Cloning, expression, and characterization of TNFSF14 (LIGHT)gene in mefugu, Takifugu obscurus

Chunlan Li • Yuefen Shen • DingFang Liang •

Fei Yin • Hongxin Ai • Boqing Sun •

Shikang Lin • Shuangquan Zhang

Received: 25 December 2012 / Accepted: 21 March 2013 / Published online: 29 March 2013

� Springer Science+Business Media New York 2013

Abstract LIGHT/TNFSF14 is a member of the tumor

necrosis factor ligand superfamily, which plays important

roles in inflammatory and immune responses. In this study,

the cDNA of mefugu (Takifugu obscures) LIGHT (desig-

nated as fLIGHT) was amplified from spleen by reverse

transcription polymerase chain reaction. The open reading

frame of fLIGHT covers 765 bp and translates into a

254-aa protein. The predicted three-dimensional (3D)

structure of the soluble LIGHT of mefugu (designated as

fsLIGHT) monomer analyzed by comparative protein

modeling revealed that it was very similar to its human

counterpart. Real-time quantitative PCR analysis indicated

that LIGHT is constitutively expressed in various tissues in

mefugu. The soluble LIGHT binding of green fluorescent

protein (GFP) (designated as GFP/fsLIGHT) had been

cloned into the pET28a vector; SDS-PAGE and western

blotting analysis confirmed that the recombinant protein

pET28a-GFP/fsLIGHT was efficiently expressed in Esch-

erichia coli BL21 (DE3). After purification, the GFP/

fsLIGHT fusion protein obtained similar fluorescence

spectrum to those of GFP. Laser scanning confocal

microscopy analysis showed GFP/fsLIGHT could bind to

its receptors. In view of our basic research, LIGHT may be

a potential immunologic factor for enhancing immuno-

logical efficacy in fish, and our results might provide a

platform for further study into the effects of LIGHT.

Keywords GFP/fsLIGHT � Real-time quantitative PCR �3D structure � Fluorescence spectrum � Confocal laser

Introduction

Members of the tumor necrosis factor (TNF) family and their

receptors are important regulators of the immune system [1].

This family includes cytokines that regulate various cellular

responses, including proliferation, differentiation, inflamma-

tion, and cell death [2]. So the TNF superfamily consists of

many membrane-bound and soluble proteins with proin-

flammatory effects on innate and adaptive immune responses

[3]. LIGHT (lymphotoxin-related inducible ligand that com-

petes with herpes simplex virus glycoprotein D for herpesvi-

rus entry mediator on T cells) is a recently identified member

of TNF superfamily [4]. It is mainly expressed on activated T

cells, natural killer cells, immature dendritic cells (DCs), and

some tumor cell lines. Constitutive expression of LIGHT

results in T cell-mediated inflammation that causes tissue

destruction [5], whereas the absence of LIGHT leads to the

deficient T cell responses [6, 7]. It is reported that LIGHT may

bind to three receptors: HVEM, lymphotoxin-b receptor

(LTbR), and decoy receptor 3(DcR3)/TNF receptor 6 [8].

LTbR is prominent on epithelial cells but is absent in T and B

lymphocytes [9], and HVEM is expressed on T, B, and other

hematopoietic cells [4], which is a new member of TNFR

family involved mainly in T cell activation [10]. LIGHT is

also capable of binding to a soluble non-signaling receptor,

C. Li � Y. Shen � D. Liang � F. Yin � H. Ai � S. Zhang (&)

Jiangsu Province Key Laboratory for Molecular and Medical

Biotechnology, Life Sciences College, Nanjing Normal

University, Nanjing 210046, China

e-mail: shuangquanzhang@yahoo.com

C. Li � Y. Shen � S. Zhang

Jiangsu Province Key Laboratory for Aquatic Crustacean

Diseases, Life Sciences College, Nanjing Normal University,

Nanjing 210046, China

D. Liang � B. Sun � S. Lin � S. Zhang

Jiangsu Province Key Laboratory of Supramolecular Medicinal

Materials and Technology, Life Sciences College,

Nanjing Normal University, Nanjing 210046, China

123

Mol Cell Biochem (2013) 379:87–96

DOI 10.1007/s11010-013-1630-x

decoy receptor 3(DcR3), which is implicated in T cell

development and homeostasis [11, 12], DC maturation [13],

malignant glioma progression, and immune escape [14].

LIGHT is a 29-kDa type II transmembrane protein

containing an intracellular N-terminal domain, a short

transmembrane segment, an extracellular stalk, and a

C-terminal THD (TNF homology domain) that can fold

into a b-sandwich jelly roll structure that interacts with

adjacent monomers to form a bell-shaped homotrimer [15,

16]. An alternatively spliced LIGHT isoform has been

described as encoding a non-glycosylated molecule form

that lacks the transmembrane region and thus is not dis-

played on the cell surface. The third form of LIGHT is

soluble because metalloprotease activity can cleave LIGHT

and release it from the cell surface [17]. Recent studies

have shown that soluble LIGHT (sLIGHT) promotes ath-

erogenesis by inducing pro-inflammatory cytokines and

matrix metalloproteinases in macrophage/foam cells and

endothelial cells [18].

Mefugu (Takifugu obscurus) is a teleost fish of high

commercial value. It is mainly found in the East China Sea,

the South China Sea, the inland waters in China and the

Korean Peninsula. It lives in the bottom layer of inshore

and inland waters, and grows 20–40 cm in length. Because

of the relatively small size and simple organization of its

genome, Takifugu has become model organism to under-

stand genome architecture, organization, and function [19].

In this study, we cloned the mefugu LIGHT gene and

determined its genomic structure. Furthermore, phyloge-

netic analysis, tissue distribution, predicted three-dimen-

sional structure, and protein expression of the LIGHT gene

from mefugu were conducted.

Materials and methods

Animals and cell preparations

Mefugu were purchased from Jiangsu Zhongyang Group

(Jiangsu, China). Mice were obtained from Nanjing

Qinglongshan Animal Center, Jiangsu, China. All animal

usage was conducted according to the protocol approved

by Institutional Animal Care and Use Committee of Nan-

jing Normal University. The mefugu splenocytes were

separated from spleen homogenate using Lymphocyte

Separation Medium (BD Pharmingen, USA) according to

the manual. The mefugu splenocytes were maintained in

DMEM supplemented with 10 % fetal bovine serum

(FBS), 1 % glutamine, and 1 % penicillin/streptomycin

(P/S) at 37 �C. Mouse T cells were isolated from spleen

using T cell-specific anti-Mouse CD90.2 Magnetic Parti-

cles (BD bioscience). The mouse T cells were maintained

in RPMI1640 medium with penicillin/streptomycin

(Gibco-BRL, USA) supplemented with 10 % FCS at 37 �C

in an atmosphere of 5 % CO2.

Tissue sampling, RNA isolation, and RT-PCR

Various tissues including heart, liver, spleen, gill, kidney,

and intestine from mefugu were collected and immediately

snap frozen in liquid nitrogen and stored at -80 �C until

use. Total RNA was prepared with an RNAprep pure

Tissue Kit (Tiangen Biotech Co. Ltd., Beijing, China)

following the manufacturer’s instruction. A first-strand

cDNA was synthesized from 1 lg RNA isolated from

spleen using Reverse Transcriptase M-MLV (Takara,

Japan) according to the manufacturer’s protocol. A pair of

primers, F1 and R1 (Table 1) was designed and synthe-

sized according to alignments of the predicted sequence of

Tetraodon nigroviridis and Takifugu rubripes. PCR was

conducted with F1 and R1 under the following conditions:

94 �C for 5 min, 30 cycles (94 �C/30 s; 60 �C/30 s; 72 �C/

1 min), and finally 72 �C for 10 min. PCR product was

cloned into pMD19-T vector (Takara) and sequenced.

Bioinformatics analysis

The sequence of open reading frame of fLIGHT was used

to search for similarity using BLAST at web servers of the

National Center of Biotechnology Information (http://blast.

ncbi.nlm.nih.gov/). For the exact localization of the exon–

intron boundaries, the mRNA-to-genomic alignment pro-

gram Spidey was used. The deduced amino acid sequence

was analyzed with the Expert Protein Analysis System

(http://www.expasy.org/). Multiple sequence alignment

was performed using the ClustalW (version 1.83) [20]. The

phylogenetic tree was constructed from the ClustalW-

generated alignments using the neighbor-joining method

and the MEGA4.0 program [21]. The predicted 3D

(three-dimensional) structure of the soluble mature region

of mefugu LIGHT (fsLIGHT) was determined by

Table 1 Primer sequences used in this study

Primer 50–30

F1 GTTGGAGCTGTCCACACCNA

R1 GCTCNAAACNGGGTNNGAG

QL1 TTGAATGCTGCAGAGGAGTG

QL2 CCTGTTTGCAGGTGGAAAAT

QG1 CACCTCCAAGAAGGTGGAAA

QG2 CTCTCGTGGAAAACGGTGAT

A1 CGCCATATG GTGAGCAAGGGCGAGGA

A2 GCTGCCACCTCCACCCTTGTACAGC TCGTC

B1 GGTGGAGGTGGCAGCATCCAAAACCGGCCA

B2 CCCAAGCTTTCACGGGGCTATCATAAAGGCT

88 Mol Cell Biochem (2013) 379:87–96

123

comparative protein modeling on the I-TASSER sever

(http://zhanglab.ccmb.med.umich.edu/ I-TASSER), then

visualized and manipulated with the RasWin molecular

graphics program (RasMol, version 2.7.2). Real-time quan-

tification PCR primer pairs were designed manually based on

Primer3 Input [22].

Real-time quantitative PCR (qPCR) analysis

Tissue distribution of fLIGHT was studied by real-time

qPCR. First-strand cDNAs were synthesized from RNA

obtained from various tissues as described above. A pair of

primers QL1 and QL2 (Table 1) was used to amplify a

PCR product of 197 bp. A constitutively expressed gene,

the glyceraldehyde phosphate dehydrogenase (GAPDH),

was used as an internal control to verify the real-time qPCR

reaction. Two primers QG1 and QG2 (Table 1) were used

to amplify a 171 bp fragment of mefugu GAPDH cDNA.

The program of PCR was 94 �C for 5 min, followed by 40

cycles of 94 �C for 30 s, 65 �C for 30 s, 72 �C for 12 s.

DEPC-water for the replacement of cDNA template was

used as a negative control. The SYBR Green RT-PCR

assay was carried out as previously described in detail [23].

Construction of expression vector pET28a-GFP/

fsLIGHT

The DNA encoding mefugu LIGHT soluble domain (amino

acids 101–253) was amplified by RT-PCR. To obtain GFP/

fsLIGHT fusion gene first, the method of overlapping

polymerase chain reaction (overlap PCR) was used. Four

primers for PCR were designed based on the green fluo-

rescent protein (GFP) and the fsLIGHT encoding sequence

as follows: A1 (sense), A2 (anti-sense), B1 (sense), and B2

(anti-sense) (Table 1). The primer A2 contained a (Gly4-

Ser) linker encoding sequence (Italic and Bold). For

overlap PCR, the primers A2 and B1 had an overlapping

complementary sequence shown with Italic and Bold,

resulting in one fusion cassette containing GFP (Gly4Ser),

linker, and fsLIGHT-encoding sequences. The A1 and the

B2 were introduced with NdeI and HindIII restriction sites,

respectively, for subsequent cloning. The A1 and the A2

were used to amplify the cDNA sequence of GFP without

the stop codon. The B1 and the B2 were used to amplify

the cDNA sequence of fsLIGHT, with pMD19T-fLIGHT

above as template. After the first round of PCR using A1/

A2 and B1/B2, respectively, gel purification was used for

the two products. The second round of PCR was performed

using the two resulting PCR products as templates and A1/

B2 as primers to obtain the cDNA encoding GFP/(Gly4-

Ser)/fsLIGHT fusion protein. Following digestion with

NdeI and HindIII, the PCR product was subcloned into the

pET28a expression vector (Novagen), forming a sequence

encoding a fusion protein of pET28a-GFP/fsLIGHT and an

NH2-terminal His6-tag. The recombinant plasmid was

named as pET28a-GFP/fsLIGHT.

Expression, purification of recombinant GFP/fsLIGHT

and western blotting analysis

The constructed recombinant plasmid pET28a-GFP/fsLIGHT

was transformed into Escherichia coli BL21 (DE3) cells. The

bacteria were cultured in 600 ml Luria–Bertani media with

vigorous shaking (220 rpm) and 30 mg/ml kanamycin at

37 �C to the optical density of OD600 & 0.6. Then, the protein

production was induced with 0.1 mM IPTG (isopropyl b-a-

thiogalactoside) at 16 �C for a further 24 h and shaking speed

was set to 135 rpm/min. The soluble proteins in the super-

natant were collected by refrigerated centrifugation after hy-

persound quassation. Finally, the target proteins were purified

with His-Bind Columns (Qiagen, Germany) according to the

manual. The expression of His6-tagged pET28a-GFP/

fsLIGHT was analyzed by SDS-PAGE and western blotting

with an anti-His6-tag mouse antibody (Invitrogen, USA).

Purified pET28a-GFP/fsLIGHT was used for further studies.

Measurement of fluorescence spectra

The fluorescence spectra of GFP/fsLIGHT and GFP were

measured using the fluorescence spectrophotometer LS50B

(Perkin Elmer, USA). Emission spectra were measured at

510 nm and excitation spectra were measured at 488 nm.

Laser scanning confocal microscopic analysis

The purified splenic lymphocytes from mefugu and mouse

splenic T cells (107 cell/ml) were cultured in RPMI 1640

containing 10 % FBS. The cells were incubated for 90 min

at 37 �C with/without GFP/fsLIGHT (15 lg/ml), and then

washed three times with PBS buffer (pH 7.2). Free GFP

(15 lg/ml) was used as a control protein. The images were

captured on an LSM 510 confocal microscope with a

cooled MicroMax CCD camera.

Results

Molecular cloning and analysis of the genomic

structure of fLIGHT

In this study, the fLIGHT was identified from the spleen

cDNA library of mefugu. The open reading frame (ORF) of

this EST clone was obtained by RT-PCR with primers F1

and R1 (GenBank accession no. JX023508). The 765 bp

ORF encodes a 254-amino acid protein with a putative

molecular weight of 27.7 kDa, and the isoelectric point pI

Mol Cell Biochem (2013) 379:87–96 89

123

is 8.78 (Fig. 1). The nucleotide and predicted amino acid

sequence of the ORF of fLIGHT are shown in Fig. 1. To

obtain the genomic DNA of mefugu LIGHT, the publicly

available mefugu genome database at the ensemble

(http://www.ensembl.org/Takifugu_rubripes/blastview) was

screened using the full-length cDNA sequence of fLIGHT.

The mefugu LIGHT gene spans 1,691 bp at chromosomal

scaffold_194. The gene consists of six exons (Table 2),

Exon 1 of fLIGHT encodes the first 66 amino acids of the

polypeptide, which comprises the entire cytoplasmic tail (aa

1–38), transmembrane domain (aa 39–61), and the begin-

ning of the extracellular stalk region. The remaining exons

encode amino acids 67–89, 90–99,100–111,112–191, and

192–254, respectively, which make up the stalk region and

the trimerization domain. They all belong to the extracel-

lular domain. All exon–intron splice junction sequences

basically conformed to the canonical GT–AG rule (Bold),

which is similar to that of other animals.

Fig. 1 The sequence of the

fLIGHT gene (GenBank

accession no. JX023508). The

entire deduced amino acid

sequence is depicted in single

letter code beneath the

corresponding nucleotide

sequence. The stop codon TGA

is with an asterisk

Table 2 Intron/exon arrangement of fLIGHT

50End 30End Size (bp) Encodes (aa) Size (bp)

Exon1 ATGT- -GAGG 199 1–66 66

Intron1 GTAA- -ACAG 515

Exon2 CGTT- -ACAG 68 67–89 23

Intron2 GTT- -TCAG 112

Exon3 GGGG- -AAAG 31 90–99 10

Intron3 GTAC- -GTGG 147

Exon4 AACA- -ATAG 36 100–111 12

Intron4 GTCA- -GTAG 83

Exon5 GCTC- -AAAG 238 112–191 80

Intron5 GTTA- -CTAG 79

Exon6 TTCT- -TGA stop 193 192–254 63

Fig. 2 a Amino acid sequence alignment of LIGHT from several

species: Fo_LIGHT (Takifugu obscurus, JX023508), Hs_LIGHT (Homosapiens, NM_003807), Mm_LIGHT (Mus musculus, NM_019418.2),

and Om_LIGHT (Oncorhynchus mykiss, NP_001118039.1). Multiple

alignments were first performed using ClustalW program. Asteriskidentical residues among the four sequences. Substitution said to be

conservative or semi-conservative by ClustalWare are with semicolonand end period, respectively. The transmembrane domain was unlined.

The thick black solid line below LIGHT sequences is the conserved TNF

homology domain (THD). The TNF homology domain (THD) that is

typically composed of 10 b-strands (designated A, A0, B0, B, C, D, E, F, G,

and H),which are in blue. The light grey is the potential cleave site.

b Comparison of the predicted mefugu LIGHT protein sequences from

our study and Ensembl

c

90 Mol Cell Biochem (2013) 379:87–96

123

Mol Cell Biochem (2013) 379:87–96 91

123

Sequence comparison analysis

The fLIGHT comprises 254 amino acids, containing a

predicted transmembrane domain (TMD) of 21 amino

acids and a extracellular domain which include a cleave

site (Gln101, Ile102) can be cleaved form a soluble protein.

To study the evolutionary relationship of mefugu LIGHT

with other known LIGHT proteins, amino acid sequences

comparison was performed using the ClustalW software

(Fig. 2a). By analysis of the primary structure, fLIGHT

protein is a trimerization polypeptide, the receptor-binding

domain includes a site for N-linked glycosylation (Asn79)

[24]. Based on structural homology with LTa [25] and

supportive evidence from modeling and biochemical

analysis, the trimerization domain of LIGHT folds into an

anti-parallel b sandwich, wherein the receptor-binding sites

are formed from adjacent subunits [26]. A search of the

genome revealed the presence of a T. rubripes LIGHT

cDNA (Ensembl: scaffold_194: 420,541-422,231) and its

genomic DNA sequence. The fLIGHT sequence differs by

four amino acids from the sequence of T. rubripes in

Ensembl (Fig. 2b).

Three-dimensional modeling and phylogenetic analysis

The 3D structures of soluble LIGHT (designated as

sLIGHT) of several species were predicted by I-TASSER

using the human sLIGHT crystal structure as a template.

As shown in Fig. 3a, despite some differences existing at

amino acid level, the predicted 3D structure of fsLIGHT

monomer was very similar with other counterparts, and

further indicating that fLIGHT has similar biological

function with human LIGHT in vivo. To determine the

position of fLIGHT gene in evolution, ten representative

LIGHT proteins were used to construct a phylogenetic tree

using MEGA4.0. Our results showed that the phylogenetic

tree was divided into two different branches with one

containing all fish sequences and the other was mamma-

lian, and fLIGHT was clustered with the other fish ortholog

proteins (Fig. 3b). To a certain extent, the phylogenetic

tree reflects the affinities among these species.

Tissue-specific distribution of fLIGHT

Real-time quantitative PCR was employed to quantify the

fLIGHT expression in the tissues of heart, liver, spleen,

gill, kidney, and intestine and the fGAPDH gene was used

as a control. A dissociation curve showing a single peak at

the melting temperature expected for the target amplicon

suggests specific amplification. Expression was determined

as fold increased 2-DDCt levels relative to the tissue with

lowest expression (heart) set to one. SYBR Green Real-

time qPCR analysis revealed that fLIGHT gene expressed

in various tissues, with highest mRNA levels observed in

spleen (66.78-fold), followed by the kidney (35.59-fold),

intestine (26.54-fold), and liver (17.26-fold) (Fig. 4).

Lowest levels were detected in gill (7.36-fold) and heart

(the calibrator). These results indicated that LIGHT in

mefugu plays an important role in immune system as in

human.

Fig. 3 a Homology modeling of the LIGHT monomer of several species

based on the human structure (aa 83–240). Cartoon displays of structure

models are shown, b strands are in yellow, a-helix are in red, turns are in

blue, white represent other residues. b Phylogenetic tree showing the

relationship of the mefugu LIGHT amino acid sequence with other

identified LIGHT sequences. The tree was constructed by the neighbor-

joining method with the MEGA4.0 program and was bootstrapped 1,000

times. Accession numbers of LIGHT sequences obtained from GenBank

and UniProtKB are: mefugu LIGHT (Takifugu obscurus, JX023508),

human LIGHT (Homo sapiens, NM_003807), rabbit LIGHT (Oryctol-agus cuniculus, G1STJ4), dog LIGHT (Canis familiaris, E2RFV8), horse

LIGHT (Equus caballus F6SZH4), mouse LIGHT (Mus musculus,NM_019418.2), bovine LIGHT (Bos Taurus, A6QPWO), pig LIGHT

(Sus scrofa, F1SBS6), zebrafish LIGHT (Danio rerio, JX023464),

rainbow trout LIGHT (Oncorhynchus mykiss, NP_001118039.1). (Color

figure online)

92 Mol Cell Biochem (2013) 379:87–96

123

Expression and purification of the GFP/fsLLIGHT

protein

The GFP/fsLIGHT plasmids were transformed into E. coli

BL21 (DE3), and the protein was efficiently expressed and

purified under optimal conditions. According to the SDS-

PAGE analysis, after IPTG induction, 44.4 kDa band (Fig. 5,

lane 3) corresponding to the expectant size of the fusion

protein was observed. There was almost no basal expression of

soluble fusions without IPTG induction (Fig. 5, lane 2). Sol-

uble recombinant GFP/fsLIGHT was successfully purified

with His-Bind columns (Fig. 5, lane 4). The expressed GFP/

fsLIGHT was recognized by western blotting using anti-His6-

tag monoclonal antibody (Fig. 5, lane 5).

Fluorescence activity

GFP is a spontaneously fluorescent protein isolated from

marine organisms, such as certain jellyfish and sea pansies [27].

The fluorophore of GFP originates from an internal Ser-Tyr-

Gly sequence which is post-translationally modified to a 4-(p-

hydroxybenzylidene)-imidazolidin-5-one structure [28]. When

GFP is fused to the N-terminus of over-expressed globular

proteins, over-expression in soluble form allows GFP to fold

correctly. To verify the correct folding of the GFP domain, the

purified soluble GFP/fsLIGHT was tested for its fluorescence

activity with comparison to free GFP. As determined by the

measurement of fluorescence spectra using the florescence

spectrophotometer, fluorescence properties of GFP/fsLIGHT

were quite similar to free GFP. Their maximum excitation

wavelengths were both at 488 nm, and the maximum emission

wavelengths were both at 510 nm. However, the fluorescence

intensity exhibited weaker than free GFP (Fig. 6). It indicates

no shift in excitation and emission spectra of GFP/fsLIGHT

fusion protein compared to free GFP. The fluorophore is pro-

tected from collisions with fluorescence quenchers [29], so the

decrease of fluorescence in chimera might be explained by one

mechanism: the fluorophore is formed but the fluorescence is

quenched by fsLIGHT, which could absorb the inducing or

induced radiation.

Recombinant GFP/fsLIGHT binds to mefugu

lymphocytes or mouse splenic T cells

GFP is widely used as a fluorescent probe, no need for

substrates and co-factors, being active as a monomer, and

exhibiting stability in a broad range of buffers and tem-

peratures. Localization of GFP fusion proteins can be

analyzed in live bacteria and eukaryotic cells. In view of

this, laser scanning confocal microscopy (LSCM) provided

a visibly clear image of the distribution of GFP/fsLIGHT

binding to mefugu lymphocytes and mouse splenic T cells

by detection of fluorescent signal of GFP. However, cells

treated with free GFP protein did not release any fluores-

cence signals (Fig. 7). The findings indicate that fsLIGHT

has the binding ability to mefugu lymphocytes and mouse

splenic T cells.

Fig. 4 Expression analysis of mefugu LIGHT in various tissues.

Real-time qPCR analysis of the expression of fLIGHT. Mean mRNA

levels in six tissues, heart, liver, spleen, gill, kidney, and small

intestine, were analyzed. Data are 2-DDCt levels calculated relative to

the tissue with lowest expression (heart) set to 1, normalized against

GAPDH mRNA levels. Vertical bars the mean ± SE (N = 3)

Fig. 5 SDS-PAGE analysis of recombinant GFP/fsLIGHT expressed

in E. coli BL21 (DE3). Molecular weight marker is in the left lane.

Lane 1 the pure GFP protein. Lane 2 Cell lysates of bacteria

transformed with pET28a-GFP/fsLIGHT without IPTG induction.

Lane 3 cell lysates of bacteria transformed with pET28a-GFP/

fsLIGHT under IPTG (0.1 mM) induction. Lane 4 the GFP/fsLIGHT

fusion protein purified by immobilized metal affinity chromatogra-

phy. Lane 5 western blot analysis of purified GFP/fsLIGHT using

mAb against His6-tag. The arrow the location of GFP/fsLIGHT

fusion protein

Mol Cell Biochem (2013) 379:87–96 93

123

Discussion and conclusion

In this study, the cDNA sequence of LIGHT/TNFSF14 from

T. obscures was determined. The cloning strategy was based

on the 99 % identities of 16S rRNA within the Takifugu

species [30]. The ORF cDNA of fLIGHT gene was 765 bp

encoding a polypeptide of 254 amino acids (Fig. 1). The

fLIGHT is a type II membrane protein with absence of a signal

peptide, which is typical of the members of the TNF ligand

family. The sequence alignment showed that the protein of

fLIGHT contains a predicted transmembrane domain, a pro-

teolytic cleavage site, and a conservative C-terminal domain

Fig. 6 Fluorescence spectra of free GFP and GFP/fsLIGHT. Emis-

sion spectra were measured with 470 nm excitation over the range

480–570 nm. Excitation spectra were measured with 430 nm

emission over the range 300–525 nm. Maximum emission wave-

lengths of free GFP and GFP/fsLIGHT were both at 510 nm, and

maximum excitation wavelengths were both at 488 nm

Fig. 7 a Confocal laser microscopic images of GFP/fsLIGHT bind to

mefugu splenic lymphocytes. b Confocal laser microscopic images of

GFP/fsLIGHT bind to mouse splenic T cells. Images were captured

using a CCD camera with identical settings below the saturation

limits. a Image with transmitted light (phase contrast). b Same images

as in a with GFP fluorescence (green) following excitation at 488 nm.

c Image merged with a and b. Cells were treated with free GFP

protein as a control (d, e, f). d Image with transmitted light (phase

contrast). e Same images as in d with GFP fluorescence (green)

following excitation at 488 nm. f Image merged with d and e. Scalebar represents 3 lm. (Color figure online)

94 Mol Cell Biochem (2013) 379:87–96

123

known as the THD like other LIGHTs (Fig. 2a). The THD is

typically composed of ten b-strands (designated as A, A0, B0,B, C, D, E, F, G, and H), wherein the receptor-binding sites are

formed. The four amino acid replacements may indicate that

the Takifugu species diversified very recently (Fig. 2b). As

shown in Fig. 3a, the predicted 3D structure of fsLIGHT is

very similar to its human counterpart, indicating that mefugu

LIGHT may have similar biological function in vivo with

human LIGHT. Phylogenetic tree analysis showed that

fLIGHT protein is grouped primarily with other teleost

LIGHT molecules (Fig. 3b). It is consistent with the previous

studies such as Glenney et al. [31]. The real-time quantitative

PCR results showed that fLIGHT was constitutively expres-

sed in all detected tissues, with high mRNA level observed in

fish-related immune organs, especially in the lymphoid organ

spleen (Fig. 4), indicating that fLIGHT could play important

immunological roles.

To determine the activity of the fsLIGHT, we con-

structed fusion protein consisting of GFP and fsLIGHT.

First, we expressed recombinant GFP/fsLIGHT in E. coli

BL21 (DE3) using the pET28a plasmid. The protein effi-

ciently expressed and was mostly found in soluble region

under hypothermia induction. Then, the soluble recombi-

nant GFP/fsLIGHT was successfully purified using His-

Bind columns. Western blot analysis of GFP/fsLIGHT

purified from BL21 (DE3) revealed a prominent band at

44.4 kDa, indicative of GFP/fsLIGHT soluble expression.

Fluorescence analysis showed that fluorescence properties

of GFP/fsLIGHT were quite similar to free GFP despite the

fluorescence intensity exhibited weaker than free GFP

(Fig. 6). It indicates that fsLIGHT do not damage the

correct folding of the GFP fluorophore.

LSCM was used to determine receptor-binding activity.

It was found that GFP/fsLIGHT could be able to bind to the

receptor-positive cell lines, including mouse LIGHT

receptors (Fig. 7). This result suggested that, due to the

highly conserved nature of LIGHT, functional cross-reac-

tivity exists among different species.

In conclusion, this is the first report of cloning and

molecular structure research of mefugu LIGHT. It provides

information regarding the molecular evolution of fish,

mRNA expression in various tissues, the fused protein

construction, expression, and receptor-binding activity.

LIGHT play important roles in the immune system, so

LIGHT protein may be developed as fish biologics for

mefugu, which is a very important economic fish. More-

over, this study may be useful for further research into

LIGHT using mefugu as a model system.

Acknowledgments This study was funded by a grant from The

National Science Foundation of China (No. 30271093) and a project

funded by the Priority Academic Program Development (PAPD) of

Jiangsu Higher Education Institution (No. 164320H106).

References

1. Locksley RM, Killeen N, Lenardo MJ (2001) The TNF and TNF

receptor superfamilies: integrating mammalian biology. Cell

104:487–501

2. Smith CA, Farrah T, Goodwin RG (1994) The TNF receptor

superfamily of cellular and viral proteins: activation, costimula-

tion, and death. Cell 76:959–962

3. Doherty TA, Soroosh P, Khorram N, Fukuyama S, Rosenthal P,

Cho JY, Norris PS, Choi H, Scheu S, Pfeffer K, Zuraw BL, Ware

CF, Broide DH, Croft M (2011) The tumor necrosis factor family

member LIGHT is a target for asthmatic airway remodeling. Nat

Med 17:596–603. doi:10.1038/nm.2356

4. Mauri DN, Ebner R, Montgomery RI, Kochel KD, Cheung TC,

Yu GL, Ruben S, Murphy M, Eisenberg RJ, Cohen GH, Spear

PG, Ware CF (1998) LIGHT, a new member of the TNF super-

family, and lymphotoxic a are ligands for herpesvirus entry

mediator. Immunity 8:21–30

5. Shaikh RB, Santee S, Granger SW, Butrovich K, Cheung T,

Kronenberg M, Cheroutre H, Ware CF (2001) Constitutive

expression of LIGHT on T cells leads to lymphocyte activation,

inflammation, and tissue destruction. J. Immunol 167:6330–6337

6. Tamada K, Shimozaki K, Chapoval AI, Zhai Y, Su J, Chen SF,

Hsieh SL, Nagata S, Ni J, Chen L (2000) LIGHT, a TNF-like

molecule, costimulates T cell proliferation and is required for

dendritic cell-mediated allogeneic T cell response. J. Immunol

164:4105–4110

7. Tamada K, Shimozaki K, Chapoval AI, Zhu G, Sica G, Flies D,

Boone T, Hsu H, Fu YX, Nagata S, Ni J, Chen L (2000) Mod-

ulation of T-cell-mediated immunity in tumor and graftversus-

host-disease models through the LIGHT co-stimulatory pathway.

Nat Med 6:283–289. doi:10.1038/73136

8. Hu G, Liu Y, Li H, Zhao D, Yang L, Shen J, Hong X, Cao X,

Wang Q (2010) Adenovirus-mediated LIGHT gene modification

in murine B-cell lymphoma elicits a potent antitumor effect. Cell

Mol Immunol 7:296–305. doi:10.1038/cmi.2010.15

9. Crowe PD, VanArsdale TL, Walter BN, Ware CF, Hession C,

Ehrenfels B, Browning JL, Din WS, Goodwin RG, Smith CA

(1994) A lymphotoxin-beta-specific receptor. Science

264:707–710. doi:10.1126/science.8171323

10. Kwon BS, Tan KB, Ni J, Lee KO, Kim KK, Kim YJ, Wang S,

Gentz R, Yu GL, Harrop J, Lyn SD, Silverman C, Porter TG,

Truneh A, Young PR (1997) A newly identified member of the

tumor necrosis factor receptor superfamily with a wide tissue

distribution and involvement in lymphocyte activation. J Biol

Chem 272:14272–14276. doi:10.1074/jbc.272.22.14272

11. Migone TS, Zhang J, Luo X, Zhuang L, Chen C, Hu B, Hong JS,

Perry JW, Chen SF, Zhou JX, Cho YH, Ullrich S, Kanakaraj P,

Carrell J, Boyd E, Olsen HS, Hu G, Pukac L, Liu D, Ni J, Kim S,

Gentz R, Feng P, Moore PA, Ruben SM, Wei P (2002) TL1A is a

TNF-like ligand for DR3 and TR6/DcR3 and functions as a T cell

costimulator. Immunity 16:479–492. doi:10.1016/S1074-7613

(02)00283-2

12. Shi G, Luo H, Wan X, Salcedo TW, Zhang J, Wu J (2002) Mouse T

cells receive costimulatory signals from LIGHT, a TNF family

member. Blood 100:3279–3286. doi:10.1182/blood-2002-05-1404

13. Hsu TL, Chang YC, Chen SJ, Liu YJ, Chiu AW, Chio CC, Chen

L, Hsieh SL (2002) Modulation of dendritic cell differentiation

and maturation by decoy receptor 3. J Immunol 168:4846–4853

14. Roth W, Isenmann S, Nakamura M, Platten M, Wick W, Kleihues

P, Bahr M, Ohgaki H, Ashkenazi A, Weller M (2001) Soluble

decoy receptor 3 is expressed by malignant gliomas and sup-

presses CD95 ligand-induced apoptosis and chemotaxis. Cancer

Res 61:2759–2765

Mol Cell Biochem (2013) 379:87–96 95

123

15. Harrop JA, McDonnell PC, Brigham-Burke M, Lyn SD, Minton

J, Tan KB, Dede K, Spampanato J, Silverman C, Hensley P,

DiPrinzio R, Emery JG, Deen K, Eichman C, Chabot-Fletcher M,

Truneh A, Young PR (1998) Herpesvirus entry mediator ligand

(HVEM-L), a novel ligand for HVEM/TR2, stimulates prolifer-

ation of T cells and inhibits HT29 cell growth. J Biol Chem

73:27548–27556. doi:10.1074/jbc.273.42.27548

16. Bodmer JL, Schneider P, Tschopp J (2002) The molecular

architecture of the TNF superfamily. Trends Biochem Sci

27:19–26. doi:10.1016/S0968-0004(01)01995-8

17. Granger SW, Rickert S (2003) LIGHT–HVEM signaling and the

regulation of T cell-mediated immunity. Cytokine Growth F R

14:289–296

18. Otterdal K, Smith C, Øie E, Pedersen TM, Yndestad A, Stang E,

Endresen K, Solum NO, Aukrust P, Damas JK (2006) Platelet-derived

LIGHT induces inflammatory responses in endothelial cells and

monocytes. Blood 108:928–935. doi:10.1182/blood-2005-09-010629

19. Aparicio S, Chapman J, Stupka E et al (2002) Whole-genome

shotgun assembly and analysis of the genome of Fugu rubripes.

Science 297:1301–1310. doi:10.1126/science.1072104

20. Thompson JD, Higgins DG, Gibson TJ (1994) Clustal W:

improving the sensitivity of progressive multiple sequence

alignment through sequence weighting, position-specific gap

penalties and weight matrix choice. Nucleic Acids Res

22:4673–4680. doi:10.1093/nar/22.22.4673

21. Tamura K, Dudley J, Nei M, Kumar S (2007) MEGA4: molecular

evolutionary genetics analysis (MEGA) software version 4.0.

Mol Biol Evol 24:1596–1599. doi:10.1093/molbev/msm092

22. Rozen S, Skaletsky HJ (2000) Primer3 on the WWW for general

users and for biologist programmers. In: Krawetz S, Misener S

(eds) Bioinformatics methods and protocols: methods in molec-

ular biology. Humana, Totowa, pp 365–386

23. Guan ZB, Shui Y, Zhang SQ (2007) Two related ligands of the

TNF family, BAFF and APRIL, in rabbit: molecular cloning, 3D

modeling, and tissue distribution. Cytokine 39:192–200

24. Granger SW, Butrovich KD, Houshmand P, Edwards WR, Ware

CF (2001) Genomic characterization of LIGHT reveals linkage to

an immune response locus on chromosome 19p13.3 and distinct

isoforms generated by alternate splicing or proteolysis. J Immu-

nol 167:5122–5128

25. Eck MJ, Sprang SR (1989) The structure of tumor necrosis fac-

tor-a at 2.6 A resolution. Implications for receptor binding. J Biol

Chem 264:17595–17604

26. Rooney IA, Butrovich KD, Glass AA, Borboroglu S, Benedict

CA, Whitbeck JC, Cohen GH, Eisenberg RJ, Ware CF (2000)

The lymphotoxin-b receptor is necessary and sufficient for

LIGHT-mediated apoptosis of tumor cells. J Biol Chem

275:14307–14315. doi:10.1074/jbc.275.19.14307

27. George N, Phillips JR (1997) Structure and dynamics of green

fluorescent protein. Curr Opin Struc Biol 7:821–827

28. Cody CW, Prasher DC, Westler WM, Prendergast FG, Ward WW

(1993) Chemical structure of the hexapeptide chromophore of the

Aequorea green-fluorescent protein. Biochemistry 32:1212–1218.

doi:10.1021/bi00056a003

29. Rao BDN, Kemple MD, Prendergast FG (1980) Proton nuclear

magnetic resonance and fluorescence spectroscopic studies of

segmental mobility in aequorin and a green fluorescent protein

from Aequorea forskalea. Biophys J 32:630–632

30. Kato A, Doi H, Nakada T, Sakai H, Hirose S (2005) Takifuguobscurus is a euryhaline fugu species very close to Takifugurubripes and suitable for studying osmoregulation. BMC Physiol

5:1–11. doi:10.1186/1472-6793-5-18

31. Glenney GW, Wiens GD (2007) Early diversification of the TNF

superfamily in teleosts: genomic characterization and expression

analysis. J Immunol 178:7955–7973

96 Mol Cell Biochem (2013) 379:87–96

123