A

hgrpspgdosoot©

K

1

dbSdshabs

gB

0d

Virus Research 123 (2007) 161–169

Complete nucleotide sequence of genotype 4 hepatitis C viruses isolatedfrom patients co-infected with human immunodeficiency virus type 1

Sandra Franco, Cristina Tural, Bonaventura Clotet, Miguel Angel Martınez ∗Fundacio irsiCaixa, Universitat Autonoma de Barcelona, Spain

Received 10 July 2006; received in revised form 31 August 2006; accepted 1 September 2006Available online 4 October 2006

bstract

The hepatitis C virus (HCV) genotype 4 is spreading among southern European intravenous drug users, who are frequently co-infected withuman immunodeficiency virus type 1 (HIV-1). Response to interferon (IFN) �-based therapies in HIV-1 positive patients co-infected with HCVenotype 4 is poor, similar to that obtained for HCV genotype 1 and much lower than for HCV genotypes 2 and 3. The lack of sequence dataelated to HCV of genotype 4 prompted us to sequence the complete genome of two genotype 4 variants isolated from two HIV-1 co-infectedatients (24 and 25). Our aim was to investigate the evolutionary relationships of the former variants with other genotypes and/or genotype 4ubtypes. Sequence alignments and phylogenetic analysis from genomic regions 5′NC, core-E1 and NS5B revealed that the variants isolated fromatients 24 and 25 (both subtyped 4c/4d by INNO-LIPA II HCV) belong to subtypes 4d and 4a, respectively. When looking at the completeenome sequence one of the variants showed a new genotype 4 subtype. Interestingly, sequence length differences in the interferon sensitivityetermining region coding regions were observed when compared with sequences from other genotypes. Similarly, when the catalytic efficiencyf the NS3/4 protease from patients 24 and 25 samples were determined, they displayed 70.6 ± 7.7 and 23.5 ± 3.4%, respectively, of the activity

hown by genotype 1 NS3/4 proteases. Overall, pairwise comparison and phylogenetic analysis of nucleotide sequences of the complete genomer the different protein-encoding regions showed that genotype 4 sequences were more closely related to genotype 1 sequences. The descriptionf new HCV genome variants may help our understanding of the HCV biology as well as the role of different genotypes in HCV treatment andherapy response.

2006 Elsevier B.V. All rights reserved.

1 co-i

ei(hlf2uI

eywords: HCV; Genotype 4; Complete genome; NS3/4 protease; HCV–HIV-

. Introduction

Hepatitis C virus (HCV) is a major cause of chronic liverisease. Six major genotypes and more than 70 subtypes haveeen described so far (Kuiken et al., 2005; Simmonds, 2004;immonds et al., 2005). Genotype 4, prevalent in the Mid-le East and different parts of Africa, is increasing amongouthern European intravenous drug users (IDUs) infected withuman immunodeficiency virus type 1 (HIV-1) (van Asten et

l., 2004). Although 17 different subtypes of genotype 4 haveeen described so far, there is only one genotype 4 full-lengthequence available (Chamberlain et al., 1997). There is growing

∗ Corresponding author at: Fundacio irsiCaixa, Laboratori de Retrovirolo-ia, Hospital Universitari Germans Trias i Pujol, Ctra del Canyet s/n, 08916adalona, Spain. Tel.: +34 934656374; fax: +34 934653968.

E-mail address: mmartinez@irsicaixa.es (M.A. Martınez).

2m

p42bar

168-1702/$ – see front matter © 2006 Elsevier B.V. All rights reserved.oi:10.1016/j.virusres.2006.09.001

nfection; Therapy

vidence for genotypic-specific differences in persistence andnteractions with the innate and adaptive immune host responseSimmonds, 2004). A poor response to (IFN) �-based treatmentsas been observed in HCV genotype 4 infected patients, simi-ar to that obtained for HCV genotype 1 and much lower thanor HCV genotypes 2 and 3 (Carrat et al., 2004; Poynard et al.,003). Indeed, HCV co-infected patients from our HIV clinicalnit responded poorly to conventional pegylated-IFN (PEG-FN) plus ribavirin (RBV) treatment (Ballesteros et al., 2004,005). Biological differences between different HCV genotypesay have important consequences for current and future therapy.The lack of sequence data related to HCV of genotype 4

rompted us to sequence the complete genome of two genotypevariants isolated from two HIV-1 co-infected patients (24 and

5) (Ballesteros et al., 2004). These two patients were chosenecause they showed a discordant response to INF �-based ther-py. The number of patients infected with genotype 4 HCV isising in our clinical setting and represents 25% of the HCV

1 esear

giwwgfNeHeiisHnhp

2

2

e�pc(igdNlOlnlwMwIwiHcR(ti

2

aa1p

gra(urpw29aTv(D(KtsPeww(aG(Pt(tnegiIerag(o(2

2

wci(1

62 S. Franco et al. / Virus R

enotypes in the HIV–HCV co-infected patients from our clin-cal unit (Ballesteros et al., 2004; Ibanez et al., 1998). Our aimas to investigate the evolutionary relationships of these variantsith other genotypes and/or genotype 4 subtypes, specifically,enomic regions implicated in treatment response such as inter-eron sensitivity determining region (ISDR). Since the HCVS3 protease may be a future target for HCV therapy (Lamarre

t al., 2003; Summa, 2005) as well as an important factor in theCV pathogenesis (Foy et al., 2003; Loo et al., 2006; Meylan

t al., 2005), we also decided to analyze this protein, specif-cally, its evolutionary relationships with other genotypes andts catalytic efficiency. Although differences among genotype 4ubtypes have not been assigned to a poorer response to currentCV therapies, the remarkable genetic heterogeneity and largeumber of different subtypes found within genotype 4 isolatesave raised concerns about sensitivity of diagnostic assays andossible implications in the development of future vaccines.

. Materials and methods

.1. Patient samples

Two patients were selected from a previous study (Ballesterost al., 2004) on the basis of their discordant response to INF-based therapy. Patient 24 did not respond to therapy, whileatient 25 showed a sustained response to therapy. Clinicalharacteristics of the two patients were previously describedBallesteros et al., 2004). We amplified the HCV RNA of twosolates from two IDU HIV-1 patients co-infected with the HCVenotype 4c/4d. The HCV genotype from the two patients wasetermined by the INNO-LIPA HCV IIR assay (InnogeneticsU, Ghent, Belgium). The baseline HCV viral load was simi-

ar in both patients (831,763 and 263,026 IU/ml, respectively).nly patient 25 had received HIV-1 treatment. HCV RNA viral

oad was quantified by the Amplicor Monitor v2.0 (Roche Diag-ostics Systems, Inc., Branchburg, NJ, USA) with a detectionimit between 600 and 850.000 IU/ml. HIV-1 RNA viral loadas measured by NASBA (Nuclisens HIV-QT, Biomerieux,adrid, Spain; limit of detection <80 copies/ml). Both patientsere treated for 48 weeks with PEG-Interferon �-2b (Peg-

ntron; Shering-Plough, Kenilworth, NJ, USA) in combinationith RBV (Rebetol; Schering-Plough). Patient 1 sample used

n this study was obtained from an individual infected withCV genotype 1b and co-infected with HIV-1 (CD4 T cell

ount of 390 cells/�l and HIV-1 plasma viral load of 116 984NA copies/ml) and was previously described and analyzed

Martinez and Clotet, 2003). This analysis included NS3/4 pro-ease sequence determination and proteolytic activity character-zation.

.2. RNA extraction, PCR amplification and sequencing

HCV RNA extraction and amplification was performed

s previously described (Ballesteros et al., 2004; Martineznd Clotet, 2003). Briefly, the HCV RNA was extracted from40 �l of plasma and amplified by PCR using a nested set ofrimers (see Table 1). Five microlitres of RNA was used to

(234

ch 123 (2007) 161–169

enerate the cDNA in a 10 �l reaction at 42 ◦C for 1 h with theeverse outer primer for each region of the genome (see Table 1)nd 5 U of avian myeloblastosisvirus reverse transcriptaseRT) (Promega). Ten microlitres of the RT reaction were thensed in the first PCR amplification in a final volume of 50 �leaction with 2 U of the proof-reading Platinum Taq DNAolymerase (Invitrogen) and 5 �l of the first amplificationere used for the second amplification in a final volume of5 �l. Both PCR amplifications were carried out for 2 min at4 ◦C, followed by 35 cycles of 30 s at 94 ◦C, 1 min at 45 ◦Cnd 2 min at 68 ◦C, and a final extension of 7 min at 68 ◦C.he PCR products were separated on a 1% agarose gel andisualized with the SYBR safe DNA gel stain in 0.5× TBEMolecular probes, Invitrogen). For direct sequencing of bothNA strands we use ExoSAP-IT One Step PCR Clean-Up

Amersham) and BigDye Terminator v3.1 cycle Sequencingit (Applied Biosystems). The products of the reactions were

hen analyzed on a Applied Biosystems 3100 sequencer. Whenequence mixtures were observed at certain positions, theCR DNA fragments were ligated and cloned in a pGEM-Tasy vector (Promega). For each of these regions analyzede obtained 6–10 clones that were sequenced bidirectionallyith the Big Dye v3.1 in the 3100 DNA sequencing system

Applied Biosystems). Finally, sequences were analyzed andligned with the Sequencher 4.6 (http://www.genecodes.com),eneDoc (http://www.psc.edu/biomed/genedoc/) and Bioedit

http://www.mbio.ncsu.edu/BioEdit/bioedit.html) software.rimers were designed from reference sequences from geno-

ypes: HCV-J (1b) (Kato et al., 1990), HCV-H (1a) and ED434a). The location of each fragment is shown relative to its posi-ion with HCV-J (accession number D90208) (Table 1). Pairwiseucleotide distances were calculated with the Kimura-2 param-ter model of evolution and the phylogenetic reconstruction wasenerated by using the neighbor-joining method implementedn the PAUP* 4.0 beta 10 software package (Sinauer Associates,nc., Sunderland, Mass) as previously described (Fernandezt al., 2006). Bootstrap resampling (Felsenstein, 1988) (1000eplicates) was applied to the neighbor-joining trees to assignpproximate confidence limits to individual branches. The finalraphical output was created with the TREEVIEW programPage, 1996). Nucleotide composition and molecular analysesf the sequences were computed with MEGA 3 programKumar et al., 2004) as previously described (Ibanez et al.,001; Parera et al., 2004).

.3. Reference sequences used in this study

Reference sequences used for comparison with our samplesere retrieved from the HCV database (http://hcv.lanl.gov/

ontent/hcv-db/index). They were for the 5′end noncod-ng region (5′NC), core/E1 and NS5B were: 1a HCV-NAF139594), 1a.H77 (AF009606), 1a HCV-H (M67463),b HCV-BK (M58335), 1b HCV-J (D90208), 2a HCJ6CH

AF177036), 2a JFH1 (AB047639), 2b.HC-J8 (D10988),c.BEBE1 (D50409), 3a.CB (AF046866), 3a.K3A (D28917),a.NZL1 (D17763), 4a.ED43 (Y11604), 4a.AY766634),a.AF057154, 4a.AF057155, 4a.AF271825 to AF271839,

S. Franco et al. / Virus Research 123 (2007) 161–169 163

Table 1Sequence of oligonucleotides used for PCR amplification and sequencing

Name Directiona Sequence (5′ to 3′) Positionb

P9 F GTATCTCGAGGCGACACTCCACCATAGAT 6P940E F TTCCTGCAGAAAGCGTCTAG 51CORE-42 R GGCCGAAGCGGGGACAGTCAGG 881CORE-44 R CACGAAAGAAGTGCCAAGAGG 860E1-41 F CTTGGCACTTCTYTCGTGCC 863E1-42 R GGCATCAACYCCWGCRAAGAG 1458E1-43 F TCACCAAYGACTGCCCGAAYTC 937E1-44 R GGCCCAATTRGCYTGCATGC 1417E2-41 F GCATGCAGGCCAATTGGGCC 1417E2-42 R CGCGAGCACCACATATTCCC 2476E2-43 F CTCTCTGGAGGCCACTGGGG 1371E2-44 R AGGGCCCAAGATACCACTGC 2457P7-41 F GCAGTGGTATCTTGGGCCCT 2457NS2-42 R CCAGTGAGGCTCGTTACGAT 3456P7-43 F TGGGAATATGTGGTGCTCGC 2481NS2-44 R GCGTATGCTGTGATGGGGGC 3408HCVPROTS1-4 F AAAGGGGTGGAGACTCCTTGC 3395HCVPROTR1-4 R ATTCCACATGTCGTTCGCCC 3957HCVPROTS2-4 F CCCATCACAGCATACGC 3417HCVPROTR2-4 R TGCTTGAACTGCTCAGCCAG 3933NS3-Hel45 F GTGCGCAGRAGAGGVGACAC 3759NS3-Hel46 R GGYTTGAGGCGGATKAGGCA 5163NS3-Hel47 F GGHGGBCCGCTGYTGTGCCC 3831NS3-Hel48 R TTCCACATKGTGTCCCARCT 5142NS3-Hel41 F CCAGGCCTTCCTGTGTGCCA 4971NS4B-42 R ATTCCACATGTCGTTCGCCC 5617NS3-Hel43 F CAGGGTTAACCCACATAGACG 5023NS4B-44 R TGCTTGAACTGCTCAGCCAG 5505NS4B-41 F CCTGATCGCGAAGTGCTCTA 5421NS5A45rev R CAKGGGAGTTGBGATCCCAC 6801NS4B-43 F TTCGACGAAATGGAGGAGTG 5448NS5A43rev R AGGGGCGTGGCGGTGTATCCT 6720NS5A-41 F CCGGCCCCAGAGCTCTTCAC 6684NS5A-48 R GAAGGTCACCTTCTTCTGCCG 7749NS5A-43 F AGGATACACCGCYACGCCCCT 6720NS5A-46 R GCAGAACGGGTGGTCGTGGC 7722NS5B-41 F GTCAATGCCTCCACTAGAGGG 7508NS5B-42 R GCGATAACGACTAAGTCGTC 8562NS5B-43 F TGACATCAGACTCTTGGTCC 7549NS5B-44 R CCGCARACCAGCATGGTGCA 8538NS5B-45 F CGGCGTCTACACCACCAGCTT 8453NS5B-46 R AGGTCGGAGTGTTAAGCTGC 9388NS5B-47 F TGCCGTGCTATCTYAARGCC 8485NS5B-48 R CTACCGAGCAGGCAGCAGGA 9363

10sensec F AGGTCTCGTAGACCGTGCACC 30912sensec F ACTGCCTGATAGGGTGCTTGCGAGTG 276CORE-46c R CGACCGCTCCGAAGTCTTCC 490E146c R GCCACACAGGTCCCCGATGT 1168E147sc F CAYATCACAGGRCACAGAATGG 1263E245sc F TGGTCGGGACAACYGAYCGCC 1876NS241c F CGTCCCYTACTTCGTGAGGGC 3060SEQNS34R R TCATGATCTCATGGTAGT 3942NS3Hel49c F GCCAATCACGTACTCCACRTA 4202NS4B46c R GAAGGGRATRCCKGGCAT 6342NS5A4REVc R ARAGAYGGGGCRGAWAGCTG 6948NS5B4SEQc F CGGCAGAAGAARGTSACCTTC 7749NS5B4SEQ3c F CCAACAACAATCATGGCCAA 8010NS5A47c F CACRTCAARAACGGCTCGATGAG 6457NS5B4SEQ2c R GAGTGTGTCGGRCTGTCTCCC 8797E246c R TCTGGACACCCKGAGCTGTTG 1670E245REVc R GGCGRTCRGTTGTCCCGACCA 1876

a F, forward; R, reverse.b Position is according to the reference sequence HCV-J (1b).c Oligonucleotides only used for sequencing.

164 S. Franco et al. / Virus Research 123 (2007) 161–169

Table 2Genetic distances of the HCV full-length genome and E2, NS3 and NS5A protein coding regions

HCV genotype Full length (9405 nt) E2 (1089 nt) NS3 (1089 nt) NS5A (1416 nt)

24 25 24 25 24 25 24 25

1 35.36 (0.36) 36.52 (0.37) 39.68 (0.83) 40.55 (0.37) 34.99 (0.39) 32.68 (0.83) 42.58 (1.53) 41.02 (1.83)2 43.47 (0.71) 44.33 (0.72) 45.94 (2.01) 48.73 (0.71) 38.35 (1.11) 35.28 (2.03) 55.37 (1.02) 57.56 (0.83)3 42.97 (0.25) 42.36 (0.18) 47.97 (0.59) 45.49 (1.11) 42.00 (0.48) 38.00 (0.53) 53.86 (0.27) 51.72 (0.53)4 23.84 12.31 33.53 16.39 24.80 11.78 30.74 12.685 39.69 40.33 46.59 45.97 36.30 34.44 52.02 51.416 .94

4444444444(gB1(((

2o

wsA1b((ostTo(31gco2GTA

GTCJTGA4rssTGrTw3cCmge(2cmapwcmoTcm0twtc

40.87 41.23 48.47 48

a.AJ291293, 4a.AJ291288, 4a.AJ291284, 4a.AJ291282,a.AJ291278, 4c.U94724, 4c.AY766694, 4c.AY766525,c.AY766528, 4c.AY766532, 4c.AY766533, 4c.AY766536,c.AY766538, 4c.AY766542, 4c.AY766551, 4c.AY766558,c.L38338, 4c.L29601, 4c.L29604, 4c.L29606, 4c.L3928,c.L78841, 4d.AY766523, 4d.AY766910, 4d.AY767046,d.AY767331, 4d.AY767341, 4d.AY767378, 4d.AY767384,d.AY767392, 4d.AY767507, 4d.AY767524, 4d.AY768197,d.AY768280, 4d.AY768281, 4d.L39310, 4d.AJ291271,d.AJ291289-92, 5a.EUH1480 (Y13184) and 6a.EUHK2Y12083). Sequences used for comparison of the completeenome, structural and nonstructural proteins were: 1b.HCV-K (M58335), 1b.HCV-J (D90208), 1b.HCV-N (AF139594),a.HCV-H (M67463), 1a.H77 (AF009606), 2a. HC-J6CHAF177036), 2b.HC-J8 (D10988), 2c.BEBE1 (D50409), 3a.CBAF046866), 3a.K3A (D28917), 3a.NZL1 (D17763), 4a.ED43Y11604), 5a.EUH1480 (Y13184) and 6a.EUHK2 (Y12083).

.4. Genetic screen for determining the catalytic efficiencyf HCV NS3/4 proteases

The catalytic efficiency of the different HCV NS3/4 proteasesas determined using bacteriophage lambda based genetic

creen as previously described (Martinez and Clotet, 2003).fter viral RNA was isolated from individual infected patients,0 �l of resuspended RNA was reverse transcribed at 42 ◦Cy using the avian myeloblastosis virus reverse transcriptasePromega) and the oligonucleotide HCVproR1 (antisense)5′-GGATGAGTTGTCTGTGAAGAC-3′; residues 3954–3974f the HCV-J strain) for genotype 1 and HCVproR1-4 (anti-ense) (Table 2) for genotype 4. Five microlitres of the reverseranscriptase product was amplified by PCR with Platinumaq DNA polymerase (Invitrogen) as described above. Theligonucleotides used for the amplification were HCVproL1sense) (5′-GCAAGGGTGGCGACTCCTTGC-3′; residues389–3409 of the HCV-J strain) and HCVproR1 for genotipeand HCVproS1-4 (sense) (Table 1) and HCVproR1-4 for

enotype 4. Nested PCR was then performed with a 5′ oligonu-leotide (HCVproL2) encoding an EcoRI site, residues 21–34f NS4, and a dipeptide linker, Gly–Gly, along with residues

–8 of NS3 (residues 3411–3431 of the HCV-J strain) (5′-GGTTGAATTCTATGGCTCCTATTGGATCTGTTGTTAT-GTTGGAAGAATTATTTTGTCTGGAAGAGGAGGACCT-TCACGGCCTACTCCCAA-3′) for genotype 1, NS34a4 (5′-

aoti

39.05 36.17 51.04 51.08

GGTTGAATTCTATGGCTCCTATTGGCAGCGTGGTGA-TGTCGGGAGAGTTGTCCTGTCGGGCCAAGGAGGAC-CATCACAGCATACGC-3′, residues 3414–3428 of the HCV-strain) for genotype 4a and NS34cd4 (5′-GGGTTGAATTC-ATGGCTCCTATTGGCAGCGTGGTGATTGTCGGGAGG-TCGTTATATCTGGCCAAGGAGGACCCATCACAGCAT-CGC-3′, residues 3414–3428 of the HCV-J strain) for genotyped. The 3′ oligonucleotide (HCV proR) was complementary toesidues 175–181 of NS3 (residues 3930–3950 of the HCV-Jtrain) and encoded an in-frame stop codon flanked by an XhoIite (5′-GGGAGGGGCTCGAGTCAAGACCGCATAGTAGT-TCCAT-3) for genotype 1 and HCVproREV2-4 (5′-GGGA-GGGCTCGAGTCATGATCTCATGGTAGTTTCAAGAGA,

esidues 3933–3954 of the HCV-J strain) for genotype 4d.he 3′oligonucleotide used for genotype 4a (NS3p4-R2)as complementary to residues 175–181 of NS3 (residues933–3954 of the HCV-J strain) and encoded an in frame stopodon flanked by an Apa I site (5′-GGGAGGGGGGGCCCT-ATGATCTCATGGTAGTTTCAAG-3′). The 621-bp frag-ent was digested with EcoRI and XhoI (or ApaI for

enotype 4a) and inserted into pBSK- (Stratagene) to gen-rate a �gal-HCV NS32-181/421-34 protease fusion proteinpHCVNS32-181/421-34 protease). For each sample, 24 and5, 10 �gal-HCV NS32-181/421-34 protease fusion proteinlones were obtained and sequenced. In both samples theaster (most abundant) clone was selected for subsequent

nalysis. Escherichia coli JM109 cells containing plasmidcI.HCVcro (Martinez and Clotet, 2003) were then transformedith plasmid pHCVNS32-181/421-34 protease. The resulting

ells were grown overnight at 30 ◦C in the presence of 0.2%altose, harvested by centrifugation, and resuspended to an

ptical density at 600 nm of 2.0 per ml in 10 mM MgSO4.o induce the expression of HCV NS32 181/421-34 protease,ells (200 �l) were incubated in 1 ml of Luria–Bertani (LB)edium containing 12.5 �g of tetracycline, 20 �g of ampicillin,

.2% maltose, 10 mM MgSO4, and 1 mM isopropyl-�-d-hiogalactopyranoside (IPTG) for 1 h. Thereafter, cell culturesere infected with 107 PFU of � phage. After 3 h at 37 ◦C, the

iter of the resulting phage was determined by coplating theultures with 200 �l of E. coli XL-1 Blue cells (adjusted to

n optical density at 600 nm of 2.0 per ml in 10 mM MgSO4)n LB plates using 3 ml of top agar containing 12.5 �g ofetracycline per ml, 0.2% maltose, and 0.1 mM IPTG. Afterncubation at 37 ◦C for 6 h, the resulting phage plaques were

S. Franco et al. / Virus Research 123 (2007) 161–169 165

Fig. 1. Neighbor-joining phylogram of HCV genomic regions 5′NC, core-E1 and NS5B used to genotype patient samples 24 and 25. Bootstrap analysis (1000r (numt

ccrna

2

au

3

3

tiotst2g2hfE

f1fpo(2garsrtusp

s7watsfw

epetitions) was performed to determine the reliability of the sample groupingree) represents 0.1 nucleotide substitutions per site.

ounted in order to score growth. In the experiments in which E.oli cells express the HCV NS32-181/421-34 protease, � phageeplicated up to 8000-fold more efficiently than in cells that didot express the HCV NS32-181/421-34 construct (Martineznd Clotet, 2003).

.5. Nucleotide sequence accession number

Both full-length HCV genome sequences obtained and char-cterized in this study have been submitted to GenBank databasender accession numbers DQ516083 and DQ516084.

. Results

.1. Sequence alignments and phylogenetic analysis

The entire genomes of patient 24 and 25 HCV isolates, withhe exception of the 3′untranslated region (UTR), were amplifiedn 11 fragments. These fragments overlapped the entire genomef the 24 and 25 samples, which were 9300 and 9309 nt, respec-ively. The 5′ UTR were 279 nt for both samples, followed byingle open reading frames (ORFs) of 9021 and 9030 nt, respec-ively. The base composition of the HCV isolate from patient4 was 21% thymine, 30% cytosine, 21.4% adenine and 27.5%uanine; and from patient 25 was 22% thymine, 29.2% cytosine,

1.4% adenine and 27.5% guanine. The two sequence samplesad different sizes in their complete ORFs, 9021 nt (3007 aa)or sample 24 and 9030 nt (3010 aa) for sample 25, and in the2 protein 1086 nt (362 aa) for sample 24 and 1089 nt (363 aa)

2TaT

bers at branch nodes); only values >70% are shown. The scale bar (below the

or sample 25, in the NS5A 1332 nt (444 aa) for sample 24 and335 nt (445 aa) for sample 25 and in the NS5B 1776 nt (592 aa)or sample 24 and 1779 nt (593 aa) for sample 25. Both sam-les had the same size in the core (573 nt or 191 aa), E1 (576 ntr 192 aa), P7 (189 nt or 63 aa), NS2 (651 nt or 217 aa), NS31893 nt or 631 aa), NS4A (162 nt or 54 aa) and NS4B (783 nt or61 aa). Sequence alignments and phylogenetic analysis fromenomic regions, core-E1 and NS5B, used to genotype HCVnd from which many genotype 4 sequences were availableevealed that the variants isolated from patients 24 and 25, bothubtyped 4c/4d by INNO-LIPA, belong to subtypes 4d and 4a,espectively (Fig. 1). The high sequence homology found withinhe 5′NC region did not allow to clearly subtype these samplessing this viral sequence region (Fig. 1). This result empha-izes how sequence information is critical for genotyping HCVrecisely.

When we compared both isolates we found 7451 con-erved sites, 1858 variable sites, 1078 transitional pairs (si),32 transversional pairs (sv) and a ratio (si/sv) of 1.5. A pair-ise distance of 23.4% was obtained when both samples (24

nd 25) were compared. Full-length genome distances rela-ive to the 4a-ED43 isolate (subtype 4a), the only full-lengthequence of genotype 4 available so far, were 23.8 and 12.3%or samples 24 and 25, respectively (Table 2). Similar resultsere obtained when different genomic regions from samples

4 and 25 were compared with the ED43 sequence (Table 2).hese results confirmed that sample 25 was a subtype 4a isolatend that sample 24 belonged to a different genotype 4 subtype.he absence of sequences representing other subtypes did not

166 S. Franco et al. / Virus Research 123 (2007) 161–169

Fig. 2. Neighbor-joining phylogram of HCV complete genome of samples24 and 25 and reference sequences of known HCV genotypes. Completegenome reference sequences and subtype determination was based on treeanalysis using reference sequences of known HCV genotypes and subtypes(http://hcv.lanl.gov/content/hcv-db/index). Bootstrap analysis (1000 repetitions)wbr

asecStt

3c

Hbticgw22cstfifa4aIc

Fig. 3. Amino acid alignment of the interferon sensitivity determining region(ISDR) of the nonstructural 5A protein (NS5A). Patient 24 and 25 sequenceswaa

bLla1dwpioFotlapctt4s

Cpowtobmiiare

as performed to determine the reliability of the sample grouping (numbers atranch nodes); only values >70% are shown. The scale bar (below the tree)epresents 0.1 nucleotide substitutions per site.

llow subtype assignment for sample 24 based on full-lengthequences. Genetic distances calculations also showed that forvery genomic region analyzed samples 24 and 25 were slightlyloser to genotype 1 sequences than to other genotypes (Table 2).imilarly, when the phylogenetic analysis was performed with

he complete genome (Fig. 2), we found a slightly closer rela-ionship between genotype 4 and 1 than with other genotypes.

.2. Sequence alignments of genomic regions implicated inurrent or future treatment response

Since one of the most apparent biological differences betweenCV genotypes is in their susceptibility to treatment with IFN �-ased therapies, we decided to specifically analyze and comparehe amino acid sequences of viral genomic regions implicatedn current treatment response. This analysis included the ISDRoding region because so far is the only region within the HCVenome with a confirmed correlation of the number of mutationsith virologic response to IFN �-based therapies (Pascu et al.,004). The amino acid alignments between the patient 24 and5 samples and the only sequence of genotype 4 available foromparisons in this viral genomic region disclosed a 45.4% ofimilarity within the ISDR coding region (Fig. 3). Since, onlyhree genotype 4 sequences were analyzed in this study, tworom subtype 4a and one from another genotype 4 subtype, its important to mention the low amino acid similarity (15.9%)ound within the ISDR coding region (Fig. 3) when patient 24nd 25 (subtype 4a) were compared. Of note, when the genotype

ISDR regions were compared with genotype 1 sequences a fourmino acid deletion was also observed (Fig. 3). In contrast, theSDR from genotype 4 showed one amino acid insertion whenompared with genotype 2 sequences.

stfg

ere compared with HCV genotype reference sequences. Numbers indicatemino acid position according to reference sequence HCV-J. Dots indicate aminocid sequence identity and dashes indicate deletions.

Because the HCV NS3 protease has been recently shown toe an important factor in the HCV pathogenesis (Foy et al., 2003;oo et al., 2006; Meylan et al., 2005), we also decided to ana-

yze this protein. NS3/4 protease amino acid alignments showedgain that a closer relationship between genotype 4 and genotypesequences than with other genotypes (Fig. 4). As expected, noifferences were found within genotype 4 amino acid sequenceshen catalytic and substrate Zn2+ binding residues were com-ared (Fig. 4). Similarly, comparison of amino acid residuesmplicated in protease inhibitor resistance revealed the absencen any of such substitutions within genotype 4 NS3/4 proteases.inally, a high degree of amino acid conservation was alsobserved when the 12 residues implicated in the NS3 bindingo the NS4 co-factor were analyzed. In short, although a certainevel of variation could be detected when the genotype 4 aminocid sequences were compared with other genotypes, the NS3rotein as part of the NS3/4A serine protease complex was to aertain extent more related to genotype 1, 5 and 6 sequences thano genotype 2 or genotype 3 sequences. Phylogenetic analysis ofhe NS3/4A protease coding region also showed that genotype

sequences were related more closely to genotype 1, 5 and 6equences (not shown).

Using a genetic screen previously described (Martinez andlotet, 2003) we quantified the protease activity of the NS3/4rotease from patient 24 and 25 samples. The catalytic efficiencyf these two NS3/4 proteases from genotype 4 were comparedith two other genotype 1 NS3/4 proteases (Fig. 5). To be sure

hat the NS3/4 protease clones analyzed here were representativef the patients’ virus populations several clones were sequenced,eing the master clones (most abundant) the ones used for enzy-atic determinations. In both samples the master sequence was

dentical to the consensus sequence obtained by direct sequenc-ng of the protease RT-PCR amplification products. Patient 24nd 25 NS3/4 proteases displayed 70.6 ± 7.7 and 23.5 ± 3.4%,espectively, of the activity of genotype 1 NS3/4 proteases. Inter-stingly, patient 25 NS3/4 protease had only 33.3% of the activity

hown by the patient 24 NS3/4 protease. These results suggesthat very different catalytic efficiencies can be found when dif-erent HCV genotypes, or different isolates within the sameenotype, are compared.

S. Franco et al. / Virus Research 123 (2007) 161–169 167

Fig. 4. Amino acid alignment of HCV NS3/4 protease. Patient 24 and 25 s

Fig. 5. HCV NS3/4 protease activity of genotype 4 patient 24 and 25 and geno-type 1b patient 1 (previously described by Martinez and Clotet (2003)) samplescompared to the activity of genotype 1b replicon I389/NS3-3′ protease. Theprotease activity of a mutated (S139A) protease from patient 1 (Martinez andClotet, 2003) was also included as a negative control. The protease activity wasdim

4

dpttaid2Hiti

nr

ineirhwawi(2rdpaegatae

etermined as described in Section 2. Average values and standard deviation arellustrated. Each data point is the average of at least three independent experi-

ents.

. Discussion

Samples from two HIV-positive patients, 24 and 25, that wereescribed before, were again analyzed in this report. They werereviously genotyped by INNO-LIPA and classified both as sub-ype 4c/4d. However, core-E1 or NS5B nucleotide sequence ofhese isolates easily designated them to belong to subtype 4dnd 4a, respectively. This emphasizes why genomic sequences critical for genotyping HCV isolates precisely. This type ofiscordant results were also described by others (Nolte et al.,003). Since important biological differences may exist between

CV variants (Simmonds et al., 2005) using an accurate typ-

ng methodology is essential. Furthermore, although responseo INF �-based therapies has not been associated to differencesn subtype, it is important to realise here that patient 24 did

rmfm

equences were compared with HCV genotype reference sequences.

ot no respond to therapy, while patient 25 showed a sustainedesponse to therapy (Ballesteros et al., 2004).

Treatment of chronic HCV infection in HIV-infected patientss a growing concern (Tural et al., 2003). In our HIV clinical unitearly 50% of the patients are co-infected with HCV (Ballesterost al., 2004; Ibanez et al., 1998), being 25% of the former co-nfected patients infected with HCV of genotype 4. Moreover,ecent studies conducted in Western and Southern Europe haveighlighted the spread of HCV genotype 4 among IDU, many ofhom are co-infected with HIV-1 (Nicot et al., 2005; Ramos et

l., 2006; van Asten et al., 2004). Similar to genotype 1, patientsith genotype 4 infections are poor responders, less than 30%

n co-infected HIV/HCV patients, to INF �-based therapies,Ballesteros et al., 2004; Ballesteros et al., 2005; Carrat et al.,004; Poynard et al., 2003). Since different treatment virologicesponses between the different HCV genotypes may be mainlyetermined by the HCV genome, we decide to analyze the NS3/4rotease and the ISDR in NS5A which have been suggested tontagonize the antiviral effect of INF-� (Foy et al., 2003; Galet al., 1997; Meylan et al., 2005; Taylor et al., 1999). The twoenotype 4 samples studied here showed highly different ISDRmino acid sequences (Fig. 3). Interestingly samples from geno-ype 4a patient 25, who responded to therapy, showed 4 aminocid substitutions within the ISDR when compared to the ref-rence sequence 4a.ED43, suggesting that this viral genomic

egion may be of importance for response to INF �-based treat-ent. However, the absence of a genotype 4 sequence data base

or this genomic viral region did not allow us to correlate ISDRutations with treatment outcome. Furthermore, other factors

1 esear

toAt3p12ta

cbio2siweehdaftfatiangsmp

tvdGtf

A

yt

R

B

B

C

C

E

F

F

F

G

I

I

K

K

K

K

L

L

68 S. Franco et al. / Virus R

hat influence response to INF �-based treatment as the numberf CD4 T cells, liver fibrosis or age must be also considered.lso interesting is the finding of a 3 amino acid deletion within

he genotype 4 ISDR sequences when compared to genotype 1,, 5 and genotype 6 sequences (Fig. 3). Again, similar to thaterformed with genotype 1b, 2a or 3a isolates (Enomoto et al.,995; Kobayashi et al., 2002; Murakami et al., 1999; Pascu et al.,004; Saiz et al., 1998; Sarrazin et al., 2000) it will be importanto examine a possible association of genotype 4 ISDR sequencesnd INF-� treatment response.

Recently, it was found that the HCV NS3/4 protease canleave two components of the dsRNA signalling pathway andlocks the phosphorylation and nuclear translocation of thenterferon regulatory factor 3 (IRF-3) resulting in a reductionf the transcription of INF-� and �-inducible genes (Foy et al.,003; Loo et al., 2006; Meylan et al., 2005). Thus, a potentialignificance of mutations that affect enzyme function might bemplicated in a better response to cellular antiviral defense path-ays and treatment response. While there are significant differ-

nces in nucleic and amino acid sequences and enzymatic param-ters between the two NS3/4 proteases of genotype 4 analyzedere or between the different genotypes (Figs. 4 and 5), a largeatabase comprising information on NS3/4 protease sequencesnd response to INF treatment will be needed to provide a basisor a NS3/4 protease genotype-dependent response to currentherapy. HCV protease inhibitors are currently being developedor clinical applications (VX-950 and SCH 503034) (Perni etl., 2006; Yi et al., 2006). We found that none of the muta-ions definitively associated with resistance to HCV proteasenhibitors was seen in our genotype 4 sequences (Fig. 4)(Lin etl., 2005; Yi et al., 2006). Overall, genotype 4 NS3/4 proteaseucleic and amino acid sequences are more closely related toenotype 1, 5 and 6 sequences than to genotype 2 or genotype 3equences. Nevertheless, further studies are warranted to deter-ine whether genotype 4 NS3/4 proteases are sensitive to HCV

rotease inhibitors with clinical potential.Since sequence and biochemical data about HCV of geno-

ype 4 are scarce, characterization of the different circulatingiruses of genotype 4 will be crucial for the improvement ofiagnostic, epidemiological and clinical treatment regimens.enotype-specific differences in response to the new genera-

ion of antiviral agents will be a major research priority in theuture.

cknowledgments

This work was supported by Spanish Minsiterio de EducacionCiencia (MEC) project BCM2003-02148 and Fondo de Inves-

igacion Sanitaria (FIS) project PI050022.

eferences

allesteros, A.L., Franco, S., Fuster, D., Planas, R., Martinez, M.A., Acosta, L.,Sirera, G., Salas, A., Tor, J., Rey-Joly, C., Clotet, B., Tural, C., 2004. EarlyHCV dynamics on Peg-Interferon and ribavirin in HIV/HCV co-infection:indications for the investigation of new treatment approaches. AIDS 18 (1),59–66.

L

ch 123 (2007) 161–169

allesteros, A.L., Fuster, D., Planas, R., Clotet, B., Tural, C., 2005. Role of viralkinetics under HCV therapy in HIV/HCV-coinfected patients. J. Antimicrob.Chemother. 55 (6), 824–827.

arrat, F., Bani-Sadr, F., Pol, S., Rosenthal, E., Lunel-Fabiani, F., Benzekri, A.,Morand, P., Goujard, C., Pialoux, G., Piroth, L., Salmon-Ceron, D., Degott,C., Cacoub, P., Perronne, C., 2004. Pegylated interferon alfa-2b vs. standardinterferon alfa-2b, plus ribavirin, for chronic hepatitis C in HIV-infectedpatients: a randomized controlled trial. JAMA 292 (23), 2839–2848.

hamberlain, R.W., Adams, N., Saeed, A.A., Simmonds, P., Elliott, R.M., 1997.Complete nucleotide sequence of a type 4 hepatitis C virus variant, the pre-dominant genotype in the Middle East. J. Gen. Virol. 78 (Pt. 6), 1341–1347.

nomoto, N., Sakuma, I., Asahina, Y., Kurosaki, M., Murakami, T., Yamamoto,C., Izumi, N., Marumo, F., Sato, C., 1995. Comparison of full-lengthsequences of interferon-sensitive and resistant hepatitis C virus 1b. Sen-sitivity to interferon is conferred by amino acid substitutions in the NS5Aregion. J. Clin. Invest. 96 (1), 224–230.

elsenstein, J., 1988. Phylogenies from molecular sequences: inference and reli-ability. Annu. Rev. Genet. 22, 521–565.

ernandez, G., Llano, A., Esgleas, M., Clotet, B., Este, J., Martınez, M., 2006.Purifying selection of CCR5-tropic HIV-1 variants in AIDS subjects thathave developed syncytium inducing CXCR4-tropic viruses. J. Gen. Virol.87 (Pt5), 1285–1294.

oy, E., Li, K., Wang, C., Sumpter Jr., R., Ikeda, M., Lemon, S.M., Gale Jr., M.,2003. Regulation of interferon regulatory factor-3 by the hepatitis C virusserine protease. Science 300 (5622), 1145–1148.

ale Jr., M.J., Korth, M.J., Tang, N.M., Tan, S.L., Hopkins, D.A., Dever, T.E.,Polyak, S.J., Gretch, D.R., Katze, M.G., 1997. Evidence that hepatitis C virusresistance to interferon is mediated through repression of the PKR proteinkinase by the nonstructural 5A protein. Virology 230 (2), 217–227.

banez, A., Clotet, B., Martinez, M.A., 2001. Absence of genetic diversityreduction in the HIV-1 integrated proviral LTR sequence population dur-ing successful combination therapy. Virology 282 (1), 1–5.

banez, A., Gimenez-Barcons, M., Tajahuerce, A., Tural, C., Sirera, G., Clotet,B., Sanchez-Tapias, J.M., Rodes, J., Martinez, M.A., Saiz, J.C., 1998. Preva-lence and genotypes of GB virus C/hepatitis G virus (GBV-C/HGV) andhepatitis C virus among patients infected with human immunodeficiencyvirus: evidence of GBV-C/HGV sexual transmission. J. Med. Virol. 55 (4),293–299.

ato, N., Hijikata, M., Ootsuyama, Y., Nakagawa, M., Ohkoshi, S., Sugimura,T., Shimotohno, K., 1990. Molecular cloning of the human hepatitis C virusgenome from Japanese patients with non-A, non-B hepatitis. Proc. Natl.Acad. Sci. U.S.A. 87 (24), 9524–9528.

obayashi, M., Watanabe, K., Ishigami, M., Murase, K., Ito, H., Ukai, K., Yano,M., Takagi, K., Hattori, M., Kakumu, S., Yoshioka, K., 2002. Amino acidsubstitutions in the nonstructural region 5A of hepatitis C virus genotypes2a and 2b and its relation to viral load and response to interferon. Am. J.Gastroenterol. 97 (4), 988–998.

uiken, C., Yusim, K., Boykin, L., Richardson, R., 2005. The Los Alamoshepatitis C sequence database. Bioinformatics 21 (3), 379–384.

umar, S., Tamura, K., Nei, M., 2004. MEGA3: Integrated software for molecu-lar evolutionary genetics analysis and sequence alignment. Brief Bioinform.5 (2), 150–163.

amarre, D., Anderson, P.C., Bailey, M., Beaulieu, P., Bolger, G., Bonneau,P., Bos, M., Cameron, D.R., Cartier, M., Cordingley, M.G., Faucher, A.M.,Goudreau, N., Kawai, S.H., Kukolj, G., Lagace, L., LaPlante, S.R., Narjes,H., Poupart, M.A., Rancourt, J., Sentjens, R.E., St George, R., Simoneau, B.,Steinmann, G., Thibeault, D., Tsantrizos, Y.S., Weldon, S.M., Yong, C.L.,Llinas-Brunet, M., 2003. An NS3 protease inhibitor with antiviral effects inhumans infected with hepatitis C virus. Nature 426 (6963), 186–189.

in, C., Gates, C.A., Rao, B.G., Brennan, D.L., Fulghum, J.R., Luong, Y.P.,Frantz, J.D., Lin, K., Ma, S., Wei, Y.Y., Perni, R.B., Kwong, A.D., 2005.In vitro studies of cross-resistance mutations against two hepatitis C virusserine protease inhibitors, VX-950 and BILN 2061. J. Biol. Chem. 280 (44),

36784–36791.

oo, Y.M., Owen, D.M., Li, K., Erickson, A.K., Johnson, C.L., Fish, P.M.,Carney, D.S., Wang, T., Ishida, H., Yoneyama, M., Fujita, T., Saito, T., Lee,W.M., Hagedorn, C.H., Lau, D.T., Weinman, S.A., Lemon, S.M., Gale Jr.,M., 2006. Viral and therapeutic control of IFN-beta promoter stimulator 1

esear

M

M

M

N

N

P

P

P

P

P

R

S

S

S

S

S

T

T

v

Y

S. Franco et al. / Virus R

during hepatitis C virus infection. Proc. Natl. Acad. Sci. U.S.A. 103 (15),6001–6006.

artinez, M.A., Clotet, B., 2003. Genetic screen for monitoring hepatitis Cvirus NS3 serine protease activity. Antimicrob. Agents Chemother. 47 (5),1760–1765.

eylan, E., Curran, J., Hofmann, K., Moradpour, D., Binder, M., Bartenschlager,R., Tschopp, J., 2005. Cardif is an adaptor protein in the RIG-I antiviralpathway and is targeted by hepatitis C virus. Nature 437 (7062), 1167–1172.

urakami, T., Enomoto, N., Kurosaki, M., Izumi, N., Marumo, F., Sato, C.,1999. Mutations in nonstructural protein 5A gene and response to interferonin hepatitis C virus genotype 2 infection. Hepatology 30 (4), 1045–1053.

icot, F., Legrand-Abravanel, F., Sandres-Saune, K., Boulestin, A., Dubois, M.,Alric, L., Vinel, J.P., Pasquier, C., Izopet, J., 2005. Heterogeneity of hepatitisC virus genotype 4 strains circulating in south-western France. J. Gen. Virol.86 (Pt. 1), 107–114.

olte, F.S., Green, A.M., Fiebelkorn, K.R., Caliendo, A.M., Sturchio, C., Grun-wald, A., Healy, M., 2003. Clinical evaluation of two methods for genotypinghepatitis C virus based on analysis of the 5′ noncoding region. J. Clin. Micro-biol. 41 (4), 1558–1564.

age, R.D., 1996. TreeView: an application to display phylogenetic trees onpersonal computers. Comput. Appl. Biosci. 12 (4), 357–358.

arera, M., Ibanez, A., Clotet, B., Martinez, M.A., 2004. Lack of evidence forprotease evolution in HIV-1-infected patients after 2 years of successfulhighly active antiretroviral therapy. J. Infect. Dis. 189 (8), 1444–1451.

ascu, M., Martus, P., Hohne, M., Wiedenmann, B., Hopf, U., Schreier, E., Berg,T., 2004. Sustained virological response in hepatitis C virus type 1b infectedpatients is predicted by the number of mutations within the NS5A-ISDR:a meta-analysis focused on geographical differences. Gut 53 (9), 1345–1351.

erni, R.B., Almquist, S.J., Byrn, R.A., Chandorkar, G., Chaturvedi, P.R., Court-ney, L.F., Decker, C.J., Dinehart, K., Gates, C.A., Harbeson, S.L., Heiser, A.,Kalkeri, G., Kolaczkowski, E., Lin, K., Luong, Y.P., Rao, B.G., Taylor, W.P.,Thomson, J.A., Tung, R.D., Wei, Y., Kwong, A.D., Lin, C., 2006. Preclinicalprofile of VX-950, a potent, selective, and orally bioavailable inhibitor ofhepatitis C virus NS3-4A serine protease. Antimicrob. Agents Chemother.

50 (3), 899–909.

oynard, T., Yuen, M.F., Ratziu, V., Lai, C.L., 2003. Viral hepatitis C. Lancet362 (9401), 2095–2100.

amos, B., Nunez, M., Toro, C., Sheldon, J., Garcia-Samaniego, J., Rios,P., Soriano, V., 2006. Changes in the distribution of hepatitis C virus

ch 123 (2007) 161–169 169

(HCV) genotypes over time in Spain according to HIV serostatus: impli-cations for HCV therapy in HCV/HIV-coinfected patients. J. Infect,doi:10.1016/j.jinf.2006.02.006.

aiz, J.C., Lopez-Labrador, F.X., Ampurdanes, S., Dopazo, J., Forns, X.,Sanchez-Tapias, J.M., Rodes, J., 1998. The prognostic relevance of the non-structural 5A gene interferon sensitivity determining region is different ininfections with genotype 1b and 3a isolates of hepatitis C virus. J. Infect.Dis. 177 (4), 839–847.

arrazin, C., Kornetzky, I., Ruster, B., Lee, J.H., Kronenberger, B., Bruch, K.,Roth, W.K., Zeuzem, S., 2000. Mutations within the E2 and NS5A protein inpatients infected with hepatitis C virus type 3a and correlation with treatmentresponse. Hepatology 31 (6), 1360–1370.

immonds, P., 2004. Genetic diversity and evolution of hepatitis C virus—15years on. J. Gen. Virol. 85 (Pt. 11), 3173–3188.

immonds, P., Bukh, J., Combet, C., Deleage, G., Enomoto, N., Feinstone, S.,Halfon, P., Inchauspe, G., Kuiken, C., Maertens, G., Mizokami, M., Mur-phy, D.G., Okamoto, H., Pawlotsky, J.M., Penin, F., Sablon, E., Shin, I.T.,Stuyver, L.J., Thiel, H.J., Viazov, S., Weiner, A.J., Widell, A., 2005. Con-sensus proposals for a unified system of nomenclature of hepatitis C virusgenotypes. Hepatology.

umma, V., 2005. VX-950 (Vertex/Mitsubishi). Curr. Opin. Investig. Drugs 6(8), 831–837.

aylor, D.R., Shi, S.T., Romano, P.R., Barber, G.N., Lai, M.M., 1999. Inhibitionof the interferon-inducible protein kinase PKR by HCV E2 protein. Science285 (5424), 107–110.

ural, C., Fuster, D., Tor, J., Ojanguren, I., Sirera, G., Ballesteros, A., Lasanta,J.A., Planas, R., Rey-Joly, C., Clotet, B., 2003. Time on antiretroviral therapyis a protective factor for liver fibrosis in HIV and hepatitis C virus (HCV)co-infected patients. J. Viral. Hepat. 10 (2), 118–125.

an Asten, L., Verhaest, I., Lamzira, S., Hernandez-Aguado, I., Zangerle, R.,Boufassa, F., Rezza, G., Broers, B., Robertson, J.R., Brettle, R.P., McMe-namin, J., Prins, M., Cochrane, A., Simmonds, P., Coutinho, R.A., Bruisten,S., 2004. Spread of hepatitis C virus among European injection drug usersinfected with HIV: a phylogenetic analysis. J. Infect. Dis. 189 (2), 292–302.

i, M., Tong, X., Skelton, A., Chase, R., Chen, T., Prongay, A., Bogen, S.L.,

Saksena, A.K., Njoroge, F.G., Veselenak, R.L., Pyles, R.B., Bourne, N., Mal-colm, B.A., Lemon, S.M., 2006. Mutations conferring resistance to SCH6, anovel hepatitis C virus NS3/4A protease inhibitor. Reduced RNA replicationfitness and partial rescue by second-site mutations. J. Biol. Chem. 281 (12),8205–8215.