration of 1 mM. The cells were harvested by centrifugation (5000 129
g for 15 min) and suspended in PBS buffer. The cells were disrupted by sonication, and the 130
insoluble material was collected by centrifugation (5000 g for 20 min). 131
The baculovirus donor vector pFastBac HTB (Invitrogen) was sequenced to confirm the 132
7
insertion of the GoIL-17A gene. The recombinant vector was then transformed into DH10BAC 133
bacterial cells (Invitrogen) for recombination of the GoIL-17A cDNA with the genetically 134
modified baculovirus genome (bacmid). Positive recombinant bacmids were transfected into Sf9 135
(Invitrogen) insect cells. All procedures were performed according to the manufacturer’s protocols 136
(Bac-to-Bac, Invitrogen). The recombinant baculovirus was submitted to four rounds of 137
amplification (72 h each) by infecting Sf9 monolayers to generate a high titer of recombinant virus. 138
The virus stocks were protected from light at +4°C or -80°C. Protein expression was analyzed by 139
12% SDS-PAGE. 140
141
2.4 Purification and renaturation 142
The prokaryotic rGoIL-17A protein was dissolved in 2 ml of denaturing buffer (100 mM 143
NaH2PO4, 10 mM Tris-Cl, 8 M urea, 10 mM imidazole, pH 8.0), sonicated for 15 min in an ice 144
bath, and then centrifuged at 5000 g for 10 min. The supernatant was loaded onto a Ni-NTA 145
agarose (QIAGEN) column that had been equilibrated with denaturing buffer, and the column 146
contents were mixed gently by shaking for 60 min at room temperature. The column was washed 147
twice with 4 ml of wash buffer (100 mM NaH2PO4, 10 mM Tris-Cl, 8 M urea, 20 mM imidazole 148
pH 8.0), and the protein was eluted using a 4 ml gradient of 50-250 mM imidazole in the same 149
buffer. The collected fractions were analyzed by SDS-PAGE. The concentration of prokaryotic 150
rGoIL-17A was measured using a BCA Protein Assay Kit (Beyotime, Jiangsu, China). 151
Recombinant baculovirus-expressed GoIL-17A was purified as prokaryotic rGoIL-17A. 152
Renaturation of the denatured eukaryotic rGoIL-17A was performed using urea gradient 153
size-exclusion chromatography according to Gu et al., (2001) with some modifications. A 154
8
pre-packed Superdex G25 column connected to an N3000 chromatographic workstation (Zhejiang 155
University, Zhejiang, China) was used for the chromatography process. Refolding buffer 156
contained PBS (pH 6.8), 1 mM EDTA, 3 mM GSH, and 0.3 mM GSSG/. Equilibration buffer was 157
refolding buffer to which 8 mol/L urea had been added. Packed Superdex 25 columns were first 158
equilibrated with mixed buffers consisting of refolding buffer and equilibration buffer in various 159
ratios. The columns were then treated with gradients of various concentrations up to a final urea 160
concentration of 8 mol/L (100% equilibration buffer). After the equilibration, 2 mg of the 161
denatured rGoIL-17A was applied to the column and eluted with PBS. 162
163
2.5 Western blot analysis 164
Individual New Zealand rabbits were immunized with 1 mg of prokaryotic rGoIL-17A 165
protein mixed with an equal volume of complete Freund's adjuvant (Sigma) and were boosted 166
with the same amount of prokaryotic rGoIL-17A in 50% incomplete Freund’s adjuvant (IFA) 167
every two weeks for six weeks. Blood samples were collected one week after the last 168
immunization, and the sera were prepared by centrifugation. The titres of the antibodies against 169
the purified His-tagged rGoIL-17A were determined by ELISA. 170
Renaturation of the denatured eukaryotic rGoIL-17A was examined using non-reducing 171
SDS-PAGE followed by western blotting. The denatured and the renatured eukaryotic expressed 172
protein samples were mixed with equal volumes of sample buffer (0.125 M Tris–HCl, pH 6.8, 4% 173
SDS, 20% glycerol, and 0.004% bromophenol blue), resolved on 10-12% SDS-polyacrylamide 174
gels and transferred to nitrocellulose. The membranes were blocked in PBST containing 5% 175
nonfat dry milk for 16 h at 4°C. The membranes were then shaken for 2 h at room temperature 176
9
with rabbit polyclonal antibodies against GoIL-17A (1:500), followed by three washes with PBST. 177
The bound antibody was allowed to react with HRP-conjugated goat anti-rabbit IgG (G+L) 178
(1:5000, ZSGB-BIO, Beijing, China) in PBST for 40 min at room temperature. The membrane 179
was then washed three times with PBST and one time with PBS. Visualization was performed 180
with the AEC Staining Kit (Sigma). 181
182
2.6 Biological effect of eukaryotic rGoIL-17A on GEFs 183
The biological activity of eukaryotic rGoIL-17A was assessed by RT-PCR. RT-PCR was 184
performed to detect the mRNA levels of cytokines IL-6 and IL-8 (Wang et al., 2012, Wu et al., 185
2008) in GEFs after exposure to eukaryotic rGoIL-17A. GEFs were prepared from 10-day-old 186
goose embryos (Brown et al., 1995). Cells (1×107) were stimulated with 1-50 μg of eukaryotic 187
rGoIL-17A for 12 h in DMEM (Gibco). PBS was used as a control. After extraction of the total 188
RNA, reverse transcription was performed with an oligo d(T)20 primer. The primers used in the 189
PCR are listed in Table 2. The PCR conditions were as follows: one cycle for 3 min at 94°C and 190
25-30 cycles of 30 sec at 95°C, 30 sec at 55°C, and 30 sec at 72°C. The PCR products were 191
analyzed by 1% agarose-gel electrophoresis followed by ethidium bromide staining, and the gels 192
were photographed with an AlphaImager 2200 (Alpha Innotech Corporation). 193
194
3. Results 195
3.1 Molecular cloning and structure of the GoIL-17A cDNA 196
A DNA fragment of the expected size (574 bp) was obtained by PCR amplification of the 197
SMART ds cDNA using the designed primers, and a BLAST search revealed that the sequence of 198
10
this DNA fragment was similar to the sequences of known IL-17A genes (GenBank accession No. 199
JN887437). The ORF of this cDNA encoded a putative protein of 169 amino acids, including a 200
29-amino acid signal peptide and a single potential N-linked glycosylation site (Fig. 1). This 201
protein has a predicted molecular mass of 18.9 kDa (non-glycosylated) and a calculated isoelectric 202
point of 9.11. Subsequent analysis of the translated cDNA sequence indicated that GoIL-17A 203
shares 95.9%, 84.6%, 45.0% and 38.4% identity with the duck, chicken, rat and human IL-17A, 204
respectively. The six cysteine residues conserved in bird and mammalian IL-17s were observed in 205
GoIL-17A at positions 33, 94, 99, 129, 144 and 146 (stars, Fig. 1). These cysteine residues form 206
an unusual pattern of intrachain disulfide bonds, demonstrating that IL-17A is a structural 207
homolog of members of the cysteine knot family (Weaver et al., 2007). 208
209
3.2 Expression and purification of mature rGoIL-17A 210
rGoIL-17A was produced both in E. coli and baculovirus-infected insect cells. Purification 211
was performed using affinity chromatography under denaturing conditions because the proteins 212
were expressed in insoluble form. The purified prokaryotic protein was used to produce polyclonal 213
antibodies in rabbits. The polyclonal antibodies were tested by Western blotting and were found to 214
detect the monomeric and dimeric forms of IL-17A when the antibodies were diluted 1:500. These 215
antibodies were used to detect the expression of recombinant goose IL-17A by Western blot 216
analysis. 217
The refolded eukaryotic protein was considered to be a homo-dimeric protein because under 218
non-reducing conditions, a band at 40 kDa reacted with the polyclonal antibodies, and under 219
reducing conditions, the 40 kDa band disappeared, and a 20 kDa band was observed (Fig. 2). The 220
11
biological activity of the secreted protein was then tested. 221
3.3 Biological activity of eukaryotic rGoIL-17A 222
To evaluate the biological activity of eukaryotic rGoIL-17A, the induction of cytokine 223
production in primary cultures of goose embryonic fibroblasts by eukaryotic rGoIL-17F was 224
investigated. As shown in Fig. 3, refolded eukaryotic rGoIL-17A induced higher levels of IL-6 and 225
IL-8 mRNA expression than did the control. These results indicate that the eukaryotic rGoIL-17A 226
produced in this study was biologically active. 227
228
4. Discussion 229
In this study, the SMART reverse transcriptase approach was used to clone and characterize 230
the cDNA encoding IL-17A in the goose thymus. The GoIL-17A sequence is predicted to encode a 231
protein which has 95.9%, 84.6%, 45.0% and 38.4% sequence homology with the duck, chicken, 232
rat and human protein sequences, respectively. The levels of sequence homology between the 233
goose IL-17A and the duck, chicken, and human IL-17s are similar to those observed for other 234
goose cytokines and their homologs in these species (Zhou et al., 2005, Li et al., 2006). 235
E. coli-expressed rGoIL-17 does not have biological activity. However, the monomeric 236
protein was used to produce rabbit polyclonal antibodies that recognize both the monomeric and 237
dimeric forms of the protein in Western blot analyses. An active protein was produced by Sf9 cells 238
infected with recombinant baculovirus, and this protein stimulated cytokine synthesis in GEFs. In 239
previous studies, it has been shown that IL-17A stimulates the production of IL-6 and IL-8 by 240
fibroblasts (Yao et al., 1995b, Kehlen et al., 2003). In our IL-17A-mediated proinflammatory 241
model, the levels of the IL-6 and IL-8 mRNAs were up-regulated in GEFs; in contrast these 242
12
mRNAs were undetectable in the control group (Fig. 3). 243
IL-17 has been shown to play important roles in inflammation and host defense (Curtis and 244
Way, 2009). The role of IL-17A in host defense, specifically in protection against bacterial, fungal 245
and viral infections, especially at mucosal sites, was investigated. The stimulation of lung and gut 246
epithelial cells with IL-17 has been shown to induce the expression of CXCL-1, CXCL-5, 247
CXCL-2 and CCL20, which are neutrophil chemoattractants (Awane et al., 1999, Kao et al., 2005) 248
and induce the migration of neutrophils into the mucosa. The treatment of bronchial epithelial 249
cells with IL-17 stimulates the production of CXC chemokines such as IL-8 and G-CSF and the 250
expression of antimicrobial proteins such as human β-defensin 2 (Kao et al., 2004). IL-17 251
treatment also stimulates the production of IL-19 (Huang et al., 2008), which may have an 252
important role in regulating Th2 responses in the mucosa. Additionally, IL-17 induces the 253
expression of the polymeric immunoglobulin receptor and Th17 cytokines that have been shown 254
to be critical for generating mucosal IgA responses (Jaffar et al., 2009). 255
Further studies will be valuable to elucidate the role of IL-17A in mucosal immune system. 256
Additionally, it is necessary to determine if this protective effect can be exploited in the 257
development of T-cell lineage-specific adjuvants. 258
259
260
Acknowledgments 261
This research was financially supported by a major technology project from the Education 262
Department of Heilongjiang Province (10541Z004) and by the Scientific and Technological 263
Project of Heilongjiang Province (GB01B503-02 and GB04B504). 264
265
13
References 266
Awane, M., Andres, P. G., Li, D. J. Reinecker, H. C., 1999. NF-kappa B-inducing kinase is a 267
common mediator of IL-17, TNF-alpha, and IL-1 beta-induced chemokine promoter 268
activation in intestinal epithelial cells. Journal of Immunology 162, 5337-5344. 269
Brown K.E, Green S.W, Young N.S., 1995. Goose parvovirus--an autonomous member of the 270
dependovirus genus? Virology 210, 283-291 271
Curtis, M. M. Way, S. S., 2009. Interleukin-17 in host defence against bacterial, mycobacterial and 272
fungal pathogens. Immunology 126, 177-185. 273
Dubin, P. J. Kolls, J. K., 2008. Th17 cytokines and mucosal immunity. Immunological Reviews 274
226, 160-171. 275
Gouet, P., Courcelle, E., Stuart, D. I. Metoz, F., 1999. ESPript: analysis of multiple sequence 276
alignments in PostScript. Bioinformatics 15, 305-308. 277
Harrington, L. E., Hatton, R. D., Mangan, P. R., Turner, H., Murphy, T. L., Murphy, K. M. Weaver, 278
C. T., 2005. Interleukin 17-producing CD4+ effector T cells develop via a lineage distinct 279
from the T helper type 1 and 2 lineages. Nature Immunology 6, 1123-1132. 280
Huang, F., Wachi, S., Thai, P., Loukoianov, A., Tan, K. H., Forteza, R. M. Wu, R., 2008. 281
Potentiation of IL-19 expression in airway epithelia by IL-17A and IL-4/IL-13: Important 282
implications in asthma. Journal of Allergy and Clinical Immunology 121, 1415-1421. 283
Jaffar, Z., Ferrini, M. E., Herritt, L. A. Roberts, K., 2009. Cutting Edge: Lung Mucosal 284
Th17-Mediated Responses Induce Polymeric Ig Receptor Expression by the Airway 285
Epithelium and Elevate Secretory IgA Levels. Journal of Immunology 182, 4507-4511. 286
Kao, C. Y., Chen, Y., Thai, P., Wachi, S., Huang, F., Kim, C., Harper, R. W. Wu, R., 2004. IL-17 287
14
markedly up-regulates beta-defensin-2 expression in human airway epithelium via JAK and 288
NF-kappa B signaling pathways. Journal of Immunology 173, 3482-3491. 289
Kao, C. Y., Huang, F., Chen, Y., Thai, P., Wachi, S., Kim, C., Tam, L. Wu, R., 2005. Up-regulation 290
of CC chemokine ligand 20 expression in human airway epithelium by IL-17 through a 291
JAK-independent but MEK/NF-kappa B-dependent signaling pathway. Journal of 292
Immunology 175, 6676-6685. 293
Katoh S, Kitazawa H, Shimosato T, Tohno M, Kawai Y, Saito T., 2004. Cloning and 294
Characterization of Swine Interleukin-17, Preferentially Expressed in the Intestines. Journal 295
of Interferon and Cytokine Research 24, 553-559. 296
Kehlen, A., Pachnio, A., Thiele, K. Langner, J., 2003. Gene expression induced by interleukin-17 297
in fibroblast-like synoviocytes of patients with rheumatoid arthritis: upregulation of 298
hyaluronan-binding protein TSG-6. Arthritis Research and Therapy 5, 186-192. 299
Khader, S. A.,Gaffen, S. L. Kolls, J. K., 2009. Th17 cells at the crossroads of innate and adaptive 300
immunity against infectious diseases at the mucosa. Mucosal Immunology 2, 403-411. 301
Kim WH, Jeong J, Park AR, Yim D, Kim YH, Kim KD, Chang HH, Lillehoj HS, Lee BH, Min W., 302
2012. Chicken IL-17F: identification and comparative expression analysis in 303
Eimeria-infected chickens. Developmental and Comparative Immunology 38, 401-409 304
Larkin, M. A., Blackshields, G., Brown, N. P., Chenna, R., McGettigan, P. A., McWilliam, H., 305
Valentin, F., Wallace, I. M., Wilm, A., Lopez, R., Thompson, J. D., Gibson, T. J. Higgins, D. 306
G., 2007. Clustal W and clustal X version 2.0. Bioinformatics 23, 2947-2948. 307
Li, H., Ma, B., Mi, J., Jin, H., Xu, L. Wang, J., 2006. Cloning, in vitro expression and bioactivity 308
of goose interferon-alpha. Cytokine 34, 177-183. 309
15
Park, H., Li, Z. X., Yang, X. O., Chang, S. H., Nurieva, R., Wang, Y. H., Wang, Y., Hood, L., Zhu, 310
Z., Tian, Q. Dong, C., 2005. A distinct lineage of CD4 T cells regulates tissue inflammation 311
by producing interleukin 17. Nature Immunology 6, 1133-1141. 312
Riollet, C., Mutuel, D., Duonor-Cerutti, M. Rainard, P., 2006. Determination and characterization 313
of bovine interleukin-17 cDNA. Journal of Interferon and Cytokine Research 26, 141-149. 314
Rouvier, E., Luciani, M. F., Mattei, M. G., Denizot, F. Golstein, P., 1993. CTLA-8, cloned from an 315
activated T cell, bearing AU-rich messenger RNA instability sequences, and homologous to a 316
herpesvirus saimiri gene. Journal of Immunology 150, 5445-5456. 317
Tompkins, D., Hudgens, E., Horohov, D. Baldwin, C. L., 2010. Expressed gene sequences of the 318
equine cytokines interleukin-17 and interleukin-23. Veterinary Immunology and 319
Immunopathology 133, 309-313. 320
Wang, F., Tian, Y., Li, G., Chen, X., Yuan, H., Wang, D., Li, J., Shen, J., Tao, Z. Fu, Y., 2012. 321
Molecular cloning, expression and regulation analysis of the interleukin-6 (IL-6) gene in 322
goose adipocytes. British poultry science. 53, 741-746. 323
Weaver, C. T., Hatton, R. D., Mangan, P. R. Harrington, L. E., 2007. IL-17 family cytokines and 324
the expanding diversity of effector T cell lineages. Annual Review of Immunology 25, 325
821-852. 326
Wu, Y. F., Shien, J. H., Yin, H. H., Chiow, S. H. Lee, L. H., 2008. Structural and functional 327
homology among chicken, duck, goose, turkey and pigeon interleukin-8 proteins. Veterinary 328
immunology and immunopathology. 125, 205-215. 329
Xu, S. Cao, X. T., 2010. Interleukin-17 and its expanding biological functions. Cellular and 330
Molecular Immunology 7, 164-174. 331
16
Yao, Z. B., Fanslow, W. C., Seldin, M. F., Rousseau, A. M., Painter, S. L., Comeau, M. R., Cohen, 332
J. I. Spriggs, M. K., 1995a. Herpesvirus Saimiri encodes a new cytokine, IL-17, which binds 333
to a novel cytokine receptor. Immunity 3, 811-821. 334
Yao, Z., Painter, S. L., Fanslow, W. C., Ulrich, D., Macduff, B. M., Spriggs, M. K. Armitage, R. J., 335
1995b. Human IL-17: a novel cytokine derived from T cells. Journal of Immunology 155, 336
5483-5486. 337
Yoo, J., Jang, S. I., Kim, S., Cho, J. H., Lee, H. J., Rhee, M. H., Lillehoj, H. S. Min, W., 2009. 338
Molecular characterization of duck interleukin-17. Veterinary Immunology and 339
Immunopathology 132, 318-322. 340
Gu, Z. Y., Su, Z. G., Janson , J. C., 2001. Urea gradient size-exclusion chromatography enhanced 341
the yield of lysozyme refolding. Journal of Chromatography A 918, 311-318. 342
Zhou, J. Y., Chen, J. G., Wang, J. Y., Wu, J. X. Gong, H., 2005. cDNA cloning and functional 343
analysis of goose interleukin-2. Cytokine 30, 328-338. 344
345
346
347
348
349
350
351
352
353
17
Figure legends 354
355
Figure 1. Alignment of goose IL-17A with avian and mammalian IL-17A proteins. The sequences 356
were aligned using the CLUSTAL W (1.81) program (www.ebi.ac.uk/clustalw/). Identical residues 357
in the different sequences are highlighted by black boxes. The six conserved cysteine residues are 358
marked by stars and one N-glycosylation site is marked by triangles Sequences were retrieved 359
from public databases — — monkey: XP_001106391.1; human: NP_002181.1; manatee: 360
XP_004388776.1; rabbit: XP_002714544.1; bat: EPQ19560.1; fox: ELK00212.1; ferret: 361
XP_004771940.1; dog: NP_001159350.1; walrus: XP_004415698.1; horse: NP_001137264.1; 362
goat: ADB25062.1; sheep: XP_004018936.1; pig: NP_001005729.1; mouse: NP_034682.1; rat: 363
NP_001100367.1; duck: XP_005014110.1; chicken: CAD38489.1； 364
365
Figure 2. Western blot analysis of eukaryotic rGoIL-17A. Eukaryotic rGoIL-17A proteins were 366
run on a 12% gel under non-reducing conditions. Immunodetection of the Western blot was with a 367
rabbit polyclonal antibody against rGoIL-17A (1:500) and then revealed with HRP-conjugated 368
goat anti-rabbit IgG. Lane 1: denatured eukaryotic rGoIL-17A; lane 2: refolded eukaryotic 369
rGoIL-17A. 370
371
372
Figure 3. RT-PCR analysis of GEFs stimulated with 1-50 μg of rGoIL-17 or the control (PBS). 373
The RT-PCR products were resolved on an agarose gel. Ne: negative control. PBS: GEFs treated 374
with PBS. 375
Table 1 Oligonucleotide primers used to amplify cDNAs for Goose IL-17
Gene name Primer name Primer sequence Ann T (C)
cDNA First-dT20 TCTAGAGTCGACCTGCACATTTTTTTTTTTTTTTTTTTTGC 65
3G primer GAGCTCGAATTCACTTAGTATAGCGCGCGGG 65
ds cDNA 5’PCR primer TCTAGAGTCGACCTGCACAT 52.5
3’PCR primer CTCGAATTCACTTAGTATAGCG 52.5
Goose IL-17 IL-17 S GGGTCGCCCAGCACAAGCA 62.2
IL-17 A ACTCCTGTGCTGTGGGCTCCCT 61.9
Ex IL-17 mIL-17 S CGCGGATCCATGAAGGTGATACGGCCC 65
mIL-17 A CCCAAGCTTTTAAGCCTGGTGCTGGATCAA 65
Table 2 Oligonucleotide primers used to assess biologic activity of IL-17
Gene name Primer name Primer sequence Size (bp)
IL-6 IL-6 S GCGGTCTCCGACTCCTCC
546 bp IL-6 A ATAGCGAACAGCCCTCACG
IL-8 IL-8 S GCTGTCCTGGCTCTTCTCCT
210 bp IL-8 A GCACACCTCTCTGTTGTCCTTC
β-actin β-actin S CCACACCGTGCCCATCTAT
610 bp β-actin A GGTCGTATTCCTGCTTGCTG
Goose IL-6: JF437643.1; Goose IL-8: DQ393274; Goose β-actin: M26111
Table
