comparative analysis of mouse bone marrow and adipose tissue … · 2021. 1. 13. · research open...

RESEARCH Open Access

Comparative analysis of mouse bonemarrow and adipose tissue mesenchymalstem cells for critical limb ischemia celltherapyPegah Nammian1, Seyedeh-Leili Asadi-Yousefabad2, Sajad Daneshi3, Mohammad Hasan Sheikhha4,5,Seyed Mohammad Bagher Tabei6,7* and Vahid Razban1,8*

Abstract

Introduction: Critical limb ischemia (CLI) is the most advanced form of peripheral arterial disease (PAD) characterizedby ischemic rest pain and non-healing ulcers. Currently, the standard therapy for CLI is the surgical reconstruction andendovascular therapy or limb amputation for patients with no treatment options. Neovasculogenesis induced bymesenchymal stem cells (MSCs) therapy is a promising approach to improve CLI. Owing to their angiogenic andimmunomodulatory potential, MSCs are perfect candidates for the treatment of CLI. The purpose of this study was todetermine and compare the in vitro and in vivo effects of allogeneic bone marrow mesenchymal stem cells (BM-MSCs)and adipose tissue mesenchymal stem cells (AT-MSCs) on CLI treatment.

Methods: For the first step, BM-MSCs and AT-MSCs were isolated and characterized for the characteristic MSCphenotypes. Then, femoral artery ligation and total excision of the femoral artery were performed on C57BL/6 mice tocreate a CLI model. The cells were evaluated for their in vitro and in vivo biological characteristics for CLI cell therapy.In order to determine these characteristics, the following tests were performed: morphology, flow cytometry,differentiation to osteocyte and adipocyte, wound healing assay, and behavioral tests including Tarlov, Ischemia,Modified ischemia, Function and the grade of limb necrosis scores, donor cell survival assay, and histological analysis.

Results: Our cellular and functional tests indicated that during 28 days after cell transplantation, BM-MSCs had a greateffect on endothelial cell migration, muscle restructure, functional improvements, and neovascularization in ischemictissues compared with AT-MSCs and control groups.

Conclusions: Allogeneic BM-MSC transplantation resulted in a more effective recovery from critical limb ischemiacompared to AT-MSCs transplantation. In fact, BM-MSC transplantation could be considered as a promising therapy fordiseases with insufficient angiogenesis including hindlimb ischemia.

Keywords: Mesenchymal stem cells, Angiogenesis, Cell therapy, Critical limb ischemia

© The Author(s). 2021 Open Access This article is licensed under a Creative Commons Attribution 4.0 International License,which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you giveappropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate ifchanges were made. The images or other third party material in this article are included in the article's Creative Commonslicence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commonslicence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtainpermission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to thedata made available in this article, unless otherwise stated in a credit line to the data.

* Correspondence: [email protected]; [email protected] of Genetics, Shiraz University of Medical Science, Shiraz, Iran1Department of Molecular Medicine, School of Advanced Medical Sciencesand Technologies, Shiraz University of Medical Sciences, Shiraz, IranFull list of author information is available at the end of the article

Nammian et al. Stem Cell Research & Therapy (2021) 12:58 https://doi.org/10.1186/s13287-020-02110-x

http://crossmark.crossref.org/dialog/?doi=10.1186/s13287-020-02110-x&domain=pdfhttp://orcid.org/0000-0002-8966-6081http://creativecommons.org/licenses/by/4.0/http://creativecommons.org/publicdomain/zero/1.0/mailto:[email protected]:[email protected]

IntroductionCritical limb ischemia (CLI) is the most severe form ofperipheral artery disease (PAD) in which associates withcardiovascular events, ulceration, high risk of limb am-putation, infection, gangrene, and death [1, 2]. CLIcauses by atherosclerosis that leads to narrowing and ob-structions of arteries that supply the lower extremities[3]. In addition, CLI shows the appearance of extensiveatherosclerosis related to smoking, diabetes, hyperchol-esterolemia, and age [4]. Twenty percent of the mortalityrate during 6 months after the diagnosis and 50% at 5years reported. The cause of this extensive mortality rateprobably relates to the systemic aspect of cardiovasculardiseases [5]. Standard therapy for increasing blood flowto the affected extremity is surgical or endovascular re-vascularization and limb amputation [6]. While revascu-larization is the first-line treatment for CLI, medicaltherapy also considers a required therapeutic supple-ment. The main purpose of medical therapy is to inhibitmyocardial infarction, stroke, and death, but it furtherhelps to speed up wound healing, impede amputation,and also improve quality of life [7]. However, nearly halfof patients with CLI are not suitable for revasculariza-tion procedures because of high operative risk or un-desirable endovascular anatomy [8]. As a result, the useof experimental stem cell therapy (SCT) and also genetherapy in order to stimulate angiogenesis emerged as apromising alternative for the treatment of disorders re-lated to limb ischemia [9, 10].

Background on stem cell therapy for CLIIn the last few years, investigators have used cellulartherapies in order to improve blood flow to the ischemiclimb via transplanting cells that have the potential toinduce the formation of new blood vessels [11]. As amatter of fact, cell-based therapies have been exploredas a promising treatment for CLI patients who have nooption for surgical or endovascular revascularization[11, 12]. Different cell types have been used includingbone marrow-derived mononuclear cells (BMMNCs),bone marrow mesenchymal stem cells (BMMSCs),endothelial progenitor cells (EPCs), blood-derived pro-genitor cells, adipose tissue mesenchymal stem cells(ATMSCs), and other bone marrow-derived progeni-tors [13, 14]. In fact, mesenchymal stem cell (MSC)transplantation has been proposed as a novel and ef-fective treatment approach for tissue engineering andregenerative medicine for diverse disease states like is-chemic disorders, including CLI [15, 16].MSCs are multipotent non-hematopoietic and fibroblast-

like adherent cells that can isolate from different tissuesources, such as the bone marrow, placenta, adipose tissue,dental pulp, and umbilical cord blood [17, 18]. They areable to differentiate into various types of cells such as the

bone, cartilage, fat, and muscle and also show specificsurface antigen expression. In addition to the ability of celldifferentiation, MSCs perform their therapeutic effectsthrough the secretion of paracrine factors that have angio-genic, anti-apoptotic, anti-inflammatory, and immunomod-ulatory effects [19]. As a matter of fact, they can promotereparative processes via secretion of soluble molecules,MSC-derived growth factors, and extracellular matrix com-ponents that have paracrine mechanisms and also differen-tiation into specific cells [20–22].Investigations about stem cell-based therapy for CLI

focus on the use of bone marrow mesenchymal stemcells and support by clinical evidences [23]. Mesenchy-mal stem cells (MSCs) consist of nearly 0.001 to 0.08%of cells within the bone marrow and are nonhemato-poietic stromal cells be able to differentiate into mesen-chymal lineages, such as the muscle, bone, cartilage, andfat. They can be culture-expanded easily to harvest alarge number of cells. In addition, these cells can bestored for both autologous and allogeneic use [24]. Innumerous preclinical studies, the therapeutic angiogen-esis of bone marrow mesenchymal stem cells (BMMSCs)was proved, and also, there are strong evidences thatBMMSCs have the potential to produce growth factors,angiogenesis-related cytokines, chemokines and extracel-lular matrix molecules, and also have similar cellular andmolecular properties with pericytes [25, 26]. Severalanimal experiments demonstrated that transplantedBMMSCs could induce more advantages than BMMNCsfor the treatment of CLI [27]. The intramuscular (IM)injection of MSCs in animals with CLI indicated zonalangiogenesis and improved blood flow via paracrine sup-port of injured cells and a process of local progenitorcell differentiation, and also the regulation of angiogenicfactors secretion. Furthermore, MSCs involved in therestoration of vascular integrity and neovascularizationafter injury via direct differentiation into blood vesselcells and also upregulate proangiogenic factors expres-sion [28, 29].Therapeutic application of stem cells for the treatment

of CLI does not have to be derived only from the bonemarrow but also MSCs from the adipose tissue can beused [30]. In the last few years, the adipose tissue used alot in tissue repair and regeneration owing to its varietyof ingredients and functions [31]. The benefits of adi-pose tissue cells are the abundant source, stable accessi-bility, simple procedures of collection, and also possessnearly 40 times more stem cells than the bone marrow[32]. Adipose tissue-derived stem cells (ASCs) indicatestable growth and proliferation kinetics and can differenti-ate into chondrogenic, osteogenic, myogenic, adipogenic,and neurogenic lineages. In addition, the differentiationpotential of ASCs into vascular smooth muscle cells andvascular endothelial cells (VECs) was demonstrated [33].

Nammian et al. Stem Cell Research & Therapy (2021) 12:58 Page 2 of 15

ASCs secrete angiogenesis-related cytokines, such as vas-cular endothelial growth factor (VEGF) and hepatocytegrowth factor (HGF), in order to induce angiogenesis inischemic tissue [34]. Wang et al. investigated the thera-peutic effect of ASCs on the infarcted rat hearts, and theirresults indicated that ASCs can improve cardiac function,hinder ventricular remodeling, and increase angiogenesisin the infarct border zone after MI [35]. The applicationof autologous ASCs in a mouse model of ischemic limbdisease indicates that the transplantation of ASCs leads toa fast improvement of blood flow and enhances capillarydensity in the ischemic muscle tissue [36]. Fan et al. exam-ined the distribution and kinetics of engrafted ASCs aftertransplantation in a mouse hindlimb ischemia model via3D multimodality imaging technique and realized thatASCs perform proangiogenic effects through a VEGF/mechanistic target of rapamycin/Akt-dependent pathway[37]. Moreover, the angiogenic potential of xenogeneic(human) ASCs assessed in a mouse model of hindlimb is-chemia, and the transplantation of hASCs has shown toinduce restoration from ischemic muscle injury and to en-hance capillary density through paracrine secretion of an-giogenic molecules [38].

Materials and methodsIsolation and culture of mouse BM-MSCsTo isolate the bone marrow, 6-week-old C57BL/6 micewere killed by cervical dislocation, then the ends of thetibia and femur bones were cut to expose the marrow. A5-ml syringe containing complete media used to extractthe cells via flushing the marrow plug out of the cut endof the bone with 1 ml of complete media and collect in a15-ml tube. Strong flushing is necessary during marrowcell preparation. Then, the cell pellet derived from 2tibia and 2 femur bones was suspended in a growthmedium containing Dulbecco’s modified Eagle’s medium(DMEM) high glucose (Gibco, USA) and 10% fetal bo-vine serum (FBS; Gibco, USA) with 100 U/mL penicil-lin–streptomycin (Gibco, USA) and cultured in a 75-cm2

culture flask and were maintained at 37 °C and 5% CO2.Nonadherent cells were removed after 24 h, and the flaskwas washed with phosphate-buffered saline (PBS; Gibco,USA). The medium was changed regularly every 3–4days, and at approximately 70% confluence, the cellswere detached using trypsin-EDTA (Gibco, USA) andtransferred to new flasks; these cells were considered aspassage 1 (Fig. 1a–f).

Isolation and culture of mouse AT-MSCsInguinal adipose tissue was harvested from 6-week-oldC57BL/6 mice and washed with sterile phosphate-buffered saline (PBS; Gibco, USA) to remove contamin-ating debris. The adipose tissue was minced into 1–2mm3 pieces using a sterile scalpel and placed in the

tissue plate 70 mm under sterile conditions. The tissueexplants were placed in a culture dish around 5mmspace between adjacent fragments. After adhesion of ex-plants to the plate surface (10 min), growth mediumcontaining Dulbecco’s modified Eagle’s medium(DMEM) high glucose (Gibco, USA) and 20% fetal bo-vine serum (FBS; Gibco, USA) with 100 U/mL penicil-lin–streptomycin (Gibco, USA) was added gently to thePetri dish without disturbing the explants. After 48 h,the medium was replaced with fresh medium. On reach-ing 80–90% confluence, the cells were subcultured aftertreatment with 0.05% trypsin-EDTA (Gibco, USA). Thecells were incubated in a 37 °C humidified incubatorwith 5% CO2 and 95% air. At passage one, the culturemedium was changed to DMEM containing 10% FBS.All of the culture medium replaced every 3–4 days(Fig. 1g–i).

Evaluation of MSC differentiationOsteogenesisFor differentiation to osteocyte, passage 3 BM-MSCsand passage 3 AT-MSCs were incubated to differentiateinto osteoblasts in corresponding induction medium for2 weeks. The cells were maintained in control and osteo-genic media. The control medium consisted of DMEM(Gibco, USA), supplemented with 10% FBS (Gibco,USA) and 1% penicillin/streptomycin (Gibco, USA). Theosteogenic medium contained DMEM, 15% FBS (Gibco,USA), 100 μML-ascorbic acid, 10 mM glycerol 3-phosphate, and 100 nM dexamethasone (Sigma-Aldrich).The medium was replaced 2 times a week. After 2 weeksthe cultured cells were stained with Alizarin Red Solu-tion to visualize calcium deposits. The cells were fixed in4% paraformaldehyde (PFA) for 20 min and stainedusing Alizarin Red Solution for 20 min at roomtemperature.

AdipogenesisFor adipocyte differentiation, passage 3 BM-MSCs andpassage 3 AT-MSCs were incubated to differentiate intoadipocytes in corresponding to the induction mediumfor 2 weeks. The cells were maintained in control andadipogenic media. The control medium consisted ofDMEM (Gibco, USA), supplemented with 10% FBS(Gibco, USA) and 1%penicillin/streptomycin (Gibco,USA). The adipogenic medium contained DMEM, 15%FBS, 100 μML-ascorbic acid, 200 μM Indomethacin,1000 nM insulin (Sigma-Aldrich), and 100 nM dexa-methasone (Sigma-Aldrich). The medium was replaced 2times a week. After 2 weeks, the cultured cells werestained with Oil Red-O Solution to visualize lipid vacu-oles. The cells were fixed in 4% paraformaldehyde (PFA)for 20 min and stained using Oil Red-O Solution for 20min at room temperature.


Phenotypic characterizationFor the analysis of surface marker expression ofBMMSCs and ATMSCs, flow cytometry was performed.The expression of surface markers was evaluated usingmonoclonal antibodies against mouse anti-CD44 FITC,anti-CD105 perCP, anti-CD45 FITC, and anti-CD34 PE.Both types of cells at passage 4 were washed with PBSand then harvested via incubation in 0.05% trypsin/EDTA. After centrifugation, the cell pellets were washedwith PBS and resuspended in 1 ml PBS. Then, the cellswere stained with the specific antibodies in darkness.After incubation for 30 min at 4 °C, the cells were

washed with PBS and then analyzed by flow cytometry.The data was analyzed with Flow Jo software (version7.6).

Wound healing assay (scratch assay)Wound-healing assay on endothelial cells, human umbil-ical vein endothelial cell (HUVEC) (purchased from pas-teur institute of iran), was used to study the paracrineeffect of BM-MSCs and AT-MSCs on endothelial cellmigration potential. After 24-h FBS starvation of MSCs,the supernatants from cells were collected. The wound-healing assay was employed by scratching the monolayer

Fig. 1 Images of the bone marrow- and adipose-derived mesenchymal stem cell collection procedures. a First, the mouse was sacrificed bycervical dislocation. b The tibia and femur bones were dissected, and then, the muscles, ligaments, and tendons were removed. c The boneswere transferred to a 100-mm sterile culture dish with 5 mL phosphate-buffered saline containing penicillin–streptomycin. d The dish wastransferred into the biosafety cabinet and the two ends of the bones below the end of the marrow cavity were cut with scalpel. e A 5-ml syringewas inserted into the bone cavity and used to slowly flush the marrow out. The bone cavities were washed until the bones became pale. fFinally, all the bone pieces were removed and the media transferred to a new flask that incubated at 37 °C in a 5% CO2 incubator. g For adipose-derived MSCs, the inguinal adipose tissue was harvested from sacrificed mice and washed with sterile phosphate-buffered saline to removecontaminating debris. h The adipose tissue were minced into 1–2 mm3 pieces using sterile scalpel and place the tissue explants in culture disharound 5mm space between adjacent fragments. i Finally, growth medium was added gently to the Petri dish and incubated at 37 °C in a 5%CO2 incubator


HUVEC confluent cell cultures using a sterile plasticmicropipette tip. The cells were washed by DMEM andPBS twice for smoothing the edges of the scratch and re-moving floating cells. After that, wound healing initiatedby adding the collected supernatants from MSCs onHUVEC cultures in different wells of a 6-well plate.After incubating the cells at 37 °C in 5% CO2 for 0, 15,18, 20, 22, and 24 h, the migration images of the cellswere observed under a microscope with ×10 (Nikon,ECLIPSE, TS100), the distance of cell migration wasmeasured, and images were taken using ImageJ Analysissoftware.

Hindlimb ischemia model and cell transplantationAll animal experiments were performed according to theguidelines approved by the Shiraz University of MedicalSciences ethics committee (1397.430).Male C57BL/6 mice, weighing 25–30 g (6–8 week-old)

were purchased from the Comparative and ExperimentalMedicine center at Shiraz University of Medical Sciencesand were selected randomly. Animals were kept instandard conditions (12 h light and 12 h darkness,temperature of 18–22 °C, and 55 ± 5% humidity). Theywere fed a standard mouse diet and given water adlibitum.For creating critical limb ischemia (CLI) model, all an-

imals in each group were anesthetized intraperitoneal(IP) administration using ketamine 10% (100 mg/kg,Alfasan CO., Netherlands) and xylazine 2% (5 mg/kg,Alfasan CO., Netherlands). Animals were placed in dor-sal recumbency. A skin incision (about 10 mm) was donealong the center of the medial thigh from the abdomentowards the knee. Subcutaneous fat tissue superficialwas gently pushed away to expose the femoral neurovas-cular bundle. The femoral artery pushed away from thefemoral vein and nerve. Subsequently, the femoral arterywas isolated by blunt dissection from the femoral vein atthe ligation sites between the proximal caudal femoralartery and the bifurcation of the deep femoral artery andsaphenous artery. Then, two sutures were passed using6–0 silk, transected and cauterized. The incision wasclosed using continuous 5–0 vicryl sutures. The oper-ation was done under a surgical microscope (Zeiss OP-MI6 SD; Carl Zeiss, Goettingen, Germany).The male mice were randomly divided into the follow-

ing three groups (n = 12/group): (1) control group: CLIwas performed and received PBS into the ischemic site;(2) BM-MSC group: CLI was performed and receivedBM-MSCs; and (3) AT-MSC group: CLI was performedand received AT-MSCs. To transfer the cells into the is-chemic leg, intramuscularly (IM) injection of 5 × 105

BM-MSCs and AT-MSCs that resuspended in PBS astreatment groups and PBS as a control group was done

at four different sites of gastrocnemius (GC) muscle after24 h.

Functional scoring: evaluation of the recovery of thedamaged limbs after MSC transplantationSemi-quantitative assessments of limb function and is-chemia were performed using the Tarlov, ischemia,modified ischemia, function, and the grade of limb ne-crosis scoring system at days 3, 7, 14, 21, and 28 aftercell transplantation. The degree of ischemic damage wasevaluated through indicators, such as skin color changes,swelling, and grade of the limb necrosis. On the otherhand, mice were examined preoperatively, immediatelypostoperatively but after recovery from anesthesia, andat day 3, and at 1, 2, 3, and 4 weeks after induction ofhind limb ischemia (Table 1).

Assessment of donor cell survivalTo identify the presence of grafted male cells in the fe-male GC muscle, the Y chromosome-specific SRY genewas assessed by a polymerase chain reaction. At days 3,7, 14, 21, and 28 after treatment, the GC muscle was col-lected, genomic DNA was extracted using Trizol(Sigma-Aldrich), and then, SRY analysis was performed.The forward primer sequence was TTTATGGTGTGGTCCCGTGGTGAG, and the reverse primer se-quence was TTGGAGTACAGGTGTGCAGCTCTAC.

Immunohistochemical staining and histological analysisHistological analysis of the limb tissues was done at days7, 14, 21, and 28 after cell transplantation. To confirmthat the target cells induced angiogenesis in the gastro-cnemius muscle, immunohistologic staining was per-formed with an anti-CD31 antibody (Biocare Medical), amarker for vascular endothelial cells. The mice were eu-thanized at predetermined times, and gastrocnemius wasremoved and fixed in 10% formalin. After fixation, thetissue was embedded in paraffin, and the tissue sectionswere prepared and mounted on slides. Then, the tissuesection slides were stained with hematoxylin-eosin(H&E) and assessed by microscopy (Olympus BX43,Shinjuku, Japan). The tissue samples were deparaffinizedby xylene and ethanol, and then, antigen retrieval wasperformed with proteinase K treatment. After this treat-ment, the tissue samples were incubated with an anti-CD31 monoclonal primary antibody at 100 μL for 15min at room temperature. After being washed with TBS,the samples were incubated with a master polymer plusHRP at room temperature for 30 min. Then, sampleswere washed with TBS. Chromogen solution was pre-pared, 1 drop of DAB Chromogen concentrate to 1mlof DAB substrate buffer. Samples were treated with DABand incubated at room temperature for 5 min. The sam-ples were covered with hematoxylin for 15 s and then


washed with distilled water. After that, the dehydrationstep was performed by alcohol solutions at roomtemperature for 30 s. Finally, the samples were cleared inxylene and mounted with a permanent mounting

medium. Tissue sections were analyzed using the vascu-lar hotspot technique to obtain MVD. Sections werescanned at low power to determine areas of the highestvascular density. Within this region, individual microves-sels were counted in three separate random fields at highpower (0.142 mm2 field size). The mean vessel countfrom the three fields was used. A single countablemicrovessel was defined as any endothelial cell or groupof cells that were clearly separated from other vessels,stroma, or tumor cells without the necessity of a vessellumen or RBC within the lumen. Areas of grosshemorrhage and necrosis were avoided. MVD countswere measured by counting CD31 IHC hot spots inthree separate 400× fields.

Statistical analysisStatistical analysis was performed using GraphPad Prism7 Software. Results are expressed as the mean standarderror of the mean. Comparisons between multiplegroups were performed using one-way analysis of vari-ance (ANOVA), with post hoc testing performed withBonferroni analysis or unpaired t tests, as appropriate. Pvalues ≤ 0.05 were considered statistically significant(*p < .05, **p < .01, ***p < .001, ****p < .0001). Data werepresented as mean ± standard deviation (SD).

ResultsCharacterization of mouse BM-MSCs and AT-MSCsFigure 2a, b represents the spindle-shaped morphologyof BM-MSCs and AT-MSCs at passage 3 that obtainedfrom the bone marrow and adipose tissue of C57BL/6mice. To characterize the phenotypes of BM-MSCs andAT-MSCs, flow cytometry was performed to analyze thesurface markers of MSCs. Cells labeled with FITC,perCP, and PE-conjugated antibodies and examined byflow cytometry. Cells are dissociated and stained withCD34, CD45 (hematopoietic cell markers) and CD44,CD105 (mesenchymal stem-cell markers). Resultsshowed that the BM-MSCs were strongly positive forMSC marker CD44 and negative for cell markersCD105, CD34, and CD45 (Fig. 2c–f). And AT-MSCswere positive for MSC markers CD44 and CD105 andnegative for cell markers CD34 and CD45 (Fig. 2g–j).

In vitro differentiation capacities of mouse BM-MSCs andAT-MSCsThe differentiation capacities of BM-MSCs and AT-MSCsto osteocyte and adipocyte obtained using Alizarin Redstaining and Oil Red-O staining, respectively. For BM-MSCs, Alizarin Red staining showed that mineralizednodules formed in the BM-MSCs after 2 weeks under theosteogenic induction. Also Oil Red-O staining demon-strated that lipid-rich vacuoles formed after 2 weeks underthe adipogenic induction (Fig. 3a, b). For AT-MSCs,

Table 1 Functional scales

Tarlov score Description

0 No movement

1 Barely perceptible movement, non–weightbearing

2 Frequent movement, non–weight bearing

3 Supports weight, partial weight bearing

4 Walks with mild deficit

5 Normal but slow walking

6 Full and fast walking

Ischemia score Description

0 Autoamputation > half lower limb

1 Gangrenous tissue > half foot

2 Gangrenous tissue < half foot, with lowerlimb muscle necrosis

3 Gangrenous tissue < half foot, withoutlower limb muscle necrosis

4 Pale foot or gait abnormalities

5 Normal

Modified ischemia score Description

0 Autoamputation of leg

1 Leg necrosis

2 Foot necrosis

3 Discoloration of 2 toes

4 Discoloration of 1 toe

5 Discoloration of > 2 nails

6 Discoloration of 1 nail

7 No necrosis

The grade of limb necrosis Description

0 Normal limb without swelling, necrosis oratrophy of muscle

1 Necrosis limiting to toes (toes loss)

2 Necrosis extending to a dorsum pedis(foot loss)

3 Necrosis extending to a crus (knee loss)

4 Necrosis extending to a thigh(total hind-limb loss)

Function score Description

0 Dragging

1 No plantar flexion

2 No toe flexion

3 No grabbing force

4 Some grabbing force

5 Normal


Alizarin red staining demonstrated that mineralized nod-ules formed after 2 weeks under the osteogenic inductionand also intracellular Oil-red-O staining showed lipid-richvacuoles formed after 2 weeks under the adipogenic in-duction (Fig. 3c, d).

Capacity of BM-MSCs and AT-MSC supernatant in cellmigrationScratch assay was performed on the target cells. The re-sults showed that BM and AT-MSCs supernatant led toincreased migration potential of endothelial cells(HUVECs) through a paracrine manner. The super-natant of both cells led to the complete closure of the

wound after 24 h. At time points 15, 18, 20, 22, and 24 hpost-scratch, we documented a significant percentagedecrease in the scratch area remaining between the BM-MSC compared to the control group (19.44 ± 0.61,13.5 ± 0.33, 10.59 ± 0.5, 5.37 ± 0.25, 0 ± 0, respectively,p < 0.0001 for all time points). Additionally, at timepoints 15, 18, 20, 22, and 24 h post-scratch, the AT-MSC group showed a significant decrease in scratch arearemaining compared to the control group (17.44 ± 0.51,13.49 ± 0.4, 8.4 ± 0.21, 5.2 ± 0.16, 0 ± 0, respectively, p <0.0001 for all time points). In fact, supernatants fromboth cell sources showed similarity in their ability tostimulate cell migration compared with the control

Fig. 2 Morphology of the bone marrow (a) and adipose mesenchymal stem cells (b) under inverted microscope (10×) and cell surface markers ofC57BL/6 mice bone marrow and adipose mesenchymal stem cells. Flow cytometry analysis results showed that BM-MSCs were positive for MSCmarker CD44 (c) and negative for CD105 (d). Cells were negative for hematopoietic cell marker CD45 (e) and CD34 (f). AT-MSCs were positive forMSC markers CD44 (g) and CD105 (h) and negative for hematopoietic markers CD45 (i) and CD34 (j)


group. For the control group, no scratch was 100%healed by the end of the 24-h experiment. The photostaken with a microscope in a time series then analyzedby ImageJ software in order to calculate the distance be-tween gaps (Fig. 4).

BM-MSCs and AT-MSC transplantation improves recoveryof ischemia-induced injury to mouse hindlimbsIn order to test the in vivo function of BM-MSCs andAT-MSCs in ischemic hindlimb injury, the day after sur-gery mice were treated with PBS as control group and5 × 105 BM-MSCs and AT-MSCs injected into thegastrocnemius muscle. Muscle strength testing was per-formed in the gastrocnemius muscle during 28 days aftertreatment. The activity of the limbs was evaluated byTarlov and Function scores, and severity of ischemicchanges was evaluated by ischemia, modified ischemia,and the grade of limb necrosis scores. Our results indi-cated that all MSC-transplanted mice and non-treatedmice moved with difficulty after the first day of trans-plantation; in fact, mice did not walk well and onlydragged their feet. Over 28 days, BM-MSC-treated miceshowed improved functional outcomes compared withAT-MSCs and control group, with accelerated improve-ment in the Tarlov score at days 14, 21, and 28 (6 ± 0,p < 0.0001, 5.8 ± 0.44, p < 0.0001, 6 ± 0, p < 0.0001;

Fig. 5a) and Function score at days 3 and 28 (4 ± 0, p =0.0004, 5 ± 0, p = 0.01; Fig. 5b). In AT-MSC-treated micegroup, the process of recovery was not significant asmuch as BM-MSC-treated mice group, but it was muchbetter than the control group. In fact, the rate of hind-limb recovery was significantly increased in BM-MSCand also increased in AT-MSCs transplanted mice after28 days. On the contrary, in PBS group, there were nomice that fully recovered. The grade of ischemia im-proved in BM-MSC-treated mice using the ischemiascore at day 21 (4.8 ± 0.44, p = 0.02; Fig. 5c) and themodified ischemia score at day 7 (7 ± 0, p = 0.01, Fig. 5d).The degree of ischemic damage was assessed through in-dicators, such as swelling, skin color changes, and gradeof the limb necrosis. Necrotic changes were macroscop-ically evaluated using the grade of limb necrosis score,and in BM-MSCs and AT-MSCs treated mice groups, is-chemic damage recovery was observed at day 7 (0.4 ±0.54, p = 0.02, 0.2 ± 0.44, p = 0.02, respectively, Fig. 5e).

PCR for SRY genePolymerase chain reaction for Y chromosome gene SRYindicated that at days 3, 7, 14, and 21, both donor malecells, BM-MSCs and AT-MSCs, were survived in the GCmuscle of female mice. But at day 28, no SRY gene wasdetected in the GC muscle for both cells (Fig. 6).

Fig. 3 Differentiation capacity of the mouse bone marrow and adipose mesenchymal stem cells, BM-MSCs and AT-MACs. For BM-MSCs,osteogenesis differentiation demonstrated by calcium deposition in Alizarin red staining (a) and adipogenesis differentiation demonstrated byvacuoles containing fat in Oil Red staining (b). For AT-MACs, the cells differentiated into osteocytes, stained with alizarin red (c), and adipocytesstained with oil red (d); ×10 magnification


Evaluation of capillary density and neoangiogenesisThe gastrocnemius muscles were collected at days 7, 14,21, and 28 after cell transplantation. In order to under-stand the angiogenic effect of BM-MSCs and AT-MSCsin the ischemic muscles at the cellular level, the gastro-cnemius muscles were stained with H&E and the per-centage of muscle regeneration was evaluated; inaddition, capillary density was assessed morphometric-ally by examining three fields per sections after immuno-fluorescence staining for endothelial cells with an anti-CD31 antibody. The analysis of muscle regeneration ingastrocnemius muscle indicated that the muscles fromBM-MSC-treated mice had a large increase in muscleregeneration compared with AT-MSCs and controlgroups starting from day 14. BM-MSC-treated miceshowed increased gastrocnemius muscle regenerationfrom 5% at day 7 up to 40% at day 28. In fact, BM-MSCs had greater percentage in muscle regeneration atdays 14, 21, and 28 compared with AT-MSCs and

control groups (11.33 ± 3.2, p = 0.02, 18.66 ± 7.09, p =0.05, 29 ± 14.93, p = 0.04, respectively) (Fig. 7). Resultsfrom IHC showed increased vasculature in BM-MSC-treated mice at days 14, 21, and 28 compared with AT-MSCs and control group (37.33 ± 4.6, p = 0.03, 45.66 ± 4,p = 0.005, 45 ± 4.3, p = 0.006, respectively). In fact,CD31-MVD in BM-MSC-treated mice was significantlyhigher than the other groups. CD31-MVD did not sig-nificantly differ between AT-MSCs and control groups(26.66 ± 7.6, 35.33 ± 4.5, 37.66 ± 2.5, p value > 0.05 for alltime points, 22.66 ± 2.5, 31 ± 1, 32 ± 1.1, p value > 0.05for all time points) (Fig. 8).

DiscussionIschemia is a condition related to damage of the bloodvessels which thereby damage cells via depriving them ofoxygen and nutrients. Peripheral arterial disease like CLIischemia results in a serious pathological conditions thataffect different organs. Therapies for CLI have limited

Fig. 4 For BM-MSC-conditioned medium, the images in a time series (T0, T15, T18, T20, T22, T24) were analyzed for gap area over time (a–f). ForAT-MSC-conditioned medium, the images in the same time series were analyzed (g–l). Photomicrographs from the control group in a definedtime series (m–r). Graphical comparison of the mean ingrowth and standard deviation (SD) of control, BM-MSC, and AT-MSC groups. P values ≤0.05 were considered statistically significant (s); ×10 magnification, scale bar 200 μm


efficacy, but in recent years, therapies have been devel-oped to treat this disease like stem cell therapy. Recentclinical studies suggest that stem cell transplantation is areliable therapeutic option in selected patients with CLI[39, 40]. In this study, we focus on the therapeutic neo-vascularization effect of BM-MSCs and AT-MSCs andprovide insights into their potential for clinical use as acell-based therapy for CLI. Sustained angiogenesis is acrucial process and play an important role in

improvements of CLI. For the first step, we successfullyisolated BM-MSCs from the bone marrow and AT-MSCs from the adipose tissue. The cells were thenassessed for the characteristic MSC phenotypes includ-ing MSC CD markers and differentiation capacity. Thereare three criteria to define MSCs; in fact, MSCs shouldexhibit some of these properties. First, MSC must showfibroblast-like shape. Second, expression of CD44, CD73,and CD90 and negative for CD14, CD34, and CD45.

Fig. 5 MSC treatment (5 × 105) improves hind limb ischemia. BM-MSC-treated mice indicated accelerated functional recovery according to Tarlovscore at days 14, 21, and 28 (p < 0.0001 for all time points) and Function score at days 3 and 28 (p = 0.0004, p = 0.01) (a, b). BM-MSC-treatedmice had greater improvement of ischemia compared with the control group as shown by ischemia score at day 21 (p = 0.02), modified ischemiascore at day 7 (p = 0.01) (c, d). BM-MSCs and AT-MSCs had similar effect on improvement of necrotic changes according to the grade of limbnecrosis score at day 7 (p = 0.02) (e)

Fig. 6 PCR for SRY gene showed that both BM (a) and AT-MSC cells (b) were survived in the GC muscle at days 3, 7, 14, and 21


Third, the cells must be able to differentiate to osteo-blasts, adipocytes, and chondroblasts [41]. Both cellsexpressed MSC phenotypic markers. These typical MSCmarkers included CD34, CD45, CD44, and CD105. BM-MSCs were strongly positive for MSC marker CD44 andnegative for cell markers CD105, CD34, and CD45, andAT-MSCs were positive for MSC markers CD44 andCD105 and negative for cell markers CD34 and CD45.Our results indicated that both BM-MSCs and AT-MSCs successfully differentiated into osteoblasts and ad-ipocytes. After 2 weeks, the cells showed calcium deposi-tions and oil droplets in the cytoplasm and stainedpositive with alizarin red and oil red dye, respectively.These data demonstrated that both BM-MSCs and AT-MSCs exhibited the characteristic MSC phenotypes. Inorder to investigate the ability of MSCs on endothelialcell migration and neovascularization, scratch assay wasperformed on the HUVEC cells. In this study, weshowed that 24 h after scratch initiation both BM-MSCsand AT-MSC supernatant resulted in a significant

percentage decrease in the scratch area remaining com-pared to the control group. BM-MSCs compared to AT-MSCs resulted in a faster closure of the wound, althoughthis difference was not so great. In fact both cells possesspowerful paracrine effect on endothelial cell proliferationand migration. It is well known that MSCs perform theirparacrine effects via secrete soluble factors which are an-giogenic, anti-apoptotic, anti-inflammatory, and immu-nomodulatory. MSCs can secrete significant amounts ofgrowth factors and cytokines that can promote new ves-sel formation and remodeling of injured tissues such asproangiogenic factors VEGF, bFGF, MMPs, IL-8, andHGF. On the other hand, one of the most importantproperty of MSCs is their capacity for promoting angio-genesis and proangiogenic factor VEGF is the maingrowth factor for this process that secreted by MSCsduring pathophysiological conditions [42, 43]. The BM-MSCs and AT-MSCs were then assessed for their abilityto treat critical limb ischemia. We used a model of limbischemia that was induced by the complete removal of

Fig. 7 Histological analysis after H&E staining. Gastrocnemius muscle regeneration characterized by the presence of centrally located nucleus inmice treated with BM-MSCs (a, b), AT-MSCs (c, d), and control groups (e, f) at days 14 and 21. Quantification of the percentage (mean ± SD) ofmuscle regeneration (p≤ 0.05) (g); ×100 magnification, scale bar, 50 μm


the femoral artery and the closing of its branches. CLI-induced mice were evaluated for functional recovery andischemia using the Tarlov, ischemia, modified ischemia,function, and the grade of limb necrosis scoring systemat days 3, 7, 14, 21, and 28 after cell transplantation [44,45]. The results showed that BM-MSC transplantationimproved the treatment efficacy of hindlimb ischemiacompared to AT-MSCs and control groups. We ob-served remarkable improvements in function and footmobility with BM-MSC treatment according to Tarlovand Function scores. In fact, muscle function and musclestrength, which are a very important parameter to evalu-ate the angiogenic effects of MSCs therapy, improvedduring 28 days after BM-MSC treatment. Additionally,the mice showed restructuring of the skeletal muscles atthe injured sites and functional improvements. Mice inthe BM-MSC group improved necrosis of the hindlimband also showed reduced swelling and edema. In fact,according to our observational tests results, BM-MSCscompared to AT-MSCs resulted in a faster and more

effective recovery from limb ischemia because of itstherapeutic properties. Our results showed similarity toseveral pre-clinical trials. These approaches indicatedthat BM-MSC transplantation significantly improvesfunctional recovery of CLI model through induction ofangiogenesis [46, 47]. To evaluate angiogenesis at thecellular level, H&E and immunohistochemical stainingwere done for the evaluation of muscle regeneration anddetection of CD31 endothelial cells marker. Assessmentof neovascularization and capillary density was done byMVD score [48, 49]. Our results from H&E and IHCconfirmed the results obtained from the behavioral tests.Muscle regeneration in BM-MSC group had a significantincrease compared to AT-MSC group during 28 days,starting from day 14. On the other hand, it confirmedthat neovascularization and blood supply were increasedat the GC muscle. IHC results indicated that formationof the new blood vessels at day 7 was not significantlydiffer in 3 groups, but at days 14, 21, and 28, neovascu-larization in BM-MSC-treated mice was greater than

Fig. 8 Histological analysis of the limb muscles. Immunohistochemical staining of BM-MSC (a, b), AT-MSC (c, d), and PBS (e, f) groups with anti-CD31 antibody at days 14 and 21. Quantification of capillary density. Capillary density was counted after CD31 staining (p≤ 0.05) (g). ×100magnification, scale bar, 50 μm


AT-MSCs and control groups. The potential of BM-MSCs in regeneration of the new blood vessels was con-firmed by MVD score. According to our results, MVD inthe BM-MSC group was increased after day 7 comparedwith two other groups. This property of BM-MSCs in pro-moting angiogenesis is related to the vascular differenti-ation capacity of these cells as well as secretion ofangiogenic growth factors and cytokines [50]. In fact, theseresults showed that histologic findings were associatedwith vascular and functional outcomes. On the otherhand, according to our results from behavioral, H&E, andIHC tests, we observed improvements in muscle functionand muscle strength with BM-MSC treatment as well asformation of the new blood vessels and muscle regener-ation. Additionally, AT-MSC-treated mice showed im-provements in functional recovery, but it was not effectiveas much as BM-MSC group. BM-MSCs can contribute toangiogenesis via secretion of VEGF, angiogenin, IL-8,HGF, TNF-alpha, PD-ECGF, FGF-2, and MMP-9. VEGFplays a critical role in angiogenesis through stimulatingendothelial cell proliferation, migration, and organizationinto tubules. Furthermore, VEGF can increase the numberof circulating endothelial progenitor cells [51–53]. At day28, after the treatment, the presence of donor cell wasassessed by PCR for SRY gene. The results showed thatboth BM and AT-MSCs were survived during 21 days atthe GC muscle. These results indicated important infor-mation concerning immunologic response after allogeneicMSC transplantation to the GC muscle. One of the mostimportant limitations of MSC transplantation to treat limbischemia is poor survival of the transplanted cells becauseof adverse microenvironment in injured site such as hyp-oxia, ischemia, and also excessive inflammation [54, 55].Previous studies demonstrated that BM-MSCs secretevarious cytokines that have immunomodulatory, anti-inflammatory, and anti-apoptotic functions in the targetposition of the transplantation such as IL-10, IL-6, PGE2,and TGF-β [56, 57]. Some strategies are to reinforce thelongevity of transplanted cells such as ways of delivery,number of injected cells, preconditioning of cells, geneticmodification, and combined cell therapy [58]. In thisstudy, we used IM injection as a delivery way and definednumber of cells, and according to the results, thesemethods were effective in cell survival. It should be notedthat the number of cells reduce during 28 days because ofunfavorable microenvironment, and at the end of theperiod, few of the cells remain. MSCs have been broadlystudied because of their great potential for regenerativemedicine [59]. BM-MSCs participate in angiogenesis toimprove ischemia and restore blood flow via directlydifferentiating into vascular cells and secretion of proan-giogenic cytokines; in fact, MSC secretome involves abun-dant angiogenic factors, growth factors, and cytokines [60,61]. Paracrine proangiogenic properties have been defined

to mesenchymal stem cells, both in vitro and in vivo [62,63]. BM-MSCs secrete significant amounts of cytokinesand proangiogenic factors such as VEGF, bFGF, MMPs,IL-8, and HGF which play a key role in neovascularizationand promote new vessel formation and remodeling of in-jured tissues [64]. In angiogenesis-dependent diseases likeCLI, the main purpose of therapy is to improve angiogen-esis and restore blood formation. With due attention tothe regeneration properties and better angiogenic poten-tial of BM-MSCs compared to AT-MSCs, BM-MSC trans-plantation is growing up as an effective therapy fortreatment of such diseases [65].A limitation in our study was the lack of Laser Doppler

Imaging (LDI) to evaluate and monitor blood stream intothe hindlimb during the regeneration process. However,the results of our functional, molecular, and cellular testsindicated that BM-MSC transplantation compared to AT-MSCs had better therapeutic effects on critical limb ische-mia treatment. The evidences from induction of endothe-lial cell migration, muscle functional improvements,muscle restructure, necrosis grade, muscle regeneration,and formation of new blood vessels demonstrate that BM-MSC transplantation has a great potential to treat hind-limb ischemia. On the other hand, we observed all of theabove factors that associated with improvements of neo-vascularization and blood supply were significantly ele-vated in BM-MSC-treated mice compared to AT-MSCsand control groups. According to our results obtainedfrom cellular, molecular, and behavioral tests and alsofrom previous studies that detected the level of angiogenicfactors and cytokines, BM-MSCs compared to AT-MSCshave greater angiogenic potential and also secretes moreamount of angiogenic factors such as VEGF and IL-8,which confirms the importance of selection of cell type forstem cell-based regenerative therapies in order to induceangiogenesis [66, 67]. With regard to these findings, wecould say that BM-MSCs could be a promising therapy totreat diseases with insufficient angiogenesis like criticallimb ischemia compared to AT-MSCs.

ConclusionsThe present study demonstrated the significant role of BM-MSCs in the treatment of limb ischemia. We observedimprovements in functional recovery, and according to pre-vious studies, BM-MSCs can promote neovascularization inischemic tissues mainly through secretion of differentgrowth factors, proangiogenic factors, and cytokines. Inconclusion, BM-MSC transplantation could be consideredas a promising therapy for diseases with insufficient angio-genesis including hindlimb ischemia.

AbbreviationsCLI: Critical limb ischemia; PAD: Peripheral arterial disease;MSCs: Mesenchymal stem cells; BM-MSCs: Bone marrow mesenchymal stemcells; AT-MSC: Adipose tissue mesenchymal stem cell; SCT: Stem cell therapy;


BMMNCs: Bone marrow-derived mononuclear cells; EPCs: Endothelialprogenitor cells; VECs: Vascular endothelial cells; VEGF: Vascular endothelialgrowth factor; HGF: Hepatocyte growth factor; MI: Myocardial infection;DMEM: Dulbecco’s modified Eagle’s medium; FBS: Fetal bovine serum;PFA: Paraformaldehyde; PBS: Phosphate-buffered saline; HUVECs: Humanumbilical vein endothelial cell; TGF: Transforming growth factor

AcknowledgementsNot applicable.

Authors’ contributionsAll authors contributed to the study conception and design. PN and LAperformed all the experiments, collected, and analyzed the data. SDperformed the animal surgery. PN wrote the manuscript. VR, MT, and MSsupervised the study. The authors read and approved the final article.

FundingNot applicable.

Availability of data and materialsAll data generated or analyzed during this study are included in thispublished article.

Ethics approval and consent to participateAll experimental procedures and use of research animals in this study wereapproved by the Shiraz University of Medical Sciences ethics committee(1397.430).

Consent for publicationNot applicable.

Competing interestsThe authors declare that they have no competing interests.

Author details1Department of Molecular Medicine, School of Advanced Medical Sciencesand Technologies, Shiraz University of Medical Sciences, Shiraz, Iran.2Department of Molecular Medicine, School of Medicine, Shahid SadoughiUniversity of Medical Sciences, Yazd, Iran. 3Postdoctoral Researcher, StemCells Technology Research Center, Shiraz University of Medical Sciences,Shiraz, Iran. 4Biotechnology Research Center, International Campus, ShahidSadoughi University of MedicalSciences, Yazd, Iran. 5Research and ClinicalCenter for Infertility, Shahid Sadoughi University of Medical Sciences, Yazd,Iran. 6Department of Genetics, Shiraz University of Medical Science, Shiraz,Iran. 7Maternal-fetal Medicine Research Center, Shiraz University of MedicalSciences, Shiraz, Iran. 8Stem Cells Technology Research center, ShirazUniversity of Medical Sciences, Shiraz, Iran.

Received: 3 November 2020 Accepted: 21 December 2020

References1. Dabrh AMA, Steffen MW, Undavalli C, Asi N, Wang Z, Elamin MB, et al. The

natural history of untreated severe or critical limb ischemia. J Vasc Surg.2015;62(6):1642–51. e3.

2. Hioki H, Miyashita Y, Miura T, Ebisawa S, Motoki H, Izawa A, et al. Prognosticimprovement by multidisciplinary therapy in patients with critical limbischemia. Angiology. 2015;66(2):187–94.

3. Go AS, Mozaffarian D, Roger VL, Benjamin EJ, Berry JD, Blaha MJ, et al.Executive summary: heart disease and stroke statistics—2014 update: areport from the American Heart Association. Circulation. 2014;129(3):399–410.

4. Cooke JP, Losordo DW. Modulating the vascular response to limb ischemia:angiogenic and cell therapies. Circ Res. 2015;116(9):1561–78.

5. Bradbury A, Ruckley C, Fowkes F, Forbes J, Gillespie I, Adam D. Bypassversus angioplasty in severe ischaemia of the leg (BASIL): multicentre,randomised controlled trial. Lancet. 2005;366(9501):1925–34.

6. Anderson JL, Halperin JL, Albert N, Bozkurt B, Brindis RG, Curtis LH, et al.Management of patients with peripheral artery disease (compilation of 2005and 2011 ACCF/AHA guideline recommendations): a report of the American

College of Cardiology Foundation/American Heart Association Task Forceon Practice Guidelines. J Am Coll Cardiol. 2013;61(14):1555–70.

7. Rooke TW, Hirsch AT, Misra S, Sidawy AN, Beckman JA, Findeiss LK, et al.2011 ACCF/AHA focused update of the guideline for the management ofpatients with peripheral artery disease (updating the 2005 guideline) areport of the American college of cardiology foundation/American heartassociation task force on practice guidelines. Circulation. 2011;124(18):2020–45.

8. Reinecke H, Unrath M, Freisinger E, Bunzemeier H, Meyborg M, Lueders F,et al. Peripheral arterial disease and critical limb ischaemia: still pooroutcomes and lack of guideline adherence. Eur Heart J. 2015;36(15):932–8.

9. Shimamura M, Nakagami H, Koriyama H, Morishita R. Gene therapy and cell-based therapies for therapeutic angiogenesis in peripheral artery disease.Biomed Res Int. 2013;2013. https://www.hindawi.com/journals/bmri/2013/186215/.

10. Razban V, Khajeh S, Alaee S, Mostafavi-Pour Z, Soleimani M. Tube formationpotential of BMSCs and USSCs in response to HIF-1α overexpression underhypoxia. Cytol Genet. 2018;52(3):236–44.

11. Tateishi-Yuyama E, Matsubara H, Murohara T, Ikeda U, Shintani S, Masaki H,et al. Therapeutic angiogenesis for patients with limb ischaemia byautologous transplantation of bone-marrow cells: a pilot study and arandomised controlled trial. Lancet. 2002;360(9331):427–35.

12. Dash NR, Dash SN, Routray P, Mohapatra S, Mohapatra PC. Targetingnonhealing ulcers of lower extremity in human through autologous bonemarrow-derived mesenchymal stem cells. Rejuvenation Res. 2009;12(5):359–66.

13. Lenk K, Adams V, Lurz P, Erbs S, Linke A, Gielen S, et al. Therapeuticalpotential of blood-derived progenitor cells in patients with peripheralarterial occlusive disease and critical limb ischaemia. Eur Heart J. 2005;26(18):1903–9.

14. Nizankowski R, Petriczek T, Skotnicki A, Szczeklik A. The treatment ofadvanced chronic lower limb ischaemia with marrow stem cellautotransplantation. Kardiol Pol. 2005;63(10):351.

15. Murphy MB, Moncivais K, Caplan AI. Mesenchymal stem cells:environmentally responsive therapeutics for regenerative medicine. Exp MolMed. 2013;45(11):e54-e.

16. Liew A, O'Brien T. Therapeutic potential for mesenchymal stem celltransplantation in critical limb ischemia. Stem Cell Res Ther. 2012;3(4):28.

17. Teraa M, Sprengers RW, van der Graaf Y, Peters CE, Moll FL, Verhaar MC.Autologous bone marrow–derived cell therapy in patients with critical limbischemia: a meta-analysis of randomized controlled clinical trials. Ann Surg.2013;258(6):922–9.

18. Khajeh S, Razban V, Talaei-Khozani T, Soleimani M, Asadi-Golshan R,Dehghani F, et al. Enhanced chondrogenic differentiation of dental pulp-derived mesenchymal stem cells in 3D pellet culture system: effect ofmimicking hypoxia. Biologia. 2018;73(7):715–26.

19. Teraa M, Sprengers RW, Westerweel PE, Gremmels H, Goumans M-JT,Teerlink T, et al. Bone marrow alterations and lower endothelial progenitorcell numbers in critical limb ischemia patients. PloS one. 2013;8(1). https://pubmed.ncbi.nlm.nih.gov/23383236/.

20. Gremmels H, Fledderus JO, Teraa M, Verhaar MC. Mesenchymal stromal cellsfor the treatment of critical limb ischemia: context and perspective. StemCell Res Ther. 2013;4(6):140.

21. Reinders ME, Roemeling-van Rhijn M, Khairoun M, Lievers E, de Vries DK,Schaapherder AF, et al. Bone marrow-derived mesenchymal stromal cellsfrom patients with end-stage renal disease are suitable for autologoustherapy. Cytotherapy. 2013;15(6):663–72.

22. Razban V, Khajeh S, Lotfi AS, Mohsenifar A, Soleimani M, Khoshdel A, et al.Engineered heparan sulfate-collagen IV surfaces improve humanmesenchymal stem cells differentiation to functional hepatocyte-like cells. JBiomater Tissue Eng. 2014;4(10):811–22.

23. Altaner C, Altanerova V, Cihova M, Hunakova L, Kaiserova K, Klepanec A, et al.Characterization of mesenchymal stem cells of “no-options” patients withcritical limb ischemia treated by autologous bone marrow mononuclear cells.Plos One. 2013;8(9). https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3771988/.

24. Yamout B, Hourani R, Salti H, Barada W, El-Hajj T, Al-Kutoubi A, et al. Bonemarrow mesenchymal stem cell transplantation in patients with multiplesclerosis: a pilot study. J Neuroimmunol. 2010;227(1–2):185–9.

25. Cortez-Toledo E, Rose M, Agu E, Dahlenburg H, Yao W, Nolta JA, et al.Enhancing retention of human bone marrow mesenchymal stem cells withprosurvival factors promotes angiogenesis in a mouse model of limbischemia. Stem Cells Dev. 2019;28(2):114–9.


https://www.hindawi.com/journals/bmri/2013/186215/https://www.hindawi.com/journals/bmri/2013/186215/https://pubmed.ncbi.nlm.nih.gov/23383236/https://pubmed.ncbi.nlm.nih.gov/23383236/https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3771988/

26. Mohamed SA, Howard L, McInerney V, Hayat A, Krawczyk J, Naughton S, et al.Autologous bone marrow mesenchymal stromal cell therapy for “no-option”critical limb ischemia is limited by karyotype abnormalities. Cytotherapy. 2020.https://www.sciencedirect.com/science/article/pii/S1465324920300621.

27. Liao L. Cell therapy of critical limb ischemia: a review of preclinical andclinical research in China. Vasc Invest Ther. 2020;3(1):21.

28. Beugels J, De Munter J, Van der Hulst R, Kramer B, Wolters E. Efficacy ofdifferent doses of human autologous adult bone mar-row stem celltransplantation on angiogenesis in an immune deficient rat model withhind limb ischemia. J Stem Cell Res Dev Ther. 2019;S1002. https://www.heraldopenaccess.us/openaccess/efficacy-of-different-doses-of-human-autologous-adultbone-marrow-stem-cell-transplantation-on-angiogenesis-in-an-immune-deficient-rat-model-withhind-limb-ischemia.

29. van Rhijn-Brouwer FC, van Balkom BW, Papazova DA, Hazenbrink DH, MeijerAJ, Brete I, et al. Paracrine proangiogenic function of human bone marrow-derived mesenchymal stem cells is not affected by chronic kidney disease.Stem Cells Int. 2019;2019. https://pubmed.ncbi.nlm.nih.gov/31933648/.

30. Bura A, Planat-Benard V, Bourin P, Silvestre J-S, Gross F, Grolleau J-L, et al.Phase I trial: the use of autologous cultured adipose-derived stroma/stemcells to treat patients with non-revascularizable critical limb ischemia.Cytotherapy. 2014;16(2):245–57.

31. Qomi RT, Sheykhhasan M. Adipose-derived stromal cell in regenerativemedicine: a review. World J Stem Cells. 2017;9(8):107.

32. Hassan WU, Greiser U, Wang W. Role of adipose-derived stem cells inwound healing. Wound Repair Regen. 2014;22(3):313–25.

33. Zollino I, Zuolo M, Gianesini S, Pedriali M, Sibilla MG, Tessari M, et al.Autologous adipose-derived stem cells: basic science, technique, and rationalefor application in ulcer and wound healing. Phlebology. 2017;32(3):160–71.

34. Mizuno H, Tobita M, Orbay H, Uysal AC, Lu F. Adipose-derived stem cells asa novel tool for future regenerative medicine. Stem Cells Cancer Stem Cells.2014;12:165–74.

35. Wang L, Deng J, Tian W, Xiang B, Yang T, Li G, et al. Adipose-derived stem cellsare an effective cell candidate for treatment of heart failure: an MR imagingstudy of rat hearts. Am J Phys Heart Circ Phys. 2009;297(3):H1020–H31.

36. Nakagami H, Maeda K, Morishita R, Iguchi S, Nishikawa T, Takami Y, et al.Novel autologous cell therapy in ischemic limb disease through growthfactor secretion by cultured adipose tissue–derived stromal cells. ArteriosclerThromb Vasc Biol. 2005;25(12):2542–7.

37. Fan W, Sun D, Liu J, Liang D, Wang Y, Narsinh KH, et al. Adipose stromalcells amplify angiogenic signaling via the VEGF/mTOR/Akt pathway in amurine hindlimb ischemia model: a 3D multimodality imaging study. Plosone. 2012;7(9). https://pubmed.ncbi.nlm.nih.gov/23029141/.

38. Moon MH, Kim SY, Kim YJ, Kim SJ, Lee JB, Bae YC, et al. Human adiposetissue-derived mesenchymal stem cells improve postnatalneovascularization in a mouse model of hindlimb ischemia. Cell PhysiolBiochem. 2006;17(5–6):279–90.

39. Haghighat L, Altin SE, Attaran RR, Mena-Hurtado C, Regan CJ. Review of thelatest percutaneous devices in critical limb ischemia. J Clin Med. 2018;7(4):82.

40. Bath J, Kim RJ, Dombrovskiy VY, Vogel TR. Contemporary trends andoutcomes of thrombolytic therapy for acute lower extremity ischemia.Vascular. 2019;27(1):71–7.

41. Dominici M, Le Blanc K, Mueller I, Slaper-Cortenbach I, Marini F, Krause D,et al. Minimal criteria for defining multipotent mesenchymal stromal cells.The International Society for Cellular Therapy position statementCytotherapy. 2006;8(4):315–317.

42. Tao H, Han Z, Han ZC, Li Z. Proangiogenic features of mesenchymal stemcells and their therapeutic applications. Stem Cells Int. 2016;2016. https://www.hindawi.com/journals/sci/2016/1314709/.

43. Maacha S, Sidahmed H, Jacob S, Gentilcore G, Calzone R, Grivel J-C, et al.Paracrine mechanisms of mesenchymal stromal cells in angiogenesis. StemCells Int. 2020;2020. https://www.hindawi.com/journals/sci/2020/4356359/.

44. Krishna SM, Omer SM, Li J, Morton SK, Jose RJ, Golledge J. Development ofa two-stage limb ischemia model to better simulate human peripheralartery disease. Sci Rep. 2020;10(1):1–16.

45. Kang I, Lee B-C, Choi SW, Lee JY, Kim J-J, Kim B-E, et al. Donor-dependentvariation of human umbilical cord blood mesenchymal stem cells inresponse to hypoxic preconditioning and amelioration of limb ischemia.Exp Mol Med. 2018;50(4):1–15.

46. Brenes RA, Jadlowiec CC, Bear M, Hashim P, Protack CD, Li X, et al. Toward amouse model of hind limb ischemia to test therapeutic angiogenesis. JVasc Surg. 2012;56(6):1669–79.

47. Westvik TS, Fitzgerald TN, Muto A, Maloney SP, Pimiento JM, Fancher TT,et al. Limb ischemia after iliac ligation in aged mice stimulates angiogenesiswithout arteriogenesis. J Vasc Surg. 2009;49(2):464–73.

48. Hu W, Jiang J, Yang F, Liu J. The impact of bone marrow-derivedmesenchymal stem cells on neovascularisation in rats with brain injury. FoliaNeuropathol. 2018;56:112–23.

49. Li GC, Zhang HW, Zhao QC, Sun L, Yang JJ, Hong L, et al. Mesenchymalstem cells promote tumor angiogenesis via the action of transforminggrowth factor β1. Oncol Lett. 2016;11(2):1089–94.

50. Wu Y, Chen L, Scott PG, Tredget EE. Mesenchymal stem cells enhance woundhealing through differentiation and angiogenesis. Stem Cells. 2007;25(10):2648–59.

51. Shen C-C, Chen B, Gu J-T, Ning J-L, Chen L, Zeng J, et al. The angiogenicrelated functions of bone marrow mesenchymal stem cells are promoted byCBDL rat serum via the Akt/Nrf2 pathway. Exp Cell Res. 2016;344(1):86–94.

52. Wang J, Wang Y, Wang S, Cai J, Shi J, Sui X, et al. Bone marrow-derivedmesenchymal stem cell-secreted IL-8 promotes the angiogenesis andgrowth of colorectal cancer. Oncotarget. 2015;6(40):42825.

53. Fam NP, Verma S, Kutryk M, Stewart DJ. Clinician guide to angiogenesis.Circulation. 2003;108(21):2613–8.

54. Li X, Zhou J, Liu Z, Chen J, Lü S, Sun H, et al. A PNIPAAm-basedthermosensitive hydrogel containing SWCNTs for stem cell transplantationin myocardial repair. Biomaterials. 2014;35(22):5679–88.

55. Tano N, Kaneko M, Ichihara Y, Ikebe C, Coppen SR, Shiraishi M, et al.Allogeneic mesenchymal stromal cells transplanted onto the heart surfaceachieve therapeutic myocardial repair despite immunologic responses inrats. J Am Heart Assoc. 2016;5(2):e002815.

56. Saldaña L, Bensiamar F, Vallés G, Mancebo FJ, García-Rey E, Vilaboa N.Immunoregulatory potential of mesenchymal stem cells following activationby macrophage-derived soluble factors. Stem Cell Res Ther. 2019;10(1):1–15.

57. Weiss ARR, Dahlke MH. Immunomodulation by mesenchymal stem cells(MSCs): mechanisms of action of living, apoptotic, and dead MSCs. FrontImmunol. 2019;10:1191.

58. Araña M, Gavira JJ, Peña E, González A, Abizanda G, Cilla M, et al. Epicardial deliveryof collagen patches with adipose-derived stem cells in rat and minipig models ofchronic myocardial infarction. Biomaterials. 2014;35(1):143–51.

59. Samsonraj RM, Raghunath M, Nurcombe V, Hui JH, van Wijnen AJ, Cool SM.Concise review: multifaceted characterization of human mesenchymal stem cells foruse in regenerative medicine. Stem Cells Transl Med. 2017;6(12):2173–85.

60. Sherman SE, Kuljanin M, Cooper TT, Putman DM, Lajoie GA, Hess DA. Highaldehyde dehydrogenase activity identifies a subset of humanmesenchymal stromal cells with vascular regenerative potential. Stem Cells.2017;35(6):1542–53.

61. Cunha FF, Martins L, Martin PKM, Stilhano RS, Han SW. A comparison of thereparative and angiogenic properties of mesenchymal stem cells derivedfrom the bone marrow of BALB/c and C57/BL6 mice in a model of limbischemia. Stem Cell Res Ther. 2013;4(4):86.

62. Muhammad SA. Mesenchymal stromal cell secretome as a therapeuticstrategy for traumatic brain injury. BioFactors. 2019;45(6):880–91.

63. Choi M, Lee H-S, Naidansaren P, Kim H-K, Eunju O, Cha J-H, et al.Proangiogenic features of Wharton's jelly-derived mesenchymal stromal/stem cells and their ability to form functional vessels. Int J Biochem CellBiol. 2013;45(3):560–70.

64. Cunningham CJ, Redondo-Castro E, Allan SM. The therapeutic potential ofthe mesenchymal stem cell secretome in ischaemic stroke. J Cereb BloodFlow Metab. 2018;38(8):1276–92.

65. Merckx G, Hosseinkhani B, Kuypers S, Deville S, Irobi J, Nelissen I, et al.Angiogenic effects of human dental pulp and bone marrow-derivedmesenchymal stromal cells and their extracellular vesicles. Cells. 2020;9(2):312.

66. Kozlowska U, Krawczenko A, Futoma K, Jurek T, Rorat M, Patrzalek D, et al.Similarities and differences between mesenchymal stem/progenitor cellsderived from various human tissues. World J Stem Cells. 2019;11(6):347.

67. Petrenko Y, Vackova I, Kekulova K, Chudickova M, Koci Z, Turnovcova K,et al. A comparative analysis of multipotent mesenchymal stromal cellsderived from different sources, with a focus on neuroregenerative potential.Sci Rep. 2020;10(1):1–15.

Publisher’s NoteSpringer Nature remains neutral with regard to jurisdictional claims inpublished maps and institutional affiliations.


https://www.sciencedirect.com/science/article/pii/S1465324920300621https://www.heraldopenaccess.us/openaccess/efficacy-of-different-doses-of-human-autologous-adultbone-marrow-stem-cell-transplantation-on-angiogenesis-in-an-immune-deficient-rat-model-withhind-limb-ischemiahttps://www.heraldopenaccess.us/openaccess/efficacy-of-different-doses-of-human-autologous-adultbone-marrow-stem-cell-transplantation-on-angiogenesis-in-an-immune-deficient-rat-model-withhind-limb-ischemiahttps://www.heraldopenaccess.us/openaccess/efficacy-of-different-doses-of-human-autologous-adultbone-marrow-stem-cell-transplantation-on-angiogenesis-in-an-immune-deficient-rat-model-withhind-limb-ischemiahttps://www.heraldopenaccess.us/openaccess/efficacy-of-different-doses-of-human-autologous-adultbone-marrow-stem-cell-transplantation-on-angiogenesis-in-an-immune-deficient-rat-model-withhind-limb-ischemiahttps://pubmed.ncbi.nlm.nih.gov/31933648/https://pubmed.ncbi.nlm.nih.gov/23029141/https://www.hindawi.com/journals/sci/2016/1314709/https://www.hindawi.com/journals/sci/2016/1314709/https://www.hindawi.com/journals/sci/2020/4356359/

AbstractIntroductionMethodsResultsConclusions

IntroductionBackground on stem cell therapy for CLI

Materials and methodsIsolation and culture of mouse BM-MSCsIsolation and culture of mouse AT-MSCsEvaluation of MSC differentiationOsteogenesisAdipogenesis

Phenotypic characterizationWound healing assay (scratch assay)Hindlimb ischemia model and cell transplantationFunctional scoring: evaluation of the recovery of the damaged limbs after MSC transplantationAssessment of donor cell survivalImmunohistochemical staining and histological analysisStatistical analysis

ResultsCharacterization of mouse BM-MSCs and AT-MSCsIn vitro differentiation capacities of mouse BM-MSCs and AT-MSCsCapacity of BM-MSCs and AT-MSC supernatant in cell migrationBM-MSCs and AT-MSC transplantation improves recovery of ischemia-induced injury to mouse hindlimbsPCR for SRY geneEvaluation of capillary density and neoangiogenesis

DiscussionConclusionsAbbreviationsAcknowledgementsAuthors’ contributionsFundingAvailability of data and materialsEthics approval and consent to participateConsent for publicationCompeting interestsAuthor detailsReferencesPublisher’s Note

comparative analysis of mouse bone marrow and adipose tissue … · 2021. 1. 13. · research open...

Documents