cloning of are-containing genes by au-motif-directed display

Cloning of ARE-Containing Genes by AU-Motif-Directed Display

Orlando Dominguez, Yaqoub Ashhab, Lidia Sabater, Eva Belloso,Pepi Caro, and Ricardo Pujol-Borrell*,1

Almirall-Prodesfarma Research Center, and *Immunology Unit, University Hospital Germans Trias i Pujol,Autonomous University of Barcelona, Barcelona 08916, Spain

Received May 22, 1998; accepted August 28, 1998

A procedure suitable for cloning labile mRNAs thatcontain AU motifs is presented (AU-DD). These motifsare regulatory sequences within the so-called AU-richelements (AREs) often found in 3* untranslated re-gions of genes such as cytokines, proto-oncogenes, andtranscription factors. AU-DD is an AU-motif-directeddifferential display that permits the identification ofARE-containing genes differentially expressed aftercell activation. It has been applied to peripheral bloodmonocytes and a T cell clone to isolate 59 cDNA frag-ments associated to activation. Fourteen percent ofisolated fragments belong to already known genesthat certainly are cytokines and transduction/tran-scription factors. The remaining 86% correspond tounknown genes of which 92% have been confirmed tobe differentially expressed. These data demonstratethe efficiency of the system and support the notionthat numerous genes falling into those categories re-main unidentified and that they can be cloned by thismethod. © 1998 Academic Press

INTRODUCTION

The AU-rich elements (AREs)2 are cis-acting se-quences typically found in 39 untranslated regions ofmany labile mRNAs. AREs constitute the more wide-spread determinant of RNA instability among thoseknown in mammalian cells (reviewed in Chen andShyu, 1995). Depending on the cellular context, AREseither mediate rapid degradation of mRNA or inhibitits translation. Genes containing AREs are of potentialbiological and pharmacological interest, as they oftencode for inflammatory mediators, cytokines, proto-on-coproteins, and transcription factors (Shaw and Ka-men, 1986; Caput et al., 1986).

Genes sharing structural motifs are traditionallyidentified by screening with degenerate probes. In thecase of AU motifs their lengths and compositional char-acteristics prevent their use as targets for gene cloningpurposes. We describe a modification of the PCR (Mul-lis and Faloona, 1987), named AU-motif-directed dis-play (AU-DD), that allows the amplification of AU-motif-containing genes subjected to regulatedexpression. It combines the specificity attained at thePCR level with the advantages of direct comparisonbetween samples at different stage of activation (Liangand Pardee, 1992; Welsh et al., 1992).

AU-DD is a reliable and simple procedure that solvesinherent problems like the AU-motif very low duplexstability and produces cDNA fragments appropriate toderive probes for cloning full-length genes. In concept,AU-DD follows other reported PCR procedures in-tended to isolate novel genes that share a relativelyshort structural motif, like targeted differential dis-play or targeted RNA fingerprinting (Stone and Whar-ton, 1994; Fischer et al., 1995). Nevertheless, AU-DDincorporates a number of innovations that make itoriginal, such as a primer design that allows a reduc-tion of the specific sequence length requirement andthe use of a single primer for a specific PCR.

MATERIALS AND METHODS

Substrates. Cells used were: (a) the T lymphocyte cell cloneTab122.12 CD41 CD82 (described in Roura-Mir et al., 1997), cul-tured in Iscove’s modified DMEM (Gibco BRL) plus 10% normalhuman serum, and (b) peripheral blood monocytes, isolated from ahealthy donor (OD) by adherence to tissue culture plastic (Stewart etal., 1986) and cultured in RPMI 1640 with 10% Myoclone Super PlusFCS (both from Gibco BRL). The clone Tab122.12 grown as described(protocol 1 in Roura-Mir et al., 1997) was stimulated by incubationwith 25 ng/ml phorbol myristate acetate (PMA; Sigma) and 1 mg/mlionomycin (Calbiochem) for 4 h at 37°C. As protein synthesis inhib-itors usually augment and prolong the induction of at least someARE-containing genes in the presence of growth stimuli (Edwardsand Mahadevan, 1992), cycloheximide (CHX; Sigma) was added at10 mg/ml during the second half of the incubation. Freshly isolatedperipheral blood adherent cells were cultured in basal culture con-ditions for 24 h at 37°C and then were activated by incubation with0.1 mg/ml lipopolysaccharide (LPS; Sigma) for 4 h. As before, 10mg/ml CHX was present in the final 2-h period.

Sequence data from this article have been deposited with theEMBL Data Library under Accession Nos. AJ227854 to AJ227918.

1 To whom correspondence should be addressed at the Immunol-ogy Unit, University Hospital Germans Trias i Pujol, AutonomousUniversity of Barcelona, 08916 Badalona, Spain. Telephone: 34 3 4651200 Ext. 346. Fax: 34 3 395 4206. E-mail: [email protected].

2 Abbreviations used: ARE, AU-rich element; AU-DD, AU-motif-directed display; Tm, melting temperature; RT, reverse transcrip-tion; RT-PCR, reverse transcription linked to PCR.

GENOMICS 54, 278–286 (1998)ARTICLE NO. GE985548

2780888-7543/98 $25.00Copyright © 1998 by Academic PressAll rights of reproduction in any form reserved.

Reasons of limited availability determined that cDNAs from celllines other than those just mentioned would be used instead in someexperiments (see Confirmation of differential expression). Jurkat, asbelonging to a T cell lineage (Weiss et al., 1984), and U937, as amonocyte-macrophage (Abrink et al., 1994), were taken expectingthey would mimic the behavior of the Tab122.12 and peripheralblood monocytes after activation. Jurkat was treated with 10 ng/mlPMA plus 0.4 mg/ml ionomycin for 5 h. U937 was incubated 5 h with0.1 mg/ml LPS plus 10 ng/ml PMA.

Cultures of the same cell types were maintained under basalconditions to provide controls for the stimulated cells. At the end ofthe incubation periods RNA was extracted as described below. Cellsgrown in suspension were pelleted and lysed immediately. Cellsgrown in monolayer were lysed in situ after decanting the superna-tant.

Oligonucleotides. Retrotranscription and PCR primers (custommade by Genset) are listed in Table 1. PCR primers contain twodistinctive domains, a guanosine-rich 59 region and a double AUmotif at the 39. The 59 configures into a sticky anchor that stabilizesprimer annealing, while the 39 confers specificity to AREs. There areoligos whose 39 just covers the AU motifs and others that enter asingle base into the inner sequence. Retrotranscription (RT) primershave a (dT)15 stretch with a degenerate base at the 39 end forannealing to the end of any 39UTR. In addition, they incorporate thesequence of the PCR primers at their 59 end with a degenerateposition to accommodate them all. Nomenclature: Independently oftheir 59 anchors, the oligos directed to double AU motifs are gener-ically designated AU2. Primers carrying an extra base at their 39 endare named AU2N, where N can be any of the four natural bases.Finally, the sequence of the 59 anchor determines the prefix of theprimer (G7 or GTG, see Table 1).

RNA extraction and DNase treatment. The single-step acid-phe-nol method (Chomczynski and Sacchi, 1987) was used with minormodifications: lysis was done at pH 4.0 with 30 s of mechanicalhomogenization (Ultraturrax T25; Ika) to ensure DNA shearing.Total RNA was measured by spectrophotometry. DNase treatmentwas performed with total RNA adjusted at 0.25 mg/ml and 0.2 U/mlDNase I (RQ1; Promega) for 30 min at 37°C in a solution containing10 mM Bis-Tris–HCl, pH 6.5, 1 mM EDTA, 5 mM MgCl2, 5 mM DTT,and 1 U/ml RNAsin (Clontech). RNA was ethanol precipitated in the

presence of glycogen (Boehringer Mannheim) or seeDNA (Amer-sham) as a carrier. Its integrity and concentration was assessed bytitration versus Escherichia coli rRNAs (Sigma) as standard by aga-rose gel electrophoresis and ethidium bromide staining (Sambrook etal., 1989). The absence of residual contaminating DNA was demon-strated by the failure in amplifying the genomic locus of IFNa, amulticopy gene, by PCR. Under otherwise standard conditions (seeunder cDNA normalization, below) a program of 40 cycles with anannealing temperature of 60°C was conducted (primers in Table 1B).

cDNA synthesis and further treatment. A single reverse tran-scription with any of the two RT primers shown in Table 1(G7AU2dT and/or GTGAU2dT) produced cDNA for a complete set ofAU-DD reactions with matching PCR primers (see below). Standardoligo(dT)15 was employed in control samples (Jurkat and U937).First-stranded cDNA was prepared with Superscript II (Gibco BRL)following the manufacturer’s instructions with minor modifications.Briefly, for a reaction volume of 20 ml, 2–3 mg of total RNA in waterand the RT primer at 1 mM were premelted at 72°C for 3 min, chilledon ice for 1 min, and supplemented at room temperature with theother components, except the enzyme. Annealing was allowed toproceed for 10 min at room temperature; 200 U SuperScript II wasthen added, and the mixture was incubated for 1 h at 42°C. Retro-transcription was finished by heating at 90°C for 2 min, and 1 U ofRNase H was added and incubated for 20 min at 37°C. Reactionproducts were washed once in Qiaquick columns (Qiagen) and elutedin 50 ml EE. EE (10 mM EPPS, 0.1 mM EDTA, pH 8.2) was used asa general elution/dilution solution. The eluates were used in cDNAnormalization and AU-DD.

cDNA normalization. To ensure comparability between the rest-ing and the stimulated cDNAs within each cell type, an initialassessment of their relative concentrations was performed. cDNAswere tested by PCR for their concentration in GAPDH, an estab-lished housekeeping gene (Adams et al., 1995). cDNA aliquots werediluted 1:5 and 1:50 and used as templates in 25 cycles of a standardPCR with annealing temperature of 60°C (94°C for 30 s, 60°c for 30 s,and 72°C for 30 s) and primers at 1 mM each (Table 1B). Productconcentration was estimated by ethidium bromide staining and vi-sual inspection, and cDNAs were normalized by dilution according totheir GAPDH equivalents if required. Typically no adjustment wasneeded.

TABLE 1

(A) Retrotranscription (RT) and PCR primers used in AU-DD

RT: G7AU2dT GGGGGGGTATTTATTTA(ACGT)TTTTTTTTTTTTTTT(ACG)

PCR: G7AU2 GGGGGGGTATTTATTTA G7AU2A GGGGGGGTATTTATTTAAGIAU2 GGGIIIITATTTATTTA G7AU2C GGGGGGGTATTTATTTAC

G7AU2G GGGGGGGTATTTATTTAGG7AU2T GGGGGGGTATTTATTTAT

RT: GTGAU2dT GGTGGGTGGTATTTATTTA(ACGT)TTTTTTTTTTTTTTT(ACG)

PCR: GTGAU2 GGTGGGTGGTATTTATTTA GTGAU2A GGTGGGTGGTATTTATTTAAGTIAU2 GGTIIITIITATTTATTTA GTGAU2C GGTGGGTGGTATTTATTTAC

GTGAU2G GGTGGGTGGTATTTATTTAGGTGAU2T GGTGGGTGGTATTTATTTAT

(B) Primers used in control PCR experiments

IFNa (J00207) IFNa513s GGCCTTGACCTTTGCTTTAIFNa915as CTTCATCAGGGGAGTCTCTGT

GAPDH (M33197) GAPDH19s TCTTCTTTTGCGTCGCCAGGAPDH390as AGCCCCAGCCTTCTCCA

Note. (A) Two alternative primer panels are shown. The inosine-containing oligo is used as an optional supplement and never in nestedreactions. Protocol 1 of AU-DD uses a single reaction with each of the five AU2 primers compatible with a given RT primer. (B) In parenthesesare the EMBL accession numbers for the sequences from which the primers have been derived. Numbers embedded in primer namesdesignate the position of their 59 end in the corresponding sequence.

279AU-MOTIF-DIRECTED DISPLAY

AU-motif-directed display. AU-DD is a PCR system based onempirically refined primers (Table 1A) intended to anneal at AUmotifs, regardless of their immediate sequence context and overcom-ing energetic constraints. Similar PCR amplifications are performedon two related cDNAs and their products analyzed side –by –side,allowing the detection and recovery of individual products differen-tially expressed between them.

Every reaction is done with a single primer that binds to both endsof the cDNA fragments being amplified. It works both as sense andas antisense when extending from natural AREs or from the se-quence complementary to the 59 part of the RT primer (Fig. 1),respectively. Depending on the particular RT primer used, a set ofcompatible PCR primers is selected (Table 1 and legend). Two alter-native and complementary AU-DD protocols have been used satis-factorily. Protocol 1 uses a single round of PCR, whereas protocol 2employs two rounds, with second or nested reactions. In protocol 1,five separate reactions are performed on each cDNA, one with eachof the primers AU2 (one) and AU2N (four). In protocol 2, a single firstreaction with the AU2 primer is followed by four distinct nestedreactions with each of the AU2N primers. Reactions were carried outin 10-ml volumes overlaid with a drop of mineral oil. Two microlitersof cDNA at two concentrations, neat and 1:5, served as template inindependent tubes. The primer was used at 3 mM in both the singlereaction of protocol 1 and the first round of protocol 2. In some casesit was supplemented with an inosine-containing primer (see Table 1)at 1 mM. In protocol 2, the nested reactions used as template a 1:50dilution of the first reaction products with a primer concentration of1.5 mM. Reaction mixtures contained 10 mM Tris–HCl, pH 8.8, 1.5mM MgCl2, 50 mM KCl, 0.1% TX-100, each of the four dNTPs at 0.2mM, and Dynazyme II polymerase (Finnzymes OY) at 50 mU/mladded in hot start. [a-32P]dATP (0.25 ml; 3000 Ci/mmol; DuPontNEN) was included in the reactions giving the final products. Reac-tions were run in a Minicycler (MJ Research) with the followingprofile: 94°C for 40 s, 42°C for 1 min 20 s, and 70°C for 40 s. Fortycycles were applied to the reactions of protocol 1 and 30 cycles to bothreactions of protocol 2.

Gel electrophoresis. Two microliters of products was mixed withnondenaturing loading buffer (Sambrook et al., 1989) and separatedin native 0.8-mm-thick 6% polyacrylamide gels (PAGE Plus; Am-resco) at 12 V/cm in TBE buffer. Gels were fixed and autoradio-graphed as for standard sequencing gels. Every set of four reactionscoming from the same cell line, both resting and activated, and ateach of the two cDNA concentrations was run in adjacent lanes.Individual bands were selected when unique or more intense in thereactions from the activated cells.

cDNA cloning. Gel slices containing selected bands were cut outof the dried gel after the autoradiograph was aligned and wereincubated in 0.2 ml EE for 3 h at 50°C. A further 1:20 dilution in EE

was used as template for reamplification. For this purpose the sameprimer and conditions of the original reaction were used, except forthe use of Pfu DNA polymerase (Stratagene). Products were blunt-end cloned in plasmid (pZero; Invitrogen) and sequenced with theTaq Dye Terminator kit in an ABI310 genetic analyzer (Perkin–Elmer).

Sequence analysis. Sequences were searched for homologues onEMBL databases, both EMBL DNA sequence databank and ESTdivisions, by using either FastA or Blast programs (http://www.ebi.ac.uk). Homologies equal to or higher than 95% for the full lengthof the AU-DD fragments were considered a sign of identity. cDNAfragments were accepted as corresponding to known genes when atleast a theoretical ORF had been reported. Since homologies torepetitive elements can affect the specificity of a cDNA fragmentwhen used as a probe, they are mentioned when equal to or higherthan 70%.

Confirmation of differential expression. To exclude fragmentscorresponding to genes not really associated to the activation of thecell lines, a confirmation of the differential expression was performedby semiquantitative RT-PCR. PCR primers specific to the selectedfragments were derived with the help of a software program. EitherOligo v5.0 (National Biosciences, Inc.) or Prime (GCG package) wasused by fixing as main parameter the oligo Tm (nearest neighbormethod). Since both programs give different default values, 63–65°Cwas selected in Oligo and 60–62°C in Prime. Reaction conditionssimilar to those described above, under cDNA normalization, wereemployed except for the increase in the number of cycles to 40 withnormalized cDNAs, resting and stimulated. As template, cDNA fromboth the original cell lines that were substrate for AU-DD andJurkat/U937 was used. By reason of substrate shortage the cDNAfrom the original sources was not always used.

RESULTS

Designing a Primer Directed to AU Motifs

A variety of AU-DD primers directed to single AUmotifs were tested in initial experiments. Their poorspecificity and performance prompted the design ofoligos with double AU pentamer motifs, as usuallyfound in rich AU-containing 39UTRs.

Results from experiments using two primer struc-tures differing in their 59 anchors are presented: GT-GAU2 and G7AU2 (Table 1). The 59 anchors influencethe annealing to natural AU sites and therefore thearray of cDNAs that are amplified during the PCR. Inthis way AU2 primers with different 59 anchors sampledistinct subsets of genes. The correctness of the primerdesign rationale was demonstrated in experimentsthat used an IL2 gene fragment containing the AU2sequence as template. Under otherwise similar condi-tions the GTGAU2 primer allowed the detection of 103

times fewer molecules of IL2 cDNA than G7AU2 (notshown). A better anchoring of GTGAU2 on IL2 does notnecessarily imply that it also anneals better on othergenes. Therefore both primers were used in parallelexperiments to increase the number of sampled genes.To keep structural simplicity, anchor domains contain-ing only G or G and T were used, but variations can beexpected to work as well as long as primer Tm ismaintained.

In an attempt to increase the affinity of the anchor,we tested inosine-containing primers in different se-quence configurations. When used alone, these primers

FIG. 1. Schematic representation of AU-DD. Dotted lines repre-sent newly synthesized strands. The RNA molecule at the top con-tains a double AU motif (AU2) and a poly(A) tail. GnAU2T15Vrepresents a generic RT primer with a 59 anchor of n guanosines, anAU2 sequence, and an oligo(dT) stretch of 15 thymidines. Underlinedare primer parts whose names are written inverted with respect tothe actual orientation of the sequence for ease of representation. Anested reaction is performed in AU-DD of protocol 2 (see text).

280 DOMINGUEZ ET AL.

reduced the system sensitivity and reproducibility onthe IL2 cDNA. However, when used to supplementstandard primers, a small but consistent gain in thenumber of products obtained from total cDNA wasnoticed, even when sensitivity—to the IL2 standard—was not improved (not shown). Profile reproducibilityamong replicas was excellent for the primers and con-ditions described.

Technical Comments

Both AU-DD protocols, with single or nested reac-tions, are equally reliable and were implemented toincrease the number of products, since each revealeddifferent profiles on the same cDNAs (not shown).

Initial cDNA concentration can influence the finaldisplay, with lower concentrations reducing the repro-ducibility. Nevertheless, when the experiment was be-gun with the mentioned amount of RNA the resultswere consistent. The cDNA concentration was testedindirectly, and found to be reproducible, when the con-centration of GAPDH was checked at the normaliza-tion step.

During radioactive PCR, a cold dNTP concentrationof 0.2 mM was preferred over the standard 0.02 mM.Our conditions gave stronger signals and lower back-ground smear. Interestingly, the cDNA profiles ob-tained with each concentration were different, a find-ing that can be exploited to increase the number of newbands from the same cDNA by merely varying thedNTP concentration in parallel experiments.

Analysis of the AU-DD Fragments

The mRNA displays obtained by AU-DD resemblethose from typical RNA fingerprints (Liang andPardee, 1992; Welsh et al., 1992). Figure 2 shows as anexample an AU-DD display from adherent monocytes.

Both up- and down-regulated genes are noticeableafter specific activation. From separate experiments atotal of 73 fragments seen as upregulated on the gelswere cloned and sequenced (Tables 2 and 3). Occasion-ally a given gene was cloned repeatedly in differentexperiments. Sequences from 59 different genes wereobtained of which only 8 (14%) correspond to knowngenes (Table 2). Among the 8 known genes, 2 corre-spond to cytokines (TNFa and IL-8), 2 to signal trans-ducers (CL100 and p167), 2 to transcription factors(HIF-1 and G0S24), 1 to a less characterized immedi-ate-early gene (DIF-2), and 1 to a gene associated withmorphogenesis (CAZ-1). The remaining 51 fragments(86%) belong to uncharacterized genes (Table 3), ofwhich 19 (37%) were present as ESTs in the databasesat the moment this paper was being written.

Two cDNAs, YG40-3B and EE2-16E1, which accountfor 3% of the cloned fragments, have a sequence homol-ogy of about 70–80% of their total length to repetitiveelements, and they were regarded as not useful forcloning the full-length cDNA. Another 13 cDNAs con-tain repetitive elements, but specific fragments longerthan 80 bp can be defined and used for library screen-ing.

The differential expression of AU-DD fragments wasreassessed before undertaking full-length cloning. Thiswas performed by specific RT-PCR on normalizedcDNA samples from cell lines, both activated and rest-

FIG. 2. Typical AU-DD gel. Results from adherent monocytesusing the AU2A primer in a single PCR (protocol 1) are shown. Lanes1 and 2 present fingerprints from activated cells. Lanes 3 and 4,resting cells. Neat cDNA was used for lanes 1 and 3 and diluted (1:5)for 2 and 4. Arrows signal fragments from differentially expressedgenes.

TABLE 2

Known genes (in Parentheses Their EMBL Acces-sion Number) That Were Cloned as AU-DD Fragments,with Their Origin and Size

GeneAU-DD

fragment Cell typeLength

(bp)Poly(A)signala

TNFa YG39-2 Tab122.12 300 1(X02910) EE2-16F2 Adh 298CL 100 YG39-3 Tab122.12 565 1(X68277) ED166-8C AdhIL-8 ED166-8B id. 662 1(M28130) EE2-8CDIF-2 YG40-2 Tab122.12 343 1(Y14551) ED166-12D Adh 403p167 LG43-4A2 Tab122.12 450 1(U58046) LG141-7B1 AdhHIF-1 LG141-7A id. 542 1(U22431) ED128-7A 483GOs24 EE2-12C id. 200 1(M63625)CAZ 1 EE2-16F1 id. 357 2(U56637)

Note. When a gene was cloned in independent experiments differ-ent fragment names appear in the corresponding column.

a “1” or “2”, presence or absence of polyadenylation signal, respec-tively.


TABLE 3

AU-DD Fragments That Correspond to Uncharacterized Genes (without Any Defined ORF)Selected from Activated Samples

Fragment(Acc. No.) Cell type

AU-DD primer/s,protocol

Poly(A)signal Notes

ExtraAU? Diff. Exp.

YG31-1 G7AU2, 2 Tab122.12(2)YG81-3B Tab122.12 GTGAU21GTIAU2, 2 2 R01220 1 Jurkat (nd)LG43-4B2 G7AU21GIAU2, 1 U937 (3)(AJ227854)YG31-2 id. G7AU2, 2 2 Aa501227 No No(AJ227855)YG31-3 Tab122.12 (2)YG81-4 id. G7AU2, 2 1 Aa419514 3 U937 (2)(AJ227856, A

J227857)YG31-4 id. G7AU2, 2 1 N52963 3 Tab122.12 (1)(AJ227858) U937 (0)YG36-1 id. G7AU2, 2 1 Aa218859 1 Tab122.12 (0)(AJ227859) Jurkat (0)

U937 (1)YG39-1A id. GTGAU21GTIAU2, 2 2 1 1 Tab122.12 (1)(AJ227860) U937 (1)YG39-1B id. GTGAU21GTIAU2, 2 2 1, Rep 58% No Tab122.12 (1)(AJ227861) U937 (1)YG39-1C id. GTGAU21GTIAU2, 2 1 C14198, 1 Tab122.12 (2)(AJ227862) Rep 58% U937 (1)YG39-2B id. GTGAU21GTIAU2, 2 1 Aa516297 2 Tab122.12 (3)(AJ227863) U937 (2)YG40-1A id. GTGAU21GTIAU2, 2 2 1, Rep 34% 2 Tab122.12 (3)(AJ227864) U937 (2)YG40-1B id. GTGAU21GTIAU2, 2 1 1 1(AJ227865)YG40-3A id. GTGAU21GTIAU2, 2 2 1 1(AJ277866)YG40-3B id. GTGAU21GTIAU2, 2 2 Rep 87% 1(AJ227867)YG40-4 id. GTGAU21GTIAU2, 2 Tab122.12 (3)ED166-8F Adh GTGAU2A, 1 1 N22044 1 U937 (3)EE2-12B id. G7AU2T, 1 Jurkat (0)(AJ227868) Adh (3)YG40-5 Tab122.12 GTGAU21GTIAU2, 2 1 Aa187437 No Tab122.12 (2)(AJ227869) U937 (0)YG81-1 id. GTGAU21GTIAU2, 2 2 1, Rep 62% 3(AJ227870)YG81-2A id. GTGAU21GTIAU2, 2 2 1, Rep 74% No(AJ227871)YG81-2B id. GTGAU21GTIAU2, 2 1 Aa406363 1(AJ227872)YG81-3A id. GTGAU21GTIAU2, 2 1 1, 2, Rep 35% 2(AJ227873)YG81-5A id. GTGAU21GTIAU2, 2 1 Aa451694 2(AJ227874)YG81-5B id. GTGAU21GTIAU2, 2 2 1 1(AJ227875)YG81-6 id. GTGAU21GTIAU2, 2 2 N68517 No(AJ227876)LG43-4A1 id. G7AU21GIAU2, 1 2 Aa582778, No Tab122.12 (1)(AJ227877) Rep 71% Jurkat (0)

U937 (1)LG43-4B1 id. G7AU21GIAU2, 1 2 1 No Jurkat (0)(AJ227878) U937 (1)LG141-7B2 Adh G7AU2, 2 2 1 2 U937 (2)(AJ227879) Jurkat (0)LG141-7C id. G7AU2, 2 1 1, Rep 76% 1 U937 (2)(AJ227880) Jurkat (0)LG141-8A id. G7AU2, 2 2 1 1 U937 (3)(AJ227881) Jurkat (0)ED82-4A1 id. G7AU2, 1 2 1, Rep 60% 1(AJ227882)


ing (Fig. 3). This assay was not done when the se-quences corresponded to characterized genes, but onlyon selected unassigned fragments. Of 25 tested frag-ments, 23 (92%) were confirmed to be differentiallyexpressed. As shown in Table 3, the tested fragmentswere generally not differentially expressed in Jurkateven though they were in Tab122.12. Tests of activa-

tion done on our samples (not shown) observing acti-vation markers like CD69 in Tab122.12 and cytokinegene transcription in all the cell lines (IL2, TNFa),indicate that our cell activation protocols did work andthat the starting conditions were at least relativelybasal. The result in Jurkat may be explained by thefact that as a transformed cell line (T cell lymphoma;

TABLE 3—Continued

Fragment(Acc. No.) Cell type

AU-DD primer/s,protocol

Poly(A)signal Notes

ExtraAU? Diff. Exp.

ED82-4A2 G7AU2, 1 Adh (3)ED82-7A id. G7AU21GIAU2, 1 2 1 2 U937 (3)(AJ227883) Jurkat (1)ED82-7B id. G7AU21GIAU2, 1 2 1 1 Adh (0)(AJ227884)ED82-7C id. G7AU21GIAU2, 1 2 1 2 Adh (2)(AJ227885) U937 (2)

Jurkat (0)ED84-3A id. G7AU2A, 1 2 1 No Adh (3)EE2-8D U937 (nd)(AJ227886) Jurkat (nd)ED106-4B id. GTGAU2, 1 1 Aa676214 2(AJ227887)ED109-4A id. G7AU2, 1 2 1 1 Adh (2)ED166-8E GTGAU2A, 1(AJ227888)ED109-8A id. G7AU2, 1 2 1, Rep 21% 1 Adh (0)(AJ227889)ED166-4A1 id. GTGAU2C, 1 1 2, R51429 No(AJ227890)ED166-4A2 id. GTGAU2C, 1 2 1, 2 No(AJ227891)ED166-8A id. GTGAU2A, 1 2 W31454 1 Adh (1)(AJ227892)ED166-8D id. GTGAU2A, 1 2 1, Rep 14% No(AJ227893)ED166-12B id. GTGAU2T, 1 2 1, 2 No(AJ227894)ED166-12F id. GTGAU2T, 1 1 Aa430106 1(AJ227895)EE2-4A id. G7AU2G, 1 2 1 1 Adh (3)(AJ227896)EE2-4B id. G7AU2G, 1 1 1, Rep 50% 2 Adh (1)(AJ227897)EE2-8E id. G7AU2A, 1 2 1 1(AJ227898)EE2-12A id. G7AU2T, 1 2 Aa531187 No(AJ227899)EE2-16B id. G7AU2C, 1 2 F00947 2(AJ227900)EE2-16C id. G7AU2C, 1 2 Aa652723 No(AJ227901)EE2-16D id. G7AU2C, 1 2 1, Rep 74% No(AJ227902)EE2-16E1 id. G7AU2C, 1 1 1, Rep 100% 1(AJ227903)EE2-16E2 id. G7AU2C, 1 2 1, 2 No(AJ227904)

Note. Two fragments in the same row are fragments corresponding to the same gene, isolated independently under different conditions.“AU-DD primer/s” refers to the one/s used during the single reaction of protocol 1 or in the first reaction of protocol 2. “Notes,” when anaccession number is present it refers to a representative EST that corresponds to the same gene, when any found; 1, no identities are foundin the database; 2, fragment lacking the poly(A) stretch; Rep X%, X% of the sequence length is occupied by a repetitive element (Alu, MER,etc). “Extra AU?” indicates how many more AU pentamers than those of the primer are contained in the fragment, if any. “Diff. Exp.,” resultof the confirmation of differential expression, if performed (as in the Fig. 3), describing the cell type tested and a score in arbitrary unitsincreasing from 0 to 3 (nd, not detected). Adh, adherent peripheral blood monocytes.


Weiss et al., 1984) its basal state is already activated,and although our activation increased the level of themarker (IL2) it did not affect the one of the AU-DDgenes examined. In contrast, the activated U937 fol-lowed the same tendency in terms of AU-DD gene tran-scription as the activated blood monocytes (Table 3).

The cloning of a number of genes listed in Table 3 iscurrently under progress.

DISCUSSION

AU-rich elements are found in 39 untranslated re-gions of many highly unstable mRNAs for mammalianearly-response genes (Shaw and Kamen, 1986). Thecore of these RNA-destabilizing elements is one ormore copies of the AUUUA pentanucleotide (AU motif)and a high content of uridylate and sometimes alsoadenylate residues. From a functional point of viewseveral pentanucleotides clustered in close proximityhave been defined as integral features of most AREs(Xu et al., 1997).

This report describes a procedure for the isolation ofcDNA fragments from ARE-containing mRNAs. As im-plemented, AU-DD has revealed genes both up-regu-lated and down-regulated after specific activation ofthe cell substrates (Fig. 2).

The key element is a primer design whose 39 partprovides specificity to AREs while a 59 nonspecific an-chor increases Tm and favors annealing. These twodomains of the oligonucleotide are expected to annealin a cooperative way, each one requiring and facilitat-ing the annealing of the other.

The reverse transcriptase primer also incorporates asignificant improvement with respect to other systemsby including the PCR primer sequence at the 59 end.This allows the PCR to proceed with a unique primerand avoids the single-primer artifacts generated whentwo oligos are used at these low annealing tempera-tures. In fact, only 8% of products (5/59) lack thepoly(A) tail (Table 3).

With respect to the AU2 primer, both the 59 anchorand the AU2 domain have performed as expected (Ta-ble 4). Whenever the specific AU2 end found a goodmatch it was extended regardless of the anchor. Oth-

erwise, mismatches at the AU2 did not prevent primerextensions when stabilization was provided by the an-chor. These are the cases of DIF-2 (mismatch at 22with respect to the primer 39 end) and HIF-1a (mis-match at 21).

It might seem that the use of primers directed todouble-AU motifs reduces the number of genes thatcan be sampled. However, in our experiments AU-DDhas amplified cDNAs containing even single AU motifs.In fact, there were only two cases (TNFa and IL-8) inwhich the AU2 primer extended from a complete dou-ble-AU element (Table 4).

In addition to variations in primer design, differentprotocols using one or two PCR rounds can be appliedto compensate limitations of sample or increase thenumber of genes being analyzed. Products presented inthis report were derived from one or two reaction pro-tocols.

On some occasions the same gene was found in dif-ferent starting material under different AU-DD condi-tions. Fragments from TNFa, CL100, DIF-2, and p167(Table 2) were isolated from different sources. cDNAfrom unknown genes, such as YG31-1, YG40-4, orED109-4A (Table 3) were also cloned from differenttissue and/or different primer combinations. This sug-gests that AU-DD is sampling efficiently AU-contain-ing genes, with some of the more abundant being iso-lated more than once.

Another independent attempt to isolate AU-contain-ing genes by differential display has been reportedrecently (Gonsky et al., 1997). It contains some se-quence information from 10 cDNA products with 50%of them having homologies to known loci. Among themthere is a formerly detected potential transcriptionfactor.

We report here a larger set of fragments with a neatclass distribution. Although only 14% of the cDNAsbelong to characterized genes, their features demon-strate the efficiency of the method (Tables 2 and 4).They fall into the expected categories of transcriptionfactors, signal transducers, and cytokines (Shaw andKamen, 1986). In every case, the AU-DD fragmentsisolated from them begin at AREs located at their39UTRs. In addition, more than 90% of tested cDNAswere confirmed to be differentially expressed.

When trying to identify ARE-containing genes,AU-DD has particular features with clear advantages.It constitutes a solid technique with a collection ofoligos that work reliably with proposed modificationsto probe differently the transcript repertoire of a givensample.

RAP or differential display protocols claimed to bespecific for gene motifs are useful even when theirspecificity is low, provided they generate a reproduc-ible pattern with discernible differences. Other ex-amples of targeted differential display have usedlonger and well-conserved motifs from multigenefamilies. These include zinc finger motifs (Stone andWharton, 1994; Donohue et al., 1995), plant MADS

FIG. 3. Confirmation of the differential expression of threeAU-DD fragments taken as examples by specific RT-PCR in dupli-cate reactions. Lanes 1, cDNA fragment YG31-1; lanes 2, fragmentYG31-3; lanes 3, fragment YG31-4. Lanes R, cDNA from restingU937 cells; lanes S, cDNA from stimulated U937 cells. Genes YG31-1and YG31-3 are considered differentially expressed. Gene YG31-4 isconsidered a false DD positive.


boxes (Fischer et al., 1995), and motifs specific forheat-shock proteins (Joshi et al., 1997). They takeadvantage of six to eight conserved codons per site todesign primers that can predictably work well onPCR. In contrast, our protocol has tackled a moredifficult motif. The low Tm of the short AU domainhas been overcome with a primer design that allowsa highly specific PCR amplification of AU-motif-con-taining cDNAs.

Individual genes with functional AREs, c-fos, c-jun,GM-CSF, etc. (Chen and Shyu, 1995; Edwards andMahadevan, 1992; Shaw and Kamen, 1986; Xu et al.,1997), are considered to be of transient appearance,being suddenly transcribed in response to an activatoror else in cell transformation. In this context it issurprising to see ARE-containing genes expressed un-der apparent basal conditions or even down-regulatedafter activation.

From results on the analyzed cDNA products it isapparent that most of bands that seem differentiallyexpressed in the AU-DD gels actually are differentiallyexpressed. On the other hand, it can be guessed byexamining the group of known genes that most, if notall, of the differentially expressed bands correspond togenes with functional AREs. Therefore it can be hy-pothesized that the down-regulated messages seen inAU-DD gels are likely to be down-regulated genes con-taining functional AREs. These genes showing a con-trary behavior have not been explored.

AU-DD can be employed in conjunction with othermethods that select genes with a distinct feature toincrease or modulate its resolution. As an example,cDNA libraries of leader-sequence-containing genes(Klein et al., 1996) could be a convenient substrate forAU-DD to isolate secreted inflammatory proteins.

At this time of thorough coverage of expressed

TABLE 4

Binding Sites Used by the AU2 Primers on the Isolated Known Genes

AU-DDfragment Gene Anchoring position

YG39-2 TNFa 3061 ATTATTTATTTATTATTTATTTA 3083(AJ227911) (X02910) : : ::::::::::

GTGAU2 GGTGGGTGGTATTTATTTAGTIAU2 GGTIIITIITATTTATTTA

EE2-16F2 TNFa 3066 TTATTTATTATTTATTTATTTAC 3088(AJ227911) (X02910) :::::::::::

G7AU2C GGGGGGGTATTTATTTACYG39-3 CL 100 1421 CTCGAGAGGGCTGGTCCTTATTTA 1444(AJ227912) (X68277) : :: :::: :::::::

GTGAU2A GGTGGGTGGTATTTATTTAGTIAU2 GGTIIITIITATTTATTTA

ED166-8C CL 100 1421 CTCGAGAGGGCTGGTCCTTATTTAT 1445(AJ227912) (X68277) : :: :::: ::::::::

GTGAU2T GGTGGGTGGTATTTATTTATED166-8B IL8 4033 TATTTATTATTTATGTATTTATTTAA 4058(AJ227913) (M28130) : : ::::::::::::

GTGAU2A GGTGGGT-GGTATTTATTTAAEE2-8C IL8 4033 TATTTATTATTTATGTATTTATTTAA 4058(AJ227913) (M28130) ::::::::::::

G7AU2A GGGGGGGTATTTATTTAAYG40-2 DIF-2 848 ATGCAGGTCTCTTGGTATTTATTGA 872(AJ227914) (Y14551) ::: ::::::::::: :

GTGAU2 GGT-GGGTGGTATTTATTTAGTIAU2 GGT-IIITIITATTTATTTA

ED166-12D DIF-2 785 GAGATGTGTACGTAATATTTATTTTAA 811(AJ227914) (Y14551) : :: :: :::::: :::::

GTGAU2A G-GTGGGTGGTATTTA-TTTAALG43-4A2 p167 4791 GATACGGTGGGGT-TTTCTTTA 4811LG141-7B1 (U58046) :: ::::: ::: ::::(AJ227915) G7AU2 GGGGGGGTATTTATTTALG141-7A HIF-1a 3190 TAGAAGGTATGTGGCATTTATTTG 3213(AJ227916) (U22431) :: : :: ::::::::

G7AU2 GG--GGGGGTATTTATTTAEE2-12C G0s24 1482 TTATTTATGACGACTTTATTTAT 1504(AJ227917) (M63625) : : :::::::::

G7AU2 GGGGGGGTATTTATTTATEE2-16F1 CAZ 1 2049 TGGTAATGGTGG-ATTCATTTA 2069(AJ227918) (U56637) :: :: ::: :::::

G7AU2 GGGGGGGTATTTATTTA

Note. Binding sites are prolonged at their 59 ends relative to the AU2 primer to illustrate the sequence context. In parentheses are theEMBL accession numbers. The inosine-containing primer is shown when it was present.


human genes by cDNA and EST projects, it is en-couraging how a nonautomated procedure can stillyield such a high fraction of hits among the stillunknown genes. The reason may reside in the natureof these genes, with their inducible expression andinherent instability, which would make them elusiveto identification by random sequencing of standardlibrary clones. Our protocol may certainly be usefulto scientists looking for immediate-early genes with-out the need of direct access to high-throughput fa-cilities.

ACKNOWLEDGMENTS

This work has been supported in part by the CDTI as ConcertedProjects 95/0184 and 97/0313. We acknowledge D. Jaraquemada, M.Catalfamo, and C. Roura-Mir, for supplying the cell lines, and X.Vargas for monocyte isolation.

REFERENCES

Abrink, M., Gobl, A. E., Huang, R., Nilsson, K., and Hellman, L.(1994). Human cell lines U-937, THP-1 and Mono Mac 6 representrelatively immature cells of the monocyte–macrophage cell lin-eage. Leukemia 8:: 1579–1584.

Adams, M. D., Kerlavage, A. R., Fleischmann, R. D., Fuldner, R. A.,Bult, C. J., Lee, N. H., Kirkness, E. F., Weinstock, K. G., Gocayne,J. D., White, O., et al. (1995). Initial assessment of human genediversity and expression patterns based upon 83 million nucleo-tides of cDNA sequence. Nature 377: 3–174.

Caput, D., Beutler, B., Hartog, K., Thayer, R., Brown-Shimer, S., andCerami, A. (1986). Identification of a common nucleotide sequencein the 39-untranslated region of mRNA molecules specifying in-flammatory mediators. Proc. Natl. Acad. Sci. USA 83: 1670–1674.

Chen, C. Y., and Shyu, A. B. (1995). AU-rich elements: Character-ization and importance in mRNA degradation. Trends Biochem.Sci. 20: 465–470.

Chomczynski, P., and Sacchi, N. (1987). Single-step method of RNAisolation by acid guanidinium thiocyanate–phenol–chloroform ex-traction. Anal. Biochem. 162: 156–159.

Donohue, P. J., Alberts, G. F., Guo, Y., and Winkles, J. A. (1995).Identification by targeted differential display of an immediateearly gene encoding a putative serine/threonine kinase. J. Biol.Chem. 270: 10351–10357.

Edwards, D. R., and Mahadevan, L. C. (1992). Protein synthesisinhibitors differentially superinduce c-fos and c-jun by three dis-tinct mechanisms: Lack of evidence for labile suppressors. EMBOJ. 11: 2415–2424.

Fischer, A., Saedler, H., and Theissen, G. (1995). Restriction frag-ment length polymorphism-coupled domain directed differential

display: A highly efficient technique for expression analysis ofmultigene families. Proc. Natl. Acad. Sci. USA 92: 5331–5335.

Gonsky, R., Knauf, J. A., Elisei, R., Wang, J. W., Su, S., and Fagin,J. A. (1997). Identification of rapid turnover transcripts overex-pressed in thyroid tumors and thyroid cancer cell lines: Use of atargeted differential RNA display method to select for mRNAsubsets. Nucleic Acids Res. 25: 3823–3831.

Joshi, C. P., Kumar, S., and Nguyen, H. T. (1996). Application ofmodified differential display technique for cloning and sequencingof the 39 region from three putative members of wheat HSP70 genefamily. Plant Mol. Biol. 30: 641–646.

Klein, R. D., Gu, Q., Goddard, A., and Rosenthal, A. (1996). Selectionfor genes encoding secreted proteins and receptors. Proc. Natl.Acad. Sci. USA 93: 7108–7113.

Liang, P., and Pardee, A. B. (1992). Differential display of eukaryoticmessenger RNA by means of the polymerase chain reaction. Sci-ence 257: 967–971.

Mullis, K. B., and Faloona, F.,A. (1987). Specific synthesis of DNA invitro via a polymerase-catalized chain reaction. Methods Enzymol.155: 335–350.

Roura-Mir, C., Catalfamo, M., Sospedra, M., Alcalde, L., Pujol-Bor-rell, R., and Jaraquemada, D. (1997). Single cell analysis of intra-thyroidal lymphocytes shows differential cytokine expression inHashimoto’s and Graves’ disease. Eur. J. Immunol. 27: 3290–3302.

Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989). “MolecularCloning: A Laboratory Manual,” Cold Spring Harbor LaboratoryPress, Cold Spring Harbor, NY.

Shaw, G., and Kamen, R. (1986). A conserved AU sequence from the39 untranslated region of GM-CSF mRNA mediates selectivemRNA degradation. Cell 46, 659–667.

Stewart, J., Glass, E. J., Weir, D. M., and Daha, M. R. (1986).Macrophage membrane receptors. In “Handbook of ExperimentalImmunology” (D. M. Weir, Ed.), Vol. 2, pp. 48.1–48.17, BlackwellSci., Oxford.

Stone, B., and Wharton, W. (1994). Targeted RNA fingerprinting:The cloning of differentially-expressed cDNA fragments enrichedfor members of the zinc finger gene family. Nucleic Acids Res. 22:2612–2618.

Weiss, A., Wiskocil, R. L., and Stobo, J. D. (1984). The role of T3surface molecules in the activation of human T cells: A two-stim-ulus requirement for IL 2 production reflects events occurring at apre-translational level. J. Immunol. 133: 123–128.

Welsh, J., Chada, K., Dalal, S. S., Cheng, R., Ralph, D., and McClel-land, M. (1992). Arbitrarily primed PCR fingerprinting of RNA.Nucleic Acids Res. 20: 4965–4970.

Xu, N., Chen, C. Y., and Shyu, A. B. (1997). Modulation of the fate ofcytoplasmic mRNA by AU-rich elements: Key sequence featurescontrolling mRNA deadenylation and decay. Mol. Cell Biol. 17:4611–4621.


cloning of are-containing genes by au-motif-directed display

Documents